CN101748193B - Gene chip for detecting pathogens of lower respiratory tract and reagent kit - Google Patents
Gene chip for detecting pathogens of lower respiratory tract and reagent kit Download PDFInfo
- Publication number
- CN101748193B CN101748193B CN2008101825650A CN200810182565A CN101748193B CN 101748193 B CN101748193 B CN 101748193B CN 2008101825650 A CN2008101825650 A CN 2008101825650A CN 200810182565 A CN200810182565 A CN 200810182565A CN 101748193 B CN101748193 B CN 101748193B
- Authority
- CN
- China
- Prior art keywords
- gene
- probe
- dna
- sequence
- respiratory tract
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Abstract
The invention provides a gene chip for detecting pathogens of lower respiratory tract, which comprises a solid phase carrier and an oligonucleotide probe fixed on the solid phase carrier, wherein the oligonucleotide probe comprises a sequence selected from one or more DNA sequences of staphylococcus aureus, 16s-23s rDNA intergenic spacer region of Klebsiella pneumoniae or Acinetobacter baumannii,16S gene of pseudomonas aeruginosa or haemophilus influenzae, gyrB gene of streptococcus pneumoniae or legionella pneumophila and copB gene of moraxella catarrhalis or the complementary DNA or RNA sequence. The invention further provides a reagent kit containing the gene chip. The utilization of the gene chip and the reagent kit can detect the pathogens of the lower respiratory tract; furthermore, the operation is simple, the accuracy is high and the repeatability is strong.
Description
Technical field
The present invention relates to a kind of gene chip and use test kit, relate in particular to a kind of gene chip and test kit that detects pathogens of lower respiratory tract with detecting.
Background technology
Respiratory tract infection is one of frequent species in the infection; Account for 30%～40% of infection; Understand the pathogenic bacteria kind that causes such disease, particularly cultivate, isolate pathogenic bacterium in time, significant to clinical diagnosis, medicament selection and the prognosis of disease.
Lower respiratory infection (trachitis, bronchitis, bronchiolitis and pneumonia) is the infection of the current social population health of serious threat.Especially serious for the elderly and these immunologic functions of children than weak person's harm.Epidemiological study shows that annual ARI causes about death of child below 2,000,000 5 years old, is this age group children's major causes of death.About 75% pneumonia death betides the baby below 1 years old, and about 1% pneumonia disease regular meeting stays sequela (like bronchiectasis), and these sequela increases are the danger of subinfection again.In the U.S., pneumonia is listed as the 6th in all causes of death, is that modal mortality hospital acquired infects.
According to deliver document and hospital lower respiratory tract infections data analysis about lower respiratory tract, cause that the common bacteria of lower respiratory infection is: streptococcus aureus, Klebsiella pneumonia, Acinetobacter bauamnnii, Pseudomonas aeruginosa, hemophilus influenzae, streptococcus pneumoniae, legionella pneumophilia and moraxelle catarrhalis.
Mostly the method for clinical bacteria is to adopt the traditional separation and Culture and the method for biochemical identification in the GB, and the report assay is need 5～7 days roughly, in addition the method for inspection loaded down with trivial details, waste time and energy.Compare with other science of laboratory diagnosis, the development of Clinical microorganism diagnostic method relatively lags behind.
In July, 1997, Affymetrics, (Santa Clara, CA) the 6th, 228, No. 575 USPs of the people such as Thomas R. of company invention disclose the method for with biochip technology mikrobe being carried out deciding kind and phenotype analytical to Inc..Since nineteen nineties, biochip technology is set up as a kind of brand-new foranalysis of nucleic acids detection technique, and the progressively development along with carrying out of the Human Genome Project.Technology such as molecular biology, unicircuit manufacturing, computingmachine, semi-conductor, confocal laser scanning, fluorescent mark have been used in this technological synthesis; Make testing process have characteristics such as susceptibility height, high specificity, LSI, robotization, simple and efficient to handle, efficient height, obtain widespread usage at aspects such as genetic expression correlative study and bio-pharmaceuticals researchs.Therefore,, not only can simplify detection means greatly, improve detection speed, and have high accuracy, highly sensitive, high-throughput, repeatable plurality of advantages such as strong if biochip technology is used for the evaluation of bacterium.
The target molecule of the microorganism identification of the most often using at present is 16S rRNA and 23S rRNA, existing both at home and abroad a lot of bibliographical informations.Utilize 16S rRNA and 23S rRNA can bacterial micro-organism be identified to planting or belonging to; But for the evaluation of nearer bacterium kind of sibship or genus difficulty (BodrossyL, Sessitsch be microarrays in microbial diagnostics.Current Opinion in Microbiology.7:245-25 A.2004.Oligonucleotide) very.The evaluation that utilizes between 16S-23S rRNA the district to carry out bacterium as target molecule has at present become focus (the Nubel U of research gradually; SchmidtPM; Rei β E; Et al.2004.Oligonucleotide microarray for identification ofBacillus anthracis based on intergenic transcribed spacers in ribosomal DNA.FEMS Microbiology Letters 240:215-223.); Its variation speed is equivalent to 16SrRNA or 23S rRNA ten times; Therefore have higher resolving power, even can bacterium be distinguished type, have 16S rRNA and the incomparable advantage of 23S rRNA for the differentiation of the nearer kind of sibship.Two ends are 16S rRNA gene and 23S rRNA gene regions of guarding simultaneously; Can avoid the problem of many primer dimers that primer is brought at the conserved regions design universal primer at two ends; Length between 200bp-1000bp, big or small easy handling, thereby the amplification of target sequence and labeling process are simplified more; Also control more easily, the actual requirement that match operation is simple and efficient.
Summary of the invention
An object of the present invention is to provide a kind of gene chip that detects pathogens of lower respiratory tract; To remedy the defective of the time-consuming consumption power that traditional clinical pathogens of lower respiratory tract detection technique exists; Expansion pathogenic bacteria sensing range; Improve detection sensitivity and specificity, reduce labour intensity, shorten sense cycle.
