CN102424862B - Genotyping chip for legionella pneumophila, and kit for detection of legionella pneumophila - Google Patents
Genotyping chip for legionella pneumophila, and kit for detection of legionella pneumophila Download PDFInfo
- Publication number
- CN102424862B CN102424862B CN 201210003928 CN201210003928A CN102424862B CN 102424862 B CN102424862 B CN 102424862B CN 201210003928 CN201210003928 CN 201210003928 CN 201210003928 A CN201210003928 A CN 201210003928A CN 102424862 B CN102424862 B CN 102424862B
- Authority
- CN
- China
- Prior art keywords
- gene
- legionella pneumophilia
- detection
- legionella
- chip
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention provides a genotyping chip for legionella pneumophila, and a kit for detection of the legionella pneumophila. The chip and the kit are mainly provided according to the 11 serotypes of the legionella pneumophila, wherein the 11 serotypes comprise O1, O2, O3, O4, O5, O6, O7, O11, O12, O13 and O15. The gene chip comprises a solid phase carrier and oligonucleotide probes fixed on the solid phase carrier, wherein the oligonucleotide probes comprise DNA fragments selected from wzm gene, wzt gene and wecA gene, or complementary DNA fragments of the wzm gene, the wzt gene and the wecA gene, wherein the wzm gene, the wzt gene and the wecA gene have significant biological evolution advantages. According to the present invention, the genomic DNA of the sample requiring detection is amplified by the designed primers; the resulting amplified genomic DNA is labeled; the resulting labeled genomic DNA is subjected to hybridization with the gene chip; according to the resulting hybridization signals, the different serotypes of the legionella pneumophila can be detected. With the gene chip of the present invention, the purpose of the detection of the serotypes of the legionella pneumophila can be achieved, the operation is convenient, the accuracy is high, the repeatability is strong, and the accurate medical medication guidance is provided.
Description
Technical field
The present invention relates to a kind of gene chip and comprise the detection test kit of this chip, especially relate to water body important pathogenic bacteria legionella pneumophilia O1, O2, O3, O4, O5, O6, O7, O11, O12, O13 and O15 gene chip and the detection test kit of totally 11 kinds of serotypes.
Background technology
Water is the prerequisite that life is existed, and it is multiplied and lived we mankind, and the mankind's life, production, amusement all be unable to do without water.Its is simultaneously also place and the carrier that many pathogenic micro-organisms grow, propagate, may make in case these pathogenic micro-organisms enter human body the people ill, even cause death, human health in serious threat.Along with development and the growth in the living standard of society, people more and more are concerned about the health problem of self, and the safety problem of various water body (comprising Drinking Water, rivers and lakes, swimming place and hall etc.) also becomes the focus that people pay close attention to day by day.Therefore, in order to protect the healthy of people, very necessary and need badly to the detection of pathogenic micro-organism in various water bodys especially tap water.
Legionella (
Legionella) be a kind of gram negative bacillus, extensively be present in the water body, soil of nature and artificial environment, can be sucked by human body by contain that the aerocolloidal mode of bacterium is sent out in air and cause the human infection, cause febris acuta pulmonary disorder---legionnaires disease.First since the U.S. finds legionnaires disease, this disease presented worldwide distribution and two high large characteristics of case fatality rate from 1976.The growth and breeding of legionella and environment are because of closely related, and cooling tower water coolant, water of condensation and the thermal water of central air conditioning is the legionella living environment suitable in the external world.Legionella in ambient water is bred finite concentration, can form aerosol and then infect the people.Host infection mainly is subjected to the impact of its susceptibility and bacterial virulence, any age all can occur, but person in middle and old age, fundamental immunity chump, long distance travelers, smoker are the high risk population, and easily dye legionella with public places such as hospital, hotel, heavy construction building sites.
At present, legionella (
Legionellace) found that more than 50 is planted, more than 70 serotype, and constantly have new bacterial classification to be found.Wherein with mankind's relation the closest legionella pneumophilia (
Legionella pneumophila), separate from environment the earliest, be the representative species of legionella.According to the difference of O-antigen, legionella pneumophilia can be divided into 15 O serotypes.Wherein nearly 70% infection of legionella is caused by legionella pneumophilia O1 type, 20-30% is caused by other serotype, non-legionella pneumophilia causes the approximately just infection of legionella of 5-10%, from then on can learn, legionella pneumophilia O1 type occupies sizable ratio in the microbial case of legion, be the main pathotype of legionella, occupy an important position in the research of legionella.
In addition, the legionella kind is various, conventional microbial culture and serological diagnosis somatotype, and length consuming time, workload is large, and flux is low, can not satisfy epidemiology survey and reach the event real-time analysis needs that cause a disease that happen suddenly.Immunoserology method is the modern detecting of utilizing the specificity of the uniqueness of bacterial antigens and antigen-antibody combination to set up, has the characteristics such as high specificity.Many clinical diseases have brought into use this method to carry out pathogen detection, as utilize HBsAg to detect HBV virus.Yet, because this method need to be through the analysis of microbial culture, amplification and single bacterium colony of at least 48 hours, and need to carry out the antiserum(antisera) aggregation to a large amount of single bacterium colony of each sample, length consuming time and false negative may occur.In addition, do not have in the world a company or unit can produce the antiserum(antisera) of whole bacteriums, even the most frequently used colibacillary antiserum(antisera) also only has a few company and unit that the antiserum(antisera) of whole serotypes and expensive is arranged.
1993, Luk, J.M.C
Et.alChoose Salmonellas (
S.enterica) specific nucleotide sequence of O-antigen gene cluster, identified O-antigen [Luk, the J.M.C. of Salmonellas by PCR method
Et.al(1993) " Selective amplification of abequose and paratose synthase genes (
rfb) by polymerase chain reaction for identification of
S. entericaMajor serogroups (A, B,; J. Clin. Microbiol. 31:2118-2123]; opened from the O antigen gene cluster beginning of screening special molecular sign, C2 and D) " for the various O-Detection of antigen of bacterium provides that high-throughput, detection speed are fast, high specificity, highly sensitive molecular detecting method.Bacterium O antigen type is various, and general different bacterium has different O-antigen, and the bacterium in same kind also has different O-antigen mostly.Studies show that, the diversity of bacterium O-antigen is to be caused by the Polymorphism of being responsible for its synthetic gene cluster, some specific genes in the O-antigen gene cluster have high specificity for the surface antigen of its coding, thus for inspiring, can screen the special molecular sign from the O antigen gene cluster, be used for Molecular Subtyping of Legionella.
At present, patent or the patent application of application legionella context of detection mainly contain:
(1) the common pathotype legionella of amplification
gyrB gene specific district's primer and application thereof (publication No.: CN102168131), this patent application provide a kind of legionella micdadei that increases respectively (
Legionella micdadei); The Bo Ziman legionella (
Legionella bozemanii); Legionella longbeachae (
Legionella longbeachae) in
GyrBGene (DNA gyrase B subunit gene, hereinafter to be referred as
GyrB) primer in special district, a kind of amplification legionella micdadei, Bo Ziman legionella, Legionella longbeachae of comprising also is provided
GyrBThe PCR test kit of the primer in gene specific district, utilize this PCR test kit that legionella micdadei, Bo Ziman legionella, Legionella longbeachae are detected, easy fast, specificity is good, highly sensitive, can be used for the fields such as detection of pathogens in the supervision of water body and clinical sample and detection, tap water, bacteriology classification and epidemiology survey, have far-reaching social benefit and larger economic benefit.
