CN103820558B

CN103820558B - Gene chip for detecting nine pathogenicity vibrios in marine products

Info

Publication number: CN103820558B
Application number: CN201410075018.8A
Authority: CN
Inventors: 薛超波; 黄朱梁; 王萍亚
Original assignee: Zhoushan Institute Of Calibration And Testing For Quality And Technology Supervision
Current assignee: Zhoushan Institute Of Calibration And Testing For Quality And Technology Supervision
Priority date: 2014-03-03
Filing date: 2014-03-03
Publication date: 2015-02-25
Anticipated expiration: 2034-03-03
Also published as: CN103820558A

Abstract

The invention relates to a gene chip for detecting nine pathogenicity vibrios in marine products and a kit thereof. The gene chip comprises a solid phase carrier and an oligonucleotide probe, wherein the oligonucleotide probe includes one or more selected from the following nucleotide sequences: 1) DNA sequences selected from genes of a vibrio hollisae, a vibrio vulnificus, a vibrio cholera, a vibrio parahemolyticus, a vibrio harveyi, a vibrio alginolyticus, a vibrio furnissi, a vibrio mimicus and a vibrio damsel, 2) complementary DNA sequences of the DNA sequences selected in the DNA sequences in 1), 3) complementary RNA sequences of the selected DNA sequences in 1) or 2). The kit comprises the gene chips. The gene chip for detecting nine pathogenicity vibrios in marine products and the kit thereof provided by the invention are used for detecting the nine pathogenicity vibrios in marine products, and have the advantages of simplicity in operation, good sensitivity and strong repeatability.

Description

A kind of gene chip for detecting nine kinds of kinds of pathogenic vibrio in sea-food

Technical field

The invention belongs to microbial molecules detection technique technical field, particularly relate to a kind of gene chip detecting nine kinds of kinds of pathogenic vibrio in sea-food.

Background technology

Zhejiang Province is the large province in ocean, and sea-food kind is extremely abundant, seafood prods liking deeply by the local common people, and a lot of resident has the custom eating seafood raw.But along with increasingly sharpening of Marine Environmental Pollution, pathogenic micro-organism is a large amount of enrichment in fishery products, the food origin disease caused because of edible marine and aquatic product and food poisoning occur repeatedly, bring very large threat to the life and health of people.Kinds of pathogenic vibrio is topmost pathogenic micro-organism in sea-food, comprise vibrio cholerae, Vibrio mimicus, parahemolyticas bacterium, Martin Hollis bacterium, vibrio alginolyticus, Bruce Furniss bacterium, Vibrio vulnificus, mermaid vibrios, Vibrio harveyi etc. nine kinds, the pathogenic difference of above-mentioned nine kinds of kinds of pathogenic vibrio is comparatively large, and kind and the toxicity difference of associated diseases are also larger.In these nine kinds of pathogenic bacterium, most important, be also cause occur disease maximum be O1 group cholera vibrio, non-Nonther conserved quantity, Vibrio parahaemolyticus and Vibrio vulnificus.

China still stops conventional microbiological Test level for the detection of pathogens of sea-food, identification of means at present, usually based on separation and Culture, biochemical test and serological test, there is the shortcomings such as complicated operation, hand labour amount is large, round of visits long (6 ~ 7 days), specificity are not strong, sizable degree limits the rapid detection identification capacity to food origin disease pathogeny sea-food.And when determining whether the positive only by experimenter's visual inspection, enough not reliable foundation, reduces the accuracy of experimental result, can not reach the requirement that fresh marine storage time is short, need rapid detection.The false positive results that some simple molecular biological methods are as higher in PCR, ELISA have occurs, and the result using PCR and ELISA to draw all can not as final detection foundation.Therefore China is necessary high-throughput, the fast and accurately monitoring system of setting up sea-food pathogenic bacterium, and to guarantee the correct security judging sea-food within the relatively short time, this is the important prerequisite of prevention and corntrol food origin disease effectively.Only in this way could eliminate the harm caused due to the pathogenic bacterium in sea-food to a certain extent in advance, improve the detection and control ability of China's food origin disease.