The gene chip of detection pathogens of lower respiratory tract of the present invention comprises solid phase carrier and is fixed on the oligonucleotide probe on this solid phase carrier that wherein said this oligonucleotide probe comprises one or more sequences of from following sequence, choosing:
(1) sequence of between the 16S-23SrDNA of streptococcus aureus, Klebsiella pneumonia or Acinetobacter bauamnnii, choosing one or more dna sequence dnas of the gyrB gene of 16S gene, streptococcus pneumoniae or the legionella pneumophilia of district, Pseudomonas aeruginosa or hemophilus influenzae, copB gene that catarrh does not draw;
The complementary dna sequence of the dna sequence dna of (2) choosing in above-mentioned (1);
The complementary RNA sequence of the dna sequence dna of (3) choosing in above-mentioned (1) or (2).
Wherein, the above-mentioned dna fragmentation of between the 16S-23S rDNA of streptococcus aureus, Klebsiella pneumonia or Acinetobacter bauamnnii, choosing the gyrB gene, copB gene that catarrh does not draw of 16S gene, streptococcus pneumoniae or the legionella pneumophilia of district, Pseudomonas aeruginosa or hemophilus influenzae has one or more dna sequence dnas in the dna sequence dna shown in the SEQ ID NO:3-SEQ ID NO:28.
Wherein, above-mentioned oligonucleotide probe also comprises positive control probe and negative control probe.Above-mentioned positive control probe preferably has the dna sequence dna shown in SEQ ID NO:1 and/or the SEQ ID NO:2.
Another object of the present invention provides the application of above-mentioned gene chip, and it can be used for the detection of at least a pathogenic bacterium in streptococcus aureus, Klebsiella pneumonia, Acinetobacter bauamnnii, Pseudomonas aeruginosa, hemophilus influenzae, streptococcus pneumoniae, legionella pneumophilia or the moraxelle catarrhalis.
Wherein, applied detection primer has at least a of the dna sequence dna shown in the SEQ ID NO:29-SEQ ID NO:36 or its complementary dna sequence.
A purpose more of the present invention provides a kind of test kit that detects pathogens of lower respiratory tract, and this test kit comprises above-mentioned gene chip, and said gene chip comprises one or more dna sequence dnas in the dna sequence dna shown in the SEQ ID NO:3-SEQ ID NO:28.This test kit also comprises the detection primer, and this detection primer preferably has at least a of the dna sequence dna shown in the SEQ ID NO:29-SEQ ID NO:36 or its complementary dna sequence.
Test kit of the present invention also comprises interpretation software and the specification sheets that hybridizing box, hybridization solution or Analysis and Identification result use.
A purpose more of the present invention provides the application of above-mentioned test kit, and it can be used for the detection of at least a pathogenic bacterium in streptococcus aureus, Klebsiella pneumonia, Acinetobacter bauamnnii, Pseudomonas aeruginosa, hemophilus influenzae, streptococcus pneumoniae, legionella pneumophilia and the moraxelle catarrhalis.
Visible by above-mentioned technical scheme; The present invention introduces lower respiratory tract common pathogen detection range with biochip technology first, has set up a kind of brand-new lower respiratory tract common pathogen quick, sensitive, that accuracy is high, repeatability is strong and has detected gene chip and detection method thereof, utilizes gene chip of the present invention can reach the purpose that detects the common pathogenic bacterium of lower respiratory tract; Because it is easy and simple to handle; Accuracy is high, and repeatability is strong, has important use to be worth for the hospital clinical inspection department.
For let above and other objects of the present invention, feature and advantage can be more obviously understandable, below special lift preferred embodiment, and cooperate Figure of description, elaborate as follows.
Description of drawings
Fig. 1 is the profile synoptic diagram of an embodiment of gene chip of the present invention.
Fig. 2 is the rule synoptic diagram of arranging of single dot matrix probe on the embodiment of gene chip of the present invention.
Fig. 3 A is the results of hybridization when utilizing gene chip of the present invention to detect the lower respiratory tract streptococcus aureus.
Fig. 3 B is the results of hybridization when utilizing gene chip of the present invention to detect the lower respiratory tract Klebsiella Pneumoniae.
Fig. 3 C is the results of hybridization when utilizing gene chip of the present invention to detect the lower respiratory tract Pseudomonas aeruginosa.
Fig. 3 D is the results of hybridization when utilizing gene chip of the present invention to detect the lower respiratory tract moraxelle catarrhalis.
Fig. 3 E is the results of hybridization when utilizing gene chip of the present invention to detect the lower respiratory tract hemophilus influenzae.
Fig. 3 F is the results of hybridization when utilizing gene chip of the present invention to detect lower respiratory tract streptococcus pneumoniae bacterium.
Fig. 3 G is the results of hybridization when utilizing gene chip of the present invention to detect the lower respiratory tract Acinetobacter bauamnnii.
Fig. 3 H is the results of hybridization when utilizing gene chip of the present invention to detect the lower respiratory tract legionella pneumophilia.
Embodiment
The design and the preparation of embodiment 1 probe
1. sequence obtains:
(1) acquisition of bacterium 16s rDNA sequence: download the whole 16srDNA sequences that obtain eight kinds of bacterium (streptococcus aureus, Klebsiella pneumonia, Acinetobacter bauamnnii, Pseudomonas aeruginosa, hemophilus influenzae, streptococcus pneumoniae, legionella pneumophilia and moraxelle catarrhalis) from the GenBank public database.
(2) acquisition of region sequence between 16S-23S rDNA: download region sequence between all 16S-23S rDNA that obtain streptococcus aureus, Klebsiella pneumonia and Acinetobacter bauamnnii and their nearly edge bacterium from the GenBank public database.
Region sequence between 21 of 9 strain bacterium is only arranged in the region sequence public database between Klebsiella pneumonia, and region sequence has only 1 sequence of 1 strain bacterium between acid-producing Klebsiella bacterium, has satisfied not the demand of screening specific probe.This laboratory is to 22 Klebsiella pneumoniaes; 3 strain ozena klebsiellas; 2 strain noses scleromas klebsiella, 4 strain acid-producing Klebsiella bacteriums, autochthonal klebsiella of 1 strain and 1 strain plant living klebsiella and 2 strains separate the ornithine klebsiella carried out between the order-checking in district.Distinguish between the primer amplification of 16s rDNA and 23s rDNA sequences Design with above-mentioned, be connected to behind the PCR product purification on the T carrier, the back electricity changes to advance in the DH5 α competence, and picking contains the plasmid order-checking of 500bp-1kbp, sequenator ABI3700.The sequence that records is with Staden Package software splicing, thus obtain Klebsiella pneumonia and acid-producing Klebsiella bacterium and nearly edge bacterium thereof between region sequence.