(2) a kind of DNA microarray that detects common pathogen in water (publication No.: CN1396270A, open day: on February 12nd, 2003), this Patent Application Publication a kind of DNA microarray detect the technology of common pathogen in water.This technology is utilized 16S rRNA gene test and is identified common pathogen in water, and two primers design respectively the conserved regions at 16S rRNA gene, and probe is in the variable region of 16S rRNA gene.This DNA microarray technology can detect Escherichia, Shigella, salmonella, Staphylococcus, proteus, anaerobism Clostridium, streptococcus, Legionnella, mycobacterium tuberculosis, Yersinia, listeria spp, Pseudomonas aeruginosa, campylobacter jejuni, can be used for supervision and detection and the epidemiology survey of clinical disease diagnosis, ArsenazoⅢ.This technology is due to the high conservative of 16S rRNA, and resolving power is lower, can't distinguish kind, also can't distinguish intestinal bacteria and Shigellae.
(3) a kind of primer and application (publication No.: CN101967474) thereof of the legionella pneumophilia gyrB gene specific district that increases, this Patent Application Publication gyrB gene (DNA gyrase B subunit gene in a kind of amplification legionella pneumophilia, hereinafter to be referred as gyrB) primer in special district, a kind of PCR test kit that comprises the primer in amplification legionella pneumophilia gyrB gene specific district also is provided, utilize this PCR test kit that legionella pneumophilia is detected, easy to be quick, specificity is good, highly sensitive, can be used for supervision and the detection of water body and clinical sample, detection of pathogens in tap water, the fields such as bacteriology classification and epidemiology survey, have far-reaching social benefit and larger economic benefit.(4) legionella pneumophilia
mipGene clone, restructuring, expression and method for purifying proteins (publication No.: CN1664105), this Patent Application Publication a kind of legionella pneumophilia
Legionella pneumophilaMacrophage infectivity potentiator (
mip) gene cloning, restructuring, expression, purification process and primer special, and MIP albumen and analogue thereof, derivative are in infection of legionella patient's clinical diagnosis and the application aspect treatment.Present method obtains the legionella pneumophilia genes group DNA that obtains with PCR method
mipGene, and with this gene recombination rear clone in coli expression carrier, extract MIP albumen after abduction delivering, and then use the affinity chromatography method and obtain highly purified albumen, for clinical further diagnosis Legionella pneumophila infection is applied to detect legionella pneumonia Ag and antibody.
Summary of the invention
An object of the present invention is to provide a kind of gene typing chips for detection of legionella pneumophilia and detect and use test kit, time-consuming, the consumption power that exist to make up traditional drinking-water quality detection technique, the defective that resolving power is poor, expansion the pathogenic microorganism examination scope, improve detection sensitivity and specificity, reduce labour intensity, shorten sense cycle.
The invention discloses for achieving the above object following technology contents:
A kind of detection legionella pneumophilia (
Legionella Pneumophila) gene chip, comprise solid phase carrier and be fixed on oligonucleotide probe on this solid phase carrier, it is characterized in that this oligonucleotide probe comprises at least a in following DNA fragmentation:
(1) legionella pneumophilia O4, O12, O13, O15
wzmSelected at least a DNA fragmentation in gene;
(2) legionella pneumophilia O1, O2, O3, O5, O6, O7
wztSelected at least a DNA fragmentation in gene;
(3) legionella pneumophilia O11
wecSelected at least a DNA fragmentation in the A gene;
The complementary DNA fragment of the DNA fragmentation of (4) choosing in (1) or (2) or (3).
Solid phase carrier of the present invention is the sheet glass with active group.
Described oligonucleotide probe preferably has the nucleotide sequence shown in SEQ ID NO:1-23, or is different from SEQ ID NO:1-23 but the coded identical nucleotide sequence of aminoacid sequence of aminoacid sequence and the SEQ ID NO:1-23 of coding; Gene chip of the present invention also comprises positive control probe and negative contrast probe.
Above-mentioned preferred sequence and function are as follows:
SEQ ID (5'-3')
NO:1 CAGTCATGGATATCACTCGCGACTATCTC is for detection of legionella pneumophilia O1
NO:2 GCGAAATATAAATCGGAACAGGTTTGG is for detection of legionella pneumophilia O1
NO:3 CAACTCCGGATTGGTAAATAAAATTTATTTT is for detection of legionella pneumophilia O4
NO:4 CGGTTTAATTATAATTTGCGCCACCATTTATG is for detection of legionella pneumophilia O4
NO:5 GTTAGCAGTTGGAGATCAGGATTTTCA is for detection of legionella pneumophilia O2
NO:6 GCCATGATATGAGTGCTATTGAATCGATTTG is for detection of legionella pneumophilia O2 and O3
NO:7 TATTAGCAGTAGGAGATCAAGATTTTCAAA is for detection of legionella pneumophilia O3
NO:8 AGGAAAGAGTACTTTACTGAAAATTTTATCCA is for detection of legionella pneumophilia O5
NO:9 AGCCAAGGTGGTTGTTTCAGATTCGCAAACT is for detection of legionella pneumophilia O5
NO:10 CCAAATATCACCTGGCGAACGCATAGGTTTAA is for detection of legionella pneumophilia O5
NO:11 ATCCAGAATAACTACTCCGACTTATGGTGAA is for detection of legionella pneumophilia O5
NO:12 TAGATTCAATTGCAAGATCTCATGCCC is for detection of legionella pneumophilia O6
NO:13 ACAAGGTTCTTATTCATTCTCTTAAGCTTT is for detection of legionella pneumophilia O6
NO:14 CTGTGTAGAGCTTAATTGTGTGAGATTATTGG is for detection of legionella pneumophilia O7
NO:15 TATTATTTATTTTCTTACACCGCATTATTGG is for detection of legionella pneumophilia O11
NO:16 TCATCTCATATTGATTCAGTTAATTAGTTT is for detection of legionella pneumophilia O11
NO:17 CATATTGATTCAGTTAATTAGTTTATTATTCAT is for detection of legionella pneumophilia O11
NO:18 GATTATAAATCACGAAAAATGGTTTAGCCCT is for detection of legionella pneumophilia O11
NO:19 CAGTTATAGAGATGCACTAAATGGTCGAT is for detection of legionella pneumophilia O12 and O15
NO:20 TTCACCTCATTGGTTAAGATTCTGGTATG is for detection of legionella pneumophilia O12 and O15
NO:21 TGCCACAGTTTATGATAAACTTAATTATCA is for detection of legionella pneumophilia O13
NO:22 CCTACTATTTGTTATTCAAGCAATGTTT is for detection of legionella pneumophilia O13
NO:23 TTTGTACCACTGGCATTACAATTTTATTAT is for detection of legionella pneumophilia O13
NO:33：OA532
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTACTCCTACGGGAGGCAGC is the positive control probe
WL-4006: TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT is negative contrast probe
Cy3: TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT-Cy-3 is fluorescent probe
Gene chip of the present invention can be used for the detection of at least a pathogenic bacterium in 11 kinds of serotypes such as legionella pneumophilia O1, O2, O3, O4, O5, O6, O7, O11, O12, O13 and O15.
The preparation method of gene chip of the present invention mainly comprises step:
1) legionella pneumophilia according to claim 1
wzmGene,
wztGene reaches
wecA gene conserved regions design is also prepared primer for pcr amplification;
2) genomic dna of preparation testing sample, use the primer in step 1), treats survey sample gene group DNA and carry out pcr amplification, obtains target sequence;
3) markers step 2) in the target sequence that obtains;
4) with the target sequence after mark and gene chip hybridization claimed in claim 1;
5) obtain hybridization signal and analyze results of hybridization with biochip scanner.
