CN101724686B - Gene chip and test kit for detecting important pathogenic bacteria in aquatic products - Google Patents
Gene chip and test kit for detecting important pathogenic bacteria in aquatic products Download PDFInfo
- Publication number
- CN101724686B CN101724686B CN2008101723981A CN200810172398A CN101724686B CN 101724686 B CN101724686 B CN 101724686B CN 2008101723981 A CN2008101723981 A CN 2008101723981A CN 200810172398 A CN200810172398 A CN 200810172398A CN 101724686 B CN101724686 B CN 101724686B
- Authority
- CN
- China
- Prior art keywords
- seq
- dna
- probe
- gene chip
- proteus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6834—Enzymatic or biochemical coupling of nucleic acids to a solid phase
- C12Q1/6837—Enzymatic or biochemical coupling of nucleic acids to a solid phase using probe arrays or probe chips
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N35/00—Automatic analysis not limited to methods or materials provided for in any single one of groups G01N1/00 - G01N33/00; Handling materials therefor
- G01N35/00029—Automatic analysis not limited to methods or materials provided for in any single one of groups G01N1/00 - G01N33/00; Handling materials therefor provided with flat sample substrates, e.g. slides
- G01N2035/00099—Characterised by type of test elements
- G01N2035/00158—Elements containing microarrays, i.e. "biochip"
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a gene chip and a test kit for detecting important pathogenic bacteria in aquatic products, wherein the gene chip comprises a solid matrix and an oligonucleotide probe composed of one or more serials selected from the following serials: (1) DNA serials selected from the spacers of 16S-23rS DNA of salmonella, Vibrio parahaemolyticus, Vibrio cholerae, Listeria monocytogenes, staphylococcus aureus, Suppurative streptococcus, Proteus mirabilis, Proteus Vulgaris and Paneth Proteus, and ipaH Virulence gene of Shigella; (2) complement DNA serials of the DNA serials selected from (1); (3) complement RNA serials of the DNA serials selected from (1) or (2). The chip and the test kit comprise simple and convenient operation, high veracity and strong repeatability in detecting the important pathogenic bacteria in aquatic products.
Description
Technical field
The present invention relates to a kind of gene chip and use test kit, relate in particular to the gene chip and the test kit that detect important pathogenic bacteria in the fishery products with detecting.
Background technology
Food quality and food safety concern human health, thereby receive the great attention of countries in the world.The food origin disease that mikrobe causes is the subject matter of food safety.The food origin disease that bacterial contamination causes (food poisoning) is distinct issues in China's food safety.According to Ministry of Health's statistics, received altogether that great food report reached 150,6237 people that poison, dead 135 people in 2000; 185 of great food poisonings take place in calendar year 2001 altogether, and 15715 people poison, and 116 people are dead.In the food poisonings that report in all parts of the country in 2005, mikrobe food poisoning number is maximum, accounts for 43.0% of sum.The data analysis of country's food origin disease monitoring net case report shows: the mikrobe venereal disease is former to account for 46.4%; During mikrobe property food origin disease broke out, the outbreak of disease that Vibrio parahemolyticus causes accounted for 40.1%, and Bacillus proteus accounts for 11.3%; Staphyloentero-toxin accounts for 9.4%; Bacillus cereus accounts for 8.6%, and Salmonellas accounts for 8.1%, and pathogenic colon bacillus accounts for 4%.The high-risk food of China's food poisoning is: meat, grain, fishery products, fruit and vegetable, egg, beans, milk.This ordering is based on the current intelligence of the analysis of national food origin disease monitoring net part information.Wherein fishery products are number three, and are the important high-risk food of food poisoning.The range of countries of the food origin disease influence that the fishery products pathogenic bacterium cause is wide, critical health crowd is many, but also brings crisis for food trade relevant between the country, and this makes the fishery products safety-problems receive unprecedented concern.Although these facts also can prove absolutely modern science and technology and develop into quite high level, no matter the disease that the fishery products pathogenic bacterium cause in developed country or in developing country, does not all have good Be Controlled, still endanger the people's health.
Pathogenic bacterium in the fishery products mainly contain following two types: the one, and himself original pathogenic bacterium, this bacterioid is distributed widely in the water, like low-temperature receiver property bacterium monocyte hyperplasia listeria spp, bites hot bacterium such as Vibrio parahaemolyticus and vibrio cholerae etc.; The original pathogenic bacterium of two right and wrong self, promptly contaminated pathogenic bacterium in the production process reach by in the water surrounding of human or animal's fecal pollution in main existence and the humans and animals enteron aisle; Common (the Yang Wenge such as Salmonellas, Shigellae, streptococcus aureus that comprise; Sun Cuiling, Pan Yundi, etc. the method for quick of pathogenic microorganism in the fishery products. the Chinese food journal; 2006,6 (1): 402～406).Added up the mikrobe property food poisoning case of announcing in domestic nearly ten years that the Ministry of Health announces, the current intelligence of the analysis of comprehensive national food origin disease monitoring net part information, the investigation statistics data that Tianjin Entry-Exit Inspection and Quarantine Bureau provides; Confirm that fishery products pathogenic bacterium detection chip sensing range is following 10 types of common bacterium: micrococcus scarlatinae, Shigellae (comprising shigella flexneri, Song Shi Shigellae, shigella boydii and shigella dysenteriae totally 4 kinds), Salmonellas; Streptococcus aureus; Vibrio parahaemolyticus, vibrio cholerae, Listeria monocytogenes; Proteus mirabilis, Pan Shi Bacillus proteus and proteus vulgaris.
