CN103667538A - Gene chip, kit and method for detecting three viruses for immunosuppression disease of chickens - Google Patents
Gene chip, kit and method for detecting three viruses for immunosuppression disease of chickens Download PDFInfo
- Publication number
- CN103667538A CN103667538A CN201310728530.3A CN201310728530A CN103667538A CN 103667538 A CN103667538 A CN 103667538A CN 201310728530 A CN201310728530 A CN 201310728530A CN 103667538 A CN103667538 A CN 103667538A
- Authority
- CN
- China
- Prior art keywords
- primer
- subgroup
- gene chip
- virus
- cav
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6834—Enzymatic or biochemical coupling of nucleic acids to a solid phase
- C12Q1/6837—Enzymatic or biochemical coupling of nucleic acids to a solid phase using probe arrays or probe chips
Abstract
The invention discloses a gene chip, a kit and a method for detecting three viruses for immunosuppression disease of chickens, and relates to the field of animal medical diagnosis. The gene chip is characterized in that specific probe sequences of four subgroups A, C, D and J of an ALV (Avian leucosis virus) as well as a CAV (Chicken Anemia Virus), and an REV (Reticuloendotheliosis virus) are arranged on a substrate of the chip. The invention further provides the kit for detecting the four subgroups A, C, D and J of the ALV, the CAV and the REV. The chip, kit and detecting method, provided by the invention can be used for detecting various pathogens quickly and accurately in a high-flux manner, so that infectious diseases can be diagnosed correctly within a relatively short period to be prevented from spreading.
Description
Technical field
The present invention relates to animal medicine diagnosis, particularly relate to a kind of gene chip, test kit and method that detects three kinds of immunosuppressive disease viruses of chicken
Background technology
In recent years, the development of China's aviculture is very fast, has become one of mainstay industry of China's livestock industry., along with the fast development of aviculture, various inherences and externalities are also just seriously threatening the sound development of aviculture, and wherein epidemic disease has become the No.1 formidable enemy who threatens aviculture.Although by using the means such as vaccine inoculation and medicine control, what make bird Infectious Diseases anti-ly produces certain effect, but the chicken group that immunization is crossed in the production practice of various places chicken house still various diseases can constantly occur, one of reason wherein can not be ignored is exactly that bird immunity suppresses disease.Fowl immunosuppressive disease is by single one or more paathogenic factor acting in conjunction, causes the general name of the disease of chicken compromised immune, Immune Dysfunction.Cause that the virus that poultry immunity suppresses has chicken infectious anemia virus (CAV), avian leukosis virus (ALV), reticuloendotheliosis virus (REV), infectious bursal disease virus (IBDV), marek's disease virus (MDV) etc.Wherein fowl leukemic lymphoblastoid (AL), chicken infectious anemia (CIA) and reticuloendotheliosis (RE) are at present to the most serious immunosuppressive disease of China's poultry husbandry harm, compare with other chicken diseases, they possess the characteristic of vertical transmission, subclinical infection, traditional method difficult diagnosis.In agriculture public welfare science and technology research Fund Citation " epidemiology survey of avian leukosis and the prevention and control exemplary investigation " implementation process of 2007 science and technology departments of the Nian You Ministry of Agriculture and the project verification of animal doctor office, serosurvey result that teacher Cui Zhizhong carries out shows: AB subgroup and J subgroup ALV are infected to the chicken group who is positive and account for respectively 47.9% and 52.8%, individual infection rate is respectively 3.4% and 5.7%.And show according to his statistic data in 2008: China's white plumage meat kind chicken CIAV antibody positive rate reaches 90%, REV antibody positive rate 12.3%, yellow plumage meat kind chicken antibody positive rate 90%, REV antibody positive rate 36.8%.And in 200 parts of samples, the recall rate that ALV, CAV, REV infect alone or synergistically reaches 10%-6.5%.This result shows, above-mentioned three kinds of immunosuppressive diseases are quite general in China chicken group.Because ALV, CIAV, REV and prepared product thereof its immunogenicity in deactivation can be suffered destruction in various degree, the low virulent strain of cultivating no pathogenicity does not also make important progress, therefore for above-mentioned three kinds of immunosuppressive diseases, do not develop yet vaccine with practical value clinically so far, especially for ALV and REV, the immunotolerance having due to the chick of congenital infection and the ubiquity of this infection, the application prospect of the vaccine also making is very dim, once kind chicken infects whole chicken group and just can infect, and aviculture is suffered heavy losses simultaneously.But just better preventions is in time ALV, CIAV, REV in chicken group to be detected and purified at present, cuts off the approach of its vertical transmission, to avoid the diffusion of this disease.Therefore, strengthen the research of convenient, quick, responsive detection means extremely urgent.
The detection means of existing ALV, CIAV and REV also exists various defects, can not meet high specific, large batch of sample detection, and biochip technology has advantageous advantage at aspects such as high-throughput and accuracys.Compare with traditional detection method, it can carry out the detection of various diseases at 1 chip simultaneously to a plurality of samples; Without immune response reaction, can diagnose early, testing sample consumption is little; Can detect resistance and the hypotype of pathogenic micro-organism; High sensitivity and reliability; Level of automation is high, is beneficial to large-scale promotion application.These features can make veterinary work, and person grasps a large amount of medical diagnosis on disease information at short notice.Applying gene chip not only can improve the efficiency of medical diagnosis on disease, and can diagnose out particular type, morbidity stage, severity and the indication more afterwards of disease.
Therefore this problem is intended the gene chip that research and development detect ALV, CAV, REV, can reach the detection method that the above-mentioned three kinds of chicken immunes of synchronous detection suppress sick, also can synchronously distinguish ALV E subgroup and J subgroup, the purification and the control that for China's chicken immune, suppress disease provide technical support; For the detection of batch samples provides quick, parallel, sensitive detection means with large-area epidemiology survey.