Wherein, the primer described in step 1) comprises at least a of the nucleotide sequence shown in SEQ ID NO:24-32, the oligonucleotide sequence of each primer probe by 5 ' end to 3 ' end form and corresponding amplification effect is:
P1 (SEQ ID NO:24) TGCAGCAAGCAAAAGTTCAG is used for amplification legionella pneumophilia O1 serotype
wztThe upstream primer of gene;
P2 (SEQ ID NO:25) CAACTCCGGATTGGTAAA is used for amplification legionella pneumophilia O4 serotype
wzmThe upstream primer of gene;
P3 (SEQ ID NO:26) TTCAGAAATCCTCTGGAAG is used for amplification legionella pneumophilia O2 and O3 serotype
wztThe upstream primer of gene;
P4 (SEQ ID NO:27) ATAATAAAGCAAGCCTTGAT is used for amplification legionella pneumophilia O5 serotype
wztThe upstream primer of gene;
P5 (SEQ ID NO:28) TAAAGATATTGTAGAGAGCCAGC is used for amplification legionella pneumophilia O6 serotype
wztThe upstream primer of gene;
P6 (SEQ ID NO:29) TTAAGTGCGGACTACCCA is used for amplification legionella pneumophilia O7 serotype
wztThe upstream primer of gene;
P7 (SEQ ID NO:30) TTGAATTCATTATTTCTTTTCG is used for amplification legionella pneumophilia O11 serotype
wecThe upstream primer of A gene;
P8 (SEQ ID NO:31) GGGGATATTCAACCGTTA is used for the upstream primer of amplification legionella pneumophilia O12 and O15 serotype wzm gene;
P9 (SEQ ID NO:32) TTGTCATTTGTGCCACAG is used for amplification legionella pneumophilia O13 serotype
wzmThe upstream primer of gene.
Another object of the present invention is to provide a kind of legionella pneumophilia and detects and use test kit, and this test kit comprises above-mentioned gene chip, and described gene chip comprises at least a of the nucleotide sequence of SEQ ID NO:1-23 or its complementary nucleotide sequence; The primer that also comprises pcr amplification, this primer have nucleotide sequence at least a of SEQ ID NO:24-32, wherein, are used for legionella pneumophilia O4, O12, O13, O15
wzmThe primer sequence of gene PCR amplification is according to legionella pneumophilia O4, O12, O13, O15
wzmThe gene order design; Be used for legionella pneumophilia O1, O2, O3, O5, O6, O7
wztThe primer sequence of gene PCR amplification is according to legionella pneumophilia O1, O2, O3, O5, O6, O7
wztThe gene order design; Be used for legionella pneumophilia O11's
wecThe primer sequence of A gene PCR amplification is according to legionella pneumophilia O11's
wecThe design of A gene order.
Test kit of the present invention also comprises hybridizing box, hybridization solution etc.
Test kit of the present invention can be used for the detection at least a pathogenic bacterium of 11 kinds of serotypes such as legionella pneumophilia O1, O2, O3, O4, O5, O6, O7, O11, O12, O13 and O15.
Disclosed by the invention for detection of water body important pathogenic bacteria legionella pneumophilia gene typing chips and detect with test kit compared with prior art, beneficial effect is:
(1) primer and the probe of the design of existing chip technology institute substantially all are positioned at 16S rRNA gene, and the present invention will have obvious evolutionary edge
Wzm/wztOn gene, design specific probe and primer have effectively avoided resolving power lower, can't distinguish the drawback of planting, and have greatly made up the shortcoming of the sensing range of detection chip in the prior art.
(2) this detection method approximately needs 24 hours.Can detect simultaneously 8 samples on a sheet base, reduce cost, realize high-throughput, detect simultaneously the purpose of a plurality of samples, be particularly suitable for detecting the sample of those multiple infections.
(3) the present invention is incorporated into chip technology in the rapid detection of water body important pathogenic bacteria, set up a kind of quick, sensitive, high-throughput, accuracy is high, the brand-new Serotypes that repeatability is strong detects gene chip and detection method thereof, utilize gene chip of the present invention can reach the purpose that 11 kinds of main pathogenic micro-organisms are detected, due to easy and simple to handle, accuracy is high, can once complete other detection of multiple-type, repeatability is strong, therefore for the water quality monitoring (WQM) of water quality monitoring (WQM) department, important using value is arranged, the fast and accurately detection of realization to legionella pneumophilia.
Description of drawings:
Fig. 1 is gene chip construction profile schematic diagram of the present invention;
Fig. 2 is the single dot matrix structural representation of chip of the present invention;
Fig. 3 be utilize genechip detection legionella pneumophilia O1 of the present invention the results of hybridization schematic diagram;
Fig. 4 be utilize genechip detection legionella pneumophilia O2 of the present invention the results of hybridization schematic diagram;
Fig. 5 is the results of hybridization schematic diagram that utilizes genechip detection legionella pneumophilia O3 of the present invention;
Fig. 6 is the results of hybridization schematic diagram that utilizes genechip detection legionella pneumophilia O4 of the present invention;
Fig. 7 is the results of hybridization schematic diagram that utilizes genechip detection legionella pneumophilia O5 of the present invention;
Fig. 8 is the results of hybridization schematic diagram that utilizes genechip detection legionella pneumophilia O6 of the present invention;
Fig. 9 is the results of hybridization schematic diagram that utilizes genechip detection legionella pneumophilia O7 of the present invention;
Figure 10 is the results of hybridization schematic diagram that utilizes genechip detection legionella pneumophilia O11 of the present invention;
Figure 11 is the results of hybridization schematic diagram that utilizes genechip detection legionella pneumophilia O12 of the present invention;
Figure 12 is the results of hybridization schematic diagram that utilizes genechip detection legionella pneumophilia O13 of the present invention;
Figure 13 is the results of hybridization schematic diagram that utilizes genechip detection legionella pneumophilia O15 of the present invention;
Figure 14 utilizes gene chip of the present invention to carry out the results of hybridization schematic diagram that simulated experiment detects legionella pneumophilia O1;
Figure 15 utilizes gene chip of the present invention to carry out the results of hybridization schematic diagram that sensitivity experiment detects 100ng/ μ L legionella pneumophilia O4;
Figure 16 utilizes gene chip of the present invention to carry out the results of hybridization schematic diagram that sensitivity experiment detects 10ng/ μ L legionella pneumophilia O4;
Figure 17 utilizes gene chip of the present invention to carry out the results of hybridization schematic diagram that sensitivity experiment detects 1ng/ μ L legionella pneumophilia O4;
Figure 18 utilizes gene chip of the present invention to carry out the results of hybridization schematic diagram that sensitivity experiment detects 0.1ng/ μ L legionella pneumophilia O4.
Embodiment
For above and other objects of the present invention, feature and advantage can be become apparent, the below is especially exemplified by preferred embodiment, and the cooperation Figure of description, is described in detail below.
Embodiment 1The design of probe and preparation
Sequence obtains:
(1) legionella pneumophilia O1
wztThe acquisition of gene: download from the GenBank public database and obtain legionella pneumophilia O1's
wztGene order;
(2) legionella pneumophilia O4, O12, O13, O15
wzmGene order is decoded by this laboratory and is obtained;
(3) legionella pneumophilia O2, O3, O5, O6, O7
wztGene is decoded by this laboratory and is obtained;
(4) legionella pneumophilia O11
wecThe A gene is decoded by this laboratory and is obtained;
(5) acquisition of 16S rRNA gene order: obtain whole 16S rRNA gene orders of legionella pneumophilia and whole 16S rRNA gene orders of nearly edge bacterium thereof from the download of GenBank public database.