(3) acquisition of copB gene order: download the whole copB gene orders that obtain moraxelle catarrhalis from the GenBank public database.
(4) acquisition of gyrB gene order: download the whole gyrB gene orders that obtain streptococcus pneumoniae and legionella pneumophilia from the GenBank public database.
2. probe design:
(1) general probe of bacterium: 16s rDNA sequence that eight kinds of bacterium are whole and the 16srDNA sequence of other bacterium import in the Glustal X software, choose one section 16s rDNA conserved sequence near a district as probe, satisfy length 27bp ± 2bp, T
mBe worth 68 ℃ ± 3 ℃.
(2) region probe between: respectively region sequence between all 16S-23S rDNA of streptococcus aureus, Klebsiella pneumonia and Acinetobacter bauamnnii is imported in the Glustal X software; Thereby learn this bacterium between region sequence several types is arranged; Choose one for every type and represent sequence in common data NCBI, to do the blastn comparison, confirming could be as the position of special target spot and special target spot.Contrast GlustalX comparison result is chosen and is satisfied the character that this section is not all guarded between homophyletic, while length 27bp ± 3bp, T
mBe worth 68 ℃ ± 3 ℃.
(3) copB gene probe: the above-mentioned copB gene order of downloading the moraxelle catarrhalis obtain from the GenBank public database is compared with sequence alignment software Glustal X; Find this gene conservative section; Should guard section and import in the OligoArray2.0 software, parameter setting is following :-n 20;-l 30;-L 40;-D 3000;-t 79;-T 90; 65 ℃ of-s; 65 ℃ of-x;-N 2;-p 33, and-P 65;-m GGGGG CCCCC TTTTT AAAAA;-g15.The online designing probe of working procedure.From the output result, select length, T at 27bp ± 2bp
mThe probe that is worth 68 ℃ ± 3 ℃.
(4) gyrB gene probe: the gyrB sequence of above-mentioned download streptococcus pneumoniae and legionella pneumophilia is imported in the Glustal X software, find this gene conservative section, should guard section and import in the OligoArray2.0 software, parameter setting is following :-n 20;-l 30;-L 40;-D 3000;-t 79;-T 90; 65 ℃ of-s; 65 ℃ of-x;-N 2;-p 33, and-P 65;-m GGGGG CCCCC TTTTTAAAAA;-g15.The online designing probe of working procedure.From the output result, select length, T at 27bp ± 2bp
mThe probe that is worth 68 ℃ ± 3 ℃.
3. probe is synthetic: entrust probe Synesis Company (Beijing AudioCodes company) synthetic, subsequent use after 5 ' of the probe sequence in the following table 1 is held prolongation 15 T (10 T that do not comprise prolongation in the fluorescent probe sequence shown in the table 1) and amination.
4. probe screening: will synthesize the good also an amount of dilution of probe dissolving back and on glass chip, process gene chip with gene chip sample applying appearance point; Carry out the probe screening through hybrid experiment, finally obtain being used to prepare gene chip of the present invention required special, sensitive probe.
In a preferred embodiment of the invention, selected 30 length at 35bp ± 2bp, T
m75 ℃ ± 2 ℃ probe, and carry out probe through 269 hybrid experiments and screen, probe as shown in table 1 finally obtained.Wherein, The probe sequence that is numbered NO.1 (SEQ ID NO:1) is selected from the 16s rDNA of all bacteriums; Be used for detecting as positive control whether bacterium is arranged; The probe that is numbered NO.2 is as fluorescent probe; Be numbered the negative contrast of NO.3 (SEQ ID NO:2) and be used for detecting whether bacterium is arranged; The probe that is numbered NO.4 is 50% DMSO, and as blank, 7 probe sequences (SEQ ID NO:3-SEQ ID NO:9) of numbering NO.5-NO.11 are selected between the 16S-23S rDNA of streptococcus aureus, Klebsiella pneumonia and Acinetobacter bauamnnii and distinguish; 7 probe sequences (SEQ ID NO:10-SEQ ID NO:16) of numbering NO.12-NO.18 are selected from the 16S gene of Pseudomonas aeruginosa and hemophilus influenzae; 4 probe sequences (SEQ IDNO:17-SEQ ID NO:20) of numbering NO.19-NO.22 are selected from the gyrB gene of streptococcus pneumoniae, and 4 probe sequences (SEQ ID NO:21-SEQ ID NO:24) of numbering NO.23-NO.26 are selected from the copB gene that catarrh do not draw, and 4 probe sequences (SEQ ID NO:25-SEQ IDNO:28) of numbering NO.27-NO.30 are selected from the gyrB gene of legionella pneumophilia.
Table 1: sequence oligonucleotide probe of selecting for use on the gene chip of the present invention and detectable pathogenic bacterium
| The probe numbering | SEQID | Probe sequence (5 '-3 ') | Detectable pathogenic bacterium |
| NO.1 | NO：1 | TTGTACACACCGCCCGTCACACCAT | Bacterium is over against photograph |
| NO.2 | Cy3_TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT | Fluorescent probe | |
| NO.3 | NO：2 | TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT | The negative contrast of bacterium |
| NO.4 | 50％DMSO | Blank | |
| NO.5 | NO：3 | GCTTATGCGAGCGCTTGACAATCTATTCT | Streptococcus aureus |
| NO.6 | NO：4 | TAAAGCAGTATGCGAGCGCTTGACTAAA | Streptococcus aureus |
| NO.7 | NO：5 | ATGTGAACGTTTGACTTATAAAAATGGTGG | Streptococcus aureus |
| NO.8 | NO：6 | ATTTGAAGAGGTTGCAAACGATGGG | Klebsiella pneumonia |
| NO.9 | NO：7 | GGCCTACCAAATTTGCGAAGCAA | Klebsiella pneumonia |
| NO.10 | NO：8 | TCATTATCACGGTAATTAGTGTGATCTGACG | Acinetobacter bauamnnii |
| NO.11 | NO：9 | AGTGTGATCTGACGAAGACACATTAACTCATT | Acinetobacter bauamnnii |
| NO.12 | NO：10 | TCATACGTCCTGAGGGAGAAAGTG | Pseudomonas aeruginosa |
| NO.13 | NO：11 | GGGCAGTAAGTTAATACCTTGCTGT | Pseudomonas aeruginosa |
| NO.14 | NO：12 | ATGAAGGGAGCTTGCTCCTGGAT | Pseudomonas aeruginosa |
| NO.15 | NO：13 | TCCGTTGGGATCCTTGAGATC | Pseudomonas aeruginosa |
| NO.16 | NO：14 | CGGTAGCAGGAGAAAGCTTGCTTTCTTG | Hemophilus influenzae |
| NO.17 | NO：15 | TTTGGGGGTTGGGGTTTAACTCTGGCG | Hemophilus influenzae |
| NO.18 | NO：16 | GTTGGGGTTTAACTCTGGCGCCCGTA | Hemophilus influenzae |
| NO.19 | NO：17 | AAGCGCCAAGGTTTGGAACAAACCAAG | Streptococcus pneumoniae |
| NO.20 | NO：18 | GCGCCAAGGTTTGGAACAAACCAAGC | Streptococcus pneumoniae |
| NO.21 | NO：19 | AGCGCCAAGGTTTGGAACAAACCAAG | Streptococcus pneumoniae |
| NO.2 | NO：20 | GGACCCAAAAATCTTCACTGAAACA | Streptococcus pneumoniae |
| 2 | ACAATC | ||
| NO.23 | NO：21 | GCCATTGACCTAAAAATTGACAACGCTTA | Moraxelle catarrhalis |
| NO.24 | NO：22 | CACCAAGGTCGCTTTATGCTAGACCCT | Moraxelle catarrhalis |
| NO.25 | NO：23 | AGACGAAAGCACGGCTACAGATTTGCG | Moraxelle catarrhalis |
| NO.26 | NO：24 | TACTTCTCAATTTGTCAGCATTCGTGGCA | Moraxelle catarrhalis |
| NO.2 7 | NO：25 | GCATTTGCTAGTGCGTAGACATGGA A | Legionella pneumophilia |
| NO.28 | NO：26 | CTAGCTAAAAGATTACGTGAATTGTC | Legionella pneumophilia |
| NO.2 9 | NO：27 | GAGCACTTAAATAAAAATAAAACA CCAGT | Legionella pneumophilia |
| NO.30 | NO：28 | GTATCTCCAACAGGTGATGATGCTCG | Legionella pneumophilia |
Embodiment 2 primer design and preparation
1. sequence obtains: the sequence of the same designing probe.
2. design primer:
(1) region sequence primer design between the amplification: after the 16S rDNA that from public database NCBI, downloads 8 kinds of bacteriums obtaining compares with sequence alignment software Glustal X, choose one section 16s rDNA conserved sequence near a district as upstream primer, length meets T
mBe worth 50 ℃ ± 5 ℃, length 17bp ± 2bp, Hairpin:NONE, Dimer:NONE, False Priming:NONE, Cross Dimer:NONE, and comprise bacterium general probe sequence interior.
(2) amplification copB gene order primer design: do not draw the copB gene order to compare the above-mentioned catarrh that obtains from the download of GenBank public database with sequence alignment software Glustal X; Find this gene conservative section; Should guard section imports in primer-design software Primer Premier 5.0 softwares; Relevant parameter is set as follows: Search For:PCR Primers; Search types:Both.Search Ranges:Sense Primer 1 to 672, Anti-sense Primer 1 to 672, PCRProduct Size:100bp to 1000bp.Primer Length:20bp ± 2bp.Search Mode:Automatic.From the output result, choose T
m50 ℃ ± 5 ℃ of values, length 17bp ± 2bp, Hairpin:NONE, Dimer:NONE, False Priming:NONE, Cross Dimer:NONE and comprise probe sequence at interior primer.
(3) amplification gyrB gene order primer design: all pneumonia streptococcus and legionella pneumophilia bacterium gyrB gene order that above-mentioned download obtains are compared with sequence alignment software Glustal X; Find this gene conservative section; Should guard section imports in primer-design software Primer Premier 5.0 softwares; Relevant parameter is set as follows: Search For:PCR Primers; Search types:Both.SearchRanges:Sense Primer 1 to 2415, Anti-sense Primer 1 to 2415, PCR ProductSize:100bp to 1000bp.Primer Length:20bp ± 2bp.Search Mode:Automatic.From the output result, choose T
m50 ℃ ± 5 ℃ of values, length 17bp ± 2bp, Hairpin:NONE, Dimer:NONE, False Priming:NONE, Cross Dimer:NONE and comprise probe sequence at interior primer.
3. primer is synthetic: entrust primer Synesis Company (Beijing AudioCodes) synthetic, subsequent use primer sequence in the following table 2.
4. primer screening: will synthesize good primer dissolving and an amount of dilution; On the one hand through the PCR reaction amplification property that district, 16S gene, catarrh between 16S-23S rDNA do not draw the gyrB gene order detection primer of copB gene and streptococcus pneumoniae, legionella pneumophilia that increases respectively; Another fermentation; Four pairs of primers carry out the consistency of four pairs of primers of augmentation detection simultaneously to the different strains of 8 kinds of bacterium, finally obtain being used to prepare gene chip of the present invention required special, sensitive primer.
In a preferred embodiment of the invention; 8 of primers that not only comprise probe but also be fit to use simultaneously 8 kinds of lower respiratory tract common pathogens of 4 pairs of primer amplifications (streptococcus aureus, Klebsiella pneumonia, Acinetobacter bauamnnii, Pseudomonas aeruginosa, hemophilus influenzae, streptococcus pneumoniae, legionella pneumophilia and moraxelle catarrhalis) DNA have been chosen; For adapting to the PCR of four pairs of primers simultaneously; Through the information biology primary dcreening operation and through a large amount of PCR experiment screenings, filter out suitable primer as shown in table 2.