Summary of the invention

The object of this invention is to provide a kind of gene chip and the test kit thereof that detect nine kinds of kinds of pathogenic vibrio in sea-food, to make up the defect of the time-consuming effort that traditional common sea-food pathogenic microbes detect technology exists, expansion detection of pathogens scope, improve detection sensitivity and specificity, reduce labour intensity, shorten sense cycle.

Gene chip for detecting nine kinds of kinds of pathogenic vibrio in sea-food provided by the invention, comprise solid phase carrier and be fixed on solid phase carrier, for detecting vibrio cholerae, Vibrio mimicus, parahemolyticas bacterium, Martin Hollis bacterium, vibrio alginolyticus, Bruce Furniss bacterium, Vibrio vulnificus, mermaid vibrios, the oligomerization core former times acid probe of Vibrio harveyi, wherein said oligomerization core former times acid probe is the 16s rRNA gene from Vibrio hollisae, the 16s rRNA of vibrio alginolyticus and/or toxR gene, the gyrB gene of vibrio cholerae, the 16s rRNA gene of mermaid vibrios, the 16s rRNA gene of Vibrio furnissii, the 16s rRNA gene of Vibrio harveyi and/or toxR gene, the gyrB vibrios of Vibrio mimicus, the trh gene of Vibrio parahemolyticus, design in the 16s rRNA gene of Vibrio vulnificus and/or the sequence of toxR gene,

The wherein said nucleic acid probe for detecting Martin Hollis bacterium, its nucleotides sequence is classified as SEQ ID NO:1-2;

The described nucleic acid probe for detecting mermaid vibrios, its nucleotides sequence is classified as SEQ ID NO:3-12;

The described nucleic acid probe for detecting vibrio cholerae, its nucleotides sequence is classified as SEQ ID NO:13-18;

The described nucleic acid probe for detecting Vibrio mimicus, its nucleotides sequence is classified as SEQ ID NO:19-21;

The described nucleic acid probe for detecting Bruce Furniss bacterium, its nucleotides sequence is classified as SEQ ID NO:22-31;

The described nucleic acid probe for detecting Vibrio vulnificus, its nucleotides sequence is classified as SEQ ID NO:32-54;

The described nucleic acid probe for detecting Vibrio harveyi, its nucleotides sequence is classified as SEQ ID NO:55-56;

The described nucleic acid probe for detecting vibrio alginolyticus, its nucleotides sequence is classified as SEQ ID NO:57-66;

The described nucleic acid probe for detecting parahemolyticas bacterium, its nucleotides sequence is classified as SEQ ID NO:67-74.

Gene chip of the present invention, also comprises any one or several in the positive control probe be fixed on solid phase carrier, negative control probe or fluorescent probe.

Described positive control probe is selected in bacterium 16s rRNA conserved regions fragment or DNA or the RNA sequence with its complementation.

The nucleotides sequence of described positive control probe is classified as SEQ ID NO:76.

Described negative probes is SEQ ID NO:77;

Fluorescent probe is SEQ ID NO:75.

The present invention also provide with chip of the present invention with the use of, for the detection primer of vibrio cholerae of increasing, Vibrio mimicus, parahemolyticas bacterium, Martin Hollis bacterium, vibrio alginolyticus, Bruce Furniss bacterium, Vibrio vulnificus, mermaid vibrios, Vibrio harveyi, the sequence of described detection primer is SEQ ID NO:78-91;

The present invention also provides a kind of test kit for detecting nine kinds of kinds of pathogenic vibrio in sea-food, and it comprises above-mentioned gene chip and primer.

Biochip technology is introduced kinds of pathogenic vibrio detection field in sea-food and is detected nine kinds of vibrios simultaneously by the present invention, establish a kind of quick, sensitive, accuracy is high, strong brand-new gene chip and the test kit thereof for detecting nine kinds of kinds of pathogenic vibrio in sea-food of repeatability, utilize gene chip of the present invention can reach the object detecting nine kinds of kinds of pathogenic vibrio in sea-food, due to easy and simple to handle, accuracy is high, repeatability is strong, can be used for medical test, Food Safety Analysis, import and export inspection and quarantine and epidemiology survey.

Embodiment

Below in conjunction with example, method of the present invention is described further.But example is only limitted to illustrate, is not limited to this.The experimental technique of unreceipted actual conditions in the following example, usually can condition routinely, the condition as described in " Molecular Cloning: A Laboratory guide " that J. Pehanorm Brooker (Sambrook) etc. is write, or runs according to the condition that manufacturer advises.

Embodiment 1: the design of probe and preparation

1. sequence obtains:

No. ID, the species according to target species retrieve all sequence informations of these species in Genbank database, and download the information of the genbank form of the full sequence retrieved; The genes involved collected sees the following form 1.

2. probe design process

1) search for NCBI nucleic acid database, find the gene information of all relative species, and download the data of its genbank form.

2) from the data message of the genbank form downloaded, gyrb gene order is extracted.

3) for each kind of microorganism in project, the gyrb gene order Muscle that it is all carries out Multiple Sequence Alignment.

4) according to the Multiple Sequence Alignment result of Muscle, combination tool obtains consensus sequence.

5) with consensus sequence for input, combination tool is sheared and is met the probe sequence of requirement.The condition that probe should meet is as follows:

A) 40%<GC content <60%;

B) the highest and minimum Tm value difference of all probes is different controls within ± 3 DEG C;

C) probe can not form hairpin structure, and reverse complementary sequence can not be longer than 5mer;

D) probe sequence can not have single base continuous in 4 to repeat;

E) dimer can not be formed between probe.

6) to shear the probe sequence that obtains for inquiry, with the sequence of overall ten species for storehouse, blast comparison is done.

7) with blast comparison result for input, combination tool obtains preliminary probe the selection result.

8) with the probe of preliminary screening for input, utilize RDP, the public databases such as Silva and NT carry out further probe screening and specific detection, obtain last probe sets;

3. probe synthesis: hold prolongation 10 T by 5 ' of the probe sequence in following table 2 and entrust probe Synesis Company (Dalian is precious biological) synthesis after amination, for subsequent use.

4. probe screening: synthetic probe is dissolved and makes gene chip on a glass substrate with gene chip sample applying instrument point after appropriate dilution, carry out the specificity of probe and the screening of susceptibility by hybrid experiment, finally obtain for the preparation of special, the sensitive probe needed for gene chip of the present invention.

In a preferred embodiment of the invention, have selected the probe as following table, and carry out probe screening by hybrid experiment, finally obtain probe as shown in table 2.

Table 2: the information of the probe used by the present invention

Probe is numbered	Probe sequence (5 '-3 ')	Detectable vibrios
			NO.1	ttgacatcctcagaagccggaagagattctggtgtgcctt	Vibrio hollisae
NO.2	ccttaaccgtaacaaaacgccgattcaccccactgtgttc	Vibrio hollisae
			NO.3	cgtgctagaatggcatatagagagggcagcaagaccgcga	Mermaid vibrios
NO.4	acatccagagaagcttgaagagattcgagtgtgccttcgg	Mermaid vibrios
			NO.5	atccagagaagcttgaagagattcgagtgtgccttcggga	Mermaid vibrios
NO.6	gaagtgaagtcggctgtagaatcgactatgggcgaaaagc	Mermaid vibrios
			NO.7	gaagtgaaggcggctgtagaatcgactatgggcgaaaagc	Mermaid vibrios
NO.8	ggcgaaaagctgggtgaattcctattagaaaacccaggtg	Mermaid vibrios
			NO.9	cggctgtagaatcgactatgggcgaaaaactgggtgaatt	Mermaid vibrios
NO.10	caagtgaagtgaagtcggctgtagaatcgactatgggcga	Mermaid vibrios
			NO.11	tcaagtgaagtgaagtcggctgtagaatcgactatgggcg	Mermaid vibrios
NO.12	cgccacggtgtacctcaagcaccattagaagtgattggtg	Mermaid vibrios
			NO.13	aagttaataccttaatcatttgacg	Vibrio cholerae

NO.14	ctccagcgtctccgctagattc	Vibrio cholerae
			NO.15	catcgctgactgacactgagttgt	Vibrio cholerae
NO.16	tcttgggcaatcgcatcggttga	Vibrio cholerae
			NO.17	gcggcaaagtccacacccaaacttaccatcatggtgtgcc	Vibrio cholerae
NO.18	ggcttaacggctgtagtatcggtgaaagtgccggacccga	Vibrio cholerae
			NO.19	ctatatctctcgtgccacagcagccaaggtaatgacgtga	Vibrio mimicus
NO.20	gcaacgtcagaagaaccttcacctagctcttcacagcccg	Vibrio mimicus
			NO.21	gtcgtgatctagtaccctgtggccttcggtagctaacgcg	Vibrio mimicus
NO.22	cacccaaacctaccgtcacggtgttcctgaagcgccattg	Vibrio furnissii
			NO.23	cacacccaaacctaccgtcacggtgttcctgaagcgccat	Vibrio furnissii
NO.24	gttgaatgacttcttggcagaaaacccatcggaagcgaaa	Vibrio furnissii
			NO.25	tgggcgagaagttgaatgacttcttggcagaaaacccatc	Vibrio furnissii
NO.26	catcaagctggtggatgagcgcgaagacaacaaacaagat	Vibrio furnissii
			NO.27	gccctgtcggaaaaagtggtcttgaccattcaccgcggtg	Vibrio furnissii
NO.28	aaagtggtcttgaccattcaccgcggtggcaaagtgcaca	Vibrio furnissii
			NO.29	ggcgagaagttgaatgacttcttggcagaaaacccatcgg	Vibrio furnissii
NO.30	tggcaaagtgcacacccaaacctaccgtcacggtgttcct	Vibrio furnissii
			NO.31	aaagtgcacacccaaacctaccgtcacggtgttcctgaag	Vibrio furnissii
NO.32	agaaacttgtttctcgggtg	Vibrio vulnificus
			NO.33	taccgcatgatagcccggttcttcggaattggtctccaag	Vibrio vulnificus
NO.34	taccgcatgatagcccggttcttcggaattggtctcaaag	Vibrio vulnificus
			NO.35	tgaacgacttcttggccgaacacccaagcgaagcgaaaac	Vibrio vulnificus
NO.36	actgaacgacttcttagccgagcacccaagcgaagcgaaa	Vibrio vulnificus
			NO.37	actgaacgacttcttggccgaacacccaagcgaagcgaaa	Vibrio vulnificus
NO.38	aaactgaacgacttcttggccgagcacccaagcgaagcga	Vibrio vulnificus
			NO.39	ttctagtgaagtgaagtccgcagtggaatccttcatggca	Vibrio vulnificus
NO.40	ggtttctagtgaagtgaagtccgcagtggaatccttcctg	Vibrio vulnificus
			NO.41	gaagtgaagtccgcagtggaatccttcctggcagacaaac	Vibrio vulnificus
NO.42	tagtgaagtgaagtccgcagtggaatccttcatggcagac	Vibrio vulnificus
			NO.43	aatccttcatggcagacaaactgaacgacttcttggccga	Vibrio vulnificus
NO.44	caagaccaactggttcttagtgaagtgaagtccgcagtgg	Vibrio vulnificus
			NO.45	tccttcatggcagacaaactgaacgacttcttagccgagc	Vibrio vulnificus

NO.46	agtgaagtgaagtccgcagtggaatccttcatggcagaca	Vibrio vulnificus
			NO.47	ggaatccttcatggcagacaaactgaacgacttcttggcc	Vibrio vulnificus
NO.48	atgagccaaccgctgaagagatcgc	Vibrio vulnificus
			NO.49	ggatattccggttgacgatgtgagca	Vibrio vulnificus
NO.50	tgggcaagagattggtttaactcgtga	Vibrio vulnificus
			NO.51	ctcgatcatgagccaaccgctgaagagatcgctgcgcaac	Vibrio vulnificus
NO.52	caacgctggaagaggttgggcaagagattggtttaactcg	Vibrio vulnificus
			NO.53	ttgtacgaagcgcccgtgtctgaaactggcgtaacggatt	Vibrio vulnificus
NO.54	gtgggcgatactgaccaaacgggtacacaaatccgttttt	Vibrio harveyi
			NO.55	agtaattggtgatactgaccaaacgggtacacagatccgc	Vibrio harveyi
NO.56	ctgtctgagaaagtggttctgactatccaccgcggcggtc	Vibrio harveyi
			NO.57	gaaagttgagctgacgattcatcgtggtggccatatccat	Vibrio alginolyticus
NO.58	gtagtagtttaccttcgggggacgctaccacttgtggtca	Vibrio alginolyticus
			NO.59	ccgtcacaccatgggagtgggactgctttatgatagtagg	Vibrio alginolyticus
NO.60	gtagtagtttaccttcgggggacgctaccacttgtggtca	Vibrio alginolyticus
			NO.61	gaaagttgagctgacgattcatcgtggtggccatatccat	Vibrio alginolyticus
NO.62	agttgagctaacgattcatcgtggtggccatatccatacg	Vibrio alginolyticus
			NO.63	ttgagctaacgattcatcgtggtggccatatccatacgca	Vibrio alginolyticus
NO.64	tgagctaacgattcatcgtggtggccatatccatacgcaa	Vibrio alginolyticus
			NO.65	taacacagagttccactatgacattctggcgaagcgcctg	Vibrio alginolyticus
NO.66	gttgagctaacgattcatcgtggtggccatatccatacgc	Vibrio alginolyticus
			NO.67	gtgcggcactaacacgcacgctaaacagctttatggataa	Vibrio parahemolyticus
NO.68	acggacgcaggtgcgaagaacttcatgttg	Vibrio parahemolyticus
			NO.69	ttgcgctctgagtgtgcagcgtctggtgct	Vibrio parahemolyticus
NO.70	agcactgattcgtttgacggacgcaggtgcgaagaacttc	Vibrio parahemolyticus
			NO.71	gatactcacgccttgttcgagacgctaacttctgcgccag	Vibrio parahemolyticus
NO.72	agttctacgattaggaagcaacgaaagccgtatactc	Vibrio parahemolyticus
			NO.73	aagttttaacccgtaacgagcttcacgagtttgttt	Vibrio parahemolyticus
NO.74	atcaaactgttcgcacaaggctcgacggctgaatcgacaa	Vibrio parahemolyticus
			NO.75	gtcacatgcgatggatcgagctcctttatcatcgttcccaccttaatgca	Fluorescent probe
NO.76	tttttttttttttttttttttCTCATGCCCATGCCGATGC	Positive control probe
			NO.77	ttttttttttttttttGTTGCTTCTGGAATGAGTTTGCT	Negative control probe

Annotation: in table 2, NO.x represents SEQ ID NO:X in sequence table, and the detectable vibrios hurdle vibrios kind that to be this probe can detect.

Embodiment 2: the design of bacterial strain amplimer and preparation

Gene chip of the present invention

1. sequence obtains: the sequence of the same designing probe.

2. design of primers

(1) design of aligning primer between amplification region: download after the 16s rRNA sequence alignment program Glustal X comparison of the nine kinds of vibrios obtained from public database NCBI, choose near one section of interval 16s rRNA conserved sequence as upstream primer, and comprise vibrios general probe sequence.

(2) design of amplifying specific gene order primer: by the above-mentioned specific gene sequences downloading the nine kinds of vibrios obtained from GenBank public database, with sequence alignment program Glustal X comparison, find the conservative section of this gene, this conservative section is imported in primer-design software Primer Premier5.0 software.From Output rusults, choose Tm value 55 DEG C ± 5 DEG C, length 20bp ± 5bp, and comprise the primer of specific probe sequence.

3. primer synthesis: the primer sequence in following table 3 is entrusted primer Synesis Company (Dalian is precious biological) synthesis, for subsequent use.

4. primer screening: synthetic primer is dissolved and appropriate dilution, reacted the amplification efficiency of increase respectively 16srRNA gene and specific gene sequences detection primer by PCR, finally obtain for the preparation of special, the sensitive primer needed for gene chip of the present invention.

In a preferred embodiment of the invention, have chosen and comprise probe and be applicable to the primer 14 of amplification nine kinds of vibrios DNA again, is the PCR adapting to multipair primer simultaneously, is screened, filter out applicable primer as shown in table 3 through information biology primary dcreening operation by a large amount of PCR experiment.

Table 3: for the primer sequence of the pcr amplification of nine kinds of Common Pathogenic vibrios detection DNA in sea-food

Annotation: in table 3, NO.x represents SEQ ID NO:X in sequence table, and in remarks column, this primer pair of generic representation can be used for the above-mentioned all bacterial classifications that increase, and primer pair corresponding to concrete strain name represents the sequence of this bacterial classification that is only used to increase.Wherein H, R, S, Y, N represent degeneracy base, are specifically respectively: H represents A/T/C; R represents A or G; S represents C or G; Y represents C or T; N represents any nucleotide base.

Embodiment 3: prepared by gene chip---chip point sample

1. dissolve probe: dissolve each probe to 40 μM with aqua sterilisa, mix with the ratio of gene chip sampling liquid 1:1, make each probe final concentration be 20 μMs.

2. splice: the corresponding position probe dissolved being added 384 orifice plates, every hole 10 μ L.

3. point sample: by long × wide for 57.5mm × 25.5mm × 1mm(× high)) clean aldehyde radical slide (rich difficult to understand biological) be put on the Stage microscope of chip point sample instrument (spotarray72), use control software design (PersonalArrayer16), working procedure, in the point sample district of point on the slide of aldehyde radical, low density DNA micromatrix in formation, in four dot matrix areas on slide, array arrangement rule is identical.

4. dry: by the chip overnight at room temperature drying of put, then 45 oven drying 2 hours.

5. crosslinked: to be cross-linked 2 times with crosslinked instrument.The chip be cross-linked is put back in clean chip cartridges, for subsequent use.

Embodiment 4 utilizes nine kinds of kinds of pathogenic vibrio in gene chip rapid detection sea-food

1. sample preparation: according to the working method of national standard, with sterilized cotton swabs, aseptic technique, smear the positions such as the sea-food cheek and enteron aisle such as fish, shrimp, shellfish, cotton swab is put into physiological saline and is fully vibrated.Get 100 μ L and add front enrichment medium, 30 DEG C, 220rpm cultivates 6 hours, and then get 10mL and be transferred in 100mL selective medium, 30 DEG C, 220rpm cultivates 12 hours.

2. extract genomic dna: centrifugal 3 minutes of the sample 10,000rpm of 1mL incubated overnight, abandon supernatant.In precipitation, add 200 μ L sterilized waters resuspended, 100 DEG C, boiling water bath 30 minutes, centrifugal 3 minutes of 12,000rpm, supernatant liquor is the DNA profiling slightly carried.

3. amplified target sequence: the 2 μ L supernatants getting the extraction of said gene group DNA extraction method add in PCR reaction mixture as template, and PCR reaction system is as shown in table 4 below.

Table 4PCR reaction system

Reaction tubes is put into PCR instrument (Bio-Rad), the loop parameter of setting is as shown in table 5 below:

Table 5PCR response procedures

4. hybridize: in hybridizing box (rich difficult to understand biological), add 70 μ L ddH2O in advance to keep humidity.15 μ L hybridization solutions (filling a prescription as shown in table 6 below) add the probe array region of the vibrios gene chip prepared in embodiment 3, cover the cover plate (rich difficult to understand biological) (noting bubble being had between cover plate and slide glass) of customization, cover tightly hybridizing box, hybridize 16 hours in 43 DEG C of water-baths..

Washing: after hybridization, takes out chip and is placed in 42 DEG C of preheated washing lotions I, 42 DEG C of concussion cleaning 4min, use 42 DEG C of preheated washing lotion II, 42 DEG C concussion cleaning 4min again, finally clean once with 42 DEG C of preheated distilled water, the centrifugal 1min of chip 1500rpm of cleaning, upper machine scanning.

Scanning: with the scanning of LuxScanTM10K-A microarray scanner.Parameter used is as follows:

Excitation wavelength: 532nm.

Emission wavelength: 570nm.

Scanning resolution: 10 μm.

Sweep velocity: 10 μm of lower 8 minutes/passages of resolving power.

File layout: TIFF, JPEG, LSR.

Kinds of pathogenic vibrio (vibrio cholerae common in sea-food is detected respectively with gene chip of the present invention, Vibrio mimicus, parahemolyticas bacterium, Martin Hollis bacterium, vibrio alginolyticus, Bruce Furniss bacterium, Vibrio vulnificus, mermaid vibrios, Vibrio harveyi) time hybrid screens result display, all there is specific positive signal, false-negative situation is not had to occur, vibrio cholerae, Vibrio mimicus, parahemolyticas bacterium, Martin Hollis bacterium, vibrio alginolyticus, Bruce Furniss bacterium, Vibrio vulnificus, mermaid vibrios, Vibrio harveyi can accurately detect, false-negative situation is not had to occur, negative control does not detect.

Embodiment 5: specific detection and sensitivity technique are carried out to gene chip

Detect as follows to the specific detection of the vibrios gene chip of preparation in embodiment 3:

Use the genomic dna of above-mentioned nine kinds of Protein Profiles of Vibrio Sps to carry out Evaluation on specificity to chip, concrete operation step is with embodiment 4.。The specific findings of chip is good, can realize detecting often kind of strain specificity.

The sensitivity evaluation (for Vibrio hollisae) of vibrios gene chip

1. vibrios gene extracts: the Vibrio furnissii of overnight incubation is extracted genomic dna according to thick formulation, specifically sees embodiment 4.

2. the dilution of genomic dna: the genomic dna Easy Dilution(TaKaRa by Vibrio furnissii) be diluted to 2.5 × 104 copies, 2.5 × 103 copies, 650 copies, 350 copies and 65 copies.

3.PCR increases: concrete steps are with embodiment 4.

4. hybridize, wash, scan: step is with embodiment 4.

5. result: the detected result of the present embodiment method shows, described chip can detect the Vibrio furnissii complete genome DNA of 650 copies, illustrates that gene chip of the present invention is highly sensitive.Concrete outcome sees the following form.

Can find from the above results, no matter be the Evaluation on specificity of single bacterial strain or the Evaluation on specificity of hybrid bacterial strain, chip can provide detected result accurately.Sensitivity aspect, under current technical scheme, genechip detection lower limit is the genomic dna of 650 copies, and detection sensitivity is suitable with PCR.

Claims

1. for detecting the gene chip of nine kinds of kinds of pathogenic vibrio in sea-food, comprise solid phase carrier and be fixed on solid phase carrier, for detecting vibrio cholerae, Vibrio mimicus, Vibrio parahaemolyticus, Vibrio hollisae, vibrio alginolyticus, Vibrio furnissii, Vibrio vulnificus, mermaid vibrios, the oligonucleotide probe of Vibrio harveyi, wherein said oligonucleotide probe is the 16s rRNA gene from Vibrio hollisae, 16srRNA and/or the toxR gene of vibrio alginolyticus, the gyrB gene of vibrio cholerae, the 16s rRNA gene of mermaid vibrios, the 16s rRNA gene of Vibrio furnissii, the 16s rRNA gene of Vibrio harveyi and/or toxR gene, the gyrB vibrios of Vibrio mimicus, the trh gene of Vibrio parahaemolyticus, design in the 16s rRNA gene of Vibrio vulnificus and/or the sequence of toxR gene,

The wherein said nucleic acid probe for detecting Vibrio hollisae, its nucleotides sequence is classified as SEQ ID NO:1-2;

The described nucleic acid probe for detecting Vibrio furnissii, its nucleotides sequence is classified as SEQ ID NO:22-31;

The described nucleic acid probe for detecting Vibrio vulnificus, its nucleotides sequence is classified as SEQ ID NO:32-53;

The described nucleic acid probe for detecting Vibrio harveyi, its nucleotides sequence is classified as SEQ ID NO:54-56;

The described nucleic acid probe for detecting Vibrio parahaemolyticus, its nucleotides sequence is classified as SEQ ID NO:67-74.

2. gene chip as claimed in claim 1, is characterized in that, solid phase carrier is also fixed with any one or several in positive control probe, negative control probe or fluorescent probe.

3. gene chip as claimed in claim 2, is characterized in that described positive control probe is bacterium 16s rRNA conserved regions fragment or DNA or the RNA sequence with its complementation.

4. gene chip as claimed in claim 3, is characterized in that the nucleotides sequence of described positive control probe is classified as SEQ ID NO:76.

5. gene chip as claimed in claim 2, is characterized in that the nucleotides sequence of described negative probes is classified as SEQ ID NO:77.

6. gene chip as claimed in claim 2, is characterized in that the nucleotides sequence of described fluorescent probe is classified as SEQ ID NO:75.