2. probe design is for example:
The probe of legionella pneumophilia O1: with legionella pneumophilia O1's
wztGene order imports in Glustal X software, chooses one and represents that sequence does the Blastn comparison in common data NCBI, and determining could be as the position of special target spot and special target spot.Sequence is imported in OligoArray 2.0 softwares.Parameter setting is as follows :-n 20;-l 30;-L 40;-D 3000;-t 79;-T 90; 65 ℃ of-s; 65 ℃ of-x;-N 2;-p 33, and-P 65;-m GGGGG CCCCC TTTTT AAAAA;-g 15.The online designing probe of working procedure.
3. probe is synthetic: 5 ' of the probe sequence in following table 1 is held to add entrust probe Synesis Company (Beijing AudioCodes company) synthetic, standby after T extends to 40 bp and amination.
4. probe screening: with making gene chip with gene chip sample applying instrument point on glass chip after synthetic probe dissolving and appropriate dilution, carry out the probe screening by hybrid experiment, finally obtain for the preparation of the required special probe of gene chip of the present invention.
The method of design of other probe is identical with legionella pneumophilia O1 probe design method, and the design variable of use is also identical.
The present invention carries out the probe screening by hybrid experiment repeatedly, and the preferred probe that obtains is as shown in table 1:
The sequence oligonucleotide probe of selecting on table 1. gene chip of the present invention and detectable legionella pneumophilia
| SEQ ID | The probe numbering | Sequence (5'-3') | Detect serotype |
| NO:1 | NO.1 | CAGTCATGGATATCACTCGCGACTATCTC | For detection of legionella pneumophilia O1 |
| NO:2 | NO.2 | GCGAAATATAAATCGGAACAGGTTTGG | For detection of legionella pneumophilia O1 |
| NO:3 | NO.3 | CAACTCCGGATTGGTAAATAAAATTTATTTT | For detection of legionella pneumophilia O4 |
| NO:4 | NO.4 | CGGTTTAATTATAATTTGCGCCACCATTTATG | For detection of legionella pneumophilia O4 |
| NO:5 | NO.5 | GTTAGCAGTTGGAGATCAGGATTTTCA | For detection of legionella pneumophilia O2 |
| NO:6 | NO.6 | GCCATGATATGAGTGCTATTGAATCGATTTG | For detection of legionella pneumophilia O2 and O3 |
| NO:7 | NO.7 | TATTAGCAGTAGGAGATCAAGATTTTCAAA | For detection of legionella pneumophilia O2 |
| NO:8 | NO.8 | AGGAAAGAGTACTTTACTGAAAATTTTATCCA | For detection of legionella pneumophilia O5 |
| NO:9 | NO.9 | AGCCAAGGTGGTTGTTTCAGATTCGCAAACT | For detection of legionella pneumophilia O5 |
| NO:10 | NO.10 | CCAAATATCACCTGGCGAACGCATAGGTTTAA | For detection of legionella pneumophilia O5 |
| NO:11 | NO.11 | ATCCAGAATAACTACTCCGACTTATGGTGAA | For detection of legionella pneumophilia O5 |
| NO:12 | NO.12 | TAGATTCAATTGCAAGATCTCATGCCC | For detection of legionella pneumophilia O6 |
| NO:13 | NO.13 | ACAAGGTTCTTATTCATTCTCTTAAGCTTT | For detection of legionella pneumophilia O6 |
| NO:14 | NO.14 | CTGTGTAGAGCTTAATTGTGTGAGATTATTGG | For detection of legionella pneumophilia O7 |
| NO:15 | NO.15 | TATTATTTATTTTCTTACACCGCATTATTG | For detection of legionella pneumophilia O11 |
| NO:16 | NO.16 | TCATCTCATATTGATTCAGTTAATTAGTTT | For detection of legionella pneumophilia O11 |
| NO:17 | NO.17 | CATATTGATTCAGTTAATTAGTTTATTATTCAT | For detection of legionella pneumophilia O11 |
| NO:18 | NO.18 | GATTATAAATCACGAAAAATGGTTTAGCCCT | For detection of legionella pneumophilia O11 |
| NO:19 | NO.19 | CAGTTATAGAGATGCACTAAATGGTCGAT | For detection of legionella pneumophilia O12 and O15 |
| NO:20 | NO.20 | TTCACCTCATTGGTTAAGATTCTGGTATG | For detection of legionella pneumophilia O12 and O15 |
| NO:21 | NO.21 | TGCCACAGTTTATGATAAACTTAATTATCA | For detection of legionella pneumophilia O13 |
| NO:22 | NO.22 | CCTACTATTTGTTATTCAAGCAATGTTT | For detection of legionella pneumophilia O13 |
| NO:23 | NO.23 | TTTGTACCACTGGCATTACAATTTTATTAT | For detection of legionella pneumophilia O13 |
With reference to Fig. 1, be gene chip construction profile schematic diagram of the present invention, the top of this gene chip is the point sample district, and the bottom is label area, and wherein in the point sample district, regular distribution has dot matrix area.The lattice position of probe on glass chip is: the upper end of the first horizontally-arranged dot matrix area is 9.25mm apart from the top of glass chip, the left-hand point array area is 4.5mm apart from left side, the right-hand point array area of glass chip apart from the right side of glass chip, transverse distance between two dot matrix areas is 13.5mm with vertical distance, and the distance between the 3rd horizontally-arranged dot matrix area and the 4th horizontally-arranged dot matrix area is 13.5mm.
With reference to Fig. 2, be the single point array structure schematic diagram of chip of the present invention, Cy3 wherein represents fluorescent probe, and OA532 is the positive control probe, and WL-4006 is negative contrast probe.The nucleotide sequence of the numeral of numbering correspondence wherein is consistent with the nucleotide sequence shown in table 1.
Embodiment 2The design of primer and preparation
1. design of primers is for example:
(1) owning legionella pneumophilia O1
wztGene order imports in Glustal X software, therefrom choosing a representational sequence imports in Primer Primier 5.0 softwares, preseting length 70bp-10bp, G+C% value 40%-60%, Hairpin:NONE, Dimer:NONE, False Priming:NONE, Cross Dimer:NONE.And seek out the nucleotide sequence district that is fit to the universal primer design, its characteristics meet the following conditions substantially: a), this conserved regions should comprise legionella pneumophilia O1's
wztB), this zone should include the variable region that is easy to the specific probe design, guarantees that the difference of Nucleotide between probe is greater than more than 4; C), these both sides, zone are the design that conserved regions can satisfy primer; D), designed primer extension product is unsuitable excessive, otherwise affects the susceptibility of PCR.Design O1's
wztThe primer extension product size is 369bp.
(2) for legionella pneumophilia O4, O12, O13, O15
wzmGene, legionella pneumophilia O2, O3, O5, O6, O7's
wztGene, legionella pneumophilia O11's
WecAThe primer design method of gene order is identical with (1).
(3) primer design method in legionella pneumophilia 16S rRNA gene is identical with (1).
The method of design of other primer is identical with above-mentioned probe primer method, and the design variable of use is also identical.
2. primer is synthetic: the primer sequence in table 2 is entrusted probe Synesis Company (Ying Jun biotech company) synthetic (PAGE purifying), and standby.
Table 2. is used for the pcr amplification primer sequence that the water body legionella pneumophilia detects
| SEQ ID | Numbering | Sequence (5 '-3 ') | The primer effect |
| NO:24 | P1 | TGCAGCAAGCAAAAGTTCAG | Be used for amplification legionella pneumophilia O1 serotype wztThe upstream primer of gene |
| NO:25 | P2 | CAACTCCGGATTGGTAAA | Be used for amplification legionella pneumophilia O4 serotype wzmThe upstream primer of gene |
| NO:26 | P3 | TTCAGAAATCCTCTGGAAG | Be used for amplification legionella pneumophilia O2 and O3 serotype wztThe upstream primer of gene |
| NO:27 | P4 | ATAATAAAGCAAGCCTTGAT | Be used for amplification legionella pneumophilia O5 serotype wztThe upstream primer of gene |
| NO:28 | P5 | TAAAGATATTGTAGAGAGCCAGC | Be used for amplification legionella pneumophilia O6 serotype wztThe upstream primer of gene |
| NO:29 | P6 | TTAAGTGCGGACTACCCA | Be used for amplification legionella pneumophilia O7 serotype wztThe upstream primer of gene |
| NO:30 | P7 | TTGAATTCATTATTTCTTTTCG | Be used for amplification legionella pneumophilia O11 serotype wecAThe upstream primer of gene |
| NO:31 | P8 | GGGGATATTCAACCGTTA | Be used for amplification legionella pneumophilia O12 and O15 serotype wzmThe upstream primer of gene |
| NO:32 | P9 | TTGTCATTTGTGCCACAG | Be used for amplification legionella pneumophilia O13 serotype wzmThe upstream primer of gene |
Illustrate:
(1) P1 is used for amplification legionella pneumophilia O1's
wztGene;
(2) P2 is used for amplification legionella pneumophilia O4's
wzmGene;
(3) P3 is used for amplification legionella pneumophilia O2/O3's
wztGene;
(4) P4 is used for amplification legionella pneumophilia O5's
wztGene;
(5) P5 is used for amplification legionella pneumophilia O6's
wztGene;
(6) P6 is used for amplification legionella pneumophilia O7's
wztGene;
(7) P7 is used for amplification legionella pneumophilia O11 serotype
WecAGene;
(8) P8 is used for amplification legionella pneumophilia O12 and O15 serotype
wzmGene;
(9) P9 is used for amplification legionella pneumophilia O13 serotype
wzmGene.
Embodiment 3
Specificity identification and sensitivity for detection of the gene typing chips of water body important pathogenic bacteria legionella pneumophilia detect
1, the specificity of gene chip of the present invention experiment:
Specificity with regard to refer to a probe can only be with the target gene generation hybridization of own corresponding bacterial classification and can not with the gene fragment generation hybridization of other bacterial classification.This just requires us not only will carry out a large amount of bioinformatic analysis, but the unsettled situation of non-specific result or hybridization signal also can occur by the probe of bioinformatic analysis.So the probe specificity screening also needs a large amount of experiments to verify.More particularly be used for the probe of high throughput testing, all must hybridize checking with a large amount of nearly source bacterium and source far away bacterium.
Utilize and collected legionella 49 strains, wherein reference culture 39 strains, comprise the type strain of 15 kinds of serotypes of legionella pneumophilia and the type strain of non-legionella pneumophilia, clinical separation strain 10 strains, for chip of the present invention, hybridize altogether 225 times, can distinguish accurately every kind of serotype in sensing range.The hybridization figure of every kind of serotype is as shown in Fig. 3-13.
2, the sensitivity of gene chip of the present invention detects:
Genome with Nanodrop quantitative criterion bacterial strain is carried out gradient dilution to 100ng/ μ L, 10ng/ μ L, 1ng/ μ L, 0.1ng/ μ L, every kind of bacterium in sensing range is all carried out the pcr amplification mark, further cross experiment, the sensitivity of determining this chip is 10ng.Take the sensitivity hybridization figure of legionella pneumophilia O13 serotype as example, as shown in Figure 15-18.
Embodiment 4
Utilize the method for gene chip rapid detection legionella pneumophilia serotype
1, sample preparation:
(1) the legionella pneumophilia bacterial strain that collection is obtained, on the BCYE flat board, 37 ℃, 5%CO
2Cultivated 2-3 days;
(2) add 2 mL sterilized waters on the BCYE flat board, aseptic glass stick is the scraping bacterium colony gently, is transferred in 1.5 ml centrifuge tubes centrifugal 10 minutes of 15000 g;
(3) abandon supernatant, add 100 μ L lysates, mixing, 100 ℃ of water-baths 10 minutes;
(4) split product 15000g obtained in the previous step is centrifugal 5 minutes;
(5) collect supernatant, namely contain genomic dna in supernatant, can for detection of or-20 ℃ of preservations.
Attached: the lysate formula:
50 mmol/L NaOH
10 mmol/L Tris-HCl (pH 8.0)
0.5% Tween-20
0.5% NP-40
0.5 mmol/L EDTA (pH 8.0)
5% Chelex-100
2, amplified target sequence: the 3 μ L supernatants of getting the extraction of said gene group extracting method add in the PCR reaction mixture as template; Multi-PRC reaction divides A/B two groups to carry out.PCR reaction PCR reaction mixture formula is as shown in table 3 below.(annotate: the PCR damping fluid in following table 3-table 4, MgCl
2, the dNTP mixture, the Taq enzyme is all available from Sangon company).
Table 3. PCR reaction mixture formula
Reaction tubes is put into PCR instrument (Biometra), and the loop parameter of setting is as follows:
94 ℃ 5 minutes
94 ℃ 30 seconds
57 ℃ 40 seconds
Got back to second step, totally 35 circulations in 30 seconds for 72 ℃
72 ℃ 5 minutes
3, fluorescent mark target sequence: get 10 μ L amplified productions, add in the mark mixed solution, the labeled reactant mixture formula is as shown in table 4 below.
Table 4. labeled reactant mixture formula
Be 0.4 μ mol/L.
Reaction tubes is put into PCR instrument (Biometra), and the loop parameter of setting is as follows:
94 ℃ 5 minutes
94 ℃ 30 seconds
57 ℃ 40 seconds
Got back to second step, totally 35 circulations in 30 seconds for 72 ℃
72 ℃ 5 minutes;
4, hybridization: marked product is placed in 65 ℃ of baking ovens dries, add in advance 70 μ L ddH in hybridizing box (Bo Ao company)
2O is to keep humidity.Getting 18 μ L-2 hybridization solutions mixes with the oven dry marked product, and the probe array that is added in the tap water encountered pathogenic microorganism detection gene chip of preparation in embodiment 1 is regional, cover cover plate (Bo Ao company product, production number 430042) (note between cover plate and slide glass, bubble being arranged), cover tightly hybridizing box, in 44 ℃ of water-baths, hybridization is 12 hours.
Hybridization solution formula: 25% formamide, 0.1% SDS, 6 * SSPE.
5, washing: when hybridizing to, take out hybridizing box, remove cover plate, gene chip was washed 3 minutes in washing lotion A successively, in washing lotion B, washing is 3 minutes, and in washing lotion C, washing is 90 seconds, and is air-dry in air.
Washing lotion A:1 * SSC (sodium-chlor-sodium citrate solution); 0.1% SDS
Washing lotion B:0.05 * SSC
Washing lotion C:95% ethanol
6, scanning: with GenePix personal 4100A biochip scanner (AXON instrument) scanning, parameter used is as follows:
Software and version: GenePix Pro 6.0
official name: 575DF35
PMT Gain：550
Scanning resolution: 10 μ m
Scanning result saves as JPG, TIF, GPR form
Hybridization scanning result when detecting respectively the detection of pathogenic micro-organism in tap water involved in the present invention with gene chip of the present invention is respectively as shown in Fig. 3-13.
7, the analysis interpretation of results of hybridization: this chip is low density chip, and number of probes is less, and detected result can be judged by naked eyes.According to the hybridization image that scans, as image coordinate, the position of the specific probe of fluorescent signal appears in judgement with the position of fluorescent probe, and contrast dot matrix layout viewing is judged pathogenic agent.Wherein the positive contrast probe of OA532, have two aspect effects: show a) whether the PCR reaction system is normal, have or not inhibition to exist; B) whether the clinical sample sampling amount whether enough to reach sample preparation correct.
8, double blind experiment:
From test 35 strain bacterial classifications used select 17 strains upset the order, the numbering sequence number do double blind experiment.The experimenter is consistent with experiment participant's sentence read result by amplification label, cross experiment proof.
Conclusion: determined the reliability of this chip detection result, proved the effect of water body important pathogenic bacteria legionella pneumophilia genes typing chip.
Embodiment 5
Chip agent box of the present invention
Hybridizing box (Bo Ao company)
Hybridization solution formula: 25% formamide, 0.1% SDS, 6 * SSPE.
Above-mentioned Taq enzyme is available from Sangon company, and hybridization solution, positive reference substance (a kind of sample that contains serotype in legionella pneumophilia 11), negative control product (change template into ddH
2O), chip, ultrapure water, washing lotion A and washing lotion B prepare voluntarily by us, cover plate and hybridizing box are bought Yu Boao company.
Embodiment 6
Utilize the test kit of producing to carry out the analog detection of main pathogenic microbes in tap water
When development microorganism detection chip, be the emphasis of whole process and one of crucial to the processing of sample, be also simultaneously the key element that improves chip sensitivity.Because being subjected to the water sample self-pollution to affect restriction with chip sensitivity, the applying gene chip technology increases bacterium before needing carry out the pathogenic micro-organism in water sample when in water sample, pathogenic micro-organism detects, and could satisfy the requirement of genechip detection sensitivity.If every kind of pathogenic bacterium are all undertaken increasing bacterium and selective enrichment before independent by GB regulation, this can increase the sample quantity of sampling quantity, also strengthen simultaneously workload and the complexity of experiment, in order to meet gene chip highly sensitive, high-throughout characteristics, we have set up the method that pathogenic micro-organism in the water sample increases bacterium fast.
1, concrete steps are:
(1) legionella pneumophilia of cultivating is upward scraped with stroke-physiological saline solution gently from the BCYE growth is dull and stereotyped, successively gradient dilution to 10
3-10
0Then CFU/mL gets respectively 1mL bacterium liquid and is incorporated in 100 mL sterilized waters
(2) the water system filter membrane that is 0.22 μ m with above-mentioned water sample with the aperture filters, and then filter membrane is taken off, and rinses filter membrane with 2 mL stroke-physiological saline solution (0.85%)
(3) get 100 μ L and evenly coat on BCYE growth flat board, 37 ℃, CO
2Cultivated 3-5 days.
(4) with sterilized water scraping culture bacterium colony gently, get DNA cleavage liquid (1 * PCR Buffer, 2.5 mM Mg that 1 mL bacterium liquid adds 500 μ L
2+, 0.5% NP40,0.5% Tween-20, and 0.1 ng/ μ L Proteinase K), 50 ℃ of temperature were bathed 1 hour
(5) 100 ℃ of water-baths 15 minutes
(6) 4 ℃, centrifugal 10 minutes of 12000 rpm
(7) DNA obtained in the previous step is carried out pcr amplification and the mark of target gene
2, amplified target sequence: the 3 μ L supernatants of getting the extraction of said gene group extracting method add in the PCR reaction mixture as template; Multi-PRC reaction divides A/B two groups to carry out.PCR reaction PCR reaction mixture formula is as shown in table 3.(annotate: PCR damping fluid, MgCl in table 3-table 4
2, the dNTP mixture, the Taq enzyme is all available from Sangon company).
Reaction tubes is put into PCR instrument (Biometra), and the loop parameter of setting is as follows:
94 ℃ 5 minutes
94 ℃ 30 seconds
57 ℃ 40 seconds
Got back to second step, totally 35 circulations in 30 seconds for 72 ℃
72 ℃ 5 minutes
3, fluorescent mark target sequence: get 10 μ L amplified productions, add in the mark mixed solution, the labeled reactant mixture formula is as shown in table 4.
Reaction tubes is put into PCR instrument (Biometra), and the loop parameter of setting is as follows:
94 ℃ 5 minutes
94 ℃ 30 seconds
57 ℃ 40 seconds
Got back to second step, totally 35 circulations in 30 seconds for 72 ℃
72 ℃ 5 minutes;
4, hybridization: marked product is placed in 65 ℃ of baking ovens dries, add in advance 70 μ L ddH in hybridizing box (Bo Ao company)
2O is to keep humidity.Getting 18 μ L-2 hybridization solutions mixes with the oven dry marked product, and the probe array that is added in pathogenic microorganism legionella pneumophilia detection gene chip in the water body for preparing in embodiment 1 is regional, cover cover plate (Bo Ao company product, production number 430042) (note between cover plate and slide glass, bubble being arranged), cover tightly hybridizing box, in 44 ℃ of water-baths, hybridization is 12 hours.
Hybridization solution formula: 25% formamide, 0.1% SDS, 6 * SSPE.
5, washing: when hybridizing to, take out hybridizing box, remove cover plate, gene chip was washed 3 minutes in washing lotion A successively, in washing lotion B, washing is 3 minutes, and in washing lotion C, washing is 90 seconds, and is air-dry in air.
Washing lotion A:1 * SSC (sodium-chlor-sodium citrate solution); 0.1% SDS
Washing lotion B:0.05 * SSC
Washing lotion C:95% ethanol
6, scanning: with GenePix personal 4100A biochip scanner (AXON instrument) scanning, parameter used is as follows:
Software and version: GenePix Pro 6.0
official name: 575DF35
PMT Gain：550
Scanning resolution: 10 μ m
Scanning result saves as JPG, TIF, GPR form
7, the analysis interpretation of results of hybridization: this chip is low density chip, and number of probes is less, and detected result can be judged by naked eyes.According to the hybridization image that scans, as image coordinate, the position of the specific probe of fluorescent signal appears in judgement with the position of fluorescent probe, and contrast dot matrix layout viewing is judged pathogenic agent.Wherein the positive contrast probe of OA532, have two aspect effects: show a) whether the PCR reaction system is normal, have or not inhibition to exist; B) whether the clinical sample sampling amount whether enough to reach sample preparation correct.Detected result as shown in figure 14.Figure 14 utilizes gene chip of the present invention to carry out the results of hybridization schematic diagram that analog detection goes out legionella pneumophilia O1.
Conclusion: this genechip detection is special, and detected result is credible.
The above, it is only preferred embodiment of the present invention, be not that the present invention is done any pro forma restriction, every foundation technical spirit of the present invention all still belongs in the scope of technical solution of the present invention any simple modification, equivalent variations and modification that above embodiment does.
SEQUENCE LISTING
＜110〉Nankai University
＜120〉gene typing chips of legionella pneumophilia and detection test kit
<160> 34
<170> PatentIn version 3.5
<210> 1
<211> 29
<212> DNA
＜213〉for detection of legionella pneumophilia O1
<400> 1
cagtcatgga tatcactcgc gactatctc 29
<210> 2
<211> 27
<212> DNA
＜213〉for detection of legionella pneumophilia O1
<400> 2
gcgaaatata aatcggaaca ggtttgg 27
<210> 3
<211> 31
<212> DNA
＜213〉for detection of legionella pneumophilia O4
<400> 3
caactccgga ttggtaaata aaatttattt t 31
<210> 4
<211> 32
<212> DNA
＜213〉for detection of legionella pneumophilia O4
<400> 4
cggtttaatt ataatttgcg ccaccattta tg 32
<210> 5
<211> 27
<212> DNA
＜213〉for detection of legionella pneumophilia O2
<400> 5
gttagcagtt ggagatcagg attttca 27
<210> 6
<211> 31
<212> DNA
＜213〉for detection of legionella pneumophilia O2 and O3
<400> 6
gccatgatat gagtgctatt gaatcgattt g 31
<210> 7
<211> 30
<212> DNA
＜213〉for detection of legionella pneumophilia O2
<400> 7
tattagcagt aggagatcaa gattttcaaa 30
<210> 8
<211> 32
<212> DNA
＜213〉for detection of legionella pneumophilia O5
<400> 8
aggaaagagt actttactga aaattttatcca 32
<210> 9
<211> 24
<212> DNA
＜213〉for detection of legionella pneumophilia O5
<400> 9
agccaaggtg gttgtttcag attcgcaaact 31
<210> 10
<211> 27
<212> DNA
＜213〉for detection of legionella pneumophilia O5
<400> 10
ccaaatatca cctggcgaac gcataggtttaa 32
<210> 11
<211> 24
<212> DNA
＜213〉for detection of legionella pneumophilia O5
<400> 11
atccagaata actactccga cttatggtgaa 31
<210> 12
<211> 27
<212> DNA
＜213〉for detection of legionella pneumophilia O6
<400> 12
tagattcaat tgcaagatct catgccc 27
<210> 13
<211> 30
<212> DNA
＜213〉for detection of legionella pneumophilia O6
<400> 13
acaaggttct tattcattct cttaagcttt 30
<210> 14
<211> 32
<212> DNA
＜213〉for detection of legionella pneumophilia O7
<400> 14
ctgtgtagag cttaattgtg tgagattatt gg 32
<210> 15
<211> 30
<212> DNA
＜213〉for detection of legionella pneumophilia O11
<400> 15
tattatttat tttcttacac cgcattattg 30
<210> 16
<211> 30
<212> DNA
＜213〉for detection of legionella pneumophilia O11
<400> 16
tcatctcata ttgattcagt taattagttt 30
<210> 17
<211> 33
<212> DNA
＜213〉for detection of legionella pneumophilia O11
<400> 17
catattgatt cagttaatta gtttattatt cat 33
<210> 18
<211> 31
<212> DNA
＜213〉for detection of legionella pneumophilia O11
<400> 18
gattataaat cacgaaaaat ggtttagccc t 31
<210> 19
<211> 29
<212> DNA
＜213〉for detection of legionella pneumophilia O12 and O15
<400> 19
cagttataga gatgcactaa atggtcgat 29
<210> 20
<211> 29
<212> DNA
＜213〉for detection of legionella pneumophilia O12 and O15
<400> 20
ttcacctcat tggttaagat tctggtatg 29
<210> 21
<211> 30
<212> DNA
＜213〉for detection of legionella pneumophilia O13
<400> 21
tgccacagtt tatgataaac ttaattatca 30
<210> 22
<211> 28
<212> DNA
＜213〉for detection of legionella pneumophilia O13
<400> 22
cctactattt gttattcaag caatgttt 28
<210> 23
<211> 30
<212> DNA
＜213〉for detection of legionella pneumophilia O13
<400> 23
tttgtaccac tggcattaca attttattat 30
<210> 24
<211> 20
<212> DNA
＜213〉be used for the upstream primer of amplification legionella pneumophilia O1 serotype wzt gene
<400> 24
tgcagcaagc aaaagttcag 20
<210> 25
<211> 18
<212> DNA
＜213〉be used for the upstream primer of amplification legionella pneumophilia O4 serotype wzm gene
<400> 25
caactccgga ttggtaaa 18
<210> 26
<211> 19
<212> DNA
＜213〉be used for the upstream primer of amplification legionella pneumophilia O2 and O3 serotype wzt gene
<400> 26
ttcagaaatc ctctggaag 19
<210> 27
<211> 20
<212> DNA
＜213〉be used for the upstream primer of amplification legionella pneumophilia O5 serotype wzt gene
<400> 27
ataataaagc aagccttgat 20
<210> 28
<211> 23
<212> DNA
＜213〉be used for the upstream primer of amplification legionella pneumophilia O6 serotype wzt gene
<400> 28
taaagatatt gtagagagcc agc 23
<210> 29
<211> 18
<212> DNA
＜213〉be used for the upstream primer of amplification legionella pneumophilia O7 serotype wzt gene
<400> 29
ttaagtgcgg actaccca 18
<210> 30
<211> 22
<212> DNA
＜213〉be used for the upstream primer of amplification legionella pneumophilia O11 serotype wecA gene
<400> 30
<210> 31
<211> 18
<212> DNA
＜213〉be used for the upstream primer of amplification legionella pneumophilia O12 and O15 serotype wzm gene
<400> 31
ggggatattc aaccgtta 18
<210> 32
<211> 18
<212> DNA
＜213〉be used for the upstream primer of amplification legionella pneumophilia O13 serotype wzm gene
<400> 32
ttgtcatttg tgccacag 18
<210> 33
<211> 49
<212> DNA
＜213〉positive control probe
<400> 33
tttttttttt tttttttttt tttttttttt tactcctacg ggaggcagc 49
<210> 34
<211> 39
<212> DNA
＜213〉negative contrast probe
<400> 34
tttttttttt tttttttttt tttttttttt ttttttttt 39
Claims (5)
1. gene chip that detects legionella pneumophilia comprises solid phase carrier and is fixed on oligonucleotide probe on this solid phase carrier, it is characterized in that this oligonucleotide probe comprises a kind of in following DNA fragmentation:
(1) legionella pneumophilia O4, O12, O13, O15
wzmSelected DNA fragmentation in gene;
(2) legionella pneumophilia O2, O3, O5, O6, O7
wztSelected DNA fragmentation in gene;
(3) legionella pneumophilia O11
WecADNA fragmentation in gene;
Solid phase carrier described above is the sheet glass with active group; Wherein said oligonucleotide probe has and is the nucleotide sequence shown in SEQ ID NO:1-23.
2. gene chip claimed in claim 1, wherein also comprise positive control probe and negative contrast probe; Has the nucleotide sequence shown in SEQ ID NO:33-34.
3. the using method of the non-diagnoses and treatment purpose of the described gene chip of claim 1 is characterized in that comprising step:
(1) pathogenic bacteria according to claim 1
wzmGene,
wztGene and
WecAGene design and the synthetic primer that is used for pcr amplification; Primer wherein comprises the Nucleotide shown in SEQ ID NO:24-32;
(2) genomic dna of preparation testing sample, use the primer in step (1), treats survey sample gene group DNA and carry out pcr amplification, obtains target sequence;
(3) target sequence that obtains in markers step (2);
(4) with the target sequence after mark and gene chip hybridization claimed in claim 1;
(5) obtain hybridization signal and analyze results of hybridization with biochip scanner.
4. a test kit that detects legionella pneumophilia, is characterized in that comprising the nucleotide sequence shown in SEQ ID NO:1-23; The nucleotide sequence of SEQ ID NO:24-32; Also comprise hybridizing box, hybridization solution.
5. test kit claimed in claim 5 is detecting legionella pneumophilia O2, O3, O4, O5, O6, O7, O11, O12, O13 and the O15 application at least a pathogenic bacterium in totally 10 kinds of serotype, the described purposes that is applied as non-diagnoses and treatment purpose.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201210003928 CN102424862B (en) | 2012-01-09 | 2012-01-09 | Genotyping chip for legionella pneumophila, and kit for detection of legionella pneumophila |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201210003928 CN102424862B (en) | 2012-01-09 | 2012-01-09 | Genotyping chip for legionella pneumophila, and kit for detection of legionella pneumophila |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102424862A CN102424862A (en) | 2012-04-25 |
| CN102424862B true CN102424862B (en) | 2013-06-26 |
Family
ID=45958889
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201210003928 Active CN102424862B (en) | 2012-01-09 | 2012-01-09 | Genotyping chip for legionella pneumophila, and kit for detection of legionella pneumophila |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102424862B (en) |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103160587B (en) * | 2013-04-02 | 2015-04-22 | 南开大学 | Genetic typing chip of 10 common pathogenic legionella and detection kit |
| CN105256052B (en) * | 2015-11-13 | 2017-06-23 | 黑龙江金域医学检验所有限公司 | A kind of kit and its detection method for Legionella quick detection and parting |
| CN105255876B (en) * | 2015-11-13 | 2018-06-29 | 广州市圣鑫生物科技有限公司 | A kind of primer and method quickly detected for Legionella with parting |
| CN106929573B (en) * | 2017-02-21 | 2020-06-09 | 南开大学 | Against Legionella pneumophila type O12wzmAndwecAgene specific nucleotide sequence and application thereof |
| CN107419020B (en) * | 2017-08-10 | 2018-11-20 | 南京金域医学检验所有限公司 | Legionella pneumophilia Multilocus sequence typing PCR primer, classifying method and application |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1609874A2 (en) * | 2004-05-21 | 2005-12-28 | Bioanalisi Centro Sud S.n.c. di Perseu Sinibaldo e C. | System for searching for and identifying pathogenic agents |
| JP4422019B2 (en) * | 2002-06-14 | 2010-02-24 | 日立ソフトウエアエンジニアリング株式会社 | Microbe identification probe and identification method using the same |
| CN102140514A (en) * | 2011-01-04 | 2011-08-03 | 天津生物芯片技术有限责任公司 | Specific primers and kit for detecting various serotype pathogenic bacteria of legionella pneumophilia |
-
2012
- 2012-01-09 CN CN 201210003928 patent/CN102424862B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP4422019B2 (en) * | 2002-06-14 | 2010-02-24 | 日立ソフトウエアエンジニアリング株式会社 | Microbe identification probe and identification method using the same |
| EP1609874A2 (en) * | 2004-05-21 | 2005-12-28 | Bioanalisi Centro Sud S.n.c. di Perseu Sinibaldo e C. | System for searching for and identifying pathogenic agents |
| CN102140514A (en) * | 2011-01-04 | 2011-08-03 | 天津生物芯片技术有限责任公司 | Specific primers and kit for detecting various serotype pathogenic bacteria of legionella pneumophilia |
Non-Patent Citations (6)
| Title |
|---|
| Christel Cazalet,et al.."Multigenome analysis identifies a worldwide distributed epidemic Legionella pneumophila clone that emerged within a highly diverse species".《Genome Res.》.2008,第18卷第431-441页. |
| E. Liineberg, et ai.."Cloning and functional characterization of a 30 kb gene locus required for lipopolysaccharide biosynthesis in Legionella pneumophila".《Int. J. Med. Microbial.》.2000,第290卷第37-49页. |
| Gunnar N. Schroeder,et al.."Legionella pneumophila Strain 130b Possesses a Unique Combination of Type IV Secretion Systems and Novel Dot/Icm Secretion System Effector Proteins".《JOURNAL OF BACTERIOLOGY》.2010,第192卷(第22期),第6001–6016页. |
| JP特许第4422019号B2 2009.12.11 |
| 吴守芝 等."利用荧光素原位分子杂交检验水样中嗜肺军团菌的研究".《中国卫生检验杂志》.2007,第17卷(第4期),第609-611，625页. |
| 吴守芝 等."利用荧光素原位分子杂交检验水样中嗜肺军团菌的研究".《中国卫生检验杂志》.2007,第17卷(第4期),第609-611,625页. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102424862A (en) | 2012-04-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101748192B (en) | Gene chip of main pathogenic microorganism in drinking water and testing kit | |
| CN105018489A (en) | Kit for recognizing Brucella wild strain and vaccine strains A19 and S2 | |
| CN102102124B (en) | Multiplex fluorescence PCR (Polymerase Chain Reaction) detection kit for typhoid/paratyphoid saimonella | |
| CN102424862B (en) | Genotyping chip for legionella pneumophila, and kit for detection of legionella pneumophila | |
| CN103898108B (en) | The nucleotide special to vibrio fluvialis O2, O4, O13, O15 and O18 and application thereof | |
| CN104862406A (en) | Primer and probe for on-site rapid detection of mycobacterium tuberculosis complex and kit thereof | |
| CN102140507B (en) | Detection genetic chip and detection kit for infectious diarrhea | |
| CN102947467A (en) | Assays and kits for serotyping pseudomonas aeruginosa and oligonucleotide sequences useful in such methods and kits | |
| CN105018628A (en) | Kit for recognizing Brucella A19 vaccine strain and wild strain | |
| CN104232783B (en) | Quick detection method for cow brucella attenuated vaccine strain A19 | |
| CN103160587B (en) | Genetic typing chip of 10 common pathogenic legionella and detection kit | |
| CN102747144A (en) | Triplex real-time fluorescence PCR detection primers, probes, detection kit and detection method for three bacterial | |
| CN108411014A (en) | Differentiate the primer and probe and detection method of A types and the dual real-time fluorescence quantitative PCR of Type B ox pasteurella multocida | |
| CN102168131B (en) | Primer for amplifying specific regions of common pathogenic type Legionella gyrB genes and application thereof | |
| CN102154270B (en) | Cronobacter sakazakii O antigen specific nucleotides and use thereof | |
| CN103993102A (en) | Multiple fluorescent PCR method and kit for simultaneous detection of human adenovirus, human mycoplasma pneumonia and bocavirus | |
| CN103060447A (en) | Primers, probes, a test kit and a test method for triple real-time fluorescence PCR detection of four bacteria | |
| CN1328391C (en) | Gene chip for detecting B group of streptococcus, detection method and kit for detection | |
| CN105524988A (en) | Kit for rapid detection of Mycobacterium tuberculosis in sputum | |
| CN110305986A (en) | SVA, the triple real-time fluorescence quantitative PCR detection primers of one-step method of O-shaped FMDV and A type FMDV and probe | |
| CN110079623B (en) | Method for detecting toxicity of acinetobacter baumannii | |
| CN102827930B (en) | Method for building helicobacter pylori nucleic acid fingerprint spectrum and product thereof | |
| CN102154466B (en) | Nucleotides with specificity to internal transcribed spacer(ITS) of neisseria meningitidis and application thereof | |
| CN105256028B (en) | The nucleotide special to citric acid bacillus 017 and O39 and its application | |
| JP2008161170A (en) | Oligonucleotide for highly-sensitive detection of bacterium of genus salmonella and detection method and detection kit each using the same |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |