CN106929573A - Nucleotides and its application to wzm the and wecA gene specifics of legionella pneumophilia O12 types - Google Patents
Nucleotides and its application to wzm the and wecA gene specifics of legionella pneumophilia O12 types Download PDFInfo
- Publication number
- CN106929573A CN106929573A CN201710091774.3A CN201710091774A CN106929573A CN 106929573 A CN106929573 A CN 106929573A CN 201710091774 A CN201710091774 A CN 201710091774A CN 106929573 A CN106929573 A CN 106929573A
- Authority
- CN
- China
- Prior art keywords
- seq
- types
- nucleotides
- legionella pneumophilia
- primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to a kind of to legionella pneumophilia serotype O12 typesWzm and wecAThe nucleotides of gene specific and its application, the nucleotides is：SEQ ID NO:Nucleotides and/or SEQ ID NO shown in 1:Nucleotides shown in 2；SEQ ID NO:Nucleotides and/or SEQ ID NO shown in 3:Nucleotides shown in 4；With the nucleotides of above-mentioned nucleotide complementary.These nucleotides can be used to prepare PCR kit, genetic chip or the microarray of detection legionella pneumophilia serotype O12 types.The present invention is to legionella pneumophilia serotype O12 typesWecA and wzmPractical, the PCR kit compound method simplicity of the nucleotides of gene specific and the PCR kit comprising the nucleotides, genetic chip or microarray, detection cycle is short, speed is fast, workable, it is easy to merchandized handling, and testing cost is relatively low；Accuracy is high；Sensitivity is high.
Description
Technical field
It is particularly a kind of to legionella pneumophilia serotype O12 types the present invention relates to a kind of nucleotides and its application
(Legionella pneumophila serogroup's 12)wzmGene (abc transport of LPS O- antigens, ABC
Transporter of LPS O-antigen, hereinafter referred to aswzmGene)WithwecAGene（UDP-GleNAe:Und-
PGleNAe-l- P transferases, participate in the biosynthesis of O antigens）Special nucleotides and its application, by these special cores
Thuja acid accurately can mutually differentiate legionella pneumophilia O12 types with other serotypes of legionella pneumophilia.
Background technology
Legionella is gained the name in " mystery illness " of the outburst of 1976 July, and this disease has infected 221 people, caused 34 people dead
Die.Outburst for the first time is found in the American Legion for having participated in the tercentenary activity of the U.S. 200 held in Philadelphia
In the crowd of meeting.After six months, pathogen is confirmed as bacterium unknown before, then because the reasons why this is obvious
It is named as Legionella.Legionella be one kind without brood cell's gram-Negative bacillus, it is stronger to factor of natural environment resistance, mainly
It is to cause infectious respiratory disease, can be in atmosphere spread by way of aerosol, the mankind can be because gas of the suction containing bacterium be molten
Glue and infect, cause legionaires' disease（Legionnaires disease, LD）
In the not a period of time long after legionella pneumophilia is identified, it is isolated out more than 50 kinds of Legionella, wherein at least
It is related to human diseases to have 24 kinds.Common are legionella pneumophilia（Legionella pneumophila, LP）, Michaelis
Legionella（Legionella micdadei）, Legionella bozemanii（Legionella bozemanii）, Fei Shi Legionella
（Legionella feeleii）, Du Mofu Legionella（Legionella dumoffii）And Legionella longbeachae
（Legionella longbeachae）Deng.The people of immunologic hypofunction may be infected by any kind of Legionella.
In these Legionella being found, legionella pneumophilia is the closest with human diseases relation.According to O antigens not
Together, legionella pneumophilia can be divided into 15 serotypes.It is most of（About 90%）Legionaires' disease case, caused by legionella pneumophilia.
The O1 serotypes of legionella pneumophilia are to cause the arch-criminal of the legionaires' disease case in world wide more than 84%.
Legionella pneumophilia is aerobic gram negative bacilli, and facultative intracellular bacterial parasite without pod membrane, does not produce acid, not aerogenesis, has
One to several side flagellums or end flagellum, movable, thalline is long 2-50 μm, wide 0.5-1 μm.The bacteria growing nutritional requirement is higher,
Cysteine, methionine and iron ion etc., in activated carbon-yeast leachate agar are needed during growth（ BCYE）Culture medium
On can grow, on GVPC flat boards be in canescence, there is hyacinthine gloss at edge, has provoked wire drawing；Containing 2.5 % -5.0 %
CO2Grown very well in environment, do not grown under anaerobic condition.Optimum temperature is 35 DEG C -36 DEG C, with certain resistance to
Acid and heat resistance colony colour is general in canescence, purple, blueness or green, but in common blood plate, plain agar or skilful
Do not grown on gram force agar.
Legionella pneumophilia can survive more than 400 days in ordinary tap water, at 60 DEG C or so even near volcanic crater
The trace of Legionella can be found in pool.The case of China's report is mostly legionella pneumophilia serum O1 types, O5 types, O6 types.
The 2.4 %-8.4 % in European and American countries legionella pneumophila pneumonia accounts for pneumonia case.
With the development of molecular engineering particularly round pcr, many molecular biology methods are used for legion's bacterium molecule point
Type and epidemiological study.Having been used for 4 kinds of conventional molecule parting technologies of Legionella parting at present is：DNArandom amplified polymorphic DNA
DNA (Random Amplified Polymorphic DNA, RAPD), PFGE (Pulsed-Field Gel
Electrophoresis, PFGE), AFLP (Amplified fragment length
Polymorphism, AFLP), Gene identification (Sequence-based typing, SBT).Because it can once be separated
Go out a large amount of DNA fragmentations, and with easy to operate, the advantage such as repetitive rate is good, successively for Molecular Subtyping of Legionella and epidemiology
Investigation.
Polymerase chain reaction technology (Polymerase chain reaction, abbreviation round pcr) is examined as microorganism
The technology of survey is currently accepted and promoted, and the technology has high flux, detection speed fast, special relative to traditional method
Property it is strong, the advantages of sensitivity is high, sample need to only be carried out it is simple it is pre- increase bacterium or increase bacterium process, then by being centrifuged and prepared by cracking
DNA of bacteria template, it is possible to high specific primer mediation under PCR during expand target sequence, reach detection sample in
Whether the purpose of to be measured invasive organism is contained.The PCR amplification procedures of each step only need 2 hours.This is to inspection and quarantine
Department and clinical examination undoubtedly greatly improve operating rate and reduce job costs.
The analysis of system showswzmGene is the exclusive characterizing gene of O antigen genes, can be used as molecule
The target gene of parting.wecAGene participates in the synthesis of the O- antigens of lipopolysaccharides, it is also possible to differentiate different as target gene
Serotype.
The Genotyping of the legionella pneumophilia of the application of the applicant Nankai University 2012 and detection with kit this
In patent, there is provided several 11 serotypes that can be used for legionella pneumophilia carry out the sequence oligonucleotide probe of parting.But
The probe and method provided using this patent cannot distinguish between and identify the nearer legionella pneumophilia O12 of affinity and O15 serum
Type.The present invention is for O12 typeswecAWithwzmGene is target gene, devises two pairs of special nucleotide sequence primers, can be with
Accurately, the O12 serotypes of legionella pneumophilia are sensitively detected, and it is distinguished well with O15 serotypes.In Shi Fei armies
O12 serotypes are more difficult compared with O15 serotypes are than other serotypes in 15 Genotypings of known serotype of group bacterium
Differentiate, at present, also without the report that can quickly distinguish O12 and O15 serotype discrimination methods.
The content of the invention
It is an object of the invention to provide a kind of to legionella pneumophilia serotype O12 typeswzmGene andwecAGene is special
Different nucleotides, can whereby distinguish O12 types with other serotypes of legionella pneumophilia by technological means.The nucleotides
For：
1）SEQ ID NO:Nucleotides and/or SEQ ID NO shown in 1:Nucleotides shown in 2；SEQ ID NO:Core shown in 3
Thuja acid and/or SEQ ID NO:Nucleotides shown in 4
2）With 1）The nucleotides of shown nucleotide complementary.
Above-mentioned nucleotides can be used for preparing detection legionella pneumophilia serotype O12 typeswzmGene andwecAGene
PCR kit；The legionella pneumophilia serotype O12 types can sample in running water, mineral water, air conditioning cooling water culture
Crude extract, or legionella pneumophilia serotype O12 types the crude extract of pure culture etc., using conventional phenol chloroform legal system
It is standby.
The present invention also provides a kind of two-step method PCR kit, including PCR primer, dNTP, buffer solution and archaeal dna polymerase, institute
Stating PCR primer includes above-mentioned nucleotides；Wherein described PCR primer is preferably such as SEQ ID NO:1 and/or SEQ ID NO:
Nucleotides and SEQ ID NO shown in 2:3 and/or SEQ ID NO:Nucleotides shown in 4.
SEQ NO:1 GGGGATATTCAACCGTTA specific amplified legionella pneumophilia serotype O12 typeswzmOn gene
Trip primer
SEQ NO:2 TAAATCCTATTACAAATATAGC specific amplified legionella pneumophilia serotype O12 typeswzmUnder gene
Trip primer
SEQ NO:3 ATTATATCATCATCCCTTTT specific amplified legionella pneumophilia serotype O12 typeswecAUpstream region of gene
Primer
SEQ NO:4 CTGTGTCCAACTCAATAAT specific amplified legionella pneumophilia serotype O12 typeswecADownstream of gene
Primer
Above-mentioned two-step pcr detection kit can include following reagent： 10 mM dNTP 60μL；The reaction of 10 × enzyme spcificity is slow
The μ L of fliud flushing 100；The μ L of 5 U/ μ L hot resistant DNA polymerases 10；Each 10 μ L of primer mixture in two-step pcr；The μ L of positive reference substance 20,
The μ L of negative controls 20；ddH2O 5mL。
The above-mentioned PCR kit for legionella pneumophilia serotype O12 types, whole detection needs to carry out two-step pcr amplification.
Step includes sample pretreatment-amplification-electrophoresis detection result.The examination in primer and PCR reaction systems required for two-step pcr
Agent has been previously added in amplification pipe, and user only needs just pretreated sample to be respectively added to two amplification pipes startup amplifications
Reaction, simple and quick completion detection work.
As seen from the above technical solutions, a kind of PCR reaction systems that the present invention sets up, can detect legionella pneumophilia serum
Type O12 types, the kit has the following advantages：
（1）Method is easy, cycle is short, workable:The PCR kit compound method that the present invention is prepared is easy, detection week
Phase is short, workable, it is easy to industrialization production, and testing cost is relatively low, and market application foreground is wide.PCR reagent of the present invention
If the box bacteria suspension of legionella pneumophilia enters performing PCR amplification, with the extracted DNA for obtaining as template amplification acquired results one
Cause, and susceptibility and specific indifference, the extraction step of template DNA can be saved, simplify operating process.Meanwhile, compared to routine
For biochemical detection methods, the testing sample that this method is used can be directly clinical sample nutrient solution, or to detection sample
Product carry out simple separation culture can be detected, save material resources manpower.
（2）Detection sensitivity is high：The PCR detection kit and its detection method sensitiveness that the present invention is provided are high, detection essence
Degree is high, can detect the DNA profiling of 1ng/ μ L.Common pathogen can be carried out comprehensively, system, accurately detection with mirror
It is fixed.
（3）Testing cost is relatively low：Food Hygiene Surveillance, environmental monitoring, commodity inspection quarantine can be applied to
Deng field, and for other different pathogenic bacteria detection combinations provide technology mode.
（4）Accuracy is high：The present invention is according to legionella pneumophilia O12 typeswzmGene andwecAThe specific nucleotide of gene
Sequence, designs primer.So as to constitute composite PCR detection architecture using primer, can fast and accurately by legionella pneumophilia O12
Serotype and other legionella pneumophilia serotypes are separated.
Brief description of the drawings
Fig. 1 is the first step PCR primer that kit of the present invention detects 15 serotype reference cultures of legionella pneumophilia（With
SEQ NO:1 and/or SEQ NO:2 are expanded for primer）Electrophoresis result figure, wherein：1, legionella pneumophilia O1 types G2756；2,
Legionella pneumophilia O2 types G2773；3, legionella pneumophilia O3 types G2772；4, legionella pneumophilia O4 types G2781；5, Shi Fei legions
Bacterium O5 types G3408；6, legionella pneumophilia O6 types G2771；7, legionella pneumophilia O7 types G3410；, 8, legionella pneumophilia O8 types
G2820；9, legionella pneumophilia O9 types G2774；10, legionella pneumophilia O10 types G2818；11, legionella pneumophilia O11 types
G2824；12, legionella pneumophilia O12 types G2822；13, legionella pneumophilia O13 types G2819；14, legionella pneumophilia O14 types
G2817；15, legionella pneumophilia O15 types G2829；M, DL2000 DNA marker；
Fig. 2 is the second step PCR primer that kit of the present invention detects 15 serotype reference cultures of legionella pneumophilia（With SEQ
NO:3 and/or SEQ NO:4 levy for primer carries out expansion）Electrophoresis result figure is wherein：1, legionella pneumophilia O12 types G2822；2, it is thermophilic
Lung Legionella O15 types G2829；M, DL50 DNA marker.
Specific embodiment
The present invention is described below by specific embodiment.Unless stated otherwise, technological means used in the present invention is
Method known in those skilled in the art.In addition, embodiment is interpreted as illustrative, to be not intended to limit the present invention model
Enclose, the spirit and scope of the invention are limited only by the claims that follow.To those skilled in the art, without departing substantially from this hair
On the premise of bright spirit and scope, the various changes or change carried out to the material component and consumption in these embodiments also belong to
In protection scope of the present invention.Raw materials used and reagent of the invention is commercially available.To ensure above and other objects of the present invention
Feature and advantage more perspicuousness, below especially exemplified by preferred embodiment, in combination with Figure of description and instantiation to the present invention
Describe in further detail；
Embodiment 1
The extraction of genome
（1）In superclean bench, from reference culture（It is shown in Table 2）Preservation pipe in draw a small amount of bacterium solution, streak inoculation to legion
Bacterium BCYE（Qingdao hi-tech industry garden Hai Bo Bioisystech Co., Ltd）On growth flat board, 37 °C, 5.0% CO2Culture 5-7
My god.
（2）To 2mL sterilized waters are added in BCYE growth flat boards, lawn is gently swept with aseptic round end glass bar, then will
Bacteria suspension is drawn onto in 1.5 mL centrifuge tubes, and 8000 rpm are centrifuged 5 minutes, abandons supernatant, and repetition is washed once.
（3）Add mM Tris-HCl buffer solutions (pH 8.0) of 250 μ L 50 resuspended, 12000 rpm are centrifuged 5 minutes, abandon
Supernatant.
（4）Add mM Tris-HCl buffer solutions (pH 8.0) of 250 μ L 50 resuspended, then add 10 μ L 0.45M EDTA
(pH 8.0), fully suspends, 37 DEG C of warm bath 20 minutes.
（5）Add the mg/mL lysozymes of 10 μ L 20,37 DEG C of warm bath 20 minutes.
（6）The mg/mL Proteinase Ks of 1.5 μ L 20 are added, it is soft to mix.
（7）15 μ L 10%SDS are added, 50 DEG C of water-baths are clarified for 2 hours to solution, and period gently overturns and mixes several times.
（8）Plus 2 μ L 20 mg/mL RNAse, 65 DEG C of water-baths 30 minutes.
（9）With cutting off during above-mentioned solution moves on to new clean centrifuge tube by the pipette tips of tip.
（10）250 μ L phenol are added in fume hood：Chloroform：Isoamyl alcohol（25：24：1）, fully mix, 12000 rpm,
4 DEG C are centrifuged 10 minutes, and supernatant is transferred to new centrifuge tube, is repeated once.
（11）250 μ L chloroforms are added in fume hood：Isoamyl alcohol（24：1）, fully mix, 12000 rpm, 4 DEG C of centrifugations
10 minutes, supernatant was transferred to new centrifuge tube.
（12）2.5 times of absolute ethyl alcohols of the precooling in advance of volume, jog are added to precipitate DNA in -80 DEG C.12000 rpm,
4 DEG C of 15 min of centrifugation.
（13）DNA precipitations are washed with the ice ethanol of 1 mL 70%, then at 65 DEG C, 10 min drying.
（14）Dissolved with 30 μ L TE, and it is standby in -20 °C of refrigerators.
DNA extraction effects are detected with the agarose gel electrophoresis of 1.0 %, while measuring DNA with NanoDrop2000 OD instrument
Purity and concentration.
Embodiment 2
The design of primer
Design of primers is key of the invention.The O- antigen gene cluster sequences of legionella pneumophilia serotype O12 types are this laboratories
Test oneself, analyzed by comparing, choosewzmWithwecAGene as the bacterium specific target gene, for legionella pneumophilia O12 types
'swzmWithwecAThe special area design primer of gene；As shown in table 1：
wzmThe sense primer of gene is 5 '-GGGGATATTCAACCGTTA -3 ', sees sequence SEQ ID NO:1；Anti-sense primer
It is 5 '-TAAATCCTATTACAAATATAGC -3 ', sees sequence SEQ ID NO:2.
wecAThe sense primer of gene is 5 '-ATTATATCATCATCCCTTTT-3 ', sees sequence SEQID NO:3;Downstream
Primer is 5 '-CTGTGTCCAACTCAATAAT-3 ', sees sequence SEQID NO:4；
The specific primer sequences of the legionella pneumophilia serotype O9 types of table 1
Embodiment 3
The screening of special primer
Have collected 1 plant of legionella pneumophilia O12 type reference culture, 14 plants of reference cultures of legionella pneumophilia other serotypes, bacterial strain
Numbering and source see the table below 2.
Reference culture of the table 2 for examination
PCR system is divided into two parts, and the PCR system of each section is 10 μM of the μ L of primer 0.4, the μ L of 10 × buffer 2.5,10
The μ L of mM dNTP 0.25, the μ L and 3 μ L of 5 U/ μ L Taq polymerases 0.2 testing sample template to 0.2 mL thin-walled PCR
Guan Zhong, finally uses ddH2O complements to 25 μ L.
The primer SEQ ID NO:1 and/or SEQ ID NO:2 obtain in the template of legionella pneumophilia O12 types and O15 types
To positive findings, any PCR primer band is not obtained in other groups；SEQ ID NO:3 and/or SEQ ID NO:4 in O15
There is no PCR primer band in type, and positive findings is obtained in O12 types.So these oligonucleotide fragments are high specials.
Embodiment 4
PCR detection kit
First, the preparation of test experience material requested and equipment
1. kit forms：
dNTP(10mM) 60μl；
The μ l of 10 × Buffer (10 × enzyme spcificity reaction buffer) 100；
Taq polymerase（5U/ μ l hot resistant DNA polymerases） 10μl；
PCR primer mixture（5μM） 20μl；
The μ l of positive reference substance (KP) 20；
Negative controls（KN） 20μl；
ddH2O 5ml；
Each kit can be used to detect 10 samples.
Wherein 10 × buffer, dNTP, Taq polymerase are by precious bioengineering（Dalian）Co., Ltd provides；Primer is mixed
Compound is supplied to Shanghai Ying Jun biotech companies to synthesize for the sequence of designed, designed；Positive reference substance（Contain legionella pneumophilia
The sample of O12 types）, negative controls（Change template into ddH2O）And ddH2O is voluntarily prepared by us.
The method for carrying out the detection of legionella pneumophilia O12 types using above-mentioned PCR detection kit is divided into two-part PCR and reacts
Comprise the following steps：
（1）First step PCR：DNTP, 10 × enzyme spcificity reaction buffer, Taq polymerase, P1-P2 are added in PCR light-wall pipes
Primer, testing sample template and ddH2O, is mixed, and reaction tube is put into PCR instrument (Biometra), and the loop parameter of setting is such as
Under：
94 DEG C 5 minutes
94 DEG C 30 seconds
57 DEG C 40 seconds
72 DEG C return to second step in 50 seconds, totally 35 circulations
72 DEG C 5 minutes
（2）Second step PCR：DNTP, 10 × enzyme spcificity reaction buffer, Taq polymerase, P3-P4 are added in PCR light-wall pipes
Primer, testing sample template and ddH2O, is mixed, and reaction tube is put into PCR instrument (Biometra), and the loop parameter of setting is such as
Under：
94 DEG C 5 minutes
94 DEG C 30 seconds
50 DEG C 40 seconds
72 DEG C return to second step in 50 seconds, and totally 35 circulate 72 DEG C 5 minutes
（4）The product of twice PCR is carried out into electrophoresis in electrophoresis equipment respectively, result is recorded
1）3 μ L amplified productions and 10 × bromophenol blue sample-loading buffer are taken with 9：1 volume ratio mixing；
2）Mixed liquor is splined on 2% Ago-Gel；
3）By agarose gel electrophoresis 120V voltage stabilizings electrophoresis about 15 minutes, carried out with DL2000 Marker and/or DL50marker
Control；
4）Observe and record result.
（5）Analyze and carry out result judgement.
Electrophoresis result shows that the testing sample for only all having product band to produce in two-step pcr product is accredited as thermophilic
Lung Legionella O12 serotypes, judge the serotype of testing sample if without product band or only One_step PCR has product band
It is not O12 types.
The present invention by preparing a kind of detectable legionella pneumophilia serotype O12 types, can merchandized handling PCR reagent
Box, the composition that PCR detection method is needed to use is combined, and when using, extracts testing sample, the behaviour for carrying out two-step pcr
Making program can just carry out sensitive, quick, easy detection, and the consumption and concentration of each component are experiment institute in detection kit
, detecting that the testing equipment that legionella pneumophilia O12 types are used is simple with the kit, testing cost is low.
The use of the purpose of positive and negative controls is for Quality Control whole operation process, to draw accurately judgement.
The amount of reagent that one-time detection of the present invention is tested in used kit see the table below shown in 4, and DNA profiling amount is 0.5 μ
L。
Amount of reagent in the kit that the one-time detection of table 3 experiment first step PCR is used
Amount of reagent in the kit that the one-time detection of table 4 experiment second step PCR is used
Hot resistant DNA polymerase in the present invention is Taq polymerase.
Above-mentioned positive reference substance is to have determined that it is the sample containing legionella pneumophilia O12 types, and negative controls are then
ddH2O。
2. instrument and equipment
SANYO high-pressure sterilizing pots（SANYO companies）；T Gradient PCR instruments（Biometra companies）；
Various model pipettors（Eppendorf companies）；Sigma1-13K centrifuges（Sigma companies）；5804R at a high speed freeze from
Scheming（Eppendorf companies）；ND-2000 NanoDrop OD instruments（NanoDrop companies）；SIM-F124 ice machines（Day
This SANYO）；Ultrapure water purification system（Milli-Q）；Gel imaging instrument（UVP companies）With 0.2mL PCR light-wall pipes.
3. the offer of testing sample：Experimental strain used of the invention is as shown in table 2.
2nd, the concrete operations that detection is implemented：Above-mentioned standard bacterial strain is used into PCR provided by the present invention under similarity condition
Detection kit carries out the detection of PCR method.
1. the extraction of testing sample template
A. it is directed to reference culture
1）20 μ L connect bacterium amount, sterile working, streak inoculation in BCYE culture mediums, 37 DEG C, 5%CO2Culture 2-3 days；
2）Bacterium colony is scraped with 50mM Tris-HCl (pH8.0), 12000rpm is centrifuged 5 minutes, removes supernatant.
3）With 500 μ L ddH2The resuspended precipitations of O, 12000rpm is centrifuged 5 minutes, removes supernatant, as far as possible empty dry.
4）With 100 μ L ddH2The resuspended precipitations of O, mix, 100 DEG C of boiling water baths 10 minutes,
5）Put on ice after 10 minutes, 12000rpm is centrifuged 2 minutes.
6）Take the template that 5 μ L middle layer supernatants are reacted as PCR.
2. result judgement is carried out according to following condition, there was only O12 types and O15 types in 15 serotypes of legionella pneumophilia
There should be a band at 750bp under the conditions of first step PCR, P1-P2 primer pairs；O12 and O15 serotypes in second step PCR
It is testing sample, should only has O12 types to have a band at 526bp under the conditions of P3-P4 primer pairs.
Reference culture electrophoresis result record is shown in Fig. 1, shown in Fig. 2：All reference cultures remove legionella pneumophilia O12 types and O15
Type has outside 750bp fragments, and other bacterial strains take O12 types and O15 type genomes do template and carry out second step PCR without amplified production,
Only O12 types have band at 526bp, and O15 types are without amplified production.It is anti-that this explanation can exclude false positive using PCR detection method
Should, according to the Testing and appraisal for whetheing there is the legionella pneumophilia O12 types that above fragment is carried out, accuracy in detection improves, it is to avoid because
Lost caused by detection error.
The PCR kit obtained using above-mentioned experimental procedure, can be used to detect the serotype O12 types of legionella pneumophilia.
SEQUENCE LISTING
<110>Nankai University
<120>Nucleotides and its application to wzm the and wecA gene specifics of legionella pneumophilia O12 types
<160> 4
<170> PatentIn version 3.5
<210> 1
<211> 18
<212> DNA
<213>Artificial sequence
<400> 1
ggggatattc aaccgtta 18
<210> 2
<211> 22
<212> DNA
<213>Artificial sequence
<400> 2
taaatcctat tacaaatata gc 22
<210> 3
<211> 20
<212> DNA
<213>Artificial sequence
<400> 3
attatatcat catccctttt 20
<210> 4
<211> 19
<212> DNA
<213>Artificial sequence
<400> 4
ctgtgtccaa ctcaataat 19
Claims (5)
1. a kind of to legionella pneumophilia O12 typeswzmWithwecAThe nucleotides of gene specific, it is characterised in that described nucleosides
Acid has：
1）SEQ ID NO:Nucleotides and/or SEQ ID NO shown in 1:Nucleotides and SEQ ID NO shown in 2:Shown in 3
Nucleotides and/or SEQ ID NO:Nucleotides shown in 4；
A kind of PCR kit, including PCR primer, dNTP, buffer solution and archaeal dna polymerase, the PCR primer include above-mentioned core
Thuja acid；Wherein described PCR primer is such as SEQ ID NO:1 and/or SEQ ID NO:2 and SEQ ID NO:3 and/or SEQ ID
NO:Nucleotides shown in 4.
2. the kit described in claim 2, SEQ NO therein:1 is specific amplified legionella pneumophilia serotype O12 typeswzmUpstream region of gene primer；SEQ NO:2 is specific amplified legionella pneumophilia serotype O12 typeswzmDownstream of gene primer；SEQ
NO:3 is specific amplified legionella pneumophilia serotype O12 typeswecAUpstream region of gene primer；SEQ NO:4 is that specific amplified is thermophilic
Lung Legionella serotype O12 typeswecADownstream of gene primer.
3. the kit described in claim 2, wherein also including following reagent： 10 mM dNTP 60μL；10 × enzyme spcificity
The μ L of reaction buffer 100；The μ L of 5 U/ μ L hot resistant DNA polymerases 10；SEQ NO:1 and SEQ NO:2 primer mixtures, SEQ
NO:3 and SEQ NO:Each 10 μ L of 4 primer mixtures；The μ L of positive reference substance 20, the μ L of negative controls 20；ddH2O 5mL。
4. application of the PCR kit described in claim 2 in terms of preparing for detecting legionella pneumophilia serotype O12 types；Institute
The application stated is the purposes of non-diagnostic therapeutic purposes.
5. the application described in claim 5, wherein for detecting that legionella pneumophilia serotype O12 types refer to accurate sensitive inspection
Survey serotype and it is distinguished with O15 serotypes.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710091774.3A CN106929573B (en) | 2017-02-21 | 2017-02-21 | Against Legionella pneumophila type O12wzmAndwecAgene specific nucleotide sequence and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710091774.3A CN106929573B (en) | 2017-02-21 | 2017-02-21 | Against Legionella pneumophila type O12wzmAndwecAgene specific nucleotide sequence and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106929573A true CN106929573A (en) | 2017-07-07 |
| CN106929573B CN106929573B (en) | 2020-06-09 |
Family
ID=59423819
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710091774.3A Active CN106929573B (en) | 2017-02-21 | 2017-02-21 | Against Legionella pneumophila type O12wzmAndwecAgene specific nucleotide sequence and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106929573B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108384866A (en) * | 2018-04-16 | 2018-08-10 | 南开大学 | A kind of shigella sonnei specific nucleotide PCR detection kit |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2005049642A2 (en) * | 2003-11-21 | 2005-06-02 | Institut Pasteur | Genome of legionella pneumophila paris and lens strain-diagnostic and epidemiological applications |
| WO2011020926A1 (en) * | 2009-08-21 | 2011-02-24 | Institut Pasteur | Specific marker and method for detecting and identifying a legionella pneumophila serogroup 1 bacterium |
| CN102424862A (en) * | 2012-01-09 | 2012-04-25 | 南开大学 | Genotyping chip for legionella pneumophila, and kit for detection of legionella pneumophila |
| CN102628042A (en) * | 2012-04-12 | 2012-08-08 | 天津生物芯片技术有限责任公司 | Specific ribonucleotide of legionella pneumophilia O9 wzm gene and application thereof |
| US20130331285A1 (en) * | 2012-06-12 | 2013-12-12 | The Government of the United Sates of America as represented by the Secretary of the Department of | Methods and compositions for detection of legionella |
| CN105008539A (en) * | 2012-11-07 | 2015-10-28 | 格林考瓦因有限公司 | Production of recombinant vaccine in e. coli by enzymatic conjugation |
-
2017
- 2017-02-21 CN CN201710091774.3A patent/CN106929573B/en active Active
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2005049642A2 (en) * | 2003-11-21 | 2005-06-02 | Institut Pasteur | Genome of legionella pneumophila paris and lens strain-diagnostic and epidemiological applications |
| WO2011020926A1 (en) * | 2009-08-21 | 2011-02-24 | Institut Pasteur | Specific marker and method for detecting and identifying a legionella pneumophila serogroup 1 bacterium |
| CN102424862A (en) * | 2012-01-09 | 2012-04-25 | 南开大学 | Genotyping chip for legionella pneumophila, and kit for detection of legionella pneumophila |
| CN102628042A (en) * | 2012-04-12 | 2012-08-08 | 天津生物芯片技术有限责任公司 | Specific ribonucleotide of legionella pneumophilia O9 wzm gene and application thereof |
| US20130331285A1 (en) * | 2012-06-12 | 2013-12-12 | The Government of the United Sates of America as represented by the Secretary of the Department of | Methods and compositions for detection of legionella |
| CN105008539A (en) * | 2012-11-07 | 2015-10-28 | 格林考瓦因有限公司 | Production of recombinant vaccine in e. coli by enzymatic conjugation |
Non-Patent Citations (3)
| Title |
|---|
| BOYANG CAO ET AL.: ""Development of a DNA Microarray Method for Detection and Identification of All 15 Distinct O-Antigen Forms of Legionella pneumophila"", 《APPLIED AND ENVIRONMENTAL MICROBIOLOGY》 * |
| 吴冬雪等: ""嗜肺军团菌15种血清型基因芯片检测方法的建立"", 《食品研究与开发》 * |
| 姚芳芳: ""嗜肺军团菌O血清型分子分型检测基因芯片的建立"", 《中国硕士论文全文数据库》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108384866A (en) * | 2018-04-16 | 2018-08-10 | 南开大学 | A kind of shigella sonnei specific nucleotide PCR detection kit |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106929573B (en) | 2020-06-09 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CA2596059C (en) | Method of quantitatively analysing microorganism targeting rrna | |
| CN102703603A (en) | Real-time fluorescence nucleic acid constant temperature amplification detection kit of general influenza a virus (IAV) | |
| CN103388033A (en) | Enterovirus type 71 (EV71) real-time fluorescent nucleic acid isothermal amplification detection kit | |
| CN116042902A (en) | Real-time fluorescent nucleic acid isothermal amplification detection kit for simultaneously detecting six candida species and special primer and probe thereof | |
| CN101469327A (en) | ITS sequence specific to Klebsiella pneumoniae pneumonia or subsp.ozaenae and use | |
| CN101469326B (en) | Nucleotide specific to ITS of Balcillus proteus mirabilis and use thereof | |
| CN102719542A (en) | Simultaneous amplification and testing reagent kit for VC (vibrio cholerae) | |
| CN101736078A (en) | Method for detecting viable bacteria of Mycobacterium tuberculosis through isothermal amplification of nucleic acid and kit | |
| CN102628042B (en) | Specific ribonucleotide of legionella pneumophilia O9 wzm gene and application thereof | |
| CN105256052B (en) | A kind of kit and its detection method for Legionella quick detection and parting | |
| KR101756736B1 (en) | Method for rapidly detecting actinobacillus pleuropneumoniae from clinical samples through multiplex real-time pcr assay and the apparatus thereof | |
| CN105063228B (en) | The detection kit and detection method of a kind of flavobacterium columnare | |
| CN103773884B (en) | For detecting the primer sets of Chlamydia pneumoniae 98KDa MOMP gene and probe and application thereof | |
| CN104531860B (en) | A kind of molecular detecting method of Shigella and its application | |
| CN106929573A (en) | Nucleotides and its application to wzm the and wecA gene specifics of legionella pneumophilia O12 types | |
| CN103388032A (en) | Coxsackie virus type A16 (CA16) real-time fluorescent nucleic acid isothermal amplification detection kit | |
| CN105200044B (en) | The nucleotides special to vibrio fluvialis O1, O6, O7, O8 and O9 and its application | |
| CN105255876B (en) | A kind of primer and method quickly detected for Legionella with parting | |
| CN105200045B (en) | The nucleotides special to vibrio fluvialis O11, O14, O16 and O17 and its application | |
| CN108384866A (en) | A kind of shigella sonnei specific nucleotide PCR detection kit | |
| CN102154466B (en) | Nucleotides with specificity to internal transcribed spacer(ITS) of neisseria meningitidis and application thereof | |
| CN105256028B (en) | The nucleotide special to citric acid bacillus 017 and O39 and its application | |
| CN102604945B (en) | Nucleotides specific for legionella pneumophila O5 type wzt gene, and application thereof | |
| CN105154438B (en) | To Hafnia alvei G5907, G5908, G5913, nucleotide special G5916 and its application | |
| CN102311950A (en) | Nucleotide specific to wzt of Legionella pneumophila serogroup 1 and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |