CN102424862A - Genotyping chip for legionella pneumophila, and kit for detection of legionella pneumophila - Google Patents
Genotyping chip for legionella pneumophila, and kit for detection of legionella pneumophila Download PDFInfo
- Publication number
- CN102424862A CN102424862A CN2012100039286A CN201210003928A CN102424862A CN 102424862 A CN102424862 A CN 102424862A CN 2012100039286 A CN2012100039286 A CN 2012100039286A CN 201210003928 A CN201210003928 A CN 201210003928A CN 102424862 A CN102424862 A CN 102424862A
- Authority
- CN
- China
- Prior art keywords
- gene
- legionella pneumophilia
- chip
- legionella
- detect
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Abstract
The present invention provides a genotyping chip for legionella pneumophila, and a kit for detection of the legionella pneumophila. The chip and the kit are mainly provided according to the 11 serotypes of the legionella pneumophila, wherein the 11 serotypes comprise O1, O2, O3, O4, O5, O6, O7, O11, O12, O13 and O15. The gene chip comprises a solid phase carrier and oligonucleotide probes fixed on the solid phase carrier, wherein the oligonucleotide probes comprise DNA fragments selected from wzm gene, wzt gene and wecA gene, or complementary DNA fragments of the wzm gene, the wzt gene and the wecA gene, wherein the wzm gene, the wzt gene and the wecA gene have significant biological evolution advantages. According to the present invention, the genomic DNA of the sample requiring detection is amplified by the designed primers; the resulting amplified genomic DNA is labeled; the resulting labeled genomic DNA is subjected to hybridization with the gene chip; according to the resulting hybridization signals, the different serotypes of the legionella pneumophila can be detected. With the gene chip of the present invention, the purpose of the detection of the serotypes of the legionella pneumophila can be achieved, the operation is convenient, the accuracy is high, the repeatability is strong, and the accurate medical medication guidance is provided.
Description
Technical field
Test kit is used in the detection that the present invention relates to a kind of gene chip and comprise this chip, and test kit is used in the gene chip and the detection of totally 11 kinds of serotypes especially to relate to water body important pathogenic bacteria legionella pneumophilia O1, O2, O3, O4, O5, O6, O7, O11, O12, O13 and O15.
Background technology
Water is the prerequisite that life is able to exist, and it makes we mankind be able to multiply and live, and human life, production, amusement all be unable to do without water.Its also is place and the carrier that many pathogenic micro-organisms grow, propagate simultaneously, possibly make the people ill even cause death in case these pathogenic micro-organisms get into human body, and human health in serious threat.Along with the development and the growth in the living standard of society, People more and more is concerned about the health problem of self, and the safety-problems of various water body (comprising Drinking Water, rivers and lakes, swimming place and hall etc.) also becomes the focus that people pay close attention to day by day.Therefore, in order to protect the healthy of people, to the detection of pathogenic micro-organism in the various water bodys especially tap water be very necessary with need badly.
Legionella (
Legionella) be a kind of gram negative bacillus, extensively be present in the water body, soil of nature and artificial environment, can suck through contain that the aerocolloidal mode of bacterium is sent out in air and by human body and cause the human infection, cause febris acuta property pulmonary disorder---legionnaires disease.First since the U.S. finds legionnaires disease, this disease demonstrated worldwide distribution and two high big characteristics of case fatality rate from 1976.The growth and breeding of legionella and environment are because of closely related, and cooling tower water coolant, water of condensation and the thermal water of central air conditioning is the legionella living environment suitable in the external world.Legionella in Environmental Water is bred finite concentration, then can form aerosol and then infected person.Host infection mainly receives the influence of its susceptibility and bacterial virulence; Any age all can take place; But person in middle and old age, fundamental immunity chump, long distance travelers, smoker are the high risk population, and are prone to dye legionella with public places such as hospital, hotel, heavy construction building sites.
At present, legionella (
Legionellace) found that more than 50 is planted, more than 70 serotype, and constantly have new bacterial classification to come to light.Wherein with mankind's relation the closest legionella pneumophilia (
Legionella pneumophila), from environment, separate the earliest, be the representative species of legionella.According to the antigenic difference of O-, legionella pneumophilia can be divided into 15 O serotypes.Wherein nearly 70% infection of legionella is caused by legionella pneumophilia O1 type; 20-30% is caused by other serotype; Non-legionella pneumophilia causes the approximately just infection of legionella of 5-10%, can learn that from then on legionella pneumophilia O1 type occupies sizable ratio in the microbial case of legion; Be the main monoid that causes a disease of legionella, in the research of legionella, occupy an important position.
In addition, the legionella kind is various, and conventional microbial culture and serum are identified somatotype, length consuming time, and workload is big, and flux is low, can not satisfy epidemiology survey and reach the incident real-time analysis needs that cause a disease that happen suddenly.Immunoserology method is to utilize the uniqueness of bacterial antigens and the modern detecting that antigen-antibody bonded specificity is set up, and has characteristics such as high specificity.Many clinical diseases have brought into use this method to carry out pathogen detection, as utilize the HBV surface antigen to detect HBV virus.Yet, because this method need be through the analysis of at least 48 hours microbial culture, amplification and single bacterium colony, and need carry out the antiserum(antisera) aggregation to a large amount of single bacterium colony of each sample, length consuming time and false negative possibly occur.In addition, there are not a company or unit can produce the antiserum(antisera) of whole bacteriums in the world, even the most frequently used colibacillary antiserum(antisera) also has only a few company and unit that the antiserum(antisera) of whole serotypes is arranged and costs an arm and a leg.
1993, Luk, J.M.C
Et.alChoose Salmonellas (
S.enterica) specific nucleotide sequence of O-antigen gene bunch, identified O-antigen [Luk, the J.M.C. of Salmonellas through PCR method
Et.al(1993) " Selective amplification of abequose and paratose synthase genes (
Rfb) by polymerase chain reaction for identification of
S. entericaMajor serogroups (A; B; C2 and D) "; J. Clin. Microbiol. 31:2118-2123], opened the beginning of screening special molecular sign from O antigen gene bunch, for the various O-Detection of antigen of bacterium provides that high-throughput, detection speed are fast, high specificity, highly sensitive molecular detecting method.Bacterium O antigen type is various, and general different bacterium has different O-antigen, and the bacterium in the same kind also has different O-antigen mostly.Research shows; The antigenic variety of bacterium O-is to be caused by the genetics variety of being responsible for its synthetic gene cluster; Some specific genes in the O-antigen gene bunch have high specificity for the surface antigen of its coding; Thus for inspiring, can be used for the legionella molecule parting from screening special molecular sign the O antigen gene bunch.
At present, the patent or the patented claim of application legionella context of detection mainly contain:
(1) the common pathotype legionella of amplification
GyrB gene specific district's primer and application thereof (publication No.: CN102168131), this patented claim provide a kind of Mick that increases respectively wear the moral legionella (
Legionella micdadei); The Bo Ziman legionella (
Legionella bozemanii); Legionella longbeachae (
Legionella longbeachae) in
GyrBGene (DNA gyrase B subunit gene, hereinafter to be referred as
GyrB) primer in special district, also provide a kind of amplification Mick that comprises to wear moral legionella, Bo Ziman legionella, Legionella longbeachae
GyrBThe PCR test kit of the primer in gene specific district; Utilizing this PCR test kit that Mick is worn moral legionella, Bo Ziman legionella, Legionella longbeachae detects; Easy fast, specificity is good, highly sensitive; Can be used for that pathogenic bacteria detects in supervision and detection, the tap water of water body and clinical sample, fields such as bacteriology classification and epidemiology survey, have far-reaching social benefit and bigger economic benefit.
(2) (publication No.: CN1396270A, open day: on February 12nd, 2003), this patented claim disclosed the technology that a kind of dna microarray detects common pathogen in the water to a kind of dna microarray that detects common pathogen in the water.Common pathogen in this techniques make use 16S rRNA gene test and the evaluation water, two primers design respectively in 16S rRNA gene conservative district, and probe is in the variable region of 16S rRNA gene.This dna microarray technology can detect Escherichia, Shigella, salmonella, Staphylococcus, proteus, anaerobism Clostridium, streptococcus, Legionnella, mycobacterium tuberculosis, yersinia, listeria spp, Pseudomonas aeruginosa, campylobacter jejuni, can be used for supervision and the detection and the epidemiology survey of clinical disease diagnosis, water and food.This technology is owing to the high conservative property of 16S rRNA, and resolving power is lower, can't distinguish kind, also can't distinguish intestinal bacteria and Shigellae.
(3) a kind of primer and application (publication No.: CN101967474) thereof of the legionella pneumophilia gyrB gene specific district that increases; This patented claim discloses (the DNA gyrase B subunit gene of gyrB gene in a kind of amplification legionella pneumophilia; Hereinafter to be referred as gyrB) primer in special district; A kind of PCR test kit that comprises the primer in amplification legionella pneumophilia gyrB gene specific district also is provided; Utilize this PCR test kit that legionella pneumophilia is detected; Easy fast, specificity is good, highly sensitive, can be used for that pathogenic bacteria detects in supervision and detection, the tap water of water body and clinical sample, bacteriology is classified and field such as epidemiology survey, has far-reaching social benefit and bigger economic benefit.(4) legionella pneumophilia
Mip(publication No.: CN1664105), this patented claim discloses a kind of legionella pneumophilia for gene clone, reorganization, expression and method for purifying proteins
Legionella pneumophilaMacrophage infectivity potentiator (
Mip) clone, reorganization, expression, purification process and the primer special of gene, and MIP albumen and analogue thereof, verivate are in infection of legionella patient's clinical diagnosis and the application aspect the treatment.Present method obtains legionella pneumophilia genes group DNA with PCR method
MipGene; And with this recombination rear clone in coli expression carrier; Extract MIP albumen behind the abduction delivering, and then use the affinity chromatography method and obtain highly purified albumen, for clinical further diagnosis Legionella pneumophila infection is applied to detect legionella pneumophilia antigen and antibody.
Summary of the invention
An object of the present invention is to provide and a kind ofly be used to detect the gene typing chips of legionella pneumophilia and detect and use test kit; To remedy time-consuming, the consumption power that traditional drinking-water quality detection technique exists; The defective of resolving power difference, expansion pathogenic micro-organism sensing range improves detection sensitivity and specificity; Reduce labour intensity, shorten sense cycle.
For realizing that above-mentioned purpose the invention discloses following technology contents:
A kind of detection legionella pneumophilia (
Legionella Pneumophila) gene chip, comprise solid phase carrier and be fixed on the oligonucleotide probe on this solid phase carrier, it is characterized in that this oligonucleotide probe comprises at least a in the following dna fragmentation:
(1) legionella pneumophilia O4, O12, O13, O15
WzmSelected at least a dna fragmentation in the gene;
(2) legionella pneumophilia O1, O2, O3, O5, O6, O7
WztSelected at least a dna fragmentation in the gene;
(3) legionella pneumophilia O11
WecSelected at least a dna fragmentation in the A gene;
The complementary DNA fragment of the dna fragmentation of (4) choosing in (1) or (2) or (3).
Solid phase carrier of the present invention is the sheet glass that has reactive group.
Said oligonucleotide probe preferably has the nucleotide sequence shown in the SEQ ID NO:1-23, or is different from SEQ ID NO:1-23 but the amino acid sequence coded aminoacid sequence identical nucleotide sequence coded with SEQ ID NO:1-23; Gene chip of the present invention also comprises over against contrasting probe according to probe with bearing.
Above-mentioned preferred sequence and function are as follows:
SEQ?ID?(5'-3')
NO:1 CAGTCATGGATATCACTCGCGACTATCTC is used to detect legionella pneumophilia O1
NO:2 GCGAAATATAAATCGGAACAGGTTTGG is used to detect legionella pneumophilia O1
NO:3 CAACTCCGGATTGGTAAATAAAATTTATTTT is used to detect legionella pneumophilia O4
NO:4 CGGTTTAATTATAATTTGCGCCACCATTTATG is used to detect legionella pneumophilia O4
NO:5 GTTAGCAGTTGGAGATCAGGATTTTCA is used to detect legionella pneumophilia O2
NO:6 GCCATGATATGAGTGCTATTGAATCGATTTG is used to detect legionella pneumophilia O2 and O3
NO:7 TATTAGCAGTAGGAGATCAAGATTTTCAAA is used to detect legionella pneumophilia O3
NO:8 AGGAAAGAGTACTTTACTGAAAATTTTATCCA is used to detect legionella pneumophilia O5
NO:9 AGCCAAGGTGGTTGTTTCAGATTCGCAAACT is used to detect legionella pneumophilia O5
NO:10 CCAAATATCACCTGGCGAACGCATAGGTTTAA is used to detect legionella pneumophilia O5
NO:11 ATCCAGAATAACTACTCCGACTTATGGTGAA is used to detect legionella pneumophilia O5
NO:12 TAGATTCAATTGCAAGATCTCATGCCC is used to detect legionella pneumophilia O6
NO:13 ACAAGGTTCTTATTCATTCTCTTAAGCTTT is used to detect legionella pneumophilia O6
NO:14 CTGTGTAGAGCTTAATTGTGTGAGATTATTGG is used to detect legionella pneumophilia O7
NO:15 TATTATTTATTTTCTTACACCGCATTATTGG is used to detect legionella pneumophilia O11
NO:16 TCATCTCATATTGATTCAGTTAATTAGTTT is used to detect legionella pneumophilia O11
NO:17 CATATTGATTCAGTTAATTAGTTTATTATTCAT is used to detect legionella pneumophilia O11
NO:18 GATTATAAATCACGAAAAATGGTTTAGCCCT is used to detect legionella pneumophilia O11
NO:19 CAGTTATAGAGATGCACTAAATGGTCGAT is used to detect legionella pneumophilia O12 and O15
NO:20 TTCACCTCATTGGTTAAGATTCTGGTATG is used to detect legionella pneumophilia O12 and O15
NO:21 TGCCACAGTTTATGATAAACTTAATTATCA is used to detect legionella pneumophilia O13
NO:22 CCTACTATTTGTTATTCAAGCAATGTTT is used to detect legionella pneumophilia O13
NO:23 TTTGTACCACTGGCATTACAATTTTATTAT is used to detect legionella pneumophilia O13
NO:33:OA532
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTACTCCTACGGGAGGCAGC is over against shining probe
WL-4006: TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT is negative contrast probe
Cy3: TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT-Cy-3 is a fluorescent probe
Gene chip of the present invention can be used for the detection of at least a pathogenic bacterium in 11 kinds of serotypes such as legionella pneumophilia O1, O2, O3, O4, O5, O6, O7, O11, O12, O13 and O15.
Gene chip preparation method of the present invention mainly comprises step:
1) according to the said legionella pneumophilia of claim 1
WzmGene,
WztGene reaches
WecA gene conserved regions design is also prepared the primer that is used for pcr amplification;
2) genomic dna of preparation testing sample uses the primer in the step 1), treats test sample article genomic dna and carries out pcr amplification, obtains target sequence;
3) markers step 2) in the target sequence that obtains;
4) with target sequence behind the mark and the described gene chip hybridization of claim 1;
5) obtain hybridization signal and analyze results of hybridization with biochip scanner.
Wherein, the primer described in the step 1) comprises at least a of the nucleotide sequence shown in the SEQ ID NO:24-32, the oligonucleotide sequence of each bar primer probe by 5 ' end to 3 ' end form and corresponding amplification effect is:
P1 (SEQ ID NO:24) the TGCAGCAAGCAAAAGTTCAG legionella pneumophilia O1 serotype that is used to increase
WztThe upstream primer of gene;
P2 (SEQ ID NO:25) the CAACTCCGGATTGGTAAA legionella pneumophilia O4 serotype that is used to increase
WzmThe upstream primer of gene;
P3 (SEQ ID NO:26) TTCAGAAATCCTCTGGAAG be used to increase legionella pneumophilia O2 and O3 serotype
WztThe upstream primer of gene;
P4 (SEQ ID NO:27) the ATAATAAAGCAAGCCTTGAT legionella pneumophilia O5 serotype that is used to increase
WztThe upstream primer of gene;
P5 (SEQ ID NO:28) the TAAAGATATTGTAGAGAGCCAGC legionella pneumophilia O6 serotype that is used to increase
WztThe upstream primer of gene;
P6 (SEQ ID NO:29) the TTAAGTGCGGACTACCCA legionella pneumophilia O7 serotype that is used to increase
WztThe upstream primer of gene;
P7 (SEQ ID NO:30) the TTGAATTCATTATTTCTTTTCG legionella pneumophilia O11 serotype that is used to increase
WecThe upstream primer of A gene;
P8 (SEQ ID NO:31) GGGGATATTCAACCGTTA be used to the to increase upstream primer of legionella pneumophilia O12 and O15 serotype wzm gene;
P9 (SEQ ID NO:32) the TTGTCATTTGTGCCACAG legionella pneumophilia O13 serotype that is used to increase
WzmThe upstream primer of gene.
Another object of the present invention provides a kind of legionella pneumophilia and detects and use test kit, and this test kit comprises above-mentioned gene chip, and described gene chip comprises nucleotide sequence or its complementary nucleotide sequence at least a of SEQ ID NO:1-23; The primer that also comprises pcr amplification, this primer have nucleotide sequence at least a of SEQ ID NO:24-32, wherein, are used for legionella pneumophilia O4, O12, O13, O15
WzmThe primer sequence of gene PCR amplification is according to legionella pneumophilia O4, O12, O13, O15
WzmThe gene order design; Be used for legionella pneumophilia O1, O2, O3, O5, O6, O7
WztThe primer sequence of gene PCR amplification is according to legionella pneumophilia O1, O2, O3, O5, O6, O7
WztThe gene order design; Be used for legionella pneumophilia O11's
WecThe primer sequence of A gene PCR amplification is according to legionella pneumophilia O11's
WecThe design of A gene order.
Test kit of the present invention also comprises hybridizing box, hybridization solution etc.
Test kit of the present invention can be used for the detection at least a pathogenic bacterium of 11 kinds of serotypes such as legionella pneumophilia O1, O2, O3, O4, O5, O6, O7, O11, O12, O13 and O15.
Disclosed by the invention being used to detected the gene typing chips of water body important pathogenic bacteria legionella pneumophilia and detects with test kit compared with prior art, and beneficial effect is:
(1) existing chip technology institute designed primer and probe basically all are positioned at 16S rRNA gene, and the present invention will have obvious evolutionary edge
Wzm/wztOn the gene, design specific probe and primer have effectively avoided resolving power lower, can't distinguish the drawback of planting, and have remedied the shortcoming of the sensing range of detection chip in the prior art greatly.
(2) this detection method approximately needs 24 hours.On a sheet base, can detect 8 samples simultaneously, reduce cost, realize high-throughput, detect the purpose of a plurality of samples simultaneously, be particularly suitable for detecting the sample of those multiple infections.
(3) the present invention is incorporated into chip technology in the rapid detection of water body important pathogenic bacteria; Set up a kind of fast, sensitivity, high-throughput, accuracy is high, repeatability is strong brand-new serotype somatotype detection gene chip and detection method thereof; Utilize gene chip of the present invention can reach the purpose that 11 kinds of main pathogenic micro-organisms are detected, because easy and simple to handle, accuracy is high; Can once accomplish the detection of multiple type; Repeatability is strong, therefore has important use to be worth for the WQM of WQM department, realizes the detection fast and accurately to legionella pneumophilia.
Description of drawings:
Fig. 1 is a gene chip structure and shape synoptic diagram of the present invention;
Fig. 2 is the single dot matrix structural representation of chip of the present invention;
Fig. 3 be utilize gene chip of the present invention detect legionella pneumophilia O1 the results of hybridization synoptic diagram;
Fig. 4 be utilize gene chip of the present invention detect legionella pneumophilia O2 the results of hybridization synoptic diagram;
Fig. 5 utilizes gene chip of the present invention to detect the results of hybridization synoptic diagram of legionella pneumophilia O3;
Fig. 6 utilizes gene chip of the present invention to detect the results of hybridization synoptic diagram of legionella pneumophilia O4;
Fig. 7 utilizes gene chip of the present invention to detect the results of hybridization synoptic diagram of legionella pneumophilia O5;
Fig. 8 utilizes gene chip of the present invention to detect the results of hybridization synoptic diagram of legionella pneumophilia O6;
Fig. 9 utilizes gene chip of the present invention to detect the results of hybridization synoptic diagram of legionella pneumophilia O7;
Figure 10 utilizes gene chip of the present invention to detect the results of hybridization synoptic diagram of legionella pneumophilia O11;
Figure 11 utilizes gene chip of the present invention to detect the results of hybridization synoptic diagram of legionella pneumophilia O12;
Figure 12 utilizes gene chip of the present invention to detect the results of hybridization synoptic diagram of legionella pneumophilia O13;
Figure 13 utilizes gene chip of the present invention to detect the results of hybridization synoptic diagram of legionella pneumophilia O15;
Figure 14 utilizes gene chip of the present invention to carry out the results of hybridization synoptic diagram that simulated experiment detects legionella pneumophilia O1;
Figure 15 utilizes gene chip of the present invention to carry out the results of hybridization synoptic diagram that sensitivity experiment detects 100ng/ μ L legionella pneumophilia O4;
Figure 16 utilizes gene chip of the present invention to carry out the results of hybridization synoptic diagram that sensitivity experiment detects 10ng/ μ L legionella pneumophilia O4;
Figure 17 utilizes gene chip of the present invention to carry out the results of hybridization synoptic diagram that sensitivity experiment detects 1ng/ μ L legionella pneumophilia O4;
Figure 18 utilizes gene chip of the present invention to carry out the results of hybridization synoptic diagram that sensitivity experiment detects 0.1ng/ μ L legionella pneumophilia O4.
Embodiment
For let above and other objects of the present invention, feature and advantage can be more obviously understandable, below special lift preferred embodiment, and cooperate Figure of description, elaborate as follows.
Embodiment 1The design of probe and preparation
Sequence obtains:
(1) legionella pneumophilia O1
WztThe acquisition of gene: obtain legionella pneumophilia O1's from the download of GenBank public database
WztGene order;
(2) legionella pneumophilia O4, O12, O13, O15
WzmGene order is decoded by this laboratory and is obtained;
(3) legionella pneumophilia O2, O3, O5, O6, O7
WztGene is decoded by this laboratory and is obtained;
(4) legionella pneumophilia O11
WecThe A gene is decoded by this laboratory and is obtained;
(5) acquisition of 16S rRNA gene order: obtain whole 16S rRNA gene orders of legionella pneumophilia and whole 16S rRNA gene orders of nearly edge bacterium thereof from the download of GenBank public database.
2. probe design is for example:
The probe of legionella pneumophilia O1: with legionella pneumophilia O1's
WztGene order imports in the Glustal X software, chooses one and represents sequence in common data NCBI, to do the Blastn comparison, and confirming could be as the position of special target spot and special target spot.Sequence is imported in OligoArray 2.0 softwares.Parameter setting is following :-n 20;-l 30;-L 40;-D 3000;-t 79;-T 90; 65 ℃ of-s; 65 ℃ of-x;-N 2;-p 33, and-P 65;-m GGGGG CCCCC TTTTT AAAAA;-g 15.The online designing probe of working procedure.
3. probe is synthetic: 5 ' of the probe sequence in the following table 1 is held to add entrust probe Synesis Company (Beijing AudioCodes company) synthetic, subsequent use after T extends to 40 bp and amination.
4. probe screening: will synthesize the good also an amount of dilution of probe dissolving back and on glass chip, process gene chip, and carry out the probe screening, and finally obtain being used to prepare the required special probe of gene chip of the present invention through hybrid experiment with gene chip sample applying appearance point.
The method of design of other probe is identical with legionella pneumophilia O1 probe design method, and the design variable of use is also identical.
The present invention carries out the probe screening through hybrid experiment repeatedly, and the preferred probes that obtains is as shown in table 1:
Sequence oligonucleotide probe of selecting for use on table 1. gene chip of the present invention and detectable legionella pneumophilia
SEQ ID | The probe numbering | Sequence (5'-3') | Detect serotype |
NO:1 | NO.1 | CAGTCATGGATATCACTCGCGACTATCTC | Be used to detect legionella pneumophilia O1 |
NO:2 | NO.2 | GCGAAATATAAATCGGAACAGGTTTGG | Be used to detect legionella pneumophilia O1 |
NO:3 | NO.3 | CAACTCCGGATTGGTAAATAAAATTTATTTT | Be used to detect legionella pneumophilia O4 |
NO:4 | NO.4 | CGGTTTAATTATAATTTGCGCCACCATTTATG | Be used to detect legionella pneumophilia O4 |
NO:5 | NO.5 | GTTAGCAGTTGGAGATCAGGATTTTCA | Be used to detect legionella pneumophilia O2 |
NO:6 | NO.6 | GCCATGATATGAGTGCTATTGAATCGATTTG | Be used to detect legionella pneumophilia O2 and O3 |
NO:7 | NO.7 | TATTAGCAGTAGGAGATCAAGATTTTCAAA | Be used to detect legionella pneumophilia O2 |
NO:8 | NO.8 | AGGAAAGAGTACTTTACTGAAAATTTTATCCA | Be used to detect legionella pneumophilia O5 |
NO:9 | NO.9 | AGCCAAGGTGGTTGTTTCAGATTCGCAAACT | Be used to detect legionella pneumophilia O5 |
NO:10 | NO.10 | CCAAATATCACCTGGCGAACGCATAGGTTTAA | Be used to detect legionella pneumophilia O5 |
NO:11 | NO.11 | ATCCAGAATAACTACTCCGACTTATGGTGAA | Be used to detect legionella pneumophilia O5 |
NO:12 | NO.12 | TAGATTCAATTGCAAGATCTCATGCCC | Be used to detect legionella pneumophilia O6 |
NO:13 | NO.13 | ACAAGGTTCTTATTCATTCTCTTAAGCTTT | Be used to detect legionella pneumophilia O6 |
NO:14 | NO.14 | CTGTGTAGAGCTTAATTGTGTGAGATTATTGG | Be used to detect legionella pneumophilia O7 |
NO:15 | NO.15 | TATTATTTATTTTCTTACACCGCATTATTG | Be used to detect legionella pneumophilia O11 |
NO:16 | NO.16 | TCATCTCATATTGATTCAGTTAATTAGTTT | Be used to detect legionella pneumophilia O11 |
NO:17 | NO.17 | CATATTGATTCAGTTAATTAGTTTATTATTCAT | Be used to detect legionella pneumophilia O11 |
NO:18 | NO.18 | GATTATAAATCACGAAAAATGGTTTAGCCCT | Be used to detect legionella pneumophilia O11 |
NO:19 | NO.19 | CAGTTATAGAGATGCACTAAATGGTCGAT | Be used to detect legionella pneumophilia O12 and O15 |
NO:20 | NO.20 | TTCACCTCATTGGTTAAGATTCTGGTATG | Be used to detect legionella pneumophilia O12 and O15 |
NO:21 | NO.21 | TGCCACAGTTTATGATAAACTTAATTATCA | Be used to detect legionella pneumophilia O13 |
NO:22 | NO.22 | CCTACTATTTGTTATTCAAGCAATGTTT | Be used to detect legionella pneumophilia O13 |
NO:23 | NO.23 | TTTGTACCACTGGCATTACAATTTTATTAT | Be used to detect legionella pneumophilia O13 |
With reference to Fig. 1, be gene chip structure and shape synoptic diagram of the present invention, the top of this gene chip is the point sample district, and the bottom is a label area, and wherein regular distribution has dot matrix area in the point sample district.The lattice position of probe on glass chip is: the upper end of the first horizontally-arranged dot matrix area is 9.25mm apart from the top of glass chip; Left side dot matrix offset is 4.5mm from left side, the right side dot matrix offset of glass chip from the right side of glass chip; Transverse distance between two dot matrix areas is 13.5mm with vertical distance, and the distance between the 3rd horizontally-arranged dot matrix area and the 4th horizontally-arranged dot matrix area is 13.5mm.
With reference to Fig. 2, be the single point array structure synoptic diagram of chip of the present invention, Cy3 wherein representes fluorescent probe, and OA532 is over against the photograph probe, and WL-4006 is negative contrast probe.The nucleotide sequence of the numeral that numbering wherein is corresponding is consistent with the nucleotide sequence shown in the table 1.
Embodiment 2Primer design and preparation
1. design of primers is for example:
(1) owning legionella pneumophilia O1
WztGene order imports in the Glustal X software; Therefrom choosing a representational sequence imports in Primer Primier 5.0 softwares; Preseting length 70bp-10bp; G+C% value 40%-60%, Hairpin:NONE, Dimer:NONE, False Priming:NONE, Cross Dimer:NONE.And seek out the nucleotide sequence district that is fit to the universal primer design, its characteristics meet the following conditions basically: a), this conserved regions should comprise legionella pneumophilia O1's
WztB), this zone should include the variable region that is easy to the specific probe design, and the difference that guarantees Nucleotide between probe is greater than more than 4; C), these both sides, zone are that conserved regions can satisfy primer design; D), the primer extension product that is designed is unsuitable excessive, otherwise influences the susceptibility of PCR.Design O1's
WztThe primer extension product size is 369bp.
(2) to legionella pneumophilia O4, O12, O13, O15
WzmGene, legionella pneumophilia O2, O3, O5, O6, O7's
WztGene, legionella pneumophilia O11's
WecAThe primer design method of gene order is identical with (1).
(3) primer design method in the legionella pneumophilia 16S rRNA gene is identical with (1).
Other primer design method is identical with above-mentioned probe primer method, and the design variable of use is also identical.
2. primer is synthetic: the primer sequence in the table 2 is entrusted probe Synesis Company (Ying Jun biotech company) synthetic (PAGE purifying), and subsequent use.
Table 2. is used for the pcr amplification primer sequence that the water body legionella pneumophilia detects
SEQ ID | Numbering | Sequence (5 '-3 ') | The primer effect |
NO:24 | P1 | TGCAGCAAGCAAAAGTTCAG | Legionella pneumophilia O1 serotype is used to increase wztThe upstream primer of gene |
NO:25 | P2 | CAACTCCGGATTGGTAAA | Legionella pneumophilia O4 serotype is used to increase wzmThe upstream primer of gene |
NO:26 | P3 | TTCAGAAATCCTCTGGAAG | Legionella pneumophilia O2 and O3 serotype are used to increase wztThe upstream primer of gene |
NO:27 | P4 | ATAATAAAGCAAGCCTTGAT | Legionella pneumophilia O5 serotype is used to increase wztThe upstream primer of gene |
NO:28 | P5 | TAAAGATATTGTAGAGAGCCAGC | Legionella pneumophilia O6 serotype is used to increase wztThe upstream primer of gene |
NO:29 | P6 | TTAAGTGCGGACTACCCA | Legionella pneumophilia O7 serotype is used to increase wztThe upstream primer of gene |
NO:30 | P7 | TTGAATTCATTATTTCTTTTCG | Legionella pneumophilia O11 serotype is used to increase wecAThe upstream primer of gene |
NO:31 | P8 | GGGGATATTCAACCGTTA | Legionella pneumophilia O12 and O15 serotype are used to increase wzmThe upstream primer of gene |
NO:32 | P9 | TTGTCATTTGTGCCACAG | Legionella pneumophilia O13 serotype is used to increase wzmThe upstream primer of gene |
Explain:
(1) P1 is used to increase legionella pneumophilia O1's
WztGene;
(2) P2 is used to increase legionella pneumophilia O4's
WzmGene;
(3) P3 is used to increase legionella pneumophilia O2/O3's
WztGene;
(4) P4 is used to increase legionella pneumophilia O5's
WztGene;
(5) P5 is used to increase legionella pneumophilia O6's
WztGene;
(6) P6 is used to increase legionella pneumophilia O7's
WztGene;
(7) the P7 legionella pneumophilia O11 serotype that is used to increase
WecAGene;
(8) P8 be used to increase legionella pneumophilia O12 and O15 serotype
WzmGene;
(9) the P9 legionella pneumophilia O13 serotype that is used to increase
WzmGene.
Embodiment 3
The specificity that is used to detect the gene typing chips of water body important pathogenic bacteria legionella pneumophilia is identified and the sensitivity detection
1, the specificity of gene chip of the present invention experiment:
Specificity with regard to be meant a probe can only be with the target gene generation hybridization of own pairing bacterial classification and can not with the gene fragment generation hybridization of other bacterial classification.This just requires us not only will carry out a large amount of bioinformatic analysis, but the unsettled situation of non-specific result or hybridization signal also can occur through the probe of bioinformatic analysis.So the probe specificity screening also needs a large amount of experiments to verify.The probe that more particularly is used for high throughput testing all must be hybridized checking with a large amount of nearly source bacterium and source far away bacterium.
Utilize and collected legionella 49 strains; Wherein reference culture 39 strains; Comprise the type strain of 15 kinds of serotypes of legionella pneumophilia and the type strain of non-legionella pneumophilia, clinical separation strain 10 strains are to chip of the present invention; Hybridize altogether 225 times, can distinguish every kind of serotype in the sensing range accurately.The hybridization figure of every kind of serotype is shown in Fig. 3-13.
2, the sensitivity of gene chip of the present invention detects:
Genome with Nanodrop quantitative criterion bacterial strain is carried out gradient dilution to 100ng/ μ L, 10ng/ μ L, 1ng/ μ L, 0.1ng/ μ L; Every kind of bacterium in the sensing range is all carried out the pcr amplification mark; Further cross experiment, the sensitivity of confirming this chip is 10ng.Sensitivity hybridization figure with legionella pneumophilia O13 serotype is an example, shown in Figure 15-18.
Embodiment 4
Utilize the method for gene chip rapid detection legionella pneumophilia serotype
1, sample preparation:
(1) the legionella pneumophilia bacterial strain that collection is obtained, on the BCYE flat board, 37 ℃, 5%CO
2Cultivated 2-3 days;
(2) add 2 mL sterilized waters on the BCYE flat board, aseptic glass stick is scraped gently and is got bacterium colony, is transferred in the 1.5 ml centrifuge tubes centrifugal 10 minutes of 15000 g;
(3) abandon supernatant, add 100 μ L lysates, mixing, 100 ℃ of water-baths 10 minutes;
(4) the last split product 15000g that obtains of step is centrifugal 5 minutes;
(5) collect supernatant, promptly contain genomic dna in the supernatant, promptly can be used for detecting or-20 ℃ of preservations.
Attach: the lysate prescription:
50?mmol/L?NaOH
10?mmol/L?Tris-HCl?(pH?8.0)
0.5%?Tween-20
0.5%?NP-40
0.5?mmol/L?EDTA?(pH?8.0)
5%?Chelex-100
2, amplified target sequence: the 3 μ L supernatants of getting the extraction of said gene group process for extracting add in the PCR reaction mixture as template; Multi-PRC reaction divides A/B two groups to carry out.PCR reaction PCR reaction mixture prescription is as shown in table 3 below.(annotate: the PCR damping fluid in the following table 3-table 4, MgCl
2, the dNTP mixture, the Taq enzyme is all available from Sangon company).
Table 3. PCR reaction mixture prescription
Reaction tubes is put into PCR appearance (Biometra), and the loop parameter of setting is following:
94 ℃ 5 minutes
94 ℃ 30 seconds
57 ℃ 40 seconds
Got back to second step, totally 35 circulations in 30 seconds for 72 ℃
72 ℃ 5 minutes
3, fluorescent mark target sequence: get 10 μ L amplified productions, add in the mark mixed solution, the labeled reactant mixture formula is as shown in table 4 below.
Table 4. labeled reactant mixture formula
Be 0.4 μ mol/L.
Reaction tubes is put into PCR appearance (Biometra), and the loop parameter of setting is following:
94 ℃ 5 minutes
94 ℃ 30 seconds
57 ℃ 40 seconds
Got back to second step, totally 35 circulations in 30 seconds for 72 ℃
72 ℃ 5 minutes;
4, hybridization: place 65 ℃ of baking ovens to dry marked product, in hybridizing box (Bo Ao company), add 70 μ L ddH in advance
2O is to keep humidity.Getting 18 μ L-2 hybridization solutions mixes with the oven dry marked product; And the probe array that is added in the tap water encountered pathogenic microorganism detection gene chip of preparation among the embodiment 1 is regional; Cover cover plate (rich Company products difficult to understand; Production number 430042) (note between cover plate and the slide glass bubble being arranged), cover tight hybridizing box, hybridization is 12 hours in 44 ℃ of water-baths.
Hybridization solution prescription: 25% formamide, 0.1% SDS, 6 * SSPE.
5, washing: when hybridizing to, take out hybridizing box, remove cover plate, gene chip was washed 3 minutes in washing lotion A successively, washing is 3 minutes among the washing lotion B, and washing is 90 seconds among the washing lotion C, and is air-dry in the air.
Washing lotion A:1 * SSC (sodium-chlor-sodium citrate soln); 0.1% SDS
Washing lotion B:0.05 * SSC
Washing lotion C:95% ethanol
6, scanning: with GenePix personal 4100A biochip scanner (AXON instrument) scanning, used parameter is following:
Software and version: GenePix Pro 6.0
official?name:?575DF35
PMT?Gain:550
Scanning resolution: 10 μ m
Scanning result saves as JPG, TIF, GPR form
Hybridization scanning result when detecting the detection of pathogenic micro-organism in the tap water involved in the present invention respectively with gene chip of the present invention is respectively shown in Fig. 3-13.
7, the analysis interpretation of results of hybridization: this chip is a low density chip, and number of probes is less, and detected result can be judged by naked eyes.According to the hybridization image that scans, as image coordinate, judge the position of the specific probe that fluorescent signal occurs with the position of fluorescent probe, contrast dot matrix layout viewing is judged pathogenic agent.Wherein the positive contrast probe of OA532 has two aspect effects: show a) whether the PCR reaction system is normal, have or not inhibition to exist; B) whether the clinical sample sampling amount whether enough to reach sample preparation correct.
8, double blind experiment:
From test 35 used strain bacterial classifications select 17 strains upset the order, the numbering sequence number do double blind experiment.The experimenter is consistent with experiment participant's sentence read result through amplification label, cross experiment proof.
Conclusion: confirmed this chip detection result's safety, proved the effect of water body important pathogenic bacteria legionella pneumophilia genes typing chip.
Embodiment 5
Chip agent box of the present invention
Hybridizing box (Bo Ao company)
Hybridization solution prescription: 25% formamide, 0.1% SDS, 6 * SSPE.
Above-mentioned Taq enzyme is available from Sangon company, and hybridization solution, positive reference substance (a kind of sample that contains serotype in the legionella pneumophilia 11), negative control article (change template into ddH
2O), chip, ultrapure water, washing lotion A and washing lotion B are prepared cover plate and hybridizing box purchase Yu Boao company voluntarily by us.
Embodiment 6
Utilize the test kit of producing to carry out the analog detection of main pathogenic microbes in the tap water
When development microorganism detection chip, the emphasis that to the processing of sample is whole process also is simultaneously the key element that improves chip sensitivity with one of crucial.Because of receiving the water sample self-pollution to influence the restriction with chip sensitivity, the applying gene chip technology increases bacterium before needing carry out the pathogenic micro-organism in the water sample when pathogenic micro-organism detects in the water sample, could satisfy the requirement of gene chip detection sensitivity.If every kind of pathogenic bacterium are all undertaken increasing bacterium and selective enrichment before independent by GB regulation; This can increase the sample quantity of sampling quantity; Also strengthen the workload and the complexity of experiment simultaneously; In order to meet gene chip highly sensitive, high-throughout characteristics, we have set up the method that pathogenic micro-organism in the water sample increases bacterium fast.
1, concrete steps are:
(1) legionella pneumophilia of cultivating is scraped with SPSS from dull and stereotyped the going up of BCYE growth gently, successively gradient dilution to 10
3-10
0CFU/mL gets 1mL bacterium liquid then respectively and is incorporated in the 100 mL sterilized waters
(2) above-mentioned water sample being used the aperture is that the water system filter membrane of 0.22 μ m filters, and then filter membrane is taken off, and washes filter membrane with 2 mL SPSSs (0.85%)
(3) get 100 μ L and evenly coat on the BCYE growth flat board, 37 ℃, CO
2Cultivated 3-5 days.
(4) scrape gently with sterilized water and get the culture bacterium colony, get dna cleavage liquid (1 * PCR Buffer, 2.5 mM Mg that 1 mL bacterium liquid adds 500 μ L
2+, 0.5% NP40,0.5% Tween-20, and 0.1 ng/ μ L Proteinase K), 50 ℃ of temperature were bathed 1 hour
(5) 100 ℃ of water-baths 15 minutes
(6) 4 ℃, centrifugal 10 minutes of 12000 rpm
(7) will go up one and go on foot pcr amplification and the mark that the DNA that obtains carries out target gene
2, amplified target sequence: the 3 μ L supernatants of getting the extraction of said gene group process for extracting add in the PCR reaction mixture as template; Multi-PRC reaction divides A/B two groups to carry out.PCR reaction PCR reaction mixture prescription is as shown in table 3.(annotate: PCR damping fluid, MgCl in the table 3-table 4
2, the dNTP mixture, the Taq enzyme is all available from Sangon company).
Reaction tubes is put into PCR appearance (Biometra), and the loop parameter of setting is following:
94 ℃ 5 minutes
94 ℃ 30 seconds
57 ℃ 40 seconds
Got back to second step, totally 35 circulations in 30 seconds for 72 ℃
72 ℃ 5 minutes
3, fluorescent mark target sequence: get 10 μ L amplified productions, add in the mark mixed solution, the labeled reactant mixture formula is as shown in table 4.
Reaction tubes is put into PCR appearance (Biometra), and the loop parameter of setting is following:
94 ℃ 5 minutes
94 ℃ 30 seconds
57 ℃ 40 seconds
Got back to second step, totally 35 circulations in 30 seconds for 72 ℃
72 ℃ 5 minutes;
4, hybridization: place 65 ℃ of baking ovens to dry marked product, in hybridizing box (Bo Ao company), add 70 μ L ddH in advance
2O is to keep humidity.Getting 18 μ L-2 hybridization solutions mixes with the oven dry marked product; And the probe array that is added in pathogenic microorganism legionella pneumophilia detection gene chip in the water body for preparing among the embodiment 1 is regional; Cover cover plate (rich Company products difficult to understand; Production number 430042) (note between cover plate and the slide glass bubble being arranged), cover tight hybridizing box, hybridization is 12 hours in 44 ℃ of water-baths.
Hybridization solution prescription: 25% formamide, 0.1% SDS, 6 * SSPE.
5, washing: when hybridizing to, take out hybridizing box, remove cover plate, gene chip was washed 3 minutes in washing lotion A successively, washing is 3 minutes among the washing lotion B, and washing is 90 seconds among the washing lotion C, and is air-dry in the air.
Washing lotion A:1 * SSC (sodium-chlor-sodium citrate soln); 0.1% SDS
Washing lotion B:0.05 * SSC
Washing lotion C:95% ethanol
6, scanning: with GenePix personal 4100A biochip scanner (AXON instrument) scanning, used parameter is following:
Software and version: GenePix Pro 6.0
official?name:?575DF35
PMT?Gain:550
Scanning resolution: 10 μ m
Scanning result saves as JPG, TIF, GPR form
7, the analysis interpretation of results of hybridization: this chip is a low density chip, and number of probes is less, and detected result can be judged by naked eyes.According to the hybridization image that scans, as image coordinate, judge the position of the specific probe that fluorescent signal occurs with the position of fluorescent probe, contrast dot matrix layout viewing is judged pathogenic agent.Wherein the positive contrast probe of OA532 has two aspect effects: show a) whether the PCR reaction system is normal, have or not inhibition to exist; B) whether the clinical sample sampling amount whether enough to reach sample preparation correct.Detected result is shown in figure 14.Figure 14 utilizes gene chip of the present invention to carry out the results of hybridization synoptic diagram that analog detection goes out legionella pneumophilia O1.
Conclusion: this gene chip detects special, and detected result is credible.
The above; It only is preferred embodiment of the present invention; Be not that the present invention is done any pro forma restriction, every foundation technical spirit of the present invention all still belongs in the scope of technical scheme of the present invention any simple modification, equivalent variations and modification that above embodiment did.
SEQUENCE?LISTING
< 110>Nankai University
< 120>test kit is used in gene typing chips of legionella pneumophilia and detection
<160> 34
<170> PatentIn?version?3.5
<210> 1
<211> 29
<212> DNA
< 213>be used to detect legionella pneumophilia O1
<400> 1
cagtcatgga?tatcactcgc?gactatctc 29
<210> 2
<211> 27
<212> DNA
< 213>be used to detect legionella pneumophilia O1
<400> 2
gcgaaatata?aatcggaaca?ggtttgg 27
<210> 3
<211> 31
<212> DNA
< 213>be used to detect legionella pneumophilia O4
<400> 3
caactccgga?ttggtaaata?aaatttattt?t 31
<210> 4
<211> 32
<212> DNA
< 213>be used to detect legionella pneumophilia O4
<400> 4
cggtttaatt?ataatttgcg?ccaccattta?tg 32
<210> 5
<211> 27
<212> DNA
< 213>be used to detect legionella pneumophilia O2
<400> 5
gttagcagtt?ggagatcagg?attttca 27
<210> 6
<211> 31
<212> DNA
< 213>be used to detect legionella pneumophilia O2 and O3
<400> 6
gccatgatat?gagtgctatt?gaatcgattt?g 31
<210> 7
<211> 30
<212> DNA
< 213>be used to detect legionella pneumophilia O2
<400> 7
tattagcagt?aggagatcaa?gattttcaaa 30
<210> 8
<211> 32
<212> DNA
< 213>be used to detect legionella pneumophilia O5
<400> 8
aggaaagagt?actttactga?aaattttatcca 32
<210> 9
<211> 24
<212> DNA
< 213>be used to detect legionella pneumophilia O5
<400> 9
agccaaggtg?gttgtttcag?attcgcaaact 31
<210> 10
<211> 27
<212> DNA
< 213>be used to detect legionella pneumophilia O5
<400> 10
ccaaatatca?cctggcgaac?gcataggtttaa 32
<210> 11
<211> 24
<212> DNA
< 213>be used to detect legionella pneumophilia O5
<400> 11
atccagaata?actactccga?cttatggtgaa 31
<210> 12
<211> 27
<212> DNA
< 213>be used to detect legionella pneumophilia O6
<400> 12
tagattcaat?tgcaagatct?catgccc 27
<210> 13
<211> 30
<212> DNA
< 213>be used to detect legionella pneumophilia O6
<400> 13
acaaggttct?tattcattct?cttaagcttt 30
<210> 14
<211> 32
<212> DNA
< 213>be used to detect legionella pneumophilia O7
<400> 14
ctgtgtagag?cttaattgtg?tgagattatt?gg 32
<210> 15
<211> 30
<212> DNA
< 213>be used to detect legionella pneumophilia O11
<400> 15
tattatttat?tttcttacac?cgcattattg 30
<210> 16
<211> 30
<212> DNA
< 213>be used to detect legionella pneumophilia O11
<400> 16
tcatctcata?ttgattcagt?taattagttt 30
<210> 17
<211> 33
<212> DNA
< 213>be used to detect legionella pneumophilia O11
<400> 17
catattgatt?cagttaatta?gtttattatt?cat 33
<210> 18
<211> 31
<212> DNA
< 213>be used to detect legionella pneumophilia O11
<400> 18
gattataaat?cacgaaaaat?ggtttagccc?t 31
<210> 19
<211> 29
<212> DNA
< 213>be used to detect legionella pneumophilia O12 and O15
<400> 19
cagttataga?gatgcactaa?atggtcgat 29
<210> 20
<211> 29
<212> DNA
< 213>be used to detect legionella pneumophilia O12 and O15
<400> 20
ttcacctcat?tggttaagat?tctggtatg 29
<210> 21
<211> 30
<212> DNA
< 213>be used to detect legionella pneumophilia O13
<400> 21
tgccacagtt?tatgataaac?ttaattatca 30
<210> 22
<211> 28
<212> DNA
< 213>be used to detect legionella pneumophilia O13
<400> 22
cctactattt?gttattcaag?caatgttt 28
<210> 23
<211> 30
<212> DNA
< 213>be used to detect legionella pneumophilia O13
<400> 23
tttgtaccac?tggcattaca?attttattat 30
<210> 24
<211> 20
<212> DNA
< 213>be used to the to increase upstream primer of legionella pneumophilia O1 serotype wzt gene
<400> 24
tgcagcaagc?aaaagttcag 20
<210> 25
<211> 18
<212> DNA
< 213>be used to the to increase upstream primer of legionella pneumophilia O4 serotype wzm gene
<400> 25
caactccgga?ttggtaaa 18
<210> 26
<211> 19
<212> DNA
< 213>be used to the to increase upstream primer of legionella pneumophilia O2 and O3 serotype wzt gene
<400> 26
ttcagaaatc?ctctggaag 19
<210> 27
<211> 20
<212> DNA
< 213>be used to the to increase upstream primer of legionella pneumophilia O5 serotype wzt gene
<400> 27
ataataaagc?aagccttgat 20
<210> 28
<211> 23
<212> DNA
< 213>be used to the to increase upstream primer of legionella pneumophilia O6 serotype wzt gene
<400> 28
taaagatatt?gtagagagcc?agc 23
<210> 29
<211> 18
<212> DNA
< 213>be used to the to increase upstream primer of legionella pneumophilia O7 serotype wzt gene
<400> 29
ttaagtgcgg?actaccca 18
<210> 30
<211> 22
<212> DNA
< 213>be used to the to increase upstream primer of legionella pneumophilia O11 serotype wecA gene
<400> 30
ttgaattcat?tatttctttt?cg 22
<210> 31
<211> 18
<212> DNA
< 213>be used to the to increase upstream primer of legionella pneumophilia O12 and O15 serotype wzm gene
<400> 31
ggggatattc?aaccgtta 18
<210> 32
<211> 18
<212> DNA
< 213>be used to the to increase upstream primer of legionella pneumophilia O13 serotype wzm gene
<400> 32
ttgtcatttg?tgccacag 18
<210> 33
<211> 49
<212> DNA
< 213>over against shining probe
<400> 33
tttttttttt?tttttttttt?tttttttttt?tactcctacg?ggaggcagc 49
<210> 34
<211> 39
<212> DNA
< 213>negative contrast probe
<400> 34
tttttttttt?tttttttttt?tttttttttt?ttttttttt 39
Claims (10)
1. gene chip that detects legionella pneumophilia comprises solid phase carrier and is fixed on the oligonucleotide probe on this solid phase carrier, it is characterized in that this oligonucleotide probe comprises at least a in the following dna fragmentation:
(1) legionella pneumophilia O4, O12, O13, O15
WzmSelected at least a dna fragmentation in the gene;
(2) legionella pneumophilia O1, O2, O3, O5, O6, O7
WztSelected at least a dna fragmentation in the gene;
(3) legionella pneumophilia O11
WecASelected at least a dna fragmentation in the gene;
The complementary DNA fragment of the dna fragmentation of (4) choosing in (1) or (2) or (3);
Above-mentioned described solid phase carrier is the sheet glass that has reactive group.
2. the described gene chip of claim 1; Wherein said oligonucleotide probe has the nucleotide sequence shown in the SEQ ID NO:1-23, or is different from SEQ ID NO:1-23 but the amino acid sequence coded aminoacid sequence identical nucleotide sequence coded with SEQ ID NO:1-23.
3. claim 1 or 2 described gene chips wherein also comprise over against contrasting probe according to probe with bearing; Has the nucleotide sequence shown in the SEQ ID NO:33-34.
The described gene chip of claim 1 preparation detect in the water body at least a pathogenic bacterium in 11 serotypes of bacterium legionella pneumophilia aspect use.
5. the method for use of the said gene chip of claim 1 is characterized in that comprising step:
(1) according to the said pathogenic bacteria of claim 1
WzmGene,
WztGene with
WecAGene design and the synthetic primer that is used for pcr amplification;
(2) genomic dna of preparation testing sample uses the primer in the step (1), treats test sample article genomic dna and carries out pcr amplification, obtains target sequence;
(3) target sequence that obtains in the markers step (2);
(4) with target sequence behind the mark and the described gene chip hybridization of claim 1;
(5) obtain hybridization signal and analyze results of hybridization with biochip scanner.
6. the described method of claim 5 is characterized in that the primer described in the step (1) comprises at least a of the nucleotide sequence shown in the SEQ ID NO:24-32.
7. a test kit that detects legionella pneumophilia is characterized in that comprising at least a of the nucleotide sequence shown in the said SEQ ID of claim 2 NO:1-23 or its complementary nucleotide sequence.
8. the described test kit of claim 7 is characterized in that also comprising that the primer of pcr amplification, this primer have nucleotide sequence at least a of SEQ ID NO:24-32.
9. test kit according to claim 8 is characterized in that also comprising hybridizing box, hybridization solution.
10. the described test kit of claim 7 detects legionella pneumophilia O1, O2, O3, O4, O5, O6, O7, O11, O12, O13 and the O15 application aspect at least a pathogenic bacterium in totally 11 kinds of serotype in preparation.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN 201210003928 CN102424862B (en) | 2012-01-09 | 2012-01-09 | Genotyping chip for legionella pneumophila, and kit for detection of legionella pneumophila |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN 201210003928 CN102424862B (en) | 2012-01-09 | 2012-01-09 | Genotyping chip for legionella pneumophila, and kit for detection of legionella pneumophila |
Publications (2)
Publication Number | Publication Date |
---|---|
CN102424862A true CN102424862A (en) | 2012-04-25 |
CN102424862B CN102424862B (en) | 2013-06-26 |
Family
ID=45958889
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN 201210003928 Active CN102424862B (en) | 2012-01-09 | 2012-01-09 | Genotyping chip for legionella pneumophila, and kit for detection of legionella pneumophila |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN102424862B (en) |
Cited By (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN103160587A (en) * | 2013-04-02 | 2013-06-19 | 南开大学 | Genetic typing chip of 10 common pathogenic legionella and detection kit |
CN105255876A (en) * | 2015-11-13 | 2016-01-20 | 广州市圣鑫生物科技有限公司 | Primers and method for legionella quick detecting and parting |
CN105256052A (en) * | 2015-11-13 | 2016-01-20 | 广州金域检测科技股份有限公司 | Reagent kit and detection method used for legionella quick detecting and parting |
CN106929573A (en) * | 2017-02-21 | 2017-07-07 | 南开大学 | Nucleotides and its application to wzm the and wecA gene specifics of legionella pneumophilia O12 types |
CN107419020A (en) * | 2017-08-10 | 2017-12-01 | 南京金域医学检验所有限公司 | Legionella pneumophilia Multilocus sequence typing PCR primer, classifying method and application |
Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP1609874A2 (en) * | 2004-05-21 | 2005-12-28 | Bioanalisi Centro Sud S.n.c. di Perseu Sinibaldo e C. | System for searching for and identifying pathogenic agents |
JP4422019B2 (en) * | 2002-06-14 | 2010-02-24 | 日立ソフトウエアエンジニアリング株式会社 | Microbe identification probe and identification method using the same |
CN102140514A (en) * | 2011-01-04 | 2011-08-03 | 天津生物芯片技术有限责任公司 | Specific primers and kit for detecting various serotype pathogenic bacteria of legionella pneumophilia |
-
2012
- 2012-01-09 CN CN 201210003928 patent/CN102424862B/en active Active
Patent Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
JP4422019B2 (en) * | 2002-06-14 | 2010-02-24 | 日立ソフトウエアエンジニアリング株式会社 | Microbe identification probe and identification method using the same |
EP1609874A2 (en) * | 2004-05-21 | 2005-12-28 | Bioanalisi Centro Sud S.n.c. di Perseu Sinibaldo e C. | System for searching for and identifying pathogenic agents |
CN102140514A (en) * | 2011-01-04 | 2011-08-03 | 天津生物芯片技术有限责任公司 | Specific primers and kit for detecting various serotype pathogenic bacteria of legionella pneumophilia |
Non-Patent Citations (8)
Cited By (9)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN103160587A (en) * | 2013-04-02 | 2013-06-19 | 南开大学 | Genetic typing chip of 10 common pathogenic legionella and detection kit |
CN103160587B (en) * | 2013-04-02 | 2015-04-22 | 南开大学 | Genetic typing chip of 10 common pathogenic legionella and detection kit |
CN105255876A (en) * | 2015-11-13 | 2016-01-20 | 广州市圣鑫生物科技有限公司 | Primers and method for legionella quick detecting and parting |
CN105256052A (en) * | 2015-11-13 | 2016-01-20 | 广州金域检测科技股份有限公司 | Reagent kit and detection method used for legionella quick detecting and parting |
CN105256052B (en) * | 2015-11-13 | 2017-06-23 | 黑龙江金域医学检验所有限公司 | A kind of kit and its detection method for Legionella quick detection and parting |
CN106929573A (en) * | 2017-02-21 | 2017-07-07 | 南开大学 | Nucleotides and its application to wzm the and wecA gene specifics of legionella pneumophilia O12 types |
CN106929573B (en) * | 2017-02-21 | 2020-06-09 | 南开大学 | Against Legionella pneumophila type O12wzmAndwecAgene specific nucleotide sequence and application thereof |
CN107419020A (en) * | 2017-08-10 | 2017-12-01 | 南京金域医学检验所有限公司 | Legionella pneumophilia Multilocus sequence typing PCR primer, classifying method and application |
CN107419020B (en) * | 2017-08-10 | 2018-11-20 | 南京金域医学检验所有限公司 | Legionella pneumophilia Multilocus sequence typing PCR primer, classifying method and application |
Also Published As
Publication number | Publication date |
---|---|
CN102424862B (en) | 2013-06-26 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN101748192B (en) | Gene chip of main pathogenic microorganism in drinking water and testing kit | |
CN101113475B (en) | Primer for detecting pathogenic microorganism and multiple PCR using the same | |
JP2010537650A (en) | Method for detecting bacteria and fungi | |
CN102424862B (en) | Genotyping chip for legionella pneumophila, and kit for detection of legionella pneumophila | |
CN103898108B (en) | The nucleotide special to vibrio fluvialis O2, O4, O13, O15 and O18 and application thereof | |
CN104862406A (en) | Primer and probe for on-site rapid detection of mycobacterium tuberculosis complex and kit thereof | |
CN101748193B (en) | Gene chip for detecting pathogens of lower respiratory tract and reagent kit | |
CN102140507B (en) | Detection genetic chip and detection kit for infectious diarrhea | |
CN103421898A (en) | Triple real-time fluorescent PCR (polymerase chain reaction) detection primer, detection probe, detection kit and detection method for methicillin-resistant staphylococcus aureus | |
CN103160587B (en) | Genetic typing chip of 10 common pathogenic legionella and detection kit | |
CN102634596B (en) | The specific detection of Bordetella pertussis and Bordetella parapertussis primed probe combination and test kit | |
CN105980577A (en) | Nucleic acids and methods for detecting pathogens and beneficial microorganisms | |
CN107312849B (en) | CPA detection method for detecting mycoplasma bovis, kit and application thereof | |
CN103451310B (en) | Gene chip capable of simultaneously detecting various vibrios and method for detecting vibrios | |
CN1724686B (en) | Target sequence used for detecting mycoplasma pnoumoniae and reagent box | |
CN100404691C (en) | Method of detecting bioterror related pathogen bacteria and its special DNA chip | |
CN102168131B (en) | Primer for amplifying specific regions of common pathogenic type Legionella gyrB genes and application thereof | |
CN1328391C (en) | Gene chip for detecting B group of streptococcus, detection method and kit for detection | |
CN103060447A (en) | Primers, probes, a test kit and a test method for triple real-time fluorescence PCR detection of four bacteria | |
CN102260738A (en) | Oligonucleotide gene chip and application of oligonucleotide gene chip to detection of various bacteria | |
KR100611056B1 (en) | Oligonucleotide microchip and method for the detection of pathogenic microorganisms using same | |
CN107475401A (en) | The method and primer of food-borne bacillus cereus are detected using loop-mediated isothermal amplification technique | |
CN105524988A (en) | Kit for rapid detection of Mycobacterium tuberculosis in sputum | |
CN102827930B (en) | Method for building helicobacter pylori nucleic acid fingerprint spectrum and product thereof | |
CN105256028B (en) | The nucleotide special to citric acid bacillus 017 and O39 and its application |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C14 | Grant of patent or utility model | ||
GR01 | Patent grant |