Summary of the invention
The present invention is directed to the blank and needs in above-mentioned field, a kind of gene chip, test kit and method that detects three kinds of immunosuppressive disease viruses of chicken is provided, can detect ALV, CAV, these three kinds of viruses of REV simultaneously and can distinguish A, C, D and the J subgroup of ALV simultaneously, for correctly preventing and treating epidemic disease, raise the efficiency, save time.
A kind of gene chip that detects three kinds of immunosuppressive disease viruses of chicken, it is characterized in that: in chip matrix, be provided with four subgroup A subgroups, C subgroup, D subgroup and the J subgroups of avian visceral lymphomatosis virus ALV, the specific probe sequence of Chicken Anemia Virus (CAV) CAV, fowl reticuloendotheliosis virus REV, described specific probe sequence is as follows:
Avian visceral lymphomatosis virus A subgroup (A1), TTTTTTTGTCTCAGGGGGAGGCCACACGGTTTCTC;
Avian visceral lymphomatosis virus A subgroup (A2), TTTTGGTTGGTCTAGACAGGAGGCCACGCGGTTTC;
Avian visceral lymphomatosis virus A subgroup (A3), TTTTGGATGGACTAGACAGGAAGCCACACGGTTCC;
Avian visceral lymphomatosis virus A subgroup (A4), TTTTTGCTTTCAGATTGGTCCAGGCCGCAACTCAC;
Avian visceral lymphomatosis virus C subgroup (C1), TTTTGGATGTGTATATTTCGCCCCAAGGGCCACTG;
Avian visceral lymphomatosis virus D subgroup (D1), TTTTTTTTGGCCGGGAAGAGGTGACACACATCCTC;
Avian visceral lymphomatosis virus C subgroup (J3), TTCTTAGTCTACAGTCAGCGACCTCGCCATTCCGC;
Avian visceral lymphomatosis virus C subgroup (J4), CTTAGTCTACAGTCAGCTACCTCTCCCTTCCGCAC;
Chicken infectious anemia virus (CAV), TTTTTTTTTGGGCAGTGAATCGGCGCTTAGCCG;
Reticuloendotheliosis virus (REV), TTTTTTTTTCTTGCTCGGGGTCGCCGTCCTACA.
Detect a gene chip kit for three kinds of immunosuppressive disease viruses of chicken, it is characterized in that comprising following assembly:
(1) said gene chip;
Article (2) seven, primer:
The general upstream primer J-U of tetra-subgroups of A, C, D, J of avian visceral lymphomatosis virus ALV:
5’-GGATGAGGTGACTAAGAAAG-3’；
J subgroup downstream primer J-L:5 '-CGAACCAAAGGTAACACACG-3;
The general downstream primer Tong:5'-CTGTAGCCATATGCACC-3' of A, C and D subgroup;
CAV upstream primer C-U:5 '-ACATACCGGTCGGCAGTAGG-3 ';
CAV downstream primer C-L:5 '-AGCTCGCTTACCCTGTACTC-3 ';
REV upstream primer R-U:5 '-CTACGGATTCAGTCCGGATC-3 ';
REV downstream primer R-L:5 '-CATACTGAGCCAATGGTTGTA-3 ';
And the 5 ' end of J-L, Tong, C-L and R-L has Cy3 fluorescent mark.
Described gene chip kit, also comprises the required reagent of pcr amplification, hybridization solution, chip washing lotion except universal primer and DNA probe.
The composition of described hybridization solution is: 3 * SSC solution, 25% methane amide, 0.2%SDS, 5 * Denhardt solution.
Described chip washing lotion comprises washing lotion A and washing lotion B; The formula of washing lotion A is 2 * SSC, 0.2%SDS; Washing lotion B is 0.2 * SSC.
Described gene chip kit, also comprises PCR negative control template and positive control template, and described negative control template is distilled water, and described positive control template is the plasmid DNA of CAV Reference strains CUX.
Above-mentioned arbitrary described gene chip kit, described seven primer mixed storages in two primer pipes; Primer and melting concn ratio thereof in two primer pipes are: J-U:J-L:Tong=5:2:3; (C-U+C-L): (R-U+R-L)=1:3
A gene chip detection method that detects three kinds of immunosuppressive disease viruses of chicken, comprises the steps:
(1) extract the genomic dna of strain to be measured,
(2) with the genomic dna of following primer pair strain to be measured, carry out pcr amplification,
J-U:5’-GGATGAGGTGACTAAGAAAG-3’；
J-L:5’-CGAACCAAAGGTAACACACG-3；
Tong:5'-CTGTAGCCATATGCACC-3'；
C-U:5’-ACATACCGGTCGGCAGTAGG-3’；
C-L:5’-AGCTCGCTTACCCTGTACTC-3’；
R-U:5’-CTACGGATTCAGTCCGGATC-3’；
R-L:5’-CATACTGAGCCAATGGTTGTA-3’；
5 ' the end of described J-L, Tong, C-L and R-L has Cy3 fluorescent mark;
Described pcr amplification is divided into two groups to carry out respectively,
Wherein one group of pcr amplification adopts following mix primer: wherein primer concentration compares J-U:J-L:Tong=5:2:3;
Another group pcr amplification adopts following mix primer: its primer concentration ratio is: C-U+C-L:R-U+R-L=1:3.
(3) amplified production and said gene chip hybridization,
(4) hybridization aftertreatment and scanning result.
The system of described pcr amplification is 2 * PCR mix25 μ l, template DNA 3 μ l, and 10 μ mol/L mix primer 7～8 μ l, add aseptic double-distilled water to 50 μ l;
95 ℃ of PCR reaction conditionss, 5min; 95 ℃ of 50S, 56 ℃ of 50S, 72 ℃ of 1min, 30 circulations; 72 ℃ of 10min.
Front in step (2), first described gene chip is carried out to following pre-treatment: be placed in the interior fixedly 12h of 37 ℃ of wet boxes, with distilled water, clean 3 times, in confining liquid, seal centrifuge dripping after 5 minutes, 4 ℃ save backup, and the formula of institute's confining liquid is: 0.75%PBS solution, 25% ethanol, 0.2%NaBH
4;
In step (2) with the A C D J subgroup of the ALV of synthetic, the plasmid DNA of REV, the plasmid DNA of CAV Reference strains CUX as positive control template, with distilled water as negative control template;
Described hybridization refers to: in hybridizing box, add 300 μ L distilled waters, described gene chip is put into hybridizing box; Pcr amplification product and hybridization solution are mixed with volume ratio 7:8, horse back ice bath 5min after 95 ℃ of sex change 5min, the mixed solution of getting after 15 μ l sex change is transferred to described gene chip reaction zone, and gene chip is placed under 42 ℃ of wet condition and hybridizes and spend the night together with hybridizing box;
Described hybridization aftertreatment refers to: the gene chip after hybridization successively in washing lotion A:2 * SSC, 0.2%SDS in 42 ℃ washing 2min, repeat to develop a film 2 times; In washing lotion B:0.2 * SSC, in 42 ℃ of washing 2min, repeat to develop a film 3 times.
The invention provides a kind of gene chip that can simultaneously detect three kinds of immunosuppressive disease viruses of chicken, comprise the test kit of this gene chip, and the method for utilizing this test kit or three kinds of immunosuppressive diseases of genechip detection chicken.
(1) gene chip making processes of the present invention and advantage are as follows: from Genbank, collect totally 459 of the full gene of cDNA of A, C, D and tetra-each Reference strains of subgroup of J of CAV REV ALV or the gene orders that comprise env high variant area, respectively 459 sequences are built to storehouse by tri-kinds of viruses of CAV REV ALV, select every kind of viral each 10 of sequence that represent, by the Clustal W program of DNAStar software, selected sequence is compared, find out their conserved regions and region of variability.Intercept required aim sequence, serve the synthetic aim sequence of Hai Sheng work biotech firm, errorless through sequencing result.Utilize Oligo6 software, at region of variability, to every kind of viral sequence library design species specificity probe separately, designed altogether for above-mentioned three kinds of 10 viral specific probes; By Primer Premier5.0 software design above-mentioned 10 candidate probe sequences high variant area outside conserved regions design 7 primers, a general upstream primer of ALV A, C, D, J increases,, a J subgroup downstream primer, A, C, D and the general downstream primer of J subgroup; The upstream and downstream primer of amplification CAV; The upstream and downstream primer of amplification REV, above-mentioned primer all can increase specifically to institute's amplicon virus.Primer sequence is in Table 3.
Utilize the synthetic plasmid of the target DNA sequence of three kinds of viral Reference strains of above-mentioned primer pair to carry out pcr amplification, after then PCR product being mixed with hybridization solution respectively, have gene chip hybridization, the scanner uni interpretation of result of 10 specific probes with point.Probe sequence is in Table 2.Scanning result is carried out to value, the probe that contains non-specific fluorescence signal is carried out to threshold setting, in conjunction with threshold value, judge whether fluorescent signal is specific hybrid signal.
The specific probe that the present invention chooses can detect the bacterial strain that belongs to same subgroup specifically, as in table 1 not the bacterial strain with asterisk also can be caught out by these specific probes, the detectable scope of gene chip of the present invention comprises the arbitrary bacterial strain under CAV, REV and ALVA, C, D, tetra-subgroups of J, integrate practicality and high efficiency, can be used for high-throughput and detect ALV, CAV, REV infection conditions, for high efficient detection or differentiate that epidemic situation provides the method for most critical.
(2) the present invention also provides a kind of test kit that detects three kinds of immunosuppressive disease viruses of chicken, and this test kit is characterised in that and includes said gene chip provided by the invention and primer.This test kit is possessing under Molecular Biology Lab's condition of chip scanner, can detect quickly and easily the infection state of chicken group's to be measured CAV, REV and ALV A, C, D, J subgroup, as preferably, in test kit, can also comprise PCR reagent and hybridization solution except chip and primer, make this test kit be more convenient for using.In test kit, also comprise that the vector plasmid DNA that contains goal gene of three kinds of any one viruses in disease is as PCR positive control template, for getting rid of false negative; The negative template of distilled water, the false positive causing for decontaminating.
(3) the present invention also provides the detection method that detects three kinds of immunosuppressive disease viruses of chicken, and the method principal character is to adopt gene chip provided by the invention and primer.Article 7, primer expands several times by strain template to be measured, thereby has improved the Sensitivity of strain, in this research simultaneously, has also taked multiplex PCR system to increase to above-mentioned three kinds of viruses simultaneously, and testing process is not only easy but also sensitive.
Prioritization scheme provided by the invention is: respectively 5 ' end of the downstream primer in all primer pairs is carried out to fluorescent mark, primer concentration ratio is: J-U:J-L:Tong=5:2:3; C-U+C-L:R-U+R-L=1:3; Above-mentioned primer increases to template to be measured with multiplex PCR system, the object of multiplex PCR is by add many primers in an individual system, thereby can amplify the aim sequence of different virus, for raising the efficiency to the detection of ALV, CEV, REV and to the somatotype of ALV in clinical detection simultaneously.
In order to improve the accuracy of chip hybridization, get rid of false positive or false negative, on chip, point has positive control probe, negative control probe.
The invention provides in sum a kind of gene chip that detects three kinds of immunosuppressive disease viruses of chicken, the detection method of test kit and optimization is provided simultaneously, can carry out high-throughput, detect fast and accurately for multiple cause of disease, the transmissible disease cause of disease that is suitable for happening suddenly check, the test kit providing makes detection method simple and effective, make veterinary laboratories staff to infectious diseases, make correct diagnosis in the short period of time, prevent communicable disease propagation, improve the controllability of China to animal infectious disease, reduce cultivation risk.
Accompanying drawing explanation
Fig. 1: the efficiency evaluation result that gene chip detects three kinds of viruses.
1:CAV strain; 2:REV strain; 3:ALV A subgroup strain; 4:ALV C subgroup strain; 5:ALV D subgroup strain; 6:ALV J subgroup strain.
Fig. 2: the detection evaluation result of gene chip to multiple PCR products.
1:ALV C+J strain DNA profiling equal-volume mixes; 2:ALV A+D strain DNA profiling equal-volume mixes; 3:REV PCR product mixes with ALV A+DPCR product equal-volume; 4:REV+CAV plasmid DNA template equal-volume mixes.Fig. 3: gene chip sensitivity Detection evaluation result.
4-1:M:Marker, 10 of 1-5:ALV A subgroup strain DNA profiling initial concentration
-2～10
-6doubly dilution; 4-2:M:Marker, 10 of 1-6:ALV C subgroup strain DNA profiling initial concentration
-2～10
-7doubly dilution; 4-3:M:Marker, 10 of 1-3:ALV D subgroup strain DNA profiling initial concentration
-2～10
-4doubly dilution; 4-4:M:Marker, 10 of 1-6:ALV J subgroup strain DNA profiling initial concentration
-2～10
-7doubly dilution.4-5:M:Marker, 10 of 1-7:REV strain DNA profiling initial concentration
-2～10
-8doubly dilution; 4-6:M:Marker, 10 of 1-4:CAV strain template initial concentration
-2～10
-5doubly dilution.
Fig. 4: agarose gel electrophoresis sensitivity Detection evaluation result.
10 of A1-A5:ALV A subgroup strain DNA profiling initial concentration
-2～10
-6doubly dilution; 10 of C1-C6:ALV C subgroup strain DNA profiling initial concentration
-2～10
-7doubly dilution; 10 of D1-D3:ALV D subgroup strain DNA profiling initial concentration
-2～10
-4doubly dilution; 10 of J1-J6:ALV J subgroup strain DNA profiling initial concentration
-2～10
-7doubly dilution; 10 of R1-R7:REV strain DNA profiling initial concentration
-2～10
-8doubly dilution; 10 of CA1-CA4:CAV strain template initial concentration
-2～10
-5doubly dilution.
Fig. 5: gene chip specific detection evaluation result.
1:REV PCR product mixes with ALV A+DPCR product equal-volume; 2: infectious bursal disease virus (IBDV); 3: chicken Marek's disease virus (MDV); 4: chick embryo fibroblast; 5:DF-1 cell.
Embodiment
Main agents
DNA and RNA extract test kit all purchased from QIAGEN company.
The little extraction reagent kit of plasmid is purchased from Beijing Tian Gen biochemical technology company limited product.
PCR Mix is purchased from GenStar company.
Sepharose dyestuff Goldview is purchased from match Parkson, Beijing gene engineering company limited.
Aldehyde radical sheet is purchased from Bo Ao bio tech ltd.
Methane amide, SDS, sodium borohydride, 50 * Denhardt are all purchased from the sincere industrial Science and Technology Ltd. of Beijing Xi Er.
Key instrument equipment
PCR instrument, Power-PAC200 electrophoresis apparatus and Gel Doc2000 gel imaging system are BioRad company product.
Ice-making machine is Grant company product.
5415D desk centrifuge and 5804R tabletop refrigerated centrifuge are Eppendorf company product.
Chip point sample instrument Personal Arrayer16 is Boao Biological Co., Ltd's product.
Chip hybridization instrument Bio Mixer ⅡWei Boao Biological Co., Ltd product.
It is Boao Biological Co., Ltd's product that chip is washed dry instrument Slide Washer8.
Micro-array chip scanner Lux Scan10K-A is Boao Biological Co., Ltd's product.
The source of biomaterial or record source:
The source of NX0101 strain: be known strain, be documented in applying date document before.What the present invention was used is so kind as to give by teacher Cui Zhizhong of Shandong agricultural university.
RAV-1 strain is purchased from China Veterinery Drug Inspection Office:
Chicken Anemia Virus (CAV) (CIAV), RE hyperplasia virus (REV), infectious bursal disease virus (IBDV), chicken Marek's disease virus (MDV) are known strain, are documented in applying date document before, and there is preservation in this laboratory.
Choosing of the sequence of design of primers institute foundation
The A of REV and ALV, C, D, tetra-subgroups of J the cDNA complete sequence of totally 11 Reference strains are downloaded (in Table 1) by American National biotechnology information center (NCBI) gene pool, and intercepting aim sequence is synthetic by Shanghai Sheng Gong biotech firm.
J subgroup NX0101 strain is inoculated on DF-1 cell, with the DNA extraction test kit of QIAGEN company, extracts cDNA.
CAV tissue poison is preserved by this test, with the DNA extraction test kit of QIAGEN company, extracts DNA.
(table 1).
The Reference strains that this test of table 1. is used
The design of step 1. specific probe
From Genbank, collect 459 of CAV, REV and ALV A, C, D, tetra-subgroups of J Reference strains cDNA complete genome sequences separately.459 sequences are built to storehouse by kind, select totally 13 of the Reference strains sequences of each subgroup through comparison, wherein CAV Reference strains sequence GenBank is numbered M55918; REV Reference strains sequence GenBank is numbered DQ387450, NC006934; The Reference strains sequence GenBank of ALV A subgroup is numbered HM452339, M19113, M14901, HM452340, AB617819; The Reference strains sequence GenBank of ALV C subgroup is numbered V01197; The Reference strains sequence GenBank of ALV D subgroup is numbered D10652; The Reference strains sequence GenBank of ALV J subgroup is numbered AY027920, GU982307.
By the Clustal W program of DNAStar software, these sequences are compared, find out their conserved regions and region of variability.Utilize Oligo6 software, at region of variability, the sequence library of each subgroup is designed to specific probe separately.10 specific probes have been designed altogether.The probe of designing is optimized according to following principle of design: length is controlled at 20～40 bases; The melting temperature (Tm) of probe (Tm) is in more among a small circle, and general control is at 65 ℃～75 ℃; Homologous sequence between subgroup genotype has 3 above mispairing; 5 ' end adds 15 with interior base T, sterically hindered to reduce; At 5 ' end, carry out amination modification, thereby be combined closely with aldehyde radical substrate, concrete probe sequence is in Table 2.
Table 2. sequence oligonucleotide probe
The design of step 2. multiple PCR primer
According to the needs of gene chip probes design, the design objective of sample universal primer to be checked is found conservative region before and after each object fragment, designs and filter out the primer that amplification efficiency is high in these conservative regions.Utilize DNA Star software to compare to the strain that represents of each virus, determine upstream and downstream conservative region; By Primer Premier5.0 software design and optimization primer, finally determined each viral Auele Specific Primer that increases.Meanwhile, add Cy3 fluorescent marker, thereby make PCR product with fluorescent signal when synthetic at downstream primer 5 ' end, concrete primer sequence is in Table 3.
Table 3. multiple PCR primer sequence
The primer of table 3 is synthetic by the Shanghai biological company limited of raw work, the 5' end fluorescence dye C of downstream universal primer
y3 have carried out mark.
The low-density gene chip of step 3. preparation
With distilled water by probe dilution to 50 μ mol/L, getting 5uL adds in A384 hollow plate, mix with equal-volume chip sampling liquid, according to the form below microarray layout with Personal Arrayer16 chip point sample instrument by 10 specific probes, 1 positive quality control probe, HEX point sample Quality Control probe points on aldehyde radical glass substrate, matrix is 7 * 9,10 identical arrays of every chip block point system, after completing, point sample in 37 ℃ of wet boxes, fixedly more than 12h, the amino of probe sequence 5 ' end and the aldehyde radical of slide surface are combined closely chip.Chip after fixing seals 5 minutes in confining liquid, with ultrapure water, cleans, and nitrogen dries up or centrifuge dripping, and 4 ℃ save backup.The layout of probe on chip is in Table 4.
Table 4. selects the matrix diagram of 13 probes eventually
The preparation of the DNA profiling of embodiment 2. testing samples
The CAV tissue poison (carrying the plasmid of CAV cDNA) that this research department preserves, extracts DNA with the DNA extraction test kit of QIAGEN company, finally detects nucleic acid concentration, and is placed in-20 ℃ and save backup.
REV and ALV(A, C, D, J subgroup) corresponding aim sequence synthesized by Shanghai Sheng Gong biotech firm and has been connected on PCU57 vector plasmid, get the bacterium liquid culture that contains synthetic plasmid, the little topic test kit of plasmid of Yong Tiangen company carries out plasmid extraction to bacterium liquid culture, finally detecting nucleic acid concentration, and be placed in-20 ℃ saves backup.
The object of multiplex PCR is with the primer amplification target sequence of trying one's best few, to reduce experimental period and step, improves detection efficiency; Two multiplex PCR systems are respectively: the aim sequence of system one, can simultaneously increase in same system ALV A, C, D, tetra-subgroup strains of J; System two: the aim sequence of can simultaneously increase in same system CAV and two strains of REV.
This research is respectively chosen the gene order of a Reference strains as representing sequence in ALV, CAV, REV, and after concentration is all adjusted to 1ng/ μ L, equal-volume mixes, with above-mentioned primer, respectively it is carried out to pcr amplification, primer starting point concentration is 10 μ mol/L, by repetition and the optimization of many experiments, final definite reaction system and reaction conditions are in Table 5,6,7.
Multi-PRC reaction system after table 5. is optimized
Multi-PRC reaction condition after table 6. is optimized
Multi-PRC reaction condition after table 7. is optimized
The preparation of step 1. PCR product to be measured
CAV M55918 strain, REV DQ387450 strain and ALV A subgroup HM452339, M14901 to extract respectively; C subgroup V01197; D subgroup D10652; The plasmid DNA of J subgroup AY027920, GU982307 strain is as standard model template, the initial concentration of each template is adjusted to 100ng/ μ L, with multiplex PCR system and the condition of having optimized in embodiment 3, increase respectively, the fluorescent mark PCR product obtaining is placed in-20 ℃ and saves backup.
Getting 300 μ L distilled waters adds in hybridizing box, the gene chip lattice plane of embodiment 1 preparation is placed in to hybridizing box upward, get the fluorescently-labeled PCR product of 7 μ L and 8 μ L hybridization solutions mix, 95 ℃ of sex change 5min, ice bath 5min immediately, join in each reaction array, make liquid cover whole microarray region, 42 ℃ of hybridization are spent the night; After hybridization, chip is taken out and puts into 42 ℃ of scavenging solution I(2 * SSC, 0.2%SDS) clean 2 minutes, repeat 2 times; Again chip is put into 42 ℃ of scavenging solution II(0.2 * SSC) clean 2 minutes, repeat last centrifuge dripping 3 times.
The scanning of step 3. chip hybridization result
Chip is put into micro-array chip scanner Lux Scan10K-A, setup parameter: fluorescence path Cy3, power90, PMT600, resolving power 10 μ m, scanning result also carries out interpretation of result, and chip hybridization the results are shown in Figure 1.
Fluorescent signal in experimental result is carried out to value, for D1 probe and CAV probe are set the validity that a threshold value defines non-specific hybridization signal.Through the comparative analysis to abundant experimental results, the threshold value of finally setting D1 probe is that the threshold value of 4.32, CAV probe is 4.98.
The detection evaluation of embodiment 5. chips to multiple PCR products
The Reference strains DNA profiling of concentration will be adjusted in embodiment 4, respectively getting 1 μ L equal-volume mixes, with the test of increasing of the multiplex PCR system optimized in embodiment 3 and condition simultaneously, the fluorescently-labeled PCR product that amplification obtains, with the method for embodiment 4 and the chip hybridization preparing, is developed a film also identical with method in embodiment 4 with result scanning.
Chip hybridization the results are shown in Figure 2.
Result display chip can detect above-mentioned three kinds of viruses simultaneously, and probe and sample combination rate to be checked are high, and test-results is accurately clear.
The sensitivity assessment of embodiment 6. chips
CAV M55918 strain, REV DQ387450 strain and ALV A subgroup HM452339 to extract respectively; C subgroup V01197; D subgroup D10652; The plasmid DNA of J subgroup AY027920 strain is as standard model template, working sample nucleic acid concentration, and it is 150ng/ul that all nucleic acid is all adjusted original concentration, and calculates DNA copy number, then by 10
-2～10
-10multiple dilutes it, with the experiment of increasing respectively of the multiplex PCR system optimized in embodiment 3 and condition, detects, relatively the sensitivity of two kinds of methods with gene chips and agarose gel electrophoresis method.
Hybridize, develop a film and be identical with method in embodiment 4 with result scanning.
Chip hybridization the results are shown in Figure 3.
Agarose gel electrophoresis detected result is shown in Fig. 4.
Result shows that gene chip detection method is 107copies/ml to the susceptibility of ALV A hypotype, to the susceptibility of ALV C, J hypotype, is 106copies/ml, to the susceptibility of ALV D hypotype, is 10
9copies/ml is 10 to the susceptibility of CAV
8copies/ml is 10 to the susceptibility of REV
5copies/ml;
PCR detection method is 109copies/ml to the susceptibility of ALV A hypotype, to the susceptibility of ALV C, J hypotype, be 107copies/ml, to the susceptibility of ALV D hypotype, be 1010copies/ml, to the susceptibility of CAV, be 109copies/ml, to the susceptibility of REV, be 106copies/ml, by the known gene chip detection method of result, than responsive one to two the gradient gradient of PCR detection method, institute's detected result is clear accurately.
The specificity check of embodiment 7. chips
Under the same conditions, the nucleic acid samples of infectious bursal disease virus (IBDV), chicken Marek's disease virus (MDV), chick embryo fibroblast (CEF) and DF-1 cell is carried out to pcr amplification according to the multiplex PCR system of having optimized in embodiment 3 and condition, according to the method in embodiment 4, only go and hybridize, develop a film and scan test again, the specific detection of proofing chip to ALV.
Chip hybridization the results are shown in Figure 5.
Chip detection result shows, hybridizes Quality Control probe occur fluorescent signal except HEX point sample Quality Control probe and the positive, and fluorescent signal does not all appear in other probes, illustrates that this chip has higher ALV detection specificity, and this is significant to differential diagnosis ALV.
The check of embodiment 8. chips to clinical sample
From each 50 parts of certain chicken house random acquisition chicken anticoagulation and serum, be numbered No. 1-50.With the ALV J subgroup of IDEXX company and the DNA extraction test kit of AB subgroup antibody assay kit CAV REVQIAGEN company, 50 parts of anticoagulations are carried out to extracting genome DNA, utilize the multiple PCR method of having optimized to increase, according to the multiplex PCR system of having optimized in embodiment 3 and condition, carry out pcr amplification, with its amplified production of the genechip detection preparing, and the antibody kit detected result of amplification and IDEXX company is compared.
Concrete outcome is in Table 8.
The comparison of table 8. clinical sample detected result
Claims (10)
1. a gene chip that detects three kinds of immunosuppressive disease viruses of chicken, it is characterized in that: in chip matrix, be provided with four subgroup A subgroups, C subgroup, D subgroup and the J subgroups of avian visceral lymphomatosis virus ALV, the specific probe sequence of Chicken Anemia Virus (CAV) CAV, fowl reticuloendotheliosis virus REV, described specific probe sequence is as follows:
Avian visceral lymphomatosis virus A subgroup (A1), TTTTTTTGTCTCAGGGGGAGGCCACACGGTTTCTC;
Avian visceral lymphomatosis virus A subgroup (A2), TTTTGGTTGGTCTAGACAGGAGGCCACGCGGTTTC;
Avian visceral lymphomatosis virus A subgroup (A3), TTTTGGATGGACTAGACAGGAAGCCACACGGTTCC;
Avian visceral lymphomatosis virus A subgroup (A4), TTTTTGCTTTCAGATTGGTCCAGGCCGCAACTCAC;
Avian visceral lymphomatosis virus C subgroup (C1), TTTTGGATGTGTATATTTCGCCCCAAGGGCCACTG;
Avian visceral lymphomatosis virus D subgroup (D1), TTTTTTTTGGCCGGGAAGAGGTGACACACATCCTC;
Avian visceral lymphomatosis virus C subgroup (J3), TTCTTAGTCTACAGTCAGCGACCTCGCCATTCCGC;
Avian visceral lymphomatosis virus C subgroup (J4), CTTAGTCTACAGTCAGCTACCTCTCCCTTCCGCAC;
Chicken infectious anemia virus (CAV), TTTTTTTTTGGGCAGTGAATCGGCGCTTAGCCG;
Reticuloendotheliosis virus (REV), TTTTTTTTTCTTGCTCGGGGTCGCCGTCCTACA.
2. detect a gene chip kit for three kinds of immunosuppressive disease viruses of chicken, it is characterized in that comprising following assembly:
(1) gene chip claimed in claim 1;
Article (2) seven, primer:
The general upstream primer J-U of tetra-subgroups of A, C, D, J of avian visceral lymphomatosis virus ALV:
5’-GGATGAGGTGACTAAGAAAG-3’；
J subgroup downstream primer J-L:5 '-CGAACCAAAGGTAACACACG-3;
The general downstream primer Tong:5'-CTGTAGCCATATGCACC-3' of A, C and D subgroup;
CAV upstream primer C-U:5 '-ACATACCGGTCGGCAGTAGG-3 ';
CAV downstream primer C-L:5 '-AGCTCGCTTACCCTGTACTC-3 ';
REV upstream primer R-U:5 '-CTACGGATTCAGTCCGGATC-3 ';
REV downstream primer R-L:5 '-CATACTGAGCCAATGGTTGTA-3 ';
And the 5 ' end of J-L, Tong, C-L and R-L has Cy3 fluorescent mark.
3. gene chip kit according to claim 2, also comprises the required reagent of pcr amplification, hybridization solution, chip washing lotion except universal primer and DNA probe.
4. gene chip kit according to claim 3, the composition of described hybridization solution is: 3 * SSC solution, 25% methane amide, 0.2%SDS, 5 * Denhardt solution.
5. gene chip kit according to claim 3, described chip washing lotion comprises washing lotion A and washing lotion B; The formula of washing lotion A is 2 * SSC, 0.2%SDS; Washing lotion B is 0.2 * SSC.
6. gene chip kit according to claim 2, also comprises PCR negative control template and positive control template, and described negative control template is distilled water, and described positive control template is the plasmid DNA of CAV Reference strains CUX.
7. according to the arbitrary described gene chip kit of claim 2～6, described seven primer mixed storages in two primer pipes; Primer and melting concn ratio thereof in two primer pipes are: J-U:J-L:Tong=5:2:3; (C-U+C-L): (R-U+R-L)=1:3.
8. a gene chip detection method that detects three kinds of immunosuppressive disease viruses of chicken, comprises the steps:
(1) extract the genomic dna of strain to be measured,
(2) with the genomic dna of following primer pair strain to be measured, carry out pcr amplification,
J-U:5’-GGATGAGGTGACTAAGAAAG-3’；
J-L:5’-CGAACCAAAGGTAACACACG-3；
Tong:5'-CTGTAGCCATATGCACC-3'；
C-U:5’-ACATACCGGTCGGCAGTAGG-3’；
C-L:5’-AGCTCGCTTACCCTGTACTC-3’；
R-U:5’-CTACGGATTCAGTCCGGATC-3’；
R-L:5’-CATACTGAGCCAATGGTTGTA-3’；
5 ' the end of described J-L, Tong, C-L and R-L has Cy3 fluorescent mark;
Described pcr amplification is divided into two groups to carry out respectively,
Wherein one group of pcr amplification adopts following mix primer: wherein primer concentration compares J-U:J-L:Tong=5:2:3;
Another group pcr amplification adopts following mix primer: its primer concentration ratio is: C-U+C-L:R-U+R-L=1:3.
(3) amplified production and gene chip hybridization claimed in claim 1,
(4) hybridization aftertreatment and scanning result.
9. method according to claim 8, the system of described pcr amplification is 2 * PCR mix25 μ l, template DNA 3 μ l, 10 μ mol/L mix primer 7～8 μ l, add aseptic double-distilled water to 50 μ l;
95 ℃ of PCR reaction conditionss, 5min; 95 ℃ of 50S, 56 ℃ of 50S, 72 ℃ of 1min, 30 circulations; 72 ℃ of 10min.
10. method according to claim 8 or claim 9, front in step (2), first described gene chip is carried out to following pre-treatment: be placed in the interior fixedly 12h of 37 ℃ of wet boxes, with distilled water, clean 3 times, in confining liquid, seal centrifuge dripping after 5 minutes, 4 ℃ save backup, and the formula of institute's confining liquid is: 0.75%PBS solution, 25% ethanol, 0.2%NaBH
4;
In step (2) with the A C D J subgroup of the ALV of synthetic, the plasmid DNA of REV, the plasmid DNA of CAV Reference strains CUX as positive control template, with distilled water as negative control template;
Described hybridization refers to: in hybridizing box, add 300 μ L distilled waters, described gene chip is put into hybridizing box; Pcr amplification product and hybridization solution are mixed with volume ratio 7:8, horse back ice bath 5min after 95 ℃ of sex change 5min, the mixed solution of getting after 15 μ l sex change is transferred to described gene chip reaction zone, and gene chip is placed under 42 ℃ of wet condition and hybridizes and spend the night together with hybridizing box;
Described hybridization aftertreatment refers to: the gene chip after hybridization successively in washing lotion A:2 * SSC, 0.2%SDS in 42 ℃ washing 2min, repeat to develop a film 2 times; In washing lotion B:0.2 * SSC, in 42 ℃ of washing 2min, repeat to develop a film 3 times.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310728530.3A CN103667538B (en) | 2013-12-25 | 2013-12-25 | Gene chip, kit and method for detecting three viruses for immunosuppression disease of chickens |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310728530.3A CN103667538B (en) | 2013-12-25 | 2013-12-25 | Gene chip, kit and method for detecting three viruses for immunosuppression disease of chickens |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103667538A true CN103667538A (en) | 2014-03-26 |
| CN103667538B CN103667538B (en) | 2015-04-01 |
Family
ID=50306308
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310728530.3A Active CN103667538B (en) | 2013-12-25 | 2013-12-25 | Gene chip, kit and method for detecting three viruses for immunosuppression disease of chickens |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103667538B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106244729A (en) * | 2016-08-31 | 2016-12-21 | 中国农业大学 | The PCR primer of detection Reticuloendotheliosis Virus and test kit thereof |
| CN106282417A (en) * | 2016-10-08 | 2017-01-04 | 广东省实验动物监测所 | Multi-fluorescence immunoassay primer, test kit and the method for a kind of quick differentiation CAV, MDV, REV, IBDV |
| CN106521037A (en) * | 2016-12-19 | 2017-03-22 | 咸阳职业技术学院 | Quadruple PCR detection kit for diagnosis FAdV/MDV/ALV/REV |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1510149A (en) * | 2002-12-20 | 2004-07-07 | 北京市农林科学院畜牧兽医研究所 | Reagent box for determining infectious chicken anemia |
| CN103361441A (en) * | 2012-03-31 | 2013-10-23 | 北京市农林科学院 | Gene chip, kit and method for detecting subtype avian lymphoid leukemia virus |
-
2013
- 2013-12-25 CN CN201310728530.3A patent/CN103667538B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1510149A (en) * | 2002-12-20 | 2004-07-07 | 北京市农林科学院畜牧兽医研究所 | Reagent box for determining infectious chicken anemia |
| CN103361441A (en) * | 2012-03-31 | 2013-10-23 | 北京市农林科学院 | Gene chip, kit and method for detecting subtype avian lymphoid leukemia virus |
Non-Patent Citations (2)
| Title |
|---|
| 吴萍萍: "四种蛋传性病毒病多重PCR检测方法的建立", 《中国优秀硕士学位论文全文数据库》 * |
| 秦立廷 等: "我国部分地区蛋鸡群ALV-J以及REV、MDV、CAV混合感染检测", 《中国预防兽医学报》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106244729A (en) * | 2016-08-31 | 2016-12-21 | 中国农业大学 | The PCR primer of detection Reticuloendotheliosis Virus and test kit thereof |
| CN106282417A (en) * | 2016-10-08 | 2017-01-04 | 广东省实验动物监测所 | Multi-fluorescence immunoassay primer, test kit and the method for a kind of quick differentiation CAV, MDV, REV, IBDV |
| CN106282417B (en) * | 2016-10-08 | 2018-05-04 | 广东省实验动物监测所 | A kind of quick multi-fluorescence immunoassay primer, kit and method for distinguishing CAV, MDV, REV, IBDV |
| CN106521037A (en) * | 2016-12-19 | 2017-03-22 | 咸阳职业技术学院 | Quadruple PCR detection kit for diagnosis FAdV/MDV/ALV/REV |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103667538B (en) | 2015-04-01 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110791590B (en) | Dual real-time fluorescence detection primer probe set, kit and method for genes VP72 and CD2V of African swine fever virus | |
| CN107299155A (en) | A kind of primer and probe of goose astrovirus real-time fluorescence quantitative PCR detection | |
| CN103382507B (en) | 1 type and 3 type duck hepatitis A virus (HAV) single stage method dual RT-PCR detection kit, primer pair and method | |
| CN102260737B (en) | Primers and application thereof in quick detection of nosema bombycis | |
| CN110699489B (en) | Real-time fluorescence PCR detection primer probe set, kit and method for African swine fever virus CD2V gene | |
| CN103820558B (en) | Gene chip for detecting nine pathogenicity vibrios in marine products | |
| CN108315483A (en) | A kind of combination for distinguishing the primer and probe of duck tembusu virus street strain and vaccine strain | |
| CN107828914A (en) | Infectious subcutaneous and haematopoietic necrosis virus（IHHNV）RAA constant temperature fluorescence detection method and reagent | |
| CN113564280A (en) | RAA primer for detecting 12 serotypes of avian adenovirus group I and detection method thereof | |
| CN106399486A (en) | Primer group and kit for detecting diarrhea-causing parasites through multi-PCR technology | |
| CN103667538B (en) | Gene chip, kit and method for detecting three viruses for immunosuppression disease of chickens | |
| CN102605104B (en) | Dual-PCR (Polymerase Chain Reaction) assay kit for duck circovirus and duck hepatitis virus | |
| Steyer et al. | A diagnostic method based on MGB probes for rapid detection and simultaneous differentiation between virulent and vaccine strains of avian paramyxovirus type 1 | |
| CN108411041A (en) | A kind of fluorescence quantitative RT-PCR kit of the novel avian reovirus of detection and application | |
| CN108411014A (en) | Differentiate the primer and probe and detection method of A types and the dual real-time fluorescence quantitative PCR of Type B ox pasteurella multocida | |
| CN110305986A (en) | SVA, the triple real-time fluorescence quantitative PCR detection primers of one-step method of O-shaped FMDV and A type FMDV and probe | |
| CN101418352B (en) | Shrimp white spot syndrome virus detection reagent kit | |
| CN102329889B (en) | Primer and probe and method for detecting poxvirus muris | |
| CN105525038A (en) | Newcastle disease virus strong/weak virulent one-step real-time fluorescence RT-PCR detection kit | |
| CN108707695A (en) | A kind of parrot young bird disease virus real-time fluorescence quantitative PCR detection kit | |
| CN104975077A (en) | Pig-sourced eperythrozoon fluorogenic quantitative PCR detection kit and application thereof | |
| CN103361441B (en) | Gene chip, kit and method for detecting subtype avian lymphoid leukemia virus | |
| CN109988853B (en) | Primer and probe combination for chlamydia psittaci genotype detection and application | |
| CN107723348A (en) | Identify the NASBA detection methods of Listeria monocytogenes 1/2c serotypes | |
| CN108588274A (en) | Prawn steals dead nodavirus（CMNV）RAA constant temperature fluorescence detection method and reagent |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20220331 Address after: 101302 No. 20, jinmayuan 1st Street, Gaoliying Town, Shunyi District, Beijing Patentee after: Beijing Lingyu Biotechnology Co.,Ltd. Address before: 100097 No. 9 middle garden, Shuguang garden, Beijing, Haidian District Patentee before: BEIJING ACADEMY OF AGRICULTURE AND FORESTRY SCIENCES |
|
| TR01 | Transfer of patent right |