China still stops conventional microbiological Test level for pathogenic bacteria detection, the identification of means of fishery products at present; Usually be main with separation and Culture, biochemical test and serological test; Shortcoming such as have that complicated operation, hand labour amount are big, round of visits long (6-7 days), specificity are not strong; In sizable degree limit to the rapid detection identification capacity of food origin disease pathogeny fishery products, and judging whether only to lean on experimenter's visual inspection, enough not reliable foundation when positive; Reduce the accuracy of experimental result, can not reach the requirement that fresh water product storage time is short, need rapid detection.Some simple molecular biological methods such as PCR, ELISA have higher false positive results to occur, and the result who uses PCR and ELISA to draw can not be as final detection foundation.The detected result of some Europe such as Denmark, people from Australia Leah and Australia country foodborne bacterial pathogens combines the result that real-time fluorescence PCR and two kinds of technology of ELISA detect and judges on DNA and two kinds of levels of protein a few days ago, and experimental implementation has only about 1h.Therefore China is necessary to set up the high-throughput of fishery products pathogenic bacterium, monitoring system fast and accurately, and to guarantee the correct security of judging fishery products in the relatively short time, this is the important prerequisite that effectively prevents and control food origin disease.Only in this way could eliminate the harm that causes owing to the pathogenic bacterium in the fishery products to a certain extent in advance, improve the detection and the controllability of China's food origin disease, build rich technology platform for reaching the agreement of being open to the custom with other countries as early as possible after the accession to WTO.
In July, 1997, Affymetrix, (Santa Clara, CA) the 6th, 228, No. 575 USPs of the people such as Thomas R. of company invention disclose the method for with biochip technology mikrobe being carried out deciding kind and phenotype analytical to Inc..Since nineteen nineties, biochip technology is set up as a kind of brand-new foranalysis of nucleic acids detection technique, and the progressively development along with carrying out of the Human Genome Project.Technology such as molecular biology, unicircuit manufacturing, computingmachine, semi-conductor, confocal laser scanning, fluorescent mark have been used in this technological synthesis; Make testing process have characteristics such as susceptibility height, high specificity, LSI, robotization, simple and efficient to handle, efficient height, obtain widespread usage at aspects such as genetic expression correlative study and bio-pharmaceuticals researchs.Therefore,, not only can simplify detection means greatly, improve detection speed, and have high accuracy, highly sensitive, high-throughput, repeatable plurality of advantages such as strong if biochip technology is used for the evaluation of bacterium.
The target molecule of the microorganism identification of the most often using at present is 16S rRNA and 23S rRNA, existing both at home and abroad a lot of bibliographical informations.Utilize 16S rRNA and 23S rRNA can bacterial micro-organism be identified to planting or belonging to; But for the evaluation of nearer bacterium kind of sibship or genus difficulty (BodrossyL, Sessitsch be microarrays in microbial diagnostics.Current Opinion in Microbiology.7:245-25 A.2004.Oligonucleotide) very.The evaluation that utilizes between 16S-23S rRNA the district to carry out bacterium as target molecule has at present become focus (the Nubel U of research gradually; SchmidtPM; Rei β E; Et al.2004.Oligonucleotide microarray for identification ofBacillus anthracis based on intergenic transcribed spacers in ribosomal DNA.FEMS Microbiology Letters 240:215-223.); Its variation speed is equivalent to 16SrRNA or 23S rRNA ten times; Therefore have higher resolving power, even can bacterium be distinguished type, have 16S rRNA and the incomparable advantage of 23S rRNA for the differentiation of the nearer kind of sibship.Two ends are 16S rRNA gene and 23S rRNA gene regions of guarding simultaneously; Can avoid the problem of many primer dimers that primer is brought at the conserved regions design universal primer at two ends; Length between 200bp-1000bp, big or small easy handling, thereby the amplification of target sequence and labeling process are simplified more; Also control more easily, the actual requirement that match operation is simple and efficient.
Summary of the invention
An object of the present invention is to provide a kind of gene chip that detects important pathogenic bacteria in the fishery products; To remedy the defective of the time-consuming consumption power that traditional common fishery products pathogenic bacterium detection technique exists; Expansion pathogenic bacteria sensing range; Improve detection sensitivity and specificity, reduce labour intensity, shorten sense cycle.
The gene chip of important pathogenic bacteria comprises solid phase carrier and is fixed on the oligonucleotide probe on this solid phase carrier in the detection fishery products of the present invention, and the wherein said oligonucleotide probe that is fixed on this solid phase carrier comprises one or more that from following sequence, choose:
(1) from Salmonellas, Vibrio parahaemolyticus, vibrio cholerae, singly increases the dna sequence dna of choosing ipaH (the invasion plasmid antigengene) virulence gene of district between the 16S-23S rDNA of listeria spp, streptococcus aureus, micrococcus scarlatinae, Proteus mirabilis, proteus vulgaris, Pan Shi Bacillus proteus and Shigellae;
The complementary dna sequence of the dna sequence dna of (2) choosing in above-mentioned (1);
The complementary RNA sequence of the dna sequence dna of (3) choosing in above-mentioned (1) or (2).
In the preferred embodiments of the present invention, be fixed on oligonucleotide probe on this solid phase carrier and have in the dna sequence dna shown in the SEQ ID NO:2-SEQ ID NO:26 one or more.
Gene chip of the present invention also comprises positive control probe, negative control probe or fluorescent probe.
In the gene chip of the present invention, said positive control probe is selected from dna fragmentation or its complementary DNA or the RNA sequence in the bacterial 16 S rDNA conserved regions.
In the preferred embodiments of the present invention, said positive control probe has the dna sequence dna shown in the SEQ ID NO:1.
The present invention also provides the application of described gene chip, is mainly detecting Shigellae, Salmonellas, Vibrio parahaemolyticus, vibrio cholerae, singly increasing the application of at least a pathogenic bacterium in listeria spp, streptococcus aureus, micrococcus scarlatinae, Proteus mirabilis, proteus vulgaris, the Pan Shi Bacillus proteus.In the above-mentioned application, comprise and use to detect primer, in the preferred embodiments of the present invention, said detection primer has at least a in the dna sequence dna shown in the SEQ ID NO:27-SEQ ID NO:30 or its complementary sequence.
The present invention also provides a kind of test kit, and it comprises the above-mentioned gene chip of right.
Test kit of the present invention also comprises the detection primer, and in the preferred embodiments of the present invention, said detection primer has at least a in the dna sequence dna shown in the SEQ ID NO:27-SEQ ID NO:30 or its complementary sequence.
The present invention also provides the application of above-mentioned test kit, and it is mainly and is detecting Shigellae, Salmonellas, Vibrio parahaemolyticus, vibrio cholerae, singly increasing the application of at least a pathogenic bacterium in listeria spp, streptococcus aureus, micrococcus scarlatinae, Proteus mirabilis, proteus vulgaris, the Pan Shi Bacillus proteus.
Visible by above-mentioned technical scheme; The present invention introduces biochip technology that the important pathogenic bacteria detection range detects 10 types of pathogenic bacterium simultaneously in the fishery products first; Set up a kind of fast, sensitive, accuracy is high, strong brand-new being used for of repeatability detects the fishery products important pathogenic bacteria gene chip and detection method thereof; Utilize gene chip of the present invention can reach the purpose that detects important pathogenic bacteria in the fishery products, because easy and simple to handle, accuracy is high; Repeatability is strong, can be used for medical test, food safety check, imports and exports inspection and quarantine and epidemiology survey.
More obviously understandable for guaranteeing the above and other objects of the present invention feature and advantage, below specially lift preferred embodiment, and cooperate Figure of description, elaborate as follows.
Description of drawings
Fig. 1 is the profile synoptic diagram of an embodiment of gene chip of the present invention.
Fig. 2 is the rule synoptic diagram of arranging of single dot matrix probe on the embodiment of gene chip of the present invention.
Fig. 3 A is the results of hybridization when utilizing gene chip of the present invention to detect suppurative hammer.
Fig. 3 B is the results of hybridization when utilizing gene chip of the present invention to detect Shigellae.
Fig. 3 C is the results of hybridization when utilizing gene chip of the present invention to detect streptococcus aureus.
Fig. 3 D is the results of hybridization when utilizing gene chip of the present invention to detect Salmonellas.
Fig. 3 E utilizes gene chip of the present invention to detect the results of hybridization when singly increasing listeria spp.
Fig. 3 F is the results of hybridization when utilizing gene chip of the present invention to detect Vibrio parahaemolyticus.
Fig. 3 G is the results of hybridization when utilizing gene chip of the present invention to detect vibrio cholerae.
Fig. 3 H is the results of hybridization when utilizing gene chip of the present invention to detect Proteus mirabilis.
Fig. 3 I is the results of hybridization when utilizing gene chip of the present invention to detect the Pan Shi Bacillus proteus.
Fig. 3 J is the results of hybridization when utilizing gene chip of the present invention to detect proteus vulgaris.
Embodiment
The design and the preparation of embodiment 1 probe
1. sequence obtains:
(1) acquisition of bacterial 16 S rDNA sequence: download the whole 16S rDNA sequences that obtain ten kinds of bacterium from the GenBank public database.
(2) acquisition of region sequence between 16S-23S rDNA: from the GenBank public database download obtain Salmonellas, Vibrio parahaemolyticus, vibrio cholerae, singly increase listeria spp, streptococcus aureus, micrococcus scarlatinae, and their all 16S-23S rDNA of nearly edge bacterium between region sequence.
Special needs between conservative species in the kind when analyzing for satisfying target sequence; To the few proteus of ITS resource; Having chosen 48 strain Bacillus proteuss (comprises this and belongs to whole 4 kinds: Proteus mirabilis 22 strains, proteus vulgaris 14 strains, 10 strains of Pan Shi Bacillus proteus; Produce sticking Bacillus proteus 2 strains) carried out between the order-checking in district, record 831 ITS sequences.Distinguish between the primer amplification of 16sS rDNA and 23SrDNA sequences Design with above-mentioned, be connected to behind the PCR product purification on the T carrier, the back electricity changes to advance in the DH5 α competence, and picking contains the plasmid order-checking of 500bp-1000bp, sequenator ABI3700.The sequence that records is with Staden Package software splicing, thus obtain Proteus mirabilis and proteus vulgaris and nearly edge bacterium thereof between region sequence.
(3) acquisition of ipaH gene order: download the whole ipaH gene orders that obtain four kinds of Shigellae from the GenBank public database.
2. probe design:
(1) general probe of bacterium: 16S rDNA sequence that 10 types of bacterium are whole and the 16SrDNA sequence of other bacterium import in the Glustal X software, choose one section 16S rDNA conserved sequence near a district as probe, satisfy length 35 ± 2bp, T
m75 ℃ ± 2 ℃.
(2) region probe between: respectively with Salmonellas, Vibrio parahaemolyticus, vibrio cholerae, singly increase that region sequence imports in the Glustal X software between all 16S-23S rDNA of listeria spp, streptococcus aureus, micrococcus scarlatinae, Proteus mirabilis, proteus vulgaris, Pan Shi Bacillus proteus; Thereby learn this bacterium between region sequence several types is arranged; Choose one for every type and represent sequence in common data NCBI, to do the Blastn comparison, confirming could be as the position of special target spot and special target spot.Contrast Glustal X comparison result is chosen and is satisfied the character that this section is not all guarded between homophyletic, while length 35 ± 2bp, T
m75 ℃ ± 2 ℃.
(3) ipaH gene probe: the above-mentioned ipaH gene order of downloading four kinds of Shigellae obtain from the GenBank public database is compared with sequence alignment software Glustal X; Find this gene conservative section; Should guard section and import in the OligoArray2.0 software, parameter setting is following :-n20;-130;-L40;-D3000;-t79;-T90;-s65 ℃;-x65 ℃;-N2;-p33 ,-P65;-m GGGGG CCCCC TTTTT AAAAA;-g15.The online designing probe of working procedure.From the output result, select length, T at 35bp ± 2bp
mThe probe that is worth 75 ℃ ± 2 ℃.
3. probe is synthetic: entrust probe Synesis Company (Beijing AudioCodes company) synthetic, subsequent use after 5 ' of the probe sequence in the following table 1 is held 10 T of prolongation (having comprised 10 T that prolong in the fluorescent probe sequence shown in the table 1) and amination.
4. probe screening: will synthesize the good also an amount of dilution of probe dissolving back and on glass chip, process gene chip with gene chip sample applying appearance point; Carry out the probe screening through hybrid experiment, finally obtain being used to prepare gene chip of the present invention required special, sensitive probe.
In a preferred embodiment of the invention, selected 28 length at 35bp ± 2bp, T
m75 ℃ ± 2 ℃ probe, and carry out probe through 360 hybrid experiments and screen, probe as shown in table 1 finally obtained.Wherein, The probe sequence that is numbered NO.1 (SEQ ID NO:1) is selected from the 16S rDNA of all bacteriums; Be used for detecting as positive control whether bacterium is arranged; The probe that is numbered NO.2 is as fluorescent probe, and the probe that is numbered NO.3 is a poly T fragment, as negative control; The probe that is numbered NO.4 is 50% DMSO; As blank, 21 probe sequences (SEQ ID NO:2-SEQ ID NO:22) of numbering NO.5-NO.25 are selected between the 16S-23S rDNA of common pathogen (Salmonellas, Vibrio parahaemolyticus, vibrio cholerae, singly increase listeria spp, streptococcus aureus, micrococcus scarlatinae, Proteus mirabilis, proteus vulgaris, Pan Shi Bacillus proteus) and distinguish, and 4 probe sequences of numbering NO.26-NO.29 (SEQ ID NO:23-SEQ ID NO:26) are selected from the ipaH gene of Shigellae.
Table 1: sequence oligonucleotide probe of selecting for use on the gene chip of the present invention and detectable pathogenic bacterium
| The probe numbering | SEQID | Probe sequence (5 '-3 ') | Detectable pathogenic bacterium |
| NO.1 | NO：1 | TTGTACACACCGCCCGTCACACCAT | Bacterium is over against photograph |
| NO.2 | Cy3_TTTTTTTTTTTTTTTTTTTTTTTT | Fluorescent probe |
| TTTTTTTTTTTTTTTTTTTTTTTTT | |||
| NO.3 | TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT | Negative control | |
| NO.4 | 50％DMSO | Blank | |
| NO.5 | NO：2 | GGCTCCATCAGGATACAATCCTACTAAACTT | Micrococcus scarlatinae |
| NO.6 | NO：3 | CACATGGTCAGATTCCTAATTTTCTACAGA | Micrococcus scarlatinae |
| NO.7 | NO：4 | GCTAAAGCGAGCGTTGCTTAGTATCCTA | Micrococcus scarlatinae |
| NO.8 | NO：5 | GCTTATGCGAGCGCTTGACAATCTATTCT | Streptococcus aureus |
| NO.9 | NO：6 | TAAAGCAGTATGCGAGCGCTTGACTAAA | Streptococcus aureus |
| NO.10 | NO：7 | ATGTGAACGTTTGACTTATAAAAATGGTGG | Streptococcus aureus |
| NO.11 | NO：8 | GAGGTTCTGACTACACGATGGGGCTAT | Salmonellas |
| NO.12 | NO：9 | AGGCACTATGCTTGAAGCATCGCGC | Singly increase listeria spp |
| NO.13 | NO：10 | GAGAGGTTAGTACTTCTCAGTATGTTTGTTCTT | Singly increase listeria spp |
| NO.14 | NO：11 | AATGGTTACTTCATTAGAAGTGATTAGCTC | Vibrio parahaemolyticus |
| NO.15 | NO：12 | CCGATTAGCTCCACCACTGACTTCCT | Vibrio parahaemolyticus |
| NO.16 | NO：13 | TTTTCGCTGAGAATGTTTAAAAATGGTT | Vibrio cholerae |
| NO.17 | NO：14 | CTTTAAGCGTTTTCGCTGAGAATGT | Vibrio cholerae |
| TT | |||
| NO.18 | NO：15 | GCCTTGCCTAAAGAAAAAGCTTCTTATTATAA | Proteus mirabilis |
| NO.19 | NO：16 | GAATAACTAAGCTAATTCAAATGAGTTATCTTACT | Proteus mirabilis |
| NO.20 | NO：17 | CCACCCAGATAGTCTTTGAAAGAGACACTTT | Proteus mirabilis |
| NO.21 | NO：18 | AAAAGGAGTGGTTATACGGGTATTAAAACATTA | Proteus mirabilis |
| NO.22 | NO：19 | AAAGGAACATTTCCGATAAGAAAGAAAGCTGAGTA | The Pan Shi Bacillus proteus |
| NO.23 | NO：20 | GAATAGTTAAGATAATTCGATGAGTTATTTTACCT | The Pan Shi Bacillus proteus |
| NO.24 | NO：21 | AGCGCACAGTCAGCGCAACATACATTA | Pan Shi/proteus vulgaris |
| NO.25 | NO：22 | CCCAGACGTCATTAAGAAGAAACATCT | Proteus vulgaris |
| NO.26 | NO：23 | GATAATGATACCGGCGCTCTGCTCTCC | Shigellae |
| NO.27 | NO：24 | AGATAGAAGTCTACCTGGCCTTCCAGACCA | Shigellae |
| NO.28 | NO：25 | AGGAAATGCGTTTCTATGGCGTGTCG | Shigellae |
| NO.29 | NO：26 | ACCATGGCATGCTGTACTGAAGCGTAC | Shigellae |
Embodiment 2 primer design and preparation
1. sequence obtains: the sequence of the same designing probe.
2. design primer:
(1) region sequence primer design between the amplification: after the 16S rDNA that from public database NCBI, downloads ten kinds of bacteriums obtaining compares with sequence alignment software Glustal X, choose one section 16S rDNA conserved sequence near a district as upstream primer, length meets T
mBe worth 50 ℃ ± 5 ℃, length 17bp ± 2bp, Hairpin:NONE, Dimer:NONE, False Priming:NONE, CrossDimer:NONE, and comprise bacterium general probe sequence interior.
(2) amplification ipaH gene order primer design: the ipaH gene order of four kinds of Shigellae that will be above-mentioned obtain from the download of GenBank public database is compared with sequence alignment software Glustal X; Find this gene conservative section; Should guard section imports in primer-design software PrimerPremier 5.0 softwares; Relevant parameter is set as follows: Search For:PCR Primers; Searchtypes:Both.Search Ranges:Sense Primer 1 to 672; Anti-sense Primer 1 to 672, PCR Product Size:100bp to 1000bp.Primer Length:20bp ± 2bp.Search Mode:Automatic.From the output result, choose 50 ℃ ± 5 ℃ of Tm values, length 17bp ± 2bp, Hairpin:NONE, Dimer:NONE, False Priming:NONE, Cross Dimer:NONE and comprise probe sequence at interior primer.
3. primer is synthetic: entrust primer Synesis Company (Beijing AudioCodes) synthetic, subsequent use primer sequence in the following table 2.
4. primer screening: will synthesize good primer dissolving and an amount of dilution; On the one hand through increase the respectively amplification property in district and Shigellae ipaH gene order detection primer between 16S-23S rDNA of PCR reaction; Another fermentation; Two pairs of primers carry out the consistency of two pairs of primers of augmentation detection simultaneously to the different strains of 10 types of bacterium, finally obtain being used to prepare gene chip of the present invention required special, sensitive primer.
In a preferred embodiment of the invention; 4 of primers that not only comprise probe but also be fit to use simultaneously important pathogenic bacteria in 10 types of fishery products of 2 pairs of primer amplifications (Shigellae, Salmonellas, Vibrio parahaemolyticus, vibrio cholerae, singly increase listeria spp, streptococcus aureus, micrococcus scarlatinae, Proteus mirabilis, proteus vulgaris, Pan Shi Bacillus proteus) DNA have been chosen; For adapting to the PCR of two pairs of primers simultaneously; Through the information biology primary dcreening operation and through a large amount of PCR experiment screenings, filter out suitable primer as shown in table 2.
Table 2 is used for the primer sequence that 10 types of common pathogens of enteron aisle detect the pcr amplification of DNA
| The primer numbering | SEQID | Primer sequence (5 '-3 ') | Amplification effect |
| P-1 | NO：27 | TGTACACACCGCCCGTC | Distinguish upstream primer between 16S-23S rDNA |
| P-2 | NO：28 | GGTACTTAGATGTTTCAGTTC | Distinguish downstream primer between 16S-23S rDNA |
| P-3 | NO：29 | TGACCGCCTTTCCGATA | Shigellae ipaH upstream region of gene primer |
| P-4 | NO：30 | GCCAGTACCTCGTCAGTCA | Shigellae ipaH gene downstream primer |
Embodiment 3 gene chips preparation---chip point sample
1. dissolving probe: synthetic probe among the embodiment 1 is dissolved in respectively in the 50%DMSO solution, and dilution makes the final concentration of probe reach 1 μ g/ μ l.
2. splice: will dissolve the corresponding position that good probe adds 384 orifice plates, every hole 10 μ l.
3. point sample: with aldehyde radical slide (the CapitalBio Corp. of the cleaning of 57.5mm * 25.5mm as shown in Figure 1 * 1mm (length * wide * height); China) be put on the Stage microscope of chip point sample instrument (Spotarray72); Use the control software (Telechem smp3 stealty pin) of SpotArray; Working procedure; In the point sample district by arrangement mode point 4.5mm * 4.5mm on the slide of aldehyde radicalization shown in Figure 2, low density DNA micromatrix in the formation, the array arrangement rule is identical in six dot matrix areas on the slide.Dot spacing 250 μ m in the dot matrix area domain sizes 3mm * 2mm, this dot matrix, matrix: 12 * 8,12 * 250 μ m=3mm, 8 * 250 μ m=2mm, standard film base size: 75.5mm * 25.5mm * 1mm.
4. dry: dried overnight under the chip room temperature that will put, then 45 ℃ of oven dryings 2 hours.
5. crosslinked: with crosslinked 2 times of crosslinked appearance (uvpcl-2000M ultraciolet Crosslinker) 600J.Crosslinked good chip is put back in the clean chip cartridges, subsequent use.
Visible by Fig. 2, in each point sample district the individual probe points in 12 (OK) * 8 (row).The position of NO.1 frame district signal be bacterial detection over against according to probe; The position of NO.2 frame district signal is a fluorescent probe; The position of NO.3 frame district signal is negative contrast probe, and what NO.4 frame district was illustrated is blank, and other is the specific probe (corresponding to the numbering of the correspondent probe in the table 1) of each pathogenic bacterium.
Embodiment 4 utilizes important pathogenic bacteria in the gene chip rapid detection fishery products
1. sample preparation: according to the working method of GB, with the sterilization cotton swab, aseptic technique, the 2YT substratum for preparing is put at the positions such as the cheek and enteron aisle of smearing fishery products such as fish, shrimp, crab, and 37 ℃, the 200rpm overnight shaking is cultivated.
2. extraction genome: the pathogenic bacterium thalline that centrifugal 5 minutes depositions of the sample 8000rpm of 1ml incubated overnight possibly exist, abandon supernatant (empty as far as possible doing).It is resuspended in deposition, to add the 100ul deionized water, and 8000rpm centrifugal 5 minutes, removes supernatant.The lysate (prescription is as follows) that adds 100ul, 100 ℃ of boiling water baths 15 minutes, centrifugal 3 minutes of 12000rpm, supernatant is the dna profiling of slightly carrying.
Attach: the lysate prescription:
1 * PCR damping fluid (contains Mg
+)
0.5% NP40
0.5% Tween20
3. amplified target sequence: get the 3ul middle layer supernatant that said gene group process for extracting extracts and add in the PCR reaction mixture as template, PCR reaction mixture prescription is as shown in table 3 below.(annotate: the PCR damping fluid in the following table 3-table 4, MgCl
2, the dNTP mixture, the Taq enzyme is all available from Sangon company)
Table 3 Multiplex PCR reaction mixture prescription
Annotate: P-1 to P-2 and P-3 and P-4 are primer listed in the table 2 in the table.
Reaction tubes is put into PCR appearance (Biometra), and the loop parameter of setting is following:
94 ℃ 5 minutes
94 ℃ 30 seconds
50 ℃ 30 seconds
Got back to second step, totally 35 circulations in 1 minute for 72 ℃
72 ℃ 5 minutes
4 ℃ 20 minutes
3. purifying: with purification column (MILIPORE company) purifying, concrete steps are following with the pcr amplification product of above-mentioned acquisition:
(1) the PCR product is transferred in the purification column, adds water and complement to 400 μ l.
Centrifugal 15 minutes of (2) 25 ℃, 6000rpm abandon collection tube.
(3) purification column is transferred in the centrifuge tube of new 1.5ml, added the ultrapure water (MilliQ) of 25 μ l, placed 5 minutes for 37 ℃.
(4) the purification column inversion is placed on the centrifuge tube of 1.5ml, centrifugal 2 minutes of 6000rpm collects product.
4. labels targets sequence: get 12 μ l purified products, add in the mark mixed solution, the labeled reactant mixture formula is as shown in table 4 below.
Table 4 mark mixture formula
Annotate: P-2 and P-4 are primer listed in the table 2 in the table.
Reaction tubes is put into PCR appearance (Biometra), and the loop parameter of setting is following:
94 ℃ 5 minutes
94 ℃ 30 seconds
50 ℃ 30 seconds
Got back to second step, totally 35 circulations in 1 minute for 72 ℃
72 ℃ 5 minutes
4 ℃ 20 minutes
5. oven dry: marked product is put 65 ℃ of oven for drying.
6. hybridization: in hybridizing box (Bo Ao company), add 70 μ l ddH in advance
2O is to keep humidity.12 μ l hybridization solutions (it is as follows to fill a prescription) go back to the probe array zone of common pathogen detection gene chip in the enteron aisle that dissolves the oven dry product and be added in preparation among the embodiment three; Cover the cover plate (Bo Ao company) (noting between cover plate and the slide glass bubble being arranged) of customization; Cover tight hybridizing box, hybridization is 16 hours in 40 ℃ of water-baths.
7. washing: when hybridizing to, take out hybridizing box, remove cover plate, gene chip was washed 3 minutes in washing lotion A successively, washing is 3 minutes among the washing lotion B, and washing is 90 seconds among the washing lotion C, and is air-dry in the air.
Hybridization solution prescription: 10% T 500 (dextran Sulfate); 25% methane amide (formamide); 0.1%SDS (sodium lauryl sulphate); 6 * SSPE
Washing lotion A:1 * SSC (sodium-chlor-sodium citrate soln); 0.1%SDS
Washing lotion B:0.05 * SSC
Washing lotion C:95% ethanol
8. scanning: with GenePix personal 4100A biochip scanner (AXONinstrument) scanning, used parameter is following:
Software and version: GenePix Pro 6.0
official name：575DF35
PMT Gain：550
Scanning resolution: 10 μ m
Scanning result saves as JPG, TIF, GPR form
Hybridization scanning result when detecting pathogenic bacterium in the common enteron aisle (Shigellae, Salmonellas, Vibrio parahaemolyticus, vibrio cholerae, singly increase listeria spp, streptococcus aureus, micrococcus scarlatinae, Proteus mirabilis, proteus vulgaris, Pan Shi Bacillus proteus) respectively with gene chip of the present invention is shown in Fig. 3 A-3J.
9. analysis interpretation: because the object bacteria of this chip detection has 10 kinds, 28 of probes belong to low density chip, and detected result can be judged by naked eyes.According to the hybridization image that scans, with over against according to the position of probe as image coordinate, judge the position of the specific probe that fluorescent signal occurs, contrast dot matrix layout viewing is judged pathogenic bacterium.If only, then do not have this 10 kinds of pathogenic bacterium over against signal being arranged according to probe.
5 pairs of gene chips of embodiment carry out the specificity evaluation and sensitivity detects
Important pathogenic bacteria in the fishery products of preparation among the embodiment 3 being detected the specificity of gene chip identifies as follows:
Amount to the representative bacterial strains of 197 strain pathogenic bacterium with detect strain and their nearly edge bacterial strain and identify the specificity of important pathogenic bacteria detection gene chip in the fishery products of preparation among the embodiment 3.In this specificity test, all bacterial strain situation of use are seen table 5.Utilize gene chip of the present invention and above-mentioned detection method to hybridize detection, all shown correct results of hybridization, this explains that gene chip of the present invention has good specificity.
Table 5: the bacterial strain that the specificity test is used
A, Institute of Epidemiology and Microbiology (IEM), Chinese preventive medicine research association.
B, Australian medical science and veterinary science institute (IMVS).
C, institute of microbiology of the Chinese Academy of Sciences (As).
D, Chinese medicine microbial strains preservation center (CMCC).
E, Taiwan University Of Suzhou.
F, Chinese agriculture microbial strains preservation center (ACCC).
G, Gothenburg, Sweden university culture collection center (CCUG).
H, Czech typical case DSMZ (Prk).
I, Polish Lodz university's microbiology and immunology institute.
J, Czech microbial preservation center (CCM).
K, U.S. typical case DSMZ (ATCC).
L, New South Wales,Australia disease infection and mikrobe center (CIDM).
M, Belgian bacterial classification center (LMG).
N, the national preservation center (CVCC) of Chinese veterinary science bacterial classification.
O is from the strain that detects of Tianjin Entry-Exit Inspection and Quarantine Bureau.
P comes from the clinical strains of Tianjin University Of Traditional Chinese Medicine.
Q comes from the clinical strains of the People's Hospital, Tianjin.
R comes from the clinical strains of Tianjin one central hospital.
S comes from the clinical strains of Tianjin three central hospitals.
T comes from the clinical strains of Tianjin Children's Hospital.
U comes from the clinical strains of Tianjin hospital of Nankai.
V comes from the clinical strains of Tianjin Blood Research Institute.
W comes from the clinical strains of Tianjin chest hospital.
X comes from the clinical strains of second affiliated hospital of Medical University Of Tianjin.
The sensitivity that important pathogenic bacteria in the fishery products of preparation among the embodiment 3 is detected gene chip detects as follows:
The detection sensitivity of this gene chip is through the checking of 153 hybrid experiments, the micro-genomic dna or 10 of 0.1ng
4Bacterium colony just can guarantee that above-mentioned 10 kinds of pathogenic bacterium have stable, good results of hybridization in the pure bacterium sample of cfu/ml, and this explains that gene chip of the present invention has very high detection sensitivity.
Description according to technical scheme of the present invention and preferred embodiment thereof; Any those skilled in the art; Do not breaking away from the spirit and scope of the present invention; Can make various possible being equal to and change or replacement, and all these changes or replacement all should belong to the protection domain of claim of the present invention.
Sequence table
< 110>Tianjin Biochip Technology Co., Ltd
< 120>gene chip and the test kit of important pathogenic bacteria in the detection fishery products
<130> 8P13002-CN
<160> 30
<170> PatentIn version 3.2
<210> 1
<211> 25
<212> DNA
< 213>positive probe sequence
<400> 1
<210> 2
<211> 31
<212> DNA
< 213>be used to detect the sequence oligonucleotide probe of micrococcus scarlatinae
<400> 2
<210> 3
<211> 30
<212> DNA
< 213>be used to detect the sequence oligonucleotide probe of micrococcus scarlatinae
<400> 3
<210> 4
<211> 28
<212> DNA
< 213>be used to detect the sequence oligonucleotide probe of micrococcus scarlatinae
<400> 4
<210> 5
<211> 29
<212> DNA
< 213>be used to detect the sequence oligonucleotide probe of streptococcus aureus
<400> 5
<210> 6
<211> 28
<212> DNA
< 213>be used to detect the sequence oligonucleotide probe of streptococcus aureus
<400> 6
<210> 7
<211> 30
<212> DNA
< 213>be used to detect the sequence oligonucleotide probe of streptococcus aureus
<400> 7
<210> 8
<211> 27
<212> DNA
< 213>be used to detect the sequence oligonucleotide probe of Salmonellas
<400> 8
<210> 9
<211> 25
<212> DNA
< 213>be used to detect the sequence oligonucleotide probe that singly increases listeria spp
<400> 9
<210> 10
<211> 33
<212> DNA
< 213>be used to detect the sequence oligonucleotide probe that singly increases listeria spp
<400> 10
<210> 11
<211> 30
<212> DNA
< 213>be used to detect the sequence oligonucleotide probe of Vibrio parahaemolyticus
<400> 11
<210> 12
<211> 26
<212> DNA
< 213>be used to detect the sequence oligonucleotide probe of Vibrio parahaemolyticus
<400> 12
<210> 13
<211> 28
<212> DNA
< 213>be used to detect the sequence oligonucleotide probe of vibrio cholerae
<400> 13
<210> 14
<211> 27
<212> DNA
< 213>be used to detect the sequence oligonucleotide probe of vibrio cholerae
<400> 14
<210> 15
<211> 32
<212> DNA
< 213>be used to detect the sequence oligonucleotide probe of Proteus mirabilis
<400> 15
<210> 16
<211> 35
<212> DNA
< 213>be used to detect the sequence oligonucleotide probe of Proteus mirabilis
<400> 16
<210> 17
<211> 31
<212> DNA
< 213>be used to detect the sequence oligonucleotide probe of Proteus mirabilis
<400> 17
<210> 18
<211> 33
<212> DNA
< 213>be used to detect the sequence oligonucleotide probe of Proteus mirabilis
<400> 18
<210> 19
<211> 35
<212> DNA
< 213>be used to detect the sequence oligonucleotide probe of Pan Shi Bacillus proteus
<400> 19
<210> 20
<211> 35
<212> DNA
< 213>be used to detect the sequence oligonucleotide probe of Pan Shi Bacillus proteus
<400> 20
<210> 21
<211> 27
<212> DNA
< 213>be used to detect Pan Shi/proteus vulgaris sequence oligonucleotide probe
<400> 21
<210> 22
<211> 27
<212> DNA
< 213>be used to detect the sequence oligonucleotide probe of proteus vulgaris
<400> 22
<210> 23
<211> 27
<212> DNA
< 213>be used to detect the sequence oligonucleotide probe of Shigellae
<400> 23
<210> 24
<211> 30
<212> DNA
< 213>be used to detect the sequence oligonucleotide probe of Shigellae
<400> 24
<210> 25
<211> 26
<212> DNA
< 213>be used to detect the sequence oligonucleotide probe of Shigellae
<400> 25
<210> 26
<211> 27
<212> DNA
< 213>be used to detect the sequence oligonucleotide probe of Shigellae
<400> 26
<210> 27
<211> 17
<212> DNA
< 213>distinguish upstream primer between 16S-23S rDNA
<400> 27
<210> 28
<211> 21
<212> DNA
< 213>distinguish downstream primer between 16S-23S rDNA
<400> 28
<210> 29
<211> 17
<212> DNA
< 213>Shigellae ipaH upstream region of gene primer
<400> 29
<210> 30
<211> 19
<212> DNA
< 213>Shigellae ipaH gene downstream primer
<400> 30
Claims (6)
1. a gene chip that detects pathogenic bacterium in the fishery products comprises solid phase carrier and is fixed on the oligonucleotide probe on this solid phase carrier, it is characterized in that the said oligonucleotide probe that is fixed on this solid phase carrier does
In the dna sequence dna shown in the SEQ ID NO:2-SEQ ID NO:26 one or more; Wherein SEQ ID NO:2-SEQ ID NO:4 detects micrococcus scarlatinae; SEQ ID NO:5-SEQ ID NO:7 detects streptococcus aureus; SEQ ID NO:8 detects Salmonellas, and SEQ ID NO:9 and SEQ ID NO:10 detect and singly increase listeria spp, and SEQ ID NO:11 and SEQ ID NO:12 detect Vibrio parahaemolyticus; SEQ ID NO:13 and SEQ ID NO:14 detect vibrio cholerae; SEQ ID NO:15-SEQ ID NO:18 detects Proteus mirabilis, and SEQ ID NO:19 and SEQ ID NO:20 detect the Pan Shi Bacillus proteus, and SEQ ID NO:21 detects Pan Shi Bacillus proteus or proteus vulgaris; SEQ ID NO:22 detects proteus vulgaris, and SEQ ID NO:23-SEQ ID NO:26 detects Shigellae.
2. gene chip according to claim 1 is characterized in that also comprising positive control probe, negative control probe or fluorescent probe.
3. gene chip according to claim 2 is characterized in that said positive control probe is selected from dna fragmentation or its complementary DNA or the RNA sequence in the bacterial 16 S rDNA conserved regions.
4. gene chip according to claim 3 is characterized in that said positive control probe is the dna sequence dna shown in the SEQ ID NO:1.
5. a test kit is characterized in that comprising the described gene chip of claim 1.
6. test kit according to claim 5 is characterized in that also comprising the detection primer, and wherein said detection primer is dna sequence dna or its complementary sequence shown in the SEQ ID NO:27-SEQ ID NO:30.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2008101723981A CN101724686B (en) | 2008-11-03 | 2008-11-03 | Gene chip and test kit for detecting important pathogenic bacteria in aquatic products |
| PCT/CN2009/001190 WO2010060262A1 (en) | 2008-11-03 | 2009-10-26 | Gene chip and kit for detecting important pathogenic bacterium in aquatic products |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2008101723981A CN101724686B (en) | 2008-11-03 | 2008-11-03 | Gene chip and test kit for detecting important pathogenic bacteria in aquatic products |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101724686A CN101724686A (en) | 2010-06-09 |
| CN101724686B true CN101724686B (en) | 2012-02-29 |
Family
ID=42225203
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2008101723981A Expired - Fee Related CN101724686B (en) | 2008-11-03 | 2008-11-03 | Gene chip and test kit for detecting important pathogenic bacteria in aquatic products |
Country Status (2)
| Country | Link |
|---|---|
| CN (1) | CN101724686B (en) |
| WO (1) | WO2010060262A1 (en) |
Families Citing this family (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102311993A (en) * | 2010-07-08 | 2012-01-11 | 天津生物芯片技术有限责任公司 | Gene chip for detecting important pathogenic bacteria in aquatic product and kit thereof |
| CN102140507B (en) * | 2010-12-20 | 2012-12-26 | 南开大学 | Detection genetic chip and detection kit for infectious diarrhea |
| CN102140515B (en) * | 2011-01-04 | 2012-12-12 | 天津生物芯片技术有限责任公司 | Nucleotides used for detecting important pathogenic bacteria in aquatic product and applications thereof |
| CN103540668A (en) * | 2013-10-22 | 2014-01-29 | 宁波大学 | Gene chip for detecting ten types of pathogenic bacteria in sea areas |
| CN105133040B (en) * | 2015-06-30 | 2018-01-23 | 宁波大学 | A kind of genetic chip for detecting Sea central platform and preparation method thereof and detection method |
| CN109852674B (en) * | 2019-01-23 | 2022-08-23 | 浙江工商大学 | Aquatic pathogenic microorganism detection method based on random amplification mark and in-situ synthesis microfluid chip |
| CN110951895B (en) * | 2019-12-24 | 2021-03-23 | 重庆市畜牧科学院 | System and method for detecting and distinguishing proteus mirabilis, proteus vulgaris and proteus pani |
| CN112011448B (en) * | 2020-07-20 | 2023-04-11 | 深圳市刚竹医疗科技有限公司 | Microfluidic chip, kit and application method of kit |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1536090A (en) * | 2003-04-07 | 2004-10-13 | 中国人民解放军军事医学科学院卫生学 | Food-originated pathogenic bactenium quick detection gene chip and its application |
| CN101045944B (en) * | 2007-01-12 | 2010-12-22 | 北京爱普益生物科技有限公司 | Gene chip for detecting six kinds of diarrhea pathogens and its preparation process and kit |
| CN101240335B (en) * | 2007-02-09 | 2011-02-02 | 天津生物芯片技术有限责任公司 | Gene chip and kit for detecting common pathogen in dairy products |
| CN101113476B (en) * | 2007-05-30 | 2010-05-26 | 中国疾病预防控制中心传染病预防控制所 | Pathogenic microorganism DNA detecting chip and preparation method |
-
2008
- 2008-11-03 CN CN2008101723981A patent/CN101724686B/en not_active Expired - Fee Related
-
2009
- 2009-10-26 WO PCT/CN2009/001190 patent/WO2010060262A1/en active Application Filing
Non-Patent Citations (2)
| Title |
|---|
| 侯晓丽.菌血症及肠道感染常见病原菌高通量基因诊断研究.《浙江大学博士学位论文》.2006,全文. * |
| 杨文鸽等.水产品中致病微生物的快速检测方法.《中国食品学报》.2006,第6卷(第1期),402-406. * |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2010060262A1 (en) | 2010-06-03 |
| CN101724686A (en) | 2010-06-09 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101724686B (en) | Gene chip and test kit for detecting important pathogenic bacteria in aquatic products | |
| CN101240335B (en) | Gene chip and kit for detecting common pathogen in dairy products | |
| Huq et al. | Detection, isolation, and identification of Vibrio cholerae from the environment | |
| Maukonen et al. | Methodologies for the characterization of microbes in industrial environments: a review | |
| CN101748193B (en) | Gene chip for detecting pathogens of lower respiratory tract and reagent kit | |
| Kostrzynska et al. | Application of DNA microarray technology for detection, identification, and characterization of food-borne pathogens | |
| CN105950732A (en) | Animal-derived food pathogen identification and drug-resistant and toxic gene detection composite chip | |
| López-Campos et al. | Microarray detection and characterization of bacterial foodborne pathogens | |
| CN101748192B (en) | Gene chip of main pathogenic microorganism in drinking water and testing kit | |
| CN102869785A (en) | Gene chips for detecting multiple pathogenic bacteria in animals cultivated in sea water and uses thereof | |
| CN101967510B (en) | Gene chip and kit for detecting common pathogenic bacteria in food | |
| CN102311993A (en) | Gene chip for detecting important pathogenic bacteria in aquatic product and kit thereof | |
| CN103820558B (en) | Gene chip for detecting nine pathogenicity vibrios in marine products | |
| CN102140507B (en) | Detection genetic chip and detection kit for infectious diarrhea | |
| CN101240347B (en) | Method for preparing detection chip and method for detecting pathogen by using the same | |
| CN101760514B (en) | Gene chip and kit for detecting diarrheagenic escherichia coli in food and clinical samples | |
| CN102199670A (en) | Microcystin test chip, kit and detection method | |
| CN102140515B (en) | Nucleotides used for detecting important pathogenic bacteria in aquatic product and applications thereof | |
| Schmid et al. | Development and application of oligonucleotide probes for in situ detection of thermotolerant Campylobacter in chicken faecal and liver samples | |
| CN103160587B (en) | Genetic typing chip of 10 common pathogenic legionella and detection kit | |
| Strepparava et al. | Fluorescent in situ hybridization: a new tool for the direct identification and detection of F. psychrophilum | |
| CN103451310B (en) | Gene chip capable of simultaneously detecting various vibrios and method for detecting vibrios | |
| Dias et al. | Fluorescence in situ hybridization (FISH) in food pathogen detection | |
| CN103667538A (en) | Gene chip, kit and method for detecting three viruses for immunosuppression disease of chickens | |
| JP2010022336A (en) | Radioactive probe for counting live campylobacter quickly and specifically by method of culture combined with in situ hybridization, and method by the same |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20120229 Termination date: 20121103 |