Table 2 is used for the primer sequence that 8 kinds of common pathogens of lower respiratory tract detect the pcr amplification of DNA
| The primer numbering | SEQ ID | Primer sequence (5 '-3 ') | Amplification effect |
| P-1 | NO：29 | TGTACACACCGCCCGTC | Distinguish upstream primer between 16S-23S rDNA |
| P-2 | NO：30 | GGTACTTAGATGTTTCAGTTC | Distinguish downstream primer between 16S-23S rDNA |
| P-3 | NO：31 | AGAGTTTGATCMTGGCTCAG | 16S upstream region of gene primer |
| P-4 | NO：32 | CCGTCAATTCMTTTRAGTTT | 16S upstream region of gene primer |
| P-5 | NO：33 | GAAAGGGCATTMACMACWGA | Streptococcus pneumoniae and legionella pneumophilia gyrB upstream region of gene primer |
| P-6 | NO：34 | GWGTSAYTTCACGMGCACGC | Streptococcus pneumoniae and legionella pneumophilia gyrB gene downstream primer |
| P-7 | NO：35 | GGTGAGTGCCGCTTTTACA | Catarrh does not draw copB upstream region of gene primer |
| P-8 | NO：36 | GARTYRCGYCCATGYTCTAA | Catarrh does not draw copB gene downstream primer |
Embodiment 3 gene chips preparation---chip point sample
1. dissolving probe: synthetic probe among the embodiment 1 is dissolved in respectively in the 50%DMSO solution, and dilution makes the final concentration of probe reach 1 μ g/ μ l.
2. splice: will dissolve the corresponding position that good probe adds 384 orifice plates, every hole 10 μ l.
3. point sample: with aldehyde radical slide (the CEL Associates of the cleaning of 57.5mm * 25.5mm as shown in Figure 1 * 1mm (length * wide * height); Inc.) be put on the Stage microscope of chip point sample instrument (Spotarray72); Use the control software (Tele chem SMP3 stealth pin) of SpotArray; Working procedure; In the point sample district by arrangement mode point 4.5mm * 4.5mm on the slide of aldehyde radicalization shown in Figure 2, low density DNA micromatrix in the formation, the array arrangement rule is identical in six dot matrix areas on the slide.Dot spacing 250 μ m in the dot matrix area domain sizes 3mm * 2.25mm, this dot matrix, matrix: 12 * 9,12 * 250 μ m=3mm, 9 * 250 μ m=2.25mm, standard film base size: 75.5mm * 25.5mm * 1mm.
4. dry: dried overnight under the chip room temperature that will put, then 45 ℃ of oven dryings 2 hours.
5. crosslinked: with crosslinked 2 times of crosslinked appearance (uvpcl-2000M ultraciolet Crosslinker) 600J.Crosslinked good chip is put back in the clean chip cartridges, subsequent use.
Visible by Fig. 2, in each point sample district the individual probe points in 12 (OK) * 8 (row).The position of NO.1 frame district signal be bacterial detection 16S gene over against according to probe; The position of NO.2 frame district signal is a fluorescent probe; The position of NO.3 frame district signal be bacterial detection ITS gene over against according to probe, other be the specific probe (numbering corresponding to the correspondent probe in the table 1) of each pathogenic bacterium.
Embodiment 4 utilizes common pathogen in the gene chip rapid detection lower respiratory tract sample
1. sample preparation: sputum sample is gathered by hospital, and sample is connected in the 225ml 2YT substratum for preparing in advance, and 37 ℃, the 200rpm overnight shaking is cultivated.
2. extraction genome: the pathogenic bacterium thalline that centrifugal 5 minutes depositions of the sample 8000rpm of 1ml incubated overnight possibly exist, abandon supernatant (empty as far as possible doing).It is resuspended in deposition, to add the 100ul deionized water, and 8000rpm centrifugal 5 minutes, removes supernatant.The lysate (prescription is as follows) that adds 100ul, 100 ℃ of boiling water baths 15 minutes, centrifugal 3 minutes of 12000rpm, supernatant is the dna profiling of slightly carrying.
Attach: the lysate prescription:
1 * PCR damping fluid (contains Mg
+)
0.5% NP 40
0.5% Tween 20
3. amplified target sequence: get the 3ul middle layer supernatant that said gene group process for extracting extracts and add in the PCR reaction mixture as template, PCR reaction mixture prescription is as shown in table 3 below.(annotate: the PCR damping fluid in the following table 3-table 4, MgCl
2, the dNTP mixture, the Taq enzyme is all available from Sangon company)
Table 3 Multiplex PCR reaction mixture prescription
Annotate: P-1 to P-2 and P-3 and P-4 are primer listed in the table 2 in the table.
Reaction tubes is put into PCR appearance (Biometra), and the loop parameter of setting is following:
94 ℃ 5 minutes
94 ℃ 30 seconds
52 ℃ 45 seconds
Got back to second step, totally 35 circulations in 1 minute for 72 ℃
72 ℃ 5 minutes
4 ℃ 20 minutes
3. purifying: with purification column (MILIPORE company) purifying, concrete steps are following with the pcr amplification product of above-mentioned acquisition:
(1) the PCR product is transferred in the purification column, adds water and complement to 400 μ l.
Centrifugal 15 minutes of (2) 25 ℃, 6000rpm abandon collection tube.
(3) purification column is transferred in the centrifuge tube of new 1.5ml, added the ultrapure water (MilliQ) of 25 μ l, placed 5 minutes for 37 ℃.
(4) the purification column inversion is placed on the centrifuge tube of 1.5ml, centrifugal 2 minutes of 6000rpm collects product.
4. labels targets sequence: get 12 μ l purified products, add in the mark mixed solution, the labeled reactant mixture formula is as shown in table 4 below.
Table 4 mark mixture formula
Annotate: P-2 and P-4 are primer listed in the table 2 in the table.
Reaction tubes is put into PCR appearance (Biometra), and the loop parameter of setting is following:
94 ℃ 5 minutes
94 ℃ 30 seconds
52 ℃ 45 seconds
Got back to second step, totally 35 circulations in 1 minute for 72 ℃
72 ℃ 5 minutes
4 ℃ 20 minutes
5. oven dry: marked product is put 65 ℃ of oven for drying.
6. hybridization: in hybridizing box (Bo Ao company), add 70 μ l ddH in advance
2O is to keep humidity.12 μ l hybridization solutions (it is as follows to fill a prescription) go back to the probe array zone that the lower respiratory tract common pathogen that dissolves the oven dry product and be added in preparation among the embodiment three detects gene chip; Cover the cover plate (Bo Ao company) (noting between cover plate and the slide glass bubble being arranged) of customization; Cover tight hybridizing box, hybridization is 16 hours in 40 ℃ of water-baths.
7. washing: when hybridizing to, take out hybridizing box, remove cover plate, gene chip was washed 3 minutes in washing lotion A successively, washing is 3 minutes among the washing lotion B, and washing is 90 seconds among the washing lotion C, and is air-dry in the air.
Hybridization solution prescription: 10% T 500 (dextran Sulfate); 25% methane amide (formamide); 0.1%SDS (sodium lauryl sulphate); 6 * SSPE
Washing lotion A:1 * SSC (sodium-chlor-sodium citrate soln); 0.1%SDS
Washing lotion B:0.05 * SSC
Washing lotion C:95% ethanol
8. scanning: with GenePix personal 4100A biochip scanner (AXONinstrument) scanning, used parameter is following:
Software and version: GenePix Pro 6.0
official name：575DF35
PMT Gain：550
Scanning resolution: 10 μ m
Scanning result saves as JPG, TIF, GPR form
Hybridization scanning result when detecting pathogens of lower respiratory tract (streptococcus aureus, Klebsiella pneumonia, Acinetobacter bauamnnii, Pseudomonas aeruginosa, hemophilus influenzae, streptococcus pneumoniae, legionella pneumophilia and moraxelle catarrhalis) with gene chip of the present invention is shown in Fig. 3 A-3J.
9. analysis interpretation: according to the hybridization image that scans, with over against according to the position of probe as image coordinate, judge the position of the specific probe that fluorescent signal occurs, contrast dot matrix layout viewing is judged pathogenic bacterium.If only, then do not have this eight kinds of pathogenic bacterium over against signal being arranged according to probe.
5 pairs of gene chips of embodiment carry out the specificity evaluation and sensitivity detects
The lower respiratory tract common pathogen for preparing among the embodiment 3 being detected the specificity of gene chip identifies as follows:
Amount to the type strains of 141 strain pathogenic bacterium with detect strain and their nearly edge bacterial strain and identify the specificity of common pathogen detection gene chip in the lower respiratory tract of preparation among the embodiment three.In this specificity test, all bacterial strain situation of use are seen table 5.Utilize gene chip of the present invention and above-mentioned detection method to hybridize detection, all shown correct results of hybridization, this explains that gene chip of the present invention has good specificity.
Table 5: the bacterial strain that the specificity test is used
A, institute of microbiology of the Chinese Academy of Sciences (As).
B, Chinese medicine microbial strains preservation center (CMCC).
C, Australian medical science and veterinary science institute (IMVS).
D, Institute of Epidemiology and Microbiology (IEM), Chinese preventive medicine research association.
E, DSMZ (NCTC) of Britain country.
F, German mikrobe and cell preservation center (DSMZ).
G, Gothenburg, Sweden university culture collection center (CCUG).
H, Chinese agriculture microbial strains preservation center (ACCC).
I, Chinese common micro-organisms DSMZ (CGMCC).
J, Czech microbial preservation center (CCM)
K, U.S. typical case DSMZ (ATCC).
L, medical microbial institute of Cologne, Germany university (IMIH).
M, New South Wales,Australia disease infection and mikrobe center (CIDM).
N, Belgian bacterial classification center (LMG).
O, the national preservation center (CVCC) of Chinese veterinary science bacterial classification.
P, Chinese military science medical college (AMMS).
Q comes from the clinical strains of Shenzhen CDC.
R comes from the clinical strains of Tianjin University Of Traditional Chinese Medicine.
S comes from the clinical strains of the People's Hospital, Tianjin.
T comes from the clinical strains of Tianjin one central hospital.
U comes from the clinical strains of Tianjin three central hospitals.
V comes from the clinical strains of Tianjin Children's Hospital.
W comes from the clinical strains of Tianjin hospital of Nankai.
X is from the strain that detects of Tianjin Entry-Exit Inspection and Quarantine Bureau.
The sensitivity that common pathogen in the lower respiratory tract of preparation among the embodiment 3 is detected gene chip detects as follows:
The detection sensitivity of this gene chip is through the checking of 107 hybrid experiments; 0.1ng micro-genomic dna or every 25g (ml) sputum in have (1-5) cfu just can guarantee that above-mentioned 8 kinds of pathogenic bacterium have stable, good results of hybridization, this explains that gene chip of the present invention has very high detection sensitivity.
Description according to technical scheme of the present invention and preferred embodiment thereof; Any those skilled in the art; Do not breaking away from the spirit and scope of the present invention; Can make various possible being equal to and change or replacement, and all these changes or replacement all should belong to the protection domain of claim of the present invention.
Sequence table
< 110>Tianjin Biochip Technology Co., Ltd
< 120>a kind of gene chip and test kit that detects pathogens of lower respiratory tract
<130>8P13003-CN
<160>34
<170>Patent Inversion3.2
<210>1
<211>25
<212>DNA
< 213>based on bacterial 16 S rDNA conserved regions design and synthetic over against according to probe sequence
<400>1
<210>2
<211>52
<212>DNA
< 213>negative contrast
<400>2
<210>3
<211>29
<212>DNA
< 213>design the also probe sequence of synthetic based on district between the 16S-23S rDNA of streptococcus aureus
<400>3
<210>4
<211>28
<212>DNA
< 213>design the also probe sequence of synthetic based on district between the 16S-23S rDNA of streptococcus aureus
<400>4
<210>5
<211>30
<212>DNA
< 213>design the also probe sequence of synthetic based on district between the 16S-23S rDNA of streptococcus aureus
<400>5
<210>6
<211>25
<212>DNA
< 213>design the also probe sequence of synthetic based on district between the 16S-23S rDNA of Klebsiella pneumonia
<400>6
<210>7
<211>23
<212>DNA
< 213>design the also probe sequence of synthetic based on district between the 16S-23S rDNA of Klebsiella pneumonia
<400>7
<210>8
<211>31
<212>DNA
< 213>design the also probe sequence of synthetic based on district between the 16S-23S rDNA of Acinetobacter bauamnnii
<400>8
<210>9
<211>32
<212>DNA
< 213>design the also probe sequence of synthetic based on district between the 16S-23S rDNA of Acinetobacter bauamnnii
<400>9
<210>10
<211>24
<212>DNA
< 213>based on the 16S DNA design of Pseudomonas aeruginosa and the probe sequence of synthetic
<400>10
<210>11
<211>25
<212>DNA
< 213>based on the 16S DNA design of Pseudomonas aeruginosa and the probe sequence of synthetic
<400>11
<210>12
<211>23
<212>DNA
< 213>based on the 16S DNA design of Pseudomonas aeruginosa and the probe sequence of synthetic
<400>12
<210>13
<211>21
<212>DNA
< 213>based on the 16S DNA design of Pseudomonas aeruginosa and the probe sequence of synthetic
<400>13
<210>14
<211>28
<212>DNA
< 213>based on the 16S DNA design of hemophilus influenzae and the probe sequence of synthetic
<400>14
<210>15
<211>27
<212>DNA
< 213>based on the 16S DNA design of hemophilus influenzae and the probe sequence of synthetic
<400>15
<210>16
<211>26
<212>DNA
< 213>based on the 16S DNA design of hemophilus influenzae and the probe sequence of synthetic
<400>16
<210>17
<211>27
<212>DNA
< 213>based on the gyrB gene design of streptococcus pneumoniae and the probe sequence of synthetic
<400>17
<210>18
<211>26
<212>DNA
< 213>based on the gyrB gene design of streptococcus pneumoniae and the probe sequence of synthetic
<400>18
<210>19
<211>26
<212>DNA
< 213>based on the gyrB gene design of streptococcus pneumoniae and the probe sequence of synthetic
<400>19
<210>20
<211>31
<212>DNA
< 213>based on the gyrB gene design of streptococcus pneumoniae and the probe sequence of synthetic
<400>20
<210>21
<211>29
<212>DNA
< 213>based on the copB gene design of moraxelle catarrhalis and the probe sequence of synthetic
<400>21
<210>22
<211>27
<212>DNA
< 213>based on the copB gene design of moraxelle catarrhalis and the probe sequence of synthetic
<400>22
<210>23
<211>27
<212>DNA
< 213>based on the copB gene design of moraxelle catarrhalis and the probe sequence of synthetic
<400>23
<210>24
<211>29
<212>DNA
< 213>based on the copB gene design of moraxelle catarrhalis and the probe sequence of synthetic
<400>24
<210>25
<211>26
<212>DNA
< 213>based on the gyrB gene design of legionella pneumophilia and the probe sequence of synthetic
<400>25
<210>26
<211>26
<212>DNA
< 213>based on the gyrB gene design of legionella pneumophilia and the probe sequence of synthetic
<400>26
<210>27
<211>29
<212>DNA
< 213>based on the gyrB gene design of legionella pneumophilia and the probe sequence of synthetic
<400>27
<210>28
<211>26
<212>DNA
< 213>based on the gyrB gene design of legionella pneumophilia and the probe sequence of synthetic
<400>28
<210>29
<211>17
<212>DNA
< 213>use upper reaches primer sequence based on the general detection of district's design and synthetic between streptococcus aureus, Klebsiella pneumonia, Acinetobacter bauamnnii, Pseudomonas aeruginosa, hemophilus influenzae, streptococcus pneumoniae, moraxelle catarrhalis and legionella pneumophilia 16S-23S rDNA
<400>29
<210>30
<211>21
<212>DNA
< 213>use the downstream primer sequence based on the general detection of streptococcus aureus, Klebsiella pneumonia, Acinetobacter bauamnnii, Pseudomonas aeruginosa, hemophilus influenzae, streptococcus pneumoniae, moraxelle catarrhalis and legionella pneumophilia 16S rDNA design and synthetic
<400>30
<210>31
<211>20
<212>DNA
< 213>use upper reaches primer sequence based on the general detection of streptococcus aureus, Klebsiella pneumonia, Acinetobacter bauamnnii, Pseudomonas aeruginosa, hemophilus influenzae, streptococcus pneumoniae moraxelle catarrhalis and legionella pneumophilia 16S rDNA design and synthetic
<400>31
<210>32
<211>20
<212>DNA
< 213>use upper reaches primer sequence based on the general detection of district's design and synthetic between streptococcus aureus, Klebsiella pneumonia, Acinetobacter bauamnnii, Pseudomonas aeruginosa, hemophilus influenzae, streptococcus pneumoniae, moraxelle catarrhalis and legionella pneumophilia 16S-23S rDNA
<400>32
<210>33
<211>20
<212>DNA
< 213>use upper reaches primer sequence based on the detection of streptococcus pneumoniae and legionella pneumophilia gyrB gene design and synthetic
<400>33
<210>34
<211>20
<212>DNA
< 213>use the downstream primer sequence based on the detection of streptococcus pneumoniae and legionella pneumophilia gyrB gene design and synthetic
<400>34
<210>35
<211>19
<212>DNA
< 213>do not draw the detection of copB gene design and synthetic to use upper reaches primer sequence based on catarrh
<400>35
<210>36
<211>20
<212>DNA
< 213>do not draw the detection of copB gene design and synthetic to use the downstream primer sequence based on catarrh
<400>36
Claims (6)
1. gene chip that detects pathogenic bacterium in the lower respiratory tract; Comprise solid phase carrier and be fixed on the oligonucleotide probe on this solid phase carrier, the oligonucleotide probe that it is characterized in that being fixed on the solid phase carrier is the dna sequence dna shown in the SEQ ID NO:1-SEQ ID NO:28.
2. the gene chip of pathogenic bacterium in the detection lower respiratory tract according to claim 1; It is characterized in that the sequence of choosing the dna sequence dna of said SEQ ID NO:3-SEQ ID NO:28 for the gyrB gene of 16S gene, streptococcus pneumoniae or the legionella pneumophilia of district, Pseudomonas aeruginosa or hemophilus influenzae between the 16S-23S rDNA of streptococcus aureus, Klebsiella pneumonia or Acinetobacter bauamnnii, copB gene that catarrh does not draw.
3. the gene chip of pathogenic bacterium is characterized in that in the detection lower respiratory tract according to claim 1, and SEQ ID NO:1 and SEQ ID NO:2 are respectively positive control probe and negative control probe.
4. a test kit that detects pathogens of lower respiratory tract is characterized in that comprising the described gene chip of claim 1.
5. test kit according to claim 4 is characterized in that also comprising the detection primer, and this detection primer is the dna sequence dna shown in the SEQ ID NO:29-SEQ ID NO:36.
6. test kit according to claim 4 is characterized in that also comprising hybridizing box, hybridization solution.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2008101825650A CN101748193B (en) | 2008-12-05 | 2008-12-05 | Gene chip for detecting pathogens of lower respiratory tract and reagent kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2008101825650A CN101748193B (en) | 2008-12-05 | 2008-12-05 | Gene chip for detecting pathogens of lower respiratory tract and reagent kit |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101748193A CN101748193A (en) | 2010-06-23 |
| CN101748193B true CN101748193B (en) | 2012-01-11 |
Family
ID=42475805
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2008101825650A Active CN101748193B (en) | 2008-12-05 | 2008-12-05 | Gene chip for detecting pathogens of lower respiratory tract and reagent kit |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101748193B (en) |
Families Citing this family (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102409103B (en) * | 2011-12-07 | 2013-03-13 | 江苏大学 | Multiple landing PCR(Polymerase Chain Reaction) detection kit and detection method for pathogenic bacteria of lower respiratory tract |
| CN102653793A (en) * | 2012-05-14 | 2012-09-05 | 江苏大学 | Multiple touchdown PCR (polymerase chain reaction) detection kit of acinetobacter baumannii |
| CN103255216B (en) * | 2013-04-24 | 2014-11-26 | 山东艾克韦生物技术有限公司 | Nosocomial infection multiple causative agent parallel detection gene chip and preparation method and application thereof |
| CN107119140A (en) * | 2017-06-16 | 2017-09-01 | 北京百康芯生物科技有限公司 | Respiratory tract micro-fluidic chip Fast Detection Technique and kit |
| CN107287311B (en) * | 2017-07-06 | 2020-07-28 | 中国人民解放军总医院 | Quick identification gene chip for pneumonia pathogenic bacteria |
| CN107338315B (en) * | 2017-08-15 | 2020-07-28 | 中国人民解放军总医院 | Kit for rapidly detecting 15 pneumonia pathogenic bacteria |
| CN107513582A (en) * | 2017-10-23 | 2017-12-26 | 蔡慧娜 | Authentication chip, kit and the authentication method of positive blood culture |
| CN110423835B (en) * | 2019-09-05 | 2022-09-20 | 复旦大学附属中山医院 | Primer composition for detecting pathogenic microorganisms of lower respiratory tract |
| CN111876507A (en) * | 2020-08-24 | 2020-11-03 | 上海市东方医院（同济大学附属东方医院） | Kit for rapidly detecting acinetobacter baumannii and use method thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1397649A (en) * | 2002-08-19 | 2003-02-19 | 上海华冠生物芯片有限公司 | Biochip base on 16S rDNA gene for diagnosing frequently encountered pathogenic bacteria |
| CN101240335A (en) * | 2007-02-09 | 2008-08-13 | 天津生物芯片技术有限责任公司 | Gene chip and kit for detecting common pathogen in dairy products |
-
2008
- 2008-12-05 CN CN2008101825650A patent/CN101748193B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1397649A (en) * | 2002-08-19 | 2003-02-19 | 上海华冠生物芯片有限公司 | Biochip base on 16S rDNA gene for diagnosing frequently encountered pathogenic bacteria |
| CN101240335A (en) * | 2007-02-09 | 2008-08-13 | 天津生物芯片技术有限责任公司 | Gene chip and kit for detecting common pathogen in dairy products |
Non-Patent Citations (1)
| Title |
|---|
| 杨文鸽等.水产品中致病微生物的快速检测方法.《中国食品学报》.2006,第6卷(第1期),402-406. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101748193A (en) | 2010-06-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101748193B (en) | Gene chip for detecting pathogens of lower respiratory tract and reagent kit | |
| CN101240335B (en) | Gene chip and kit for detecting common pathogen in dairy products | |
| CN101541979B (en) | A novel method for simultaneous detection and discrimination of bacterial, fungal, parasitic and viral infections of eye and central nervous system | |
| CN101724686B (en) | Gene chip and test kit for detecting important pathogenic bacteria in aquatic products | |
| CN101748192B (en) | Gene chip of main pathogenic microorganism in drinking water and testing kit | |
| JPH06502312A (en) | Oligonucleotides complementary to mycobacterial nucleic acids | |
| Volokhov et al. | Sequencing of the intergenic 16S-23S rRNA spacer (ITS) region of Mollicutes species and their identification using microarray-based assay and DNA sequencing | |
| CN101967510B (en) | Gene chip and kit for detecting common pathogenic bacteria in food | |
| CN103820558B (en) | Gene chip for detecting nine pathogenicity vibrios in marine products | |
| CN102140507B (en) | Detection genetic chip and detection kit for infectious diarrhea | |
| CN102311993A (en) | Gene chip for detecting important pathogenic bacteria in aquatic product and kit thereof | |
| CN101760514B (en) | Gene chip and kit for detecting diarrheagenic escherichia coli in food and clinical samples | |
| CN101118234B (en) | Method for detecting bacillus coli inducing diarrhoea and hydropsy during pig weaning period and reagent kit thereof | |
| CN102424862B (en) | Genotyping chip for legionella pneumophila, and kit for detection of legionella pneumophila | |
| CN103160587B (en) | Genetic typing chip of 10 common pathogenic legionella and detection kit | |
| WO2005113836A2 (en) | High through-put detection of pathogenic yeasts in the genus trichosporon | |
| CN100404691C (en) | Method of detecting bioterror related pathogen bacteria and its special DNA chip | |
| CN1328391C (en) | Gene chip for detecting B group of streptococcus, detection method and kit for detection | |
| CN101967508A (en) | Gene chip for detecting important drug resistant gene of pseudomonas aeruginosa and kit thereof | |
| Chung et al. | A DNA microarray for identification of selected Korean birds based on mitochondrial cytochrome c oxidase I gene sequences | |
| CN105624286A (en) | Legionella pneumophila fluorescence PCR detection kit | |
| CN109680082A (en) | A kind of lactobacillus specific data library and its application | |
| CN101967509A (en) | Method, gene chip and detection reagent kit for detecting common cow pathogenic escherichia coli | |
| CN101633954B (en) | Community chip for analyzing community structure and dynamic variation of activated sludge microbe | |
| CN102888467A (en) | Gene chip for detecting porcine respiratory disease complex virus and method for detecting porcine respiratory disease complex virus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |