WO2011020926A1

WO2011020926A1 - Specific marker and method for detecting and identifying a legionella pneumophila serogroup 1 bacterium

Info

Publication number: WO2011020926A1
Application number: PCT/EP2010/062275
Authority: WO
Inventors: Carmen Buchrieser; Christel Cazalet; Nathalie Merault; Christophe Rusniok; Philippe Glaser; Sophie Jarraud; Jérôme ETIENNE; Christine Lawrence
Original assignee: Institut Pasteur; Institut National De La Sante Et De La Recherche Medicale (Inserm); Assistance Publique - Hopitaux De Paris
Priority date: 2009-08-21
Filing date: 2010-08-23
Publication date: 2011-02-24
Also published as: FR2949788A1

Abstract

The present invention relates to novel specific markers and to a method for quickly detecting and identifying the Legionella pneumophila bacterium serogroup, in particular serogroup 1, particularly from a sample of water or air. The invention also includes diagnostic kits for implementing said methods.

Description

Specific marker and method for the detection and identification of Legionella pneumophila serogroup 1 bacteria

The subject of the present invention is new specific markers and a method for the rapid detection and identification of serogroup of Legionella pneumophila bacteria, in particular serogroup 1, in particular from water or air samples.

The invention also includes diagnostic kits for carrying out these methods. Legionella is an environmental bacterium responsible for legionellosis and Pontiac fever. Legionellosis is an environmental-source infectious disease caused by the inhalation of microdroplets containing Legionella pneumophila (Lp) or rarely Legionella spp. Epidemiological data indicate that only certain isolates are capable of provoking clinical cases. The species L. pneumophila appears to have greater virulence than other species, being responsible for 90% of cases of legionellosis. Within this species, among the 15 serogroups (Sg), isolates of Sg 1 are associated with 80% of cases (14, 24, 41). Legionnaire's disease is also a nosocomial disease with around 100 cases identified in 2005 in nursing homes or retirement homes.

The natural habitat of Legionella is the water environment. They are present in 90% of water withdrawals from lakes and rivers and 70-80% of water from urban water distribution systems. Control of legionella risk is based on the control of the water quality of the various possible environmental sources (domestic hot water networks, cooling towers, spa, ... (16, 17, 36)). As a result, the detection of legionella in water systems, especially the hot water networks and air conditioning systems of hotels, residences and hospitals is extremely important. This surveillance makes it possible to define the risk of legionellosis according to the contamination rate in order to undertake corrective actions, measures which would only be better understood and taken if the species and the serogroup (Sg) were known by one and same technique. To date, no rapid test of monitoring of water networks, and a single test in patients, the detection of urinary antigens, allows the identification of legionella at the level of Sg. In addition, the urine test used in clinical only highlights Sg 1, the other SGs are not detected. Current methods of typing Sg require to obtain the bacterial strain by culture beforehand. Given the dominance of Lp Sg 1 in human infections, it is important to be able to identify the species present in the networks as well as determine the SG quickly and reliably. Improving typing procedures can therefore be considered a priority in public health and for the water industry.

The monitoring of water quality is currently based on the search and enumeration of legionella by culture according to, in France, a standard AFNOR NF T90-431 "Search and enumeration of Legionella spp and Lp, method by direct seeding and after concentration by membrane filtration or centrifugation ". This technique is long and tedious (3 to 10 days). Its yield is very variable from one laboratory to another and from one sample to another. It uses culture media (BCYE and GVPC) that are adapted to the Lp Philadelphia-1 strain isolated during the first legionella outbreak. However, our recent results show that strains of Lp freshly isolated from the environment or biological samples have a growth rate on these media different, often slower, that of the strain of Lp Philadelphia -1. On the other hand, water samples often contain several strains of Legionella. The technique of identification by culture allows to type only a few colonies which implies that colonies of Lp Sg 1 can escape this detection technique (10, 22). In recent years research techniques for Legionella by PCR in water have developed (15, 30, 35, 38, 39). However, these molecular techniques are sometimes difficult to reproduce from one laboratory to another. The reagents used must be free of legionella DNA which is a specific problem of this ubiquitous bacterium in water. These different studies show that there is a correlation between culture and PCR, but the genome unit results are often higher than the results in CFU. There are many PCR positive and culture negative samples that can not be determined if it is due to nonspecific amplifications, the presence in the DNA sample of dead bacteria, or the presence of viable bacteria. but not cultivable (5). In the latter case, legionella PCR would be better than culture to identify a potential health risk. Real-time quantitative PCR reagents have been developed in recent years by several manufacturers (Biorad®, Applied biosystem®, Genesystem®, AES chemulex®, etc.) allowing standardization according to an experimental standard AFNOR XP T90-471 developed in France. However, no currently proposed technique can identify Lp of Sg 1 by PCR or by in situ hybridization.

It therefore remains to be able to have a specific Legionella pneumophila serogroup 1 marker. The identification of these marker genes would allow the development of new tools for the typing of Legionella strains based on PCR, or PCR in vitro. real time, or directly by in situ hybridization using labeled probes to detect and / or identify Lp Sg 1, including among other legionella, in the environment, in the hospital or in the patient . The new features of these typing tools will have to be:

- High discrimination and specificity between this serogroup 1 of Legionella pneumophila and other legionella species and serogroups; and

- Speed and simplicity of use.

This is precisely the object of the present invention.

The inventors have been able to demonstrate that the sequence of the wzm gene of Legionella pneumophila, in particular certain fragments of this gene, was not only well preserved within serogroup 1 of Legionella pneumophila, but also allowed to distinguish them in Legionella and in particular among the other serogroups of bacteria of the species Legionella pneumophila. Thus, the inventors have been able to demonstrate that it was possible to detect and identify the specific presence of Legionella pneumophila serogroup 1 bacteria in a sample by using as a specific marker the sequence of this gene or one of its fragments.

In this study, the inventors were also able to highlight the presence of markers specific for other serogroups of Legionella pneumophila bacteria as well as bacteria of the species Legionella longbeachae.

Thus, in a first aspect, the subject of the present invention is the use of the nucleic acid sequence of the Legionella pneumophila wzm (ABC transporter of LPS O-antigen) gene, its complementary or reverse sequence, or a fragment thereof. as a specific marker for the detection and / or identification of a bacterium belonging to

1 ^: Legionella pneumophila serogroup 1 (L. pneumophila SgI).

Preferably, the sequence of said fragment of the wzm gene of Legionella pneumophila, and useful for the detection and / or identification of a bacterium belonging to the species L. pneumophila SgI, is a sequence of a conserved fragment of the wzm gene. for the species L. pneumophila SgI.

In particular, it is preferred here the use of a sequence of the wzm gene chosen from the following sequences: a) the sequence of the wzm gene of Legionella pneumophila, Paris strain (NCBI sequence reference: NC 006368.1 dated April 26, 2009, "locus tag lppO837" sequence SEQ ID NO: 1 below);

b) the sequence of a fragment, preferably a conserved fragment, of at least 15 nucleotides, preferably 20, 25, 30, 35, 40, 50, 75, 100, 150, 200 or 250 nucleotides of a sequence as defined in a);

c) the sequence of a variant of the wzm gene, having at least 80%, preferably 85%, 90%, 92.5%, 95%, 96%, 97%, 98%, 98.25%, 98, 5%, 98.6%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3 99.4%, 99.5%, 99% , 6, 99, 7%, 99.8% or 99.9% with the sequence SEQ ID NO: 1, the sequence of this variant comprising at least the conserved sequence that it is desired to detect and / or identify for a bacterium L. pneumophila SgI or comprising at least one sequence having an identity percentage of at least 98%, preferably 98.25%,

98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3 99.4%, 99.5% , 99.6, 99, 7

%, 99.8% or 99.9% identity with said conserved sequence;

d) the complementary or inverse sequence of a sequence as defined in a), b) or c).

SEQ ID NO: 1

1 atgacctcaa tatcctcaaa aactcagacg tttaaagaaa cagtagtcta tggagttgat

61 aagtttaggc ttttagctgt tttaagaaat atatgggatt accgcttgct tttatggatt

121 ttttgtaaac gagatctcaa agggcgttac agtcaaacca tcttgggatt gggttgggtt

181 attttaactc ctttgattac ggttggggtg tttgtcattg tttttggcat catgataaag

241 gtacctaccg atgggctgcc tactgtcatg ttctatttgg ttgcggttat accttggtat

301 tcctttttaa atgttctcaa cccttccata caaatgattg agggaaatgc ttcgttaata

361 acaaaggtct attttccaag agcgttgata ggcggtgcct atgctatggg agctgcggtt

421 gattttctga tggcttatgt gtttttgata accccctttg caatttatta tggcctttgg

481 tctatcaagt tattaattat tatgccattc ctgctgatat ctaccttaat gattggatta

541 ggtattggtt tggttttagc acctatcaat gcaaaatata gggatattaa acattttatg

601 cctctggctt tgcagttatt ttattactcc actccagcga tttaccctgt ttctgctgtg

661 cctgtgtggg ctaaaccatg gtatgctgtt aatccattat ctcttgttat caccagttat

721 cgagaggtgt taatggggca ttggccatca cctactataa taatgacatt atctggtatg

781 gcaattataa ctttccttgt ggggcttgtt gcatttcatc acatggagca taaggtagtt

841 gatattttat ga

By the conserved sequence of the wzm gene which it is desired to detect and / or identify for L. pneumophila SgI bacterium or one of its natural variants, is meant herein a partial consensus sequence of the wzm gene common to all bacteria of the L. pneumophila SgI group or one of their variants.

According to a preferred embodiment, the method for detecting or identifying the presence of a Legionella pneumophila serogroup 1 bacterium (L. pneumophila SgI) in a sample according to the invention is characterized in that it implements a step of detecting or identifying the presence of a sequence of a conserved region of the wzm gene for the bacteria belonging to serogroup 1 of the Legionella pneumophila species, in particular of a conserved fragment of the sequence SEQ ID NO : 1, or the sequence of one of its variants having at least 80% identity with the sequence SEQ ID NO: 1, their complementary sequence, or their reverse sequence.

Among these preserved fragments, it is further preferred:

a fragment of at least 20 consecutive nucleotides, preferably at least 25, 30, 35, 40, 50, 75, 100, 150, 200 or 250 consecutive nucleotides, of the sequence nt 99-392 of the sequence SEQ ID NO: 1;

a fragment of at least 20 consecutive nucleotides, preferably at least 25, 30, 35, 40, 50 or 75 consecutive nucleotides, of the sequence nt 138-214 of the sequence SEQ ID NO: 1.

According to a preferred embodiment, in the method for detecting or identifying the presence of L. pneumophila SgI bacterium in a sample according to the invention, said sample is a liquid sample or air likely to be contaminated by a bacterium of the genus Legionella, in particular L. pneumophila, in particular a bacterium belonging to serogroup 1 (L. pneumophila SgI).

In a preferred embodiment, in the method for detecting or identifying the presence of an L. pneumophila SgI bacterium according to the present invention, said sample analyzed is a water sample, in particular from a distribution circuit of water, for example but not limited to city, spring, river or lake water, cooling system, such as, but not limited to, spray cooling system or runoff water that can generate aerosols that can be inhaled.

Also preferred are methods for detecting or identifying the presence of L. pneumophila SgI bacteria according to the invention characterized in that said sample is an air sample.

In another preferred embodiment, the method for detecting or identifying the presence of L. pneumophila SgI bacteria according to the present invention comprises a amplification step of a DNA isolated from said sample, this step using a pair of primers each of whose sequences is capable of hybridizing specifically under standard hybridization conditions with said sequence of a conserved region of the wzm gene, with its complementary sequence or one of its fragments of at least 15 nucleotides, preferably at least 17, 20, 22, 25 and 30 nucleotides of this conserved sequence or its complementary sequence.

In general, the nucleic sequences usable here as primers are the primers which can be deduced from the conserved nucleotide sequences which it is desired to amplify in the sample.

For probe sequences usable here after amplification, or in situ hybridization methods, they can also be deduced from the conserved sequence or PCR products obtained after amplification that it is desired to detect and identify. These include sequences, capable of hybridizing specifically under standard conditions with these PCR products or with said conserved sequence that it is desired to detect and / or identify.

Specific hybridization means that the hybridization is carried out under conditions of high stringency, particularly under conditions of temperature and ionic strength such that they allow the maintenance of hybridization between two globally complementary DNA fragments.

As an illustration, conditions of high stringency of the hybridization step for the purpose of defining the nucleotide sequences described above are advantageously as follows.

The hybridization is carried out at a preferred temperature of 65 ° C., in the presence of 6 × SSC buffer, 5 × Denhardt's solution, 0.5% SDS and 100 μg / ml salmon sperm DNA.

I x SSC corresponds to 0.15 M NaCl and 0.05 M sodium citrate and a solution of 1 x Denhardt corresponds to 0.02% Ficoll, 0.02% polyvinylpyrrolidone and 0.02% bovine serum albumin.

The washing steps may, for example, be carried out for 5 to 30 minutes. at 65 ° C, in 2 x SSC buffer or 1 x SSC and 0.1% SDS.

The high stringency hybridization conditions described above for a polynucleotide of defined size will be adapted by those skilled in the art for oligonucleotides of larger or smaller size, according to the teaching of Sambrook et al, 1989. . Preferably, the hybridization conditions will be said to be specific since only sequences having at least 90% identity with the sequence complementary to the targeted sequence will be able to hybridize, preferably those having at least 92.5%, 95%, 97.5%, 98%, 99%, 99.5% with this sequence complementary to the target sequence.

The probes or primers used in the methods according to the invention will have a minimum size of 15 bases and fragments of at least 20, 25, 30 or 50 bases will be preferred.

The techniques for detecting, identifying and, where appropriate, quantifying a nucleic sequence that can be used in the methods of the invention are well known to those skilled in the art and will not be developed here. These include, but are not limited to:

In situ hybridization (in particular FISH analysis when the markers are of the fluorescent type) in which one proceeds:

the contacting of a nucleic probe, where appropriate labeled, with the DNA contained in the biological sample, the latter having, where appropriate, been previously made accessible to hybridization, this under conditions allowing hybridization of the probe with the bacterial DNA contained in the biological sample; and

the detection and, where appropriate, the determination of the hybrid formed between the nucleic probe and the DNA of the biological sample; and

PCR (polymerase chain reaction), or related PCR, in which the specific amplification of the targeted DNA is carried out using a specific pair of primers, the detection of the amplified product, if appropriate followed by a quantitative analysis of the amplification products (quantitative PCR).

There may also be mentioned another method for quantifying a target DNA sequence from a total DNA sample extract, optionally enriched in DNA, said method comprising:

a first step in which a first oligonucleotide probe specific for the target DNA or, where appropriate, its amplification products, immobilized on a support with an extract of the total DNA of the sample, is brought into contact, or, where appropriate, with the PCR products obtained using specific primers, under conditions allowing hybridization of the first probe with the DNA of said sample or, where appropriate, with said PCR products; and

a second step in which the hybrid formed between said first probe immobilized on a support and said DNAs or, where appropriate, said PCR products, if appropriate after elimination of the nucleic acids which have not hybridized with the polymer, is brought into contact with the first a probe, with a second oligonucleotide probe, in particular labeled capable of hybridizing to the target DNA or, where appropriate, to its PCR products, and then elimination of the second non-hybrid probes; and

- the quantitative analysis of the triplexes thus formed.

By "related PCR" is meant all methods involving direct or indirect replication of the nucleic acid sequences, or in which the labeling systems have been amplified. These techniques are of course known. In general, it is the amplification of DNA by a polymerase; There are currently many methods for this amplification (for example the methods called NASBA "Nucleic Acid Sequence Based Amplification", TAS "Transcription based Amplification System", LCR "Ligase Chain Reaction", "Endo Run Amplification" (ERA), " Cycling Probe Reaction "(CPR), and SDA" Strand Displacement Amplification "well known to those skilled in the art). Also known to those skilled in the art, nucleic acid quantification techniques in which, for example, the nucleic acid to be quantified by a PCR-type method is amplified and in the presence of a standard nucleic acid of the same size, in the amount of known and capable of hybridizing to the same primers as the target nucleic acid.

By "percent identity" between two nucleic acid sequences in the sense of the present invention, is meant to designate a percentage of identical nucleotides between the two sequences to be compared, obtained after the best alignment (optimal alignment), this percentage being purely statistics and the differences between the two sequences being randomly distributed over their entire length. Sequence comparisons between two nucleic acid sequences are traditionally performed by comparing these sequences after optimally aligning them, said comparison being made over the entire length of the reference sequence. The optimal alignment of the sequences for the comparison can be realized, besides manually, by means of the algorithm of local similarity but especially by means of computer software using these algorithms (GAP, BESTFIT, FASTA and TFASTA or by the software of comparison BLAST N or BLAST P (available online at the NCBI website)).

The percentage identity between two nucleic acid sequences is determined by comparing these two optimally aligned sequences and is calculated by determining the number of positions for which the nucleotide is identical between the two sequences, by dividing this number of identical positions. by the total number of positions and multiplying the result by 100. For example, the BLAST program, "BLAST 2 sequences" (Tatusova et al., "Blast 2 sequences - a new tool for comparing protein and nucleotide sequences", FEMS Microbiol Lett., 174: 247-250) available on the site can be used. http://www.ncbi.nlm.nih.gov/gorflbl2.html, the parameters used being those given by default (in particular for the parameters "open gap penalty": 5, and "extension gap penalty": 2; chosen matrix being, for example, the "BLOSUM 62" matrix proposed by the program), the percentage of identity between the two sequences to be compared being calculated directly by the program.

The set of probes and primers used here may be labeled by methods well known to those skilled in the art, in order to obtain a detectable and / or quantifiable signal, in particular by fluorescent markers.

More preferably, the method for detecting or identifying the presence of an L. pneumophila SgI bacterium according to the invention is characterized in that it comprises the following steps:

a) amplifying a DNA isolated from said sample using a pair of primers each of whose sequences is capable of hybridizing under standard hybridization conditions with said sequence of a conserved region of the wzm gene, or with its complementary sequence;

b) bringing the amplified DNA into contact with a nucleotide probe, optionally labeled, capable of hybridizing specifically under standard hybridization conditions with said

Amplified DNA; and

c) the detection of the formation of a possible hybridization complex and, where appropriate, its quantification.

By standard hybridization condition is meant here stringency conditions that lead to a specific hybridization of the primers with the DNA to be amplified and the probe with said amplified DNA.

In a preferred embodiment, the method for detecting or identifying the presence of an L. pneumophila SgI bacteria according to the invention is characterized in that in step a), said pair of primer is chosen among the following pairs of primers:

A) Pl: TTACCGCTTGCTTTTATGGA (SEQ ID NO: 2) and

P2: CCTATCAACGCTCTTGGAAA (SEQ ID NO: 3);

B) P65: CAAAGGGCGTTACAGTCAAACC (SEQ ID NO: 4) and

P66: CAAACACCCCAACCGTAATCA (SEQ ID NO: 5). Also preferably, in step b) of the method for detecting or identifying the presence of an L. pneumophila SgI bacterium according to the invention, said probe is the sequence probe TCTTGGGATTGGGTTGGGTTATTTTAACTCCT (SEQ ID NO: 6) when the pair of primers used in step a) is the pair of sequences SEQ ID NO: 2 and SEQ ID NO: 3.

Preferably, the pair of primers chosen is the pair of primer P1 and P2 of sequence SEQ ID NO: 2 and SEQ ID NO: 3, and the probe is the probe of sequence SEQ ID NO: 6, when the process comprises no not at step c) the quantification of the hybridization complex formed (standard PCR).

In a also preferred embodiment, the method for detecting or identifying the presence of a bacterium L. pneumophila SgI according to the invention is characterized in that in step a), said pair of primer is the pair of primer P65 and P66 of sequence SEQ ID NO: 4 and SEQ ID NO: 5, and the probe is the probe of sequence SEQ ID NO: 6, when the method comprises in step c) the quantification of the complex hybridization formed (in particular by qPCR).

In a also preferred embodiment, the method for detecting or identifying the presence of an L. pneumophila SgI bacterium according to the invention is characterized in that it comprises a step of prior filtration of the sample in order to increase the concentration of bacteria present in the initial sample.

In another variant, the method for detecting or identifying the presence of an L. pneumophila SgI bacterium according to the invention is characterized in that it comprises a step of highlighting said sequence of a conserved region. of the wzm gene, or its complementary sequence, by in situ hybridization with labeled specific probes, in particular by Fluorescent In Situ Hybridization (FISH) analysis using fluorescently labeled probes.

Thus, the subject of the invention is also a method for detecting and / or identifying the presence of an L. pneumophila SgI bacterium, characterized in that it comprises the following steps:

a) bringing the genomic DNA of said sample into contact with a nucleic probe as described above, this probe being labeled and capable of hybridizing specifically under standard hybridization conditions with said genomic DNA; and b) the detection of the formation of a possible hybridization complex and, where appropriate, its quantification.

Preferably, said labeled probe used for in situ hybridization, in particular for FISH analysis, in the process according to the invention is a probe chosen from the following sequences:

a) the sequence SEQ ID NO: 6, its complementary sequence or one of their fragments having at least 15, preferably 20, 22, 25 or 30 consecutive nucleotides; or

b) a sequence comprising a sequence as defined in a) and capable of hybridizing specifically with the sequence of the targeted conserved wzm gene.

In another aspect, the invention also relates to a method for the detection or identification of a Legionella pneumophila serogroup 1 bacterium, a Paris strain present in a sample, characterized in that it implements:

a step of detecting or identifying the presence of a Legionella pneumophila serogroup 1 bacterium by a method according to the present invention; and

at least one other step of detecting or identifying the presence, or the expression of the cyoB gene, of the prefrence, this last step being characterized in that the presence or the expression of the cyoB gene implements the use of the pair of primers P95 and P96 of sequence SEQ ID NOs. : 21 and 22, especially in a PCR type method, such as qPCR, and / or a probe of sequence SEQ ID NO. : 23

In another aspect, a subject of the invention is a method for detecting or identifying not only the presence of L. pneumophila SgI bacteria but also the presence of L. pneumophila bacteria belonging to another serogroups (2- 14) using markers specific to these other groups.

Thus the subject of the invention is a method for detecting or identifying the serogroup of a bacterium Legionella pneumophila present in a sample, characterized in that it implements:

a step of detecting or identifying the presence of a Legionella pneumophila serogroup 1 bacterium by a method according to the invention; and

at least one other step of detecting or identifying the presence of a Legionella pneumophila bacterium from another serogroup, in particular chosen from serogroups 6 and 12, 13, and, 10 and 14. In another aspect, the invention also provides a method for detecting or identifying the presence of L. pneumophila bacteria belonging to another serogroup than serogroup 1 selected from serogroups 6 and 12, 13, or 10 and 14 using specific markers of these other groups as described below.

Thus the subject of the invention is a method for detecting or identifying the serogroup of a Legionella pneumophila bacterium present in a sample, characterized in that it implements at least one other step of detecting or identifying the presence of a Legionella pneumophila bacterium of at least one serogroup selected from serogroups 6 and 12, 13, or, 10 and 14.

In a particular embodiment, the method for detecting or identifying the presence of Legionella pneumophila serogroup 1 or the presence of Legionella pneumophila serogroups 6 or 12, 13, or 10 or 14 according to the invention is characterized in what:

a) when the detection or identification method comprises an amplification step, the pair of primers used for the detection or identification of the presence of a serogroup Legionella pneumophila bacterium selected from serogroups 6 and 12, 13, and 10 and 14 is:

the sequence pair P87 / P88 of sequences TGAAAATGGAGCCCTATTCTCTTAC (SEQ ID NO: 7) and

TGGTTAAAAACTCTAAAGCCCATCTC (SEQ ID NO: 8) for the detection or identification of the presence of Legionella pneumophila serogroup 6 or 12 bacteria; the pair of P85 / P86 sequence primers of AAATGAAGAATTATATCACTCCGATGAG (SEQ ID NO: 9) and AATTTCCCTTTTTTAACCCAATGAG (SEQ ID NO: 10) sequences for the detection or identification of the presence of Legionella pneumophila serogroup 10 or 14 bacteria; ; and

the pair of P91 / P92 sequence primers of GCGAGATTAGAGTACGGCATTGA (SEQ ID NO: 11) and CATTACTTTCTACTACTAATAGATCAGCATTTCC (SEQ ID NO: 12) sequences for the detection or identification of the presence of a Legionella pneumophila serogroup 13 bacterium, and

b) when the detection or identification process is carried out by in situ hybridization analysis, in particular by FISH, the probe used for detection or identification the presence of a serogroup Legionella pneumophila bacterium selected from serogroups 6 and 12, 13, and, 10 and 14 is a probe whose sequence is selected from the following sequences:

the sequence of the PCR product obtained by the pair of P87 / P88 sequence primers of SEQ ID NO: 7 and SEQ ID NO: 8 sequences for the detection or identification of the presence of a Legionella pneumophila serogroup 6 bacterium or 12, its complementary sequence, one of their fragments having at least 15, preferably 20, 22, 25 or 30 consecutive nucleotides or a sequence comprising one of these sequences;

the sequence of the PCR product obtained by the pair of P85 / P86 sequence primers of SEQ ID NO: 9 and SEQ ID NO: 10 sequences for the detection or identification of the presence of a Legionella pneumophila serogroup bacterium 10 or 14, its complementary sequence, one of their fragments having at least 15, preferably 20, 22, 25 or 30 consecutive nucleotides or a sequence comprising one of these sequences; and

the sequence of the PCR product obtained by the pair of P91 / P92 sequence primers of sequences SEQ ID NO: 11 and SEQ ID NO: 12 for the detection or identification of the presence of a Legionella pneumophila serogroup 13 bacterium its complementary sequence, one of their fragments having at least 15, preferably 20, 22, 25 or 30 consecutive nucleotides or a sequence comprising one of these sequences. The subject of the present invention is the following nucleic sequences, the use of at least one of these sequences or diagnostic kits comprising at least one of these following sequences as specific compounds for the detection or identification of the presence of Legionella pneumophila bacteria of serogroups 6 and 12; 13; and, 10 and 14:

the pair of primers of SEQ ID NO: 7 and SEQ ID NO: 8 sequences for the detection or identification of the presence of a Legionella pneumophila serogroup 6 or 12 bacterium; and or

the pair of primers of SEQ ID NO: 9 and SEQ ID NO: 10 sequences for the detection or identification of the presence of a Legionella pneumophila serogroup 10 or 14 bacterium; and or

the pair of primers of SEQ ID NO: 11 and SEQ ID NO: 12 sequences for the detection or identification of the presence of a Legionella pneumophila serogroup 13 bacterium; and or

the probe having as a sequence the sequence of the PCR product obtained by the pair of sequence primers SEQ ID NO: 7 and SEQ ID NO: 8 for the detection or identification of the presence of a Legionella pneumophila serogroup 6 bacteria or 12, its complementary sequence, one of their fragments having at least 15, preferably 20, 22, 25 or 30 consecutive nucleotides or a sequence comprising one of these sequences;

the probe having, for sequence, the sequence of the PCR product obtained by the pair of primers of SEQ ID NO: 9 and SEQ ID NO: 10 sequences for the detection or identification of the presence of a Legionella pneumophila serogroup bacterium 10 or 14, its complementary sequence, one of their fragments having at least 15, preferably 20, 22, 25 or 30 consecutive nucleotides or a sequence comprising one of these sequences; and

the probe having, for sequence, the sequence of the PCR product obtained by the pair of primers of sequences SEQ ID NO: 11 and SEQ ID NO: 12 for the detection or identification of the presence of a Legionella pneumophila serogroup 13 bacterium its complementary sequence, one of their fragments having at least 15, preferably 20, 22, 25 or 30 consecutive nucleotides or a sequence comprising one of these sequences.

In another aspect, the invention provides a method for detecting or identifying not only the presence of L. pneumophila SgI bacteria, serogroups 6 and 12, 13, or 10 and 14 but also the presence of Legionella longbeachae bacterium using markers specific for these bacteria.

Thus the subject of the invention is a method for detecting or identifying the serogroup of a bacterium Legionella pneumophila or a bacterium Legionella longbeachae present in a sample, characterized in that it implements:

A) when the detection or identification process comprises an amplification step,

a step of detecting or identifying the presence of Legionella pneumophila serogroup 1 bacterium or serogroups 6 and 12, 13, or, 10 and 14 by a method according to the invention; and

a step of detecting or identifying the presence of a Legionella longbeachae comprising the amplification of a DNA isolated from said sample by using a pair chosen from the following pairs of primers;

the pair of P51 / P52 sequence primers of CTTGCTGACTTCTTCCTTAATTT (SEQ ID NO: 13) and GATTTCTTCGGGGTAGGGAT (SEQ ID NO: 14) sequences;

the sequence pair P69 / P70 of sequences GCCATTTTCGTCGACATGCT (SEQ ID NO: 15) and TCTT AATT ATCTTGGCCGTTTCTTTT (SEQ ID NO: 16); and the pair of primers of P73 / P74 sequences of CATGCTCATCATCTGGTTTACCTAA sequences (SEQ ID NO: 17) and

CCCGAGAGAAATACCCCGATA (SEQ ID NO: 18),

contacting the amplified DNA with a nucleotide probe, where appropriate labeled, capable of hybridizing specifically under standard hybridization conditions with said

Amplified DNA and, where appropriate,

in that the chosen probe is the sequence probe:

- CGCATGCTCATCATCTGGTTTAC (SEQ ID NO: 19) (Lgbl probe) when the chosen pair of primers is the pair of P69 / P70 sequence primers; and

AAACGGCCAAGATAATTAAGAGTGTCCG (SEQ ID NO: 20) (Lgb2 probe) when the chosen pair of primers is the pair of primers of P73 / P74 sequences, and

B) when the detection or identification process is carried out by in situ hybridization,

a step of detecting or identifying the presence of a Legionella pneumophila serogroup 1 bacterium or serogroups 6 or 12, 13, or 10 or 14 by a method according to the invention; and

a step of detecting or identifying the presence of a Legionella longbeachae by in situ hybridization and whose probe used for the detection or identification of Legionella longbeachae is a probe whose sequence is chosen from the following sequences:

the sequence of the PCR product obtained by a pair chosen from the following pairs of primers;

the sequence pair P51 / P52 of sequences SEQ ID NO: 13 and SEQ ID NO: 14

the pair of primers with P69 / P70 sequences of SEQ ID NO: 15 and SEQ ID NO: 16; and

the pair of primers with P73 / P74 sequences of SEQ ID NO: 17 and SEQ ID NO: 18, in particular:

the Lgbl probe of sequence SEQ ID NO: 19 when the chosen pair of primers is the pair of P69 / P70 sequence primers, or

the Lgb2 probe of sequence SEQ ID NO: 20 when the chosen pair of primers is the pair of P73 / P74 sequence primers; and

the complementary sequence of these probes, one of the fragments of these probes or of their complementary sequence having at least 15, preferably 20, 22, 25 or 30 consecutive nucleotides or a sequence comprising one of these sequences. In another aspect, the subject of the present invention is the following nucleic sequences, the use of at least one of these sequences or diagnostic kits comprising at least one of these following sequences as specific compounds for the detection or identification of the presence of Legionella longbeachae bacteria present in a sample:

the pair of primers with sequences SEQ ID NO: 13 and SEQ ID NO: 14;

the pair of primers with sequences SEQ ID NO: 15 and SEQ ID NO: 16;

the pair of primers with sequences SEQ ID NO: 17 and SEQ ID NO: 18;

the probe having for sequence the sequence of the PCR product obtained by the pair of primers of sequences SEQ ID NO: 13 and SEQ ID NO: 14, its complementary sequence, one of their fragments having at least 15, preferably, 20, 22, 25 or 30 consecutive nucleotides or a sequence comprising one of these sequences;

the probe having for sequence the sequence of the PCR product obtained by the pair of primers of sequences SEQ ID NO: 15 and SEQ ID NO: 16, its complementary sequence, one of their fragments having at least 15, preferably, 20, 22, 25 or 30 consecutive nucleotides or a sequence comprising one of these sequences;

the probe having for sequence the sequence of the PCR product obtained by the pair of primers of sequences SEQ ID NO: 17 and SEQ ID NO: 18, its complementary sequence, one of their fragments having at least 15, preferably, 20, 22, 25 or 30 consecutive nucleotides or a sequence comprising one of these sequences;

the probe having for sequence the sequence SEQ ID NO: 19 (Lgbl probe); and

the probe having for sequence the sequence SEQ ID NO: 20 (Lgb2 probe).

In a preferred embodiment, the invention relates to a method for detecting or identifying the serogroup of a bacterium Legionella pneumophila, in particular serogroup 1, 6 or 12, 13, or, 10 or 14, and, where appropriate, optionally, of a bacterium Legionella longbeachae present in a sample according to the present invention, characterized in that in step a), the amplification of the isolated DNA is carried out by a multiplex PCR method in which the different pairs of Primers necessary for the detection or identification of the selected serogroups of Legionella pneumophila, or, where appropriate, of the bacterium Legionella pneumophila, are contacted simultaneously with said DNA isolated from the sample.

In a preferred embodiment, the subject of the invention is a method of detection or identification according to the invention, characterized in that the amplified DNA, where appropriate labeled, is brought into contact in step b). with a solid support on which the probes are fixed nucleic acids capable of specifically hybridizing under standard hybridization conditions with said amplified DNA.

In another aspect, the invention provides a method for detecting or identifying the presence of L. pneumophila bacteria of at least one of serogroups 6 or

12, 13, or 10 or 14 and, where appropriate, of Legionella longbeachae bacterium using markers or compounds specific for these bacteria according to the present invention, characterized in that it also comprises a step in which one puts in the presence or absence of the mip (macrophage infectivity potentiator) gene by PCR, or by in situ hybridization (in particular by FISH) according to the technique used for the demonstration of the other markers. This mip marker is associated with the other markers as a positive marker for the presence of L. pneumophila bacteria.

Molecular methods and tools for detecting or identifying the presence of L. pneumophila by detecting or identifying the presence of the mip gene in a biological sample are well known to those skilled in the art and will not be developed here (For example, but not limited to the sequence of the mip gene or its mRNA referenced in Genbank under the number NC 006368 from the strain of Paris Legionella pneumophila).

In another aspect, the present invention relates to a diagnostic kit for the detection and / or identification of the presence of Legionella pneumophila serogroup 1 bacteria in a sample, characterized in that it comprises:

a) a nucleic acid having for sequence the sequence of a conserved region of the wzm gene of sequence SEQ ID NO: 1, or the sequence of a conserved region of one of its variants, in particular a sequence having at least 80 % identity with this sequence, this conserved sequence preferably being selected from the sequences of the group consisting of:

the sequence of a fragment of at least 20 consecutive nucleotides, preferably at least 25, 30, 35, 40, 50, 75, 100, 150, 200 or 250 consecutive nucleotides, of the sequence nt 99-392 of the sequence SEQ ID NO: 1 or a variant thereof;

the sequence of a fragment of at least 20 consecutive nucleotides, preferably at least 35, 40, 50 or 75 consecutive nucleotides, of the sequence nt 138-214 of the sequence SEQ ID NO: 1 or of a its variants; and

- their complementary sequence or their inverse sequence; and optionally,

b) - a solid support on which is fixed one of these sequences as defined in a). Preferably, the diagnostic kit for the detection and / or identification of the presence of a Legionella pneumophila serogroup 1 bacterium in a sample is characterized in that it comprises:

a pair of nucleic primers capable of amplifying the sequence of a conserved region of the wzm gene of sequence SEQ ID NO: 1 or of one of its variants, preferably chosen from the pair of primers of the group consisting of:

P1 (SEQ ID NO: 2) and P2 (SEQ ID NO: 3); and

P65 (SEQ ID NO: 4) and P66 (SEQ ID NO: 5),

and optionally,

a probe, possibly labeled, of sequence SEQ ID NO: 6.

In another aspect, the invention also relates to a diagnostic kit for the detection and / or identification of the presence of a Legionella pneumophila serogroup 1 strain, Paris strain, in a sample, characterized in that He understands :

the elements of the preceding diagnostic kit according to the invention for the detection and / or identification of the presence of a Legionella pneumophila serogroup 1 bacterium; and

a nucleic primer pair capable of amplifying the sequence of a region of the cyoB gene, or of one of its variants, preferably chosen from primer pairs of the group consisting of:

P95 and P96 respectively SEQ ID NOs sequence. : 21 and 22:

and / or, where appropriate,

a probe, optionally labeled, capable of hybridizing specifically with the sequence of a region of the cyoB gene, or of one of its variants, or their complementary sequence, preferably the probe of sequence SEQ ID NO: 23 .

The present invention also relates to a diagnostic kit for the detection and / or identification of the serogroup of a Legionella pneumophila bacterium present in a sample, characterized in that it comprises:

a) a kit according to the invention for detecting and / or identifying the presence of a Legionella pneumophila serogroup 1 bacterium in a sample, and

b) 1) at least one pair of primers selected from the following pairs of primers:

the primer pair of P87 / P88 sequences of SEQ ID NO: 7 and SEQ ID NO: 8 sequences for the detection or identification of the presence of a Legionella pneumophila serogroup 6 or 12 bacterium; the primer pair of P85 / P86 sequences of SEQ ID NO: 9 and SEQ ID NO: 10 sequences for the detection or identification of the presence of Legionella pneumophila serogroup 10 or 14 bacteria; and

the pair of P91 / P92 sequence primers of SEQ ID NO: 11 and SEQ ID NO: 12 sequences for the detection or identification of the presence of a Legionella pneumophila serogroup 13 bacterium, or

2) at least one nucleic acid whose sequence is a sequence comprising or consisting of one of the PCR products amplified by a pair of primers as defined in b) 1), its complementary or inverse sequence, one of their fragments of at least 15 consecutive nucleotides, preferably at least 20, 25, 50, 75, 100, 200 and 250 consecutive nucleotides, and, if appropriate,

3) a solid support on which is fixed one of these sequences as defined in 2). The present invention finally relates to a diagnostic kit for the detection and / or identification of the serogroup of a bacterium Legionella pneumophila and / or a bacterium Legionella longbeachae present in a sample, characterized in that it comprises:

A) a kit as defined above according to the invention, and

the sequence pair P51 / P52 of sequences SEQ ID NO: 13 and SEQ ID NO: 14

the pair of primers with P73 / P74 sequences of SEQ ID NO: 17 and SEQ ID NO: 18,

or

T) - at least one nucleic acid whose sequence is a sequence comprising or consisting of one of the PCR products amplified by a pair of primers as defined in B) I), its complementary or reverse sequence, a fragment thereof at least 15 consecutive nucleotides, preferably at least 20, 25, 50, 75, 100, 200 and 250 consecutive nucleotides or a sequence comprising one of these sequences; or more preferably

at least one nucleic acid of sequence SEQ ID NO: 19 (Lgbl probe) or SEQ ID NO: 20 (Lgb2 probe), its complementary or inverse sequence, and, if appropriate, 3) a solid support on which is fixed one of the sequences as defined in B)

2).

In another aspect, the invention relates to a kit for detecting or identifying the presence of L. pneumophila bacteria of at least one of the following serogroups SgI, serogroups 6 or 12, 13, or 10 or 14 and, where appropriate, Legionella longbeachae bacterium using the kit of the invention comprising the specific markers of these bacteria according to the present invention, characterized in that it also comprises a pair of primers and / or a probe, which can to be labeled, specific for the mip gene.

Finally, the subject of the present invention is a nucleic primer chosen from the group of primers of sequences SEQ ID NOs. 2-5 and SEQ ID Nos. 7 to 18.

Preferably, the subject of the invention is a pair of primers chosen from the group of pairs of primers with the following sequences:

a) SEQ ID NO: 2 and SEQ ID NO: 3;

b) SEQ ID NO: 4 and SEQ ID NO: 5;

c) SEQ ID NO: 7 and SEQ ID NO: 8;

d) SEQ ID NO: 9 and SEQ ID NO: 10;

e) SEQ ID NO: 11 and SEQ ID NO: 12;

f) SEQ ID NO: 13 and SEQ ID NO: 14;

g) SEQ ID NO: 15 and SEQ ID NO: 16; and

h) SEQ ID NO: 17 and SEQ ID NO: 18.

Also included in the invention are the nucleic probes chosen from the group of probes with sequences SEQ ID NOs. 6, 19 and 20, where appropriate marked.

Other features and advantages of the invention appear in the following description with figures and examples described below.

Legends of the figures

Figure 1: Comparison of the L. pneumophila Paris SgI Lpp0827-lpp0843 LPS genes with those of the strain L. pneumophila strain ATCC33215 Sg6

Figure 2: Comparison of the "LPS-gene" region of L. pneumophila strain ATCC43283 SgIO and strain L. pneumophila ATCC43736 Sgl3. Example 1: Materials and Methods

I) "classical" PCR

1) Reagents used

DNase-RNase Free Water

1OX PCR Buffer II (Roche)

MgCl _2: 25mM solution (Roche)

dNTP Set 100 mM (Roche): dilute the 4 dNTPs together at 10 mM AmpliTaq DNA Polymerase 5U / μl (Roche)

2) Primers used: (see Table 2)

P2- for L. pneumophila SgI

P51-P52 for L. longbeachae 3) Reaction mixture

For a reaction of 50 μl:

Table 1: Final concentration for 50 μl

Dispense 48.5 μl of mix per well.

Add 1.5 μl of extracted DNA.

4) PCR program

94 ° C 1 min

94 ° C 30 sec

55 ° C 30 sec r x 35 cycles

72 ° C 30 sec

72 ° C 4 min 4 ° C

II) Quantitative PCR

1) Reagents used

DNase-RNase Free Water

Taqman universal PCR master mix 2X (Applied Biosystems)

Exogenous Internal Positive Control (Applied Biosystems)

Primers and probes used

P65-P66 for L. pneumophila SgI with SgI probe (FAM-BHQ1-Eurogentec) P69-70 for L.longbeachae with Lgbl probe (TET-BHQl - Eurogentec) (see Table 2 "Primers and probes" for sequences)

Table 2: Sequences of the primers and probes used

2) Reaction mixture

For a reaction of 20 μl:

Premix Final Concentration in 5.6 μl

Mix Final Concentration in 20 μl

Distribute 18 μl of mix per well.

Add 2 μl of extracted DNA.

PCR program

50 ⁰ C 2 min

95 ⁰ C 10 min

95 ⁰ C 15 sec

60 ⁰ C 1 min rx 40 cycles

III) Constructions of the matrix

The Legionella biodiversity chip was designed focusing mainly on genes that are variable among the three strains. For all of these genes, we have designed internal probes in the range of 151 to 600 bp. Genes less than 150 bp were thus excluded and only one probe was conserved for the redundant genes and for the different families of insertion sequences. Based on these criteria, 1303 probes were dumped on the Legionella Biodiversity Chip, including 324, 242 and 227 which were specific for the Paris, Lens and Philadelphia strains, respectively. 59 probes are common to the Paris and Lens strains but absent in the Philadelphia strain, 62 are common to the Paris and Philadelphia strains and 24 are common to the Lens and Philadelphia strains but absent in the Paris strain. Finally, 142 probes were added corresponding to known and possible virulence factors (for example, genes coding for type I, II and IV secretion systems and some of their effectors, flagellar genes, type genes). eukaryotic, ...), 31 genes forming a group required for the synthesis of lipopolysaccharides (Luneberg et al, 2000), 30 genes constituting an element unstable genetics responsible for lipopolysaccharide phase variation in the Olda strain, 148 L. longbeachae-specific ORFs identified during partial sequencing and 14 control genes. Internal PCR fragments for the genes common to the Paris and Lens strains or common to the Paris and Philadelphia strains were amplified with the genomic DNA of the Paris strain and those common to the Lens and Philadelphia strains were amplified with the genomic DNA of the Lens strain. Primers were designed using a modified version of Primer 3 software (CAAT-box (Frangeul et al, 2004)) to amplify a specific 151-600 bp fragment for each gene (melting temperatures were 55-65). ° C) (Eurogentec). Three amplification reactions were carried out for each probe in a reaction volume of 100 μl containing 6 ng of chromosomal DNA. The concentration and size of each PCR product were checked on agarose gels. For the preparation of the chips, nylon membranes (Qfilter, Genetix) were soaked in TE solution (10 mM Tris, pH: 7.1mM EDTA, pH 7.6). Spot blots of pCR products and controls were made by a Qpix robot (Genetix). After the deposition of the spots, the membranes were fixed for 15 min in 0.5 M NaOH-1.5 M NaCl, washed briefly in distilled water, fixed a second time for 1 min under UV and stored wet at room temperature. -20 ⁰ C until use.

For verification of the specificity and quality of the macropuce, 70% of all PCR products were randomly selected and sequenced. All 960 sequences corresponded to the expected PCR products. The membrane was then hybridized with the chromosomal DNAs isolated from the three strains of Legionella used to amplify the probes (L. pneumophila Paris, L. pneumophila Lens and L. pneumophila Philadelphia) in order to test the quality and the correct deposit of the probes. IV) Hybridization on the matrix

The genomic DNA was extracted using the phenol / chloroform technique and was radiolabeled using a random primed DNA labeling kit (Roche). The labeling was carried out with 200 ng of genomic DNA and 50 μCi of ³³ P-labeled dCTP (Amersham). The labeled DNA was purified using Qiaquick microcolumns (Qiagen). High density chips were wetted in 2X SSC (the SSC IX consists of 0.15 M NaCl plus 0.015 M sodium citrate) and prehybridized for 1 h in 10 ml of a hybridization solution containing SSPE 5X (SSPE IX consists of 0.18 M NaCl, 10 mM NaH ₂ PO ₄ and 1 mM EDTA, pH 7.7), 2% sodium dodecyl sulfate, Denhardt IX solution (The Denhardt 5OX solution consists of 1% Ficoll, 1% polyvinylpyrrolidone and 1% bovine serum albumin), and 1 mg of denatured salmon sperm DNA. Hybridization was carried out overnight at 60 ^° C. in 5 ml of hybridization solution mixed with the purified labeled DNA. The membranes were washed twice at ambient temperature and twice at 60 ^° C. in 0.5% SSPE-0.2% sodium dodecyl sulphate. The chips were then sealed in polypropylene bags and exposed to a phosphorimager screen (Molecular Dynamics) for 48 hours. For reading, a model Typhoon 9400 imager (Amersham Biosciences) was used. The chips were then dehybridized using 0.5 N NaOH for 30 min for another use. V) Analysis of the matrix

ArrayVision (Imaging Research) software was used for quantification of hybridization intensities. The value of the hybridization intensity of each deposit was normalized by dividing by the median of all significant intensity values on each filter. For the calculation of the ratios, a reference chip was used, which was constructed by combining the averaged data from four replicates of genomic DNA hybridization of L. pneumophila Paris, L. pneumophila Lens, L. pneumophila Philadelphia L. longbeachae 99013058 and L. pneumophila Olda RCl strain corresponding deposits on the chip. In order to define the threshold value of the ratio for the presence of a gene, we analyzed the results for the genes of L. pneumophila Paris hybrids with the chromosomal DNA of L. pneumophila Lens and Philadelphia (and in the same way, the L. pneumophila Lens hybrid genes with the chromosomal DNA of L. pneumophila Paris and Philadelphia, L. pneumophila Philadelphia genes hybridized with the chromosomal DNA of L. pneumophila Paris and Lens). The data were then converted to binary scores (for ratios> 0.3, the gene score was present [1], and for ratios <0.3, the gene score was absent [O])

(http://www.pasteur.fr/recherche/unites/gmp/sitegmp/gmp_proj ects.html). This corresponds to a DNA similarity of 80%, which has been verified by comparisons of the sequences of these genes for the three genomes. The binary data was analyzed by hierarchical classification with the J-Express program (Dysvik & Jonassen, 2001) and by an expert intensive data mining with Excel spreadsheets.

VI) References of Legionella strains tested

(see Tables 3 and 13) Example 2 Identification of a Gene Specific to All Legionella Pneumophila Serogroup 1 Strains

The inventors undertook a study of the biodiversity of the genus Legionella by determining and comparing four complete sequences. Three of Lp Sg 1 [Paris, Lens strain and Philadelphia-1 (5, 6)] and a partial sequence of an L. longbeachae isolate being sequenced. Based on these four sequences, a DNA chip was designed and constructed bearing 1303 probes. This chip was hybridized with the genomic DNA of 248 strains of the genus Legionella: 152 Lp SgI, 64 Lp Sg2-15, 32 Legionella sp. (14 species of the genus Legionella). The results of this study show that the genes encoding the proteins involved in lipopolysaccharide biosynthesis (LPS) are the only ones that have the power to discriminate the different Sg of Lp. Among them, we identified 3 genes present in all strains of SgI and specific to them (wzm, wzt, lppO831). In addition, three other genes (lppO836, lppO843, lppO827) are also present in all SgI strains whereas they are present in only one to three non SgI strains among 248 strains tested. Finally, the lppO832 gene is specific for SgI strains and appears to be lacking only in two strains of SgI. In addition, we identified several genes specific to the Paris strain, a strain found worldwide in cases of human legionellosis. The region carrying the genes lpp0068-lpp0080 is specific to strain Paris. It has been shown here that the cyoABC operon (lppO291-lppO297), the Ipp2111-lpp2125 region and the lppO779 coding for an auto transporter are specific for SgI Paris strains with one exception (Cazalet et al, 2008, Genome Res 2008). .

The inventors have therefore defined sets of primers and tested their effectiveness (sensitivity) and specificity by a concordance study between PCR and reference method (culture and serotyping). By comparing the sequences of the three SgI specific genes (wzm, wzt, lppO831) in the 4 fully sequenced Lp Sg1 strains (Paris, Lens, Philadelphia-1, current Corby, IP and German teams) we were able to define the most conserved regions. We tested 4 primer pairs for each gene and tested them for their specificity and efficacy on a collection of 464 strains. 424 strains belonging to the genera Legionella and 40 usually present in water (species chosen according to AFNOR Standard XP T90-471). The test of each set of primers was performed and as a positive control, a specific amplification of the mip gene (specific to the genus Legionella) was used. This allowed us to determine specific primers for SgI. Currently, laboratory studies on the sequencing of the specific LPS cluster in different serogroups of L. pneumophila aim to define specific genes for each serogroup thus allowing the development of PCR assays for the identification of each serogroup. To date we have sequenced the regions carrying the genes encoding the proteins involved in the LPS biosynthesis of Sg 6, 10, 12, 13 and 14. Thus, the determination of the specific primers of these other SGs is made and their specificity has been tested in the same way as for the SgI. We have also sequenced the genome of a strain of L. longbeachae, the second leading cause of human legionellosis in the world, particularly in Oceania. The analyzes show that the genes encoding L. longbeachae LPS are very different from those of Lp. We have also defined specific primers and we have tested them, to develop a universal test grouping the main legionella pathogens. Example 3: Quantitative PCR with primers P65-P66 (specific SgI)

Results

Quantity Quantity

Tested theoretical DNA Ct Estimated average Ct

(UG) (UG)

Estimate of detection limit y = -2.8117392x + 35.852413; r ² = 0, 998

L. pneumophila 25,000 23.56

SgI Philadelphia 25,000 23.45 23.48 25,135

25,000 23.43

2,500 26.15

2,500 25.83 26.05 3,064

2,500 26.17

250 29.18

250 29.52 29.39 199

250 29.46

25 32.63

25 32.67 32.72 13

25 32.86

15 32.80

15 33.30 33.25 8

15 33.66

5 35.09

5 34.11 34.87 2

5 35.42

2,5 35,85 36,06 1 First result 2.5 36.26 negative for 2.5UG detection limit

2.5 ND between 2.5 and 5 UG

White 0.0 ND ND

Estimate of the limit of quantification y = -3.3054514x + 38.245598; r ² = 0.999

25 33.15

25 34.10

25 33.61

25 33.52

25 35.41

33.62 25

25 33.65

25.33

25 33.19

25 34.33

L. pneumophila SgI 25 35.03

Philadelphia 10 34.95

10 35.23

10 33.82

10 35.06

10 36.90

35.26

10 34.77

10 36.91

10 35.63

10 34.55

White 0.0 ND ND

Results on different strains of Sα1 y = -3.188165x + 42, 18248; r ² = 0.993

25,000 28.11

L. pneumonia SgI

25,000 27.80 27.95

strain Paris 29 188

25,000 27.93

L. pneumophila SgI 25,000 27.47

environmental 25,000 27.55 27.51 39,914

No. 59 (HL02292010) 25,000 27.52

White 0 ND ND y = -3.0301416x + 41.322914; r ² = 0.986

2,500 30.99

2,500 31.12 31, 02 2,506

L. pneumophila SgI 2,500 30.96

strain Paris 25 36.52

25 38.48 37, 67 16

25 38.01

L. pneumophila SgI 2,500 30.91

strain Lens 2 500 30.78 30, 85 2 859

2,500 30.86 25 38.38

25 36.68 37.08 25

25 36.18

2,500 32.05

2,500 31.94 31.97 1218

L. pneumophila Sgl 2,500 31.93

Corby strain 25 39.29

25 37.97 38.38

25 37.87

L. pneumophila SgI 2,500 29.49

CNRl-Al 2,500 29.85 29.74 6629

(HL07073023) 2,500 29.89

L. pneumophila SgI 2,500 28.97

CNRl-Bl 2,500 29.09 29.05 11256

(HL07034031) 2,500 29.08

L. pneumophila SgI 2,500 27.15

CNRl-Cl 2,500 27.36 27.25 43975

(HL07103003) 2,500 27.25

L. pneumophila SgI 2,500 29,50

CNRl-Dl 2,500 29.88 29.72 6748

(LG08015025) 2,500 29.78

L. pneumophila SgI 2,500 28.74

CNRl-Gl 2,500 28.70 28.75 14138

(LG08075006) 2,500 28.80

L. pneumophila SgI 2,500 27.80

CNR1-C2 2,500 28.13 28.02 24496

(LG08111019) 2,500 28.14

L. pneumophila SgI 2,500 29,11

CNR1-E3 2,500 29.16 29.16 10301

(LG07285012) 2,500 29.22

White 0 ND ND y = -2.1367867x + 33.91827; r ² = 0.964

L. pneumophila SgI 2500 25.96

CNRl-Bl after

25.82

purif. 6165 Before purifying : 11256

(HL07034031) 2,500 25.68

L. pneumophila SgI 2,500 26.18

CNRl-Cl after

26,23

purif. 3963 Before purifying : 43975

(HL07103003) 2,500 26.28

L. pneumophila SgI 2,500 25.30

CNRl-Gl after

25,26

purif. 11333 Before purifying : 14138

(LG08075006) 2,500 25.21

L. pneumophila SgI 2,500 25.51

CNR1-C2 after

25.64

purif. 7525 Before purifying : 24496

(LG08111019) 2,500 25.76

L. pneumophila SgI 2,500 25,99

CNR1-E3 after

25.94

purif. 5417 Before purifying : 10301

(LG07285012) 2,500 25.89

White 0 ND ND y = -2.8159485x +39, 023796; r ² = 0, 998

2,500 28.40

2,500 28.49 28.46 5,626

L. pneumonia Sgl

2,500 28,50

# 165

(HL02324052) 25 34.03

25 33.43 34.08 57

25 34.77

2,500 27.53

2,500 27.14 27.34 14,136

L. pneumophila Sgl 2,500 27.34

No. 166 (EULl) 25 31.77

25 32.24 32.11 285

25 32.32

2,500 26.08

2,500 26.08 26.07 39,934

L. pneumophila SgI 2,500 26.04

No. 167 (00514008) 25 30.44

25 30.31 30.35 1 203

25.30.30

White 0 0 ND -

Results on DNA mixtures sgl and non-sgγ = -3,3251033x + 38, 06712; r ² = 0, 996

L. pneumophila SgI 2,500 27.82

Philadelphia 2,500 27.98 27.83 1,199

+ water 2,500 27.69

The presence of L. pneumophila SgI 2,500 27,79 non-sgl DNA did not Philadelphia 2,500 27,71 27,77 1,247 influenced the + 25,000 UG Lp quantification of sg6 2,500 27.82

sgl DNA.

L. pneumophila SgI 2,500 27.84

Philadelphia + 25 2,500 27.40 27.80 1,227

000 UG L.longb. 2,500 28.15

White 0 37.38 37.38 1.6

Results on non-sgl DNAs = -3.3251033x + 38, 06712; r ² = 0, 996

25,000 ND

L. pneumophila sg6

25,000 ND 35.55 5.7

n ° 13 (CIP103860)

25,000 35.55

25,000 36.73

L.longbeachae n ° 5

25,000 ND 36.73 2.5

(NSW150)

25,000 ND

25,000 34.76

L. pneumophila sg2

25,000 36.96 35.86 4.6

n ° 8 (CIP103856)

25,000 ND

White 0 37.38 37.38 1.6 y = -3.0301416x + 41.322914; r ² = 0.986

L. pneumophila sg2 2500 ND

CNRl-ElO 2 500 ND ND

(LG07291025) 2500 ND

White 0 ND ND y = -3.188165x + 42.18248; r ² = 0.993

L. pneumophila sg7

25,000 ND

No. 14 (CIP103861) ^{Zb UUU NU NU}

25,000 ND

White 00 NNDD ND y = -2.8117392x + 35.852413; r "= 0.998

250,000 ND

marce ^S sTens n ° 102 ² 2 ⁵ 5 ⁰ 0 ⁰ 0 ⁰ 0 ⁰ 0 ^N N ^D D ^ND

250,000 ND

SerraSa plymuthica _2∞ ""<, _ND

250,000 ND

Acinetobacter Iwoffii _{2∞∞0 mm}

250,000 ND

aerogenes ^a ^ 29 ² = "" ∞ "D ^ND

250,000 ND

White 00 NNDD ND

Example 4 Quantitative PCR with primers P69-P70 (specific L. longbeαchαé) Standard range

Made from DNA L. longbeαchαe ATCC33462 (extracted by Quiagen kit)

Amount in UG calculated by nanodrop assay, knowing that 1 UG of L. pneumophilα = 4.3 fg of DNA or 250,000 UG = 1 ng of DNA (2 μl at 0.5 ng / μl by reaction of qPCR)

Results

A ADDNiM t teessttée Quantity _(é _U t _Q _h) and e éorique ett mmoovyeenn _is Q _im _e n _e ua ti _(t _U é _G)

Estimation of detection limits and quantification y = -3.78788x + 44.52163; r ² = 0.996

Legionella 250,000 24.15

longbeachae 225500 000000 2233,, 7777 24.01 260 057

ATCC33462 250,000 24.11

2 -i5 c n 0n0n0 2 π7, n9o8 27.81 25 815

25,000 27.64 2500 31.21

31.27 3151

2500 31.33

250 35.70

250 34.24 35.60 227

250 36.85

25 ND

25 ND ND -

25 ND

White 0.0 ND ND -

Results on different DNA L.longbeachae

y = -378788x + 44.52163; r ² = 0.996

Legionella 25,000 29.36

longbeachae n ° 93 25,000 29.65 29.43 9 642

(C4E7) 25,000 29.28

Legionella 25,000 28.38

longbeachae no. 94 25 000 28.70 28.53 16 631

(98073) 25,000 28.52

Legionella 25,000 29.40

longbeachae n ° 95 25,000 29,30 29,19 11,157

(98072) 25,000 28.87

White 0.0 ND ND y = -2.4527311x + 40, 17975; r ² = 0.967

Legionella

longbeachae n ° 5 2,500 28,89

28.94 38 422

(NSW150) 2,500 28.98

Legionella

longbeachae n ° 97 2,500 30,77

30.52 8 718

(NSW150) 2,500 30.26

Legionella

longbeachae n ° 98 2,500 29,80

30.23 11 446

(NSW150) 2,500 30.65

Legionella

longbeachae n ° 100 2,500 28,46

28.86 41 225

(NSW150) 2,500 29.26

White 0.0 ND ND

Results on non-L-DNAs. longbeachae y = -3.78788x + 44.52163; r ² = 0.996

Legionella 2500 ND

pneumophila sgl 2500 ND

Philadelphia 2500 ND

Example 5 Quantitative PCR in Multiplex with primers P65-P66 / P69-P70 (specific L. longbeachae)

Stallions P65-P66: Made from DNA L. pneumophila sgl Philadelphia strain (extracted by kit

Qiagen)

P69-P70: Made from DNA L. longbeachae ATCC33462 (extracted from Quiagen kit)

Both standard ranges were made separately (not in multiplex).

Results I

Quantity Quantity

Tested theoretical DNA Ct Estimated average Ct Remarks

(UG) (UG)

Example 6 Quantitative PCR

I Materials and Methods

1) Bacterial strains and culture conditions

A total of 454 strains of Legionella were selected from the 0 collection of the National Reference Center (Lyon, France) and the laboratory collections of the Biology of Intracellular Bacteria unit of the Pasteur Institute and the Hospital. Raymond Poincaré, Garches France, belonging to the species L. pneumophila (404), L. longbeachae (19) or other species of Legionella (31). In addition, 38 bacterial strains not belonging to the genus Legionella but frequently present in aquatic environments were included in the study (Tables 3, 13 and 4A). The Legionella strains were cultured at 37 ° C. on yeast extract buffered charcoal-yeast extract (BCYE) or in BYE medium adjusted to pH 6.9 (ACES buffer 10 g / l). , yeast extract 10 g / l, cysteine L 0.4 g / l, ferric pyrophosphate 0.25 g / l) overnight stirring before extraction of the DNA. The strains that are not Legionella strains were cultured on a BHI (brain heart infusion) medium at 25 ^° C. or at 37 ^° C. depending on the culture requirements of the species.

2) Sequencing and analysis of the LPS gene cluster

The genomic DNA of strains of L. pneumophila Sg 6, 9, 10, 13, and 14 (Table 4B) was isolated using the DNeasy® Blood & Tissue kit (Qiagen). The LPS gene cluster was amplified using the Long Range PCR Kit (Qiagen) in a final volume of 50 μl according to the manufacturer's instructions. The PCR fragment was gel purified and used as a template to establish a blind sequencing data library (1 to 3 kb inserts) following the protocol described by Cazalet and his team, 2010 (5). Two hundred clones were sequenced from both ends for each LPS gene cluster with an ABI PRISM BigDye Terminator Cycle Sequencing Kit and a 3730 Xl Genome Analyzer (Applied Biosystems). The sequences were assembled and finished as previously described (21). Coding sequence definition and annotation were performed using CAAT-Box software (19). For sequence comparison, the Artemis Comparison Tool (ACT) was available free of charge from the Sanger Center (4).

3. Collection of samples from hot water distribution network

A representative sample of hospital buildings (21 buildings in 14 hospitals (AP-HP) in the Paris region) was chosen between June and November 2009. The samples were taken by each hospital hygiene team, responsible for managing the networks. hot water distribution system of the hospital (13). For each sample, 2 liters of water were taken from sterile bottles containing sodium thiosulphate chlorine (20 mg / l). The temperature of the water and the time required to obtain a temperature were measured. The water samples were sent to the laboratory in less than 24 hours. One liter was filtered for the culture method and one liter was filtered for DNA extraction with qPCR. The DNA extracts were stored at -20 ^° C. until use.

4) Collection of samples from clinical cases

A total of 96 respiratory specimens including 27 samples taken from patients with a confirmed diagnosis of legionellosis and 69 samples taken from patients with Pneumonia of non-Legionella origin was tested by both our qPCR-SgI and the Legionella spp / Z multiplex real-time PCR kit. pneumophila (Diagenode). Of the 27 cases of legionellosis, 10 were diagnosed with the culture method, 12 with the urinary antigen method (Binax NOW® immunochromatographic test) and five with the multiplex real-time PCR kit (negative with the other tests). Samples were collected between July 2007 and April 2010.

5) Analysis of water samples by culture

The viable Legionella were quantified by culture, in accordance with the French standard method T90-431 (34). 200 .mu.l of each water sample were directly inoculated on a GVPC (Oxoid) medium. The water samples were filtered through a polycarbonate membrane (Millipore 0.40 μm). The membrane was sonicated for 10 minutes in 5 ml of sterile water. 100 μl of the concentrate were inoculated on a GVPC medium, directly or after a dilution by 10, an acid treatment (5 min, pH 2) or a heat treatment (30 min, 50 ⁰ C). The plates were incubated at 37 ^° C., and the colonies were counted after 3 days and 8 days. For each sample in which a Legionella growth was detected, five colonies were subjected to additional analyzes by propagation on BCYE agar at 37 ^° C. compared to COS (Oxoid) agar. Legionella strains isolated on BCYE agar were typed using a latex agglutination test (Oxoid) specific for Legionella sp., L. pneumophila Sg2-14 or L. pneumophila SgI. Subsequently, isolates defined as serogroup Sg2-14 were further immunofluorescently typed using internally produced polyclonal rabbit sera (Legionella National Reference Center, Lyon, France) and monovalent reagents for each serogroup (2 to 15) (BioMerieux) (33)). Non-pneumophila Legionella were identified by PCR amplification and mip gene sequencing using the European Working Group for Legionella Infections (EWGLI) protocol adapted from Ratcliff and his team (32).

6) Design of primers and probe

Endpoint PCR primers were designed with Primer 3 software (http

: //frodo.wi.mit.edu/) for the lppO836, wzm and wzt genes, on the regions identified as being specific for L. pneumophila SgI compared to the available Legionella sequences. The primers and probes of the qPCR were designed using Primer Express software (Applied Biosystems). The primers were synthesized by Sigma Proligo (Sigma-Aldrich) and Eurogentec provided the 3 '-Black HoIe Quencher ™ Double-Dye Probe probe (Table 5).

7) Extraction of DNA from pure culture

DNA from pure cultures was extracted with the DNeasy Blood & Tissu kit® kit

(Qiagen). 2 ml of liquid culture were centrifuged. The pellet was resuspended in 180 μl of ATL buffer, and the extraction was performed according to the manufacturer's instructions. DNA concentrations were determined spectrophotometrically at 260 nm (Nanodrop®, Wilmington, Australia). The DNA was diluted to 1 ng / μL and distributed in 96-well plates. 2 μl were used for endpoint PCR and qPCR to test the specificity of the primers.

8) Extraction of the DNA from water samples for qPCR.

For each sample, 1 liter of water was filtered through a polycarbonate membrane (Millipore 0.40 μm). After 10 filtrations, 1 liter of sterile water (water for injections, C.D.M. Lavoisier, Paris, France) was filtered as a negative control of the filtration step. DNA extraction was performed directly on the membrane using the Aquadien kit (Biorad), according to the manufacturer's instructions. DNA was elected in

100 μl of elution buffer. For each serial extraction, a negative control of the extraction step was carried out following the same protocol without polycarbonate membrane. The DNA extracts were stored at -20 ^° C. until they were used for the qPCR tests.

9 Extraction of DNA from clinical samples for qPCR

The DNA was extracted with the MagNA Pure Compact System automated analysis system (Roche Diagnostics) and nucleic acid isolation kit I (Nucleic Acid).

Isolation kit I). Before the automated extraction, the samples were liquefied as follows:

22 μL of DTT (dithiothreitol) were added to 200 μL of sample and incubated for

10 min at 37 ^° C .; 180 μl of bacterial lysis buffer and 20 μl of proteinase K (20 mg / ml) were then added to 200 μl of liquefied sample and incubated for 10 min at 65 ^° C. We used the extraction protocol manufacturer's DNA with an elution volume of 100 μL. The DNA extracts were stored at -20 ^° C. until they were used for the qPCR tests.

10) Final-Sgl PCR conditions The amplification mixtures contained 5 μl of GeneAmp 10 X PCR Buffer II, 4 μl of 25 mM MgCl 2, 1 μl of 10 mM dNTP for each dNTP, 0.3 μl of Amplitaq DNA polymerase at 5 units / μl. (Applied Biosystems) and 3 μl of each primer (Pl and P2, Table 7) at 10 μM, 3 μl of 10 μM antisense primer, 32 μl of purified PCR grade water and 2 μl of DNA with 1 ng / μl. The thermal profile used was 1 min at 94 ^° C. followed by 35 cycles of 30 s at 94 ^° C., 30 s at 55 ^° C., 30 s at 72 ^° C., and a final step of 4 min at 72 ^° C. for the final elongation. A positive control (strain L. pneumophila SgI ATCC 33152) and a negative control (purified water grade PCR) were included in all PCR assays. The PCR products were loaded on 1% agarose gels for interpretation.

11) Conditions of the qPCR (i) qPCR-Sgl

The reaction mixtures contained 2 μl of DNA, 800 nM of each primer (P65 and P66, Table 7), 200 nM of the SgI specific probe, 10 μl of Taqman universal PCR master mix 2X (Applied Biosystems), 2 μl of Exogenous Internal Positive Control Mix 10X (Applied Biosystems), 0.4 μl of Exogenous Internal Positive Control DNA 5OX (Applied Biosystems), and purified water of PCR grade to obtain a final volume of 20 μl. The amplification was carried out on Chromo4 (Biorad), with the following parameters: a first step at 50 ^° C. for 2 min in order to activate the DNA polymerase, a step at 95 ^° C. for 10 min (initial denaturation), followed by 50 cycles of 15 s at 95 ^° C. and 1 min at 60 ^° C. Each test was carried out in duplicate. For clinical specimens, the same PCR protocol was used and amplifications were detected with the LightCycler DNA Master Hybridization Probe kit, used according to the manufacturer's instructions (Roche). If PCR inhibition occurred (non-amplification of the internal positive control or Ct> 40), the DNA samples were diluted 2 to 32-fold in PCR grade water and the qPCR- Sgl was performed with 5 μl of these dilutions (in a final volume of 50 μl). In case of suspicion of false negative results (compared to the results of the cultures), the DNA samples obtained by the previously described method (Aquadien kit, Biorad) were again purified and concentrated with a cleaning process (QIAamp Micro DNA, Qiagen). Then, qPCR-Sgl was carried out with 5 μl of these new DNA samples (in a final volume of 50 μl), and after a dilution x2 to 32 in PCR grade water if necessary, (ii) qPCR commercially available: a qPCR for Legionella sp and a qPCR for L. pneumophila were performed according to the recommendations of the supplier (iQcheck ™ Quanti Legionella, Biorad). Quantification of DNA in units of the genome (GU) was performed for all three methods of qPCR using the external standard solutions provided with the commercial kit (iQCheck ™ Quanti Legionella, Biorad).

12) Estimation of the limits of detection and quantification of qPCR-Sgl

The detection limit (DL) of the qPCR-Sgl assay (DLPCR) was defined as the smallest number of GUs per qPCR reaction, giving a positive result in at least 90% of cases. The Quantification Limit (QL) of the qPCR-Sgl assay (QLPCR) was defined as the smallest number of GUs per reaction of qPCR, producing a coefficient of variation of less than 25% (27). The DL and QL of the qPCR-Sgl applied to water samples (expressed in GU / 1) were defined as DLmeth = DLPCR x (f x F) / v and QLmeth = QLPCR / (f x F) / v. refers to the proportion of concentrate used for DNA extraction (1 / 1.6 ie 1 ml of 1.6 ml) and F refers to the proportion of DNA extracts used in the qPCR test (1/20, that is to say 5 μl of 100 μl). v is the volume of the filtered water sample, expressed in liters. For the DLmeth the result was divided by 2 because the qPCR was performed in duplicate for each DNA extracted from a water sample.

13) Analysis of qPCR data

The quantification in genome units per liter (GU / L) of the results obtained with the commercially available qPCR kit was performed using the "iQCheck ™ Analysis" analysis software provided by Biorad. Quantification of the results obtained with our qPCR-Sgl was calculated using the procedure and software provided by Biorad.

14) Statistical analysis

The concordance between qPCR and the culture method was estimated by Cohen's kappa coefficient. Given the lack of a standard gold standard, we used the Hui and Walter paradigm (25), which is the commonly accepted standard method for evaluating diagnostic tests. It introduces a probabilistic "latent class" approach, which requires the evaluation of two (or more) tests in two (or more) subpopulations. This model assumes that: (i) the prevalence of the disease is different within each population; (ii) the characteristics of the tests are identical in both populations; (iii) and the status of the disease is assigned to the tests in a conditionally independent manner. In this study, both tests (culture and qPCR) were to be compared under various conditions (building size, age of the water supply system, hot water production method, location, temperature and chlorination, which define the subpopulations of the water samples), which can not be independent of each other. We therefore performed a multiple correspondence analysis of the multiple arrays formed by the combination of all the conditions, then a hierarchical grouping on the main components. The resulting binary classification was used for the main comparison of the culture and qPCR method.

II) Results

L. pneumophila SgI encodes a cluster ("a battery") of specific genes present within genes encoding lipopolysaccharide biosynthetic proteins. The results of a comparative genomic hybridization analysis of 217 L. pneumophila strains belonging to the serogroups present in the species revealed a highly specific correlation between SgI and the gene content of a 33 kb segment encoding genes involved in LPS biosynthesis. The SgI LPS gene cluster can be subdivided into a region of 13 kb and 20 kb. While the 13 kb region was well conserved, the 20 kb region extending from lppO827 to lppO843 was highly specific for SgI strains and three genes, wzm, wzt and lppO831, were identified as present in all SgI strains. and only in these last (6). To confirm the results of the hybridization and to study the LPS gene cluster of different serogroups of L. pneumophila in more detail, we undertook a sequence analysis of this 20 kb region in six additional serogroups of L. pneumophila. Using long-range PCR and consecutive blind sequencing, we were able to amplify and sequence this region in Sg 6, 9, 10, 12, 13 and 14 strains. shown in Table 4B, the size of this region ranged from 27 to 30.8 kb. In fact, with the exception of the flanking regions and some genes within the analyzed region, the SgI LPS gene cluster sequence, compared to the newly sequenced serogroups, was strongly divergent (Table 5, Figure 1), which confirmed the specificity of SgI LPS compared to other serogroups of L. pneumophila. In contrast, a comparison of the sequenced region of non-Sgl strains present among them revealed a high similarity for many of them. In particular, Sg6 and Sgl2 had high similarity in DNA and proteins (Table 6, Figure 2), as well as SgIO and Sgl3 and Sgl4. Our new results confirm, with supporting evidence, that L. pneumophila SgI encodes a specific region, conserved within its LPS gene cluster comprising three genetic markers, wzm, wzt and lppO831, SgI strains. In order to investigate whether the three specific genes can be exploited as targets for SgI-specific PCR assays, we have designed primers that are best suited to differentiate L. pneumophila SgI from other serogroups of L. pneumophila and other Legionella sp species. . for these genes. In total, eleven pairs of primers were tested for their specificity on 492 strains, 404 of which belonged to L. pneumophila Sgl-14, 50 to Legionella sp. and 38 to other non Legionella sp. (Table 4A and Table 13). The best amplification was obtained with the pair of primers called "P1-P2" (for end-point PCR) which targets wzm because for this pair of primers, all strains of L. pneumophila SgI were in fact amplified ( n = 254) (Table 5). None of the non-SgI strains showed a positive amplification signal. The specificity of the primers P1-P2 is therefore 100%.

Development of a qPCR-Sgl method

PCR screening of 492 strains revealed that the 293 base pair region of the wzm gene extending from nucleotide 99 to 392 is a highly specific genetic marker for SgI strains. We therefore designed a pair of primers and a probe for a qPCR assay targeting this region. This pair of primers (called "P65-P66") showed the same specificity as P1-P2 on the 492 strains tested (100%), and a high efficiency on standard solutions (98.4%). It was therefore selected for the further development of qPCR-Sgl. The detection limit (DL) and the limit of quantification (QL) were found to be equal to that of the commercially available qPCR (DL = 80 UG / L and QL = 480 UG / L). QPCR-Sgl is highly specific for monitoring L. pneumophila SgI contamination in water distribution systems

There is no method that can quickly and specifically identify and "type" L. pneumophila contaminating water distribution networks such as water distribution networks of hospitals, cooling towers or networks. water supply of retirement homes. We therefore tested our PCR-SgI to evaluate its performance on water samples taken from hospitals. A total of 209 samples were collected in water distribution networks in 15 hospitals located in the Paris region. Of the 209 samples tested, 60 were positive with our qPCR-Sgl (Table 9), of which 33 were confirmed by culture. We then continued our study of the 27 samples that were positive with qPCR-Sgl but negative with the culture method. As shown in Table 10A, for seven samples out of 27, the culture method confirmed the presence of L. pneumophila Sg2-14. These results suggest that these samples were contaminated with L. pneumophila SgI and L. pneumophila Sg2-14 but that these SgI colonies were not considered in culture, as only five colonies were tested. The remaining 20 samples, positive with qPCR-Sgl, were negative with the culture method because no colonies grew. However, non-culturable L. pneumophila and / or Legionella DNA was certainly present in these samples because Biorad's qPCR was also positive. Overall, if we considered the 20 samples as positive with the two different PCR methods, only seven of the 60 SgI positive samples contained Legionella non SgI. However, these samples may have been contaminated with both SgI and Sg2-14 isolates.

Of the 209 samples tested, 149 were negative according to our qPCR-Sgl. Indeed, 143 of these 149 samples were also negative with the culture method, but surprisingly, six culture positive samples were negative with qPCR-Sgl. Table 10B summarizes the results obtained for these six samples by all the different methods used. Only one sample was highly contaminated as can be deduced from the culture results, however, Biorad's qPCR for Legionella spp. was negative, and the remaining five samples were not culturally quantifiable and were also negative by qPCR. This indicates the presence of PCR inhibitors or problems in DNA extraction.

III) Comparison of the results of qPCR-Sgl and culture method

A total of 60 samples out of the 209 samples tested were positive by

PCR-SgI; 33 out of 39 positive samples per culture and 27 out of 170 negative samples per culture (Table 9). This made it possible to calculate a sensitivity of 84.6% and a specificity of 84.1% for the qPCR-Sgl. The results were consistent for 182 of the 209 samples tested between qPCR-Sgl and the culture method. The kappa coefficient was 0.57 which can be considered a good match (18). According to estimates made by the Hui & Walter method, the prevalence of SgI was 0.29, with [sensitivities / specificities] for qPCR and for culture equal to [1 / 0.99] and [0.55 / 0.96] respectively. Inhibition of qPCR was observed in 11.9% of cases (25 of 209 samples) for qPCR-Sgl. The inhibitory activity of these samples was easily resolved by dilution (see Materials and Methods).

Contamination of water distribution systems depends on the characteristics of the sample and buildings. The buildings from which we conducted our research on the 209 water samples were selected according to several criteria known as risk factors for the spread of Legionella: chlorination, age (less than or greater than 30 years), size of the water supply system (less than or greater than 25% of hospital beds), method of producing hot water (Table 11). For each building, ten samples of domestic water were taken: (i) at the hot water production outlet (n = 1), (ii) in return for a hot water supply loop (n = 1), (iii) representative faucets (n = 3), (iv) lightly used faucets (n = 4), and (v) a representative faucet of sanitary cold water without hot water (n = 1).

Despite French regulations in order to control the risk of Legionella contamination, 13 of the 21 buildings (62%) tested were positive by qPCR-Sgl and by LpI culture. All sample types (eg hot water output, hot water supply loop return, representative faucets, seldom used faucets, and sanitary cold water) were positive at least once for L. pneumophila SgI with both methods.

Compared with the culture method (LpI), qPCR-Sgl was significantly more positive for samples from chlorinated buildings (40% vs. 25% p <0.01), for samples with a temperature between 23 ⁰ C and 55 ⁰ C (29% against 22% p <0.01) and for samples of faucets little used (31% against 23% p <0.01). In addition, samples taken from chlorinated buildings were significantly more positive than samples taken in non-chlorinated buildings with the LpI culture method (25% versus 12% p = 0.02) and the qPCR-Sgl (40% versus 17%). A similar trend, although not significant, was observed in culture tests, for samples with temperatures between 23 ⁰ C and 55 ⁰ C (22% versus 14% for the other samples) and for samples from faucets rarely used compared to representative faucets (24% vs. 14%). In contrast, when qPCR-Sgl was used, no difference was observed with respect to temperature (29% versus 29%) or for representative faucets compared to low-used faucets (32% vs. 31%). Finally, the size and age of the building or the method of water production did not have any significant impact on the positive LpI or when the culture was used, nor when qPCR-Sgl was applied. Overall, chlorination, water temperature, and frequency of network use appear to be the most important factors in L. pneumophila SgI contamination. QPCR-Sgl is a rapid and reliable method for detecting L. pneumophila SgI for clinical specimen testing. In order to evaluate the performance of the qPCR-Sgl developed here for the detection of L. pneumophila SgI applied to clinical cases, 96 respiratory specimens from patients with pneumonia were tested. A total of 22 of the 96 samples tested were positive for L. pneumophila SgI by standard methods (culture and / or urine antigen test), three samples were positive for L. pneumophila-FCK (PCR-Lp) and two samples were found positive by Legionella spp.-PCR (PCR-Lspp) (Table 12). When our qPCR-SgI was used, 22 samples indicated legionellosis due to L. pneumophila Sg 1. These samples included 21 culture-tested samples and one of three PCR-Lp positive samples. The only negative sample by qPCR-Sgl on the 22 cases of legionellosis diagnosed was that identified by the Legionella pneumophila serogroup 1 (LpI) antigen test in the urine. However, the SgI-PCR may just as well be correct because this case has not been confirmed by any other method. This respiratory sample was negative by culture, negative by PCR-Lp and negative by Nested-SBT (no amplification for the 7 alleles as described by Ginevra et al (20)). Thus, if we consider that the two samples negative by qPCR-Sgl but positive by PCR-Lp were in fact Lp2-15 strains (impossible to confirm because no culture is available), and that the samples positive by qPCR -Sgl and PCR-Lp were actually a strain of L. pneumophila SgI, the performance of our qPCR-Sgl is also very high with a sensitivity of 95.6% (22/23), and a specificity of 100% (73%). / 73) for use in the diagnosis of legionellosis in clinical specimens.

Numerous studies have shown that qPCR for the detection of Legionella species in the environment is a promising method that could replace the culture method (2, 15, 30, 35, 38, 39). In addition, although the L. pneumophila SgI antigen test in urine works very well, a qPCR-Sgl method for diagnosing clinical specimens can be a useful alternative that is fast, less expensive, and complementary. However, in contrast to the culture method, the available qPCR methods do not identify L. pneumophila SgI, L. serogroup. pneumophila responsible for more than 85% of human infections. Sequencing and genomic comparison by hybridization have identified three genes encoding proteins involved in lipopolysaccharide biosynthesis (LPS) as being specific for SgI strains (6, 7). Our work has thus focused on a characterization of the sequences in depth of the genomic region specific to the LPS cluster in different serogroups of L. pneumophila and consecutively in the development of a qPCR method allowing rapid and precise detection and identification. L. pneumophila SgI in water samples, an indispensable tool for global surveillance.

Analysis of the LPS gene cluster in six additional L. pneumophila strains belonging to serogroups 6, 9, 10, 12, 13, 14 revealed that the previously defined 20 kb region of the LPS gene cluster extended from lppO287 to lppO843 in the strain L. pneumophila Paris (6), is in fact highly specific for SgI strains. For example, when comparing this region between SgI and Sg6, the second serogroup frequently encountered in human pathology (14), only two genes have significant similarity. The remaining genes are highly divergent (Table 6). The comparison of the sequences of the different regions thus confirmed that the previously identified genes, in particular one, wzm were a specific and sensitive target for a new qPCR-Sgl method.

From these results, we developed a PCR-SgI and a qPCR-Sgl method that was tested on 492 Legionella strains and 209 water samples taken in hospital environment. The results showed that this assay developed here was highly specific and sensitive for the detection and identification of L. pneumophila SgI in cultured (100%) DNA samples. In addition, the qPCR method is much faster (4 hours vs 8 days) and simpler than the culture method; it also allows a direct quantification of the amount of L. pneumophila SgI present. In contrast, the culture method allows only an approximation of the amount of L. pneumophila SgI by colony counting by immunofluorescence or agglutination of certain colonies (at least five colonies according to the AFNOR T90-431 standard method). Obviously, with the culture method it is possible to let the presence of L. pneumophila SgI pass because the results depend on the colonies that are selected for further analysis. This occurs especially when another species of Legionella or strains of other serogroups of L. pneumophila predominate in the sample. Our results showed that qPCR-Sgl can be positive while culture was negative (27/209 ie 12.9% of samples). These results may correspond to the detection of the DNA of colonies badly identified in the culture, of viable but non-culturable cells or of cells included in amoebae or of dead cells. Although it may be difficult to directly associate such results with the risk of legionellosis, this is important information as it may reveal the presence of a niche in the water supply system, which is likely to to present a risk one day or another. This hidden risk would not have been identified by culture until favorable growth conditions had been restored (temperature drop, failure of the chlorination system, etc.) and L. pneumophila can proliferate in large numbers. The combination of qPCR with extraction methods that exclude dead bacteria may improve the meaning of a positive signal (8-10, 15).

When qPCR-Sgl was applied to water samples, some qPCR results were negative but positive with the standard culture method. This was due to the presence of PCR inhibitors in water samples as previously described (2). The nature of these inhibitors has not been investigated, but the addition of a step of purification and / or dilution of DNA samples has eliminated these inhibitions and restored the sensitivity of qPCR-Sg. In addition, the remaining six false-negative results, obtained with qPCR-Sgl, compared to the culture-based method, involved samples of water with very low levels of contamination (5/6), or water samples for which qPCR commercially available was not effective either (1 out of 6 samples was not quantifiable with commercially available qPCR whereas 5300 CFU / l were enumerated with the culture method). As a result, the detection limit of our qPCR-Sgl for culture tested samples was similar to that of the culture method. In the future, concentration and extraction need to be improved to eliminate PCR inhibitors in one step.

In a second step, we undertook a randomized multicenter study to prospectively evaluate the contamination of hospital buildings, which are very often involved in nosocomial legionellosis. In our study, despite French recommendations and regulations aimed at preventing the growth of Legionella in hospital water distribution systems (13), a significant proportion of samples taken from hospital water distribution systems was positive for L. pneumophila and L. pneumophila SgI by culture and by qPCR-Sgl. In contrast, commercially available qPCR for Legionella sp. showed in our hands a low specificity because after subtraction of the value of the negative control from the filtration step, 60.8% of the water samples remained positive for the contamination with Legionella sp. This result does not represent a real risk because legionellosis due to other species than L. pneumophila, apart from L. longbeachae in Oceania, is very rare. Therefore, the commercially available qPCR method should not be used for the management of hospital water installations. In contrast, the qPCR-Z. pneumophila commercially available shows a higher specificity and therefore allows to evaluate if a facility facilitates the proliferation of Legionella. Combined with specific qPCR for L. pneumophila, the new qPCR-Sgl described herein, the first available quantitative analysis for L. pneumophila SgI, should be used by operators or authorities to assess the risk of contamination. a hospital water installation. For example, if a hot water supply system or cooling tower is positive (positive) with L. pneumophila SgI, even at a low level, this could lead to more drastic decisions to control the future proliferation of Legionella. Levels of alert or regulatory action could be associated with qualitative information on the amount of L. pneumophila SgI present. This analysis could also be very useful to quickly trace an environmental source in the event of a legionella outbreak, mainly due to L. pneumophila SgI (41).

The fact that the LPS gene cluster contains specific regions of the serogroup has also been demonstrated by Thϋrmer and his team, who have developed a specific end-point PCR method for L. pneumophila SgI that can be used for the serotyping of strains. L. pneumophila instead of the agglutination test (37). In addition, in the future, additional specific primers may be defined on the sequences, reported herein, of LPS gene cluster regions of other serogroups of L. pneumophila non-Sgl and in particular for L. longbeachae, which also carries genes coding for very specific LPS (5). In the long term, this study also opens new perspectives for the diagnosis of Legionnaires' disease because it allows to combine now qPCR-Sgl and qPCR-Z. pneumophila on clinical specimens in addition to the culture method and the search for soluble antigens, which allows rapid and specific diagnosis. Table 3: References of the strains of Legionella tested species sq strain

L pneumophila 1 Paris

L pneumophila 1 Lens

Pneumophila 1 Philadelphia

L pneumophila 1 Corby

L longbeachae NSW150

Pneumophila ATCC 35251

L pneumophila 1 Lorraine

Pneumophila 2 ATCC 33154 / CIP 103856

Pneumophila 3 ATCC 33155 / CIP 103857

Pneumophila 4 ATCC 33156 / CIP 103858

Pneumophila 5 ATCC 33216 / CIP 103859

Pneumophila 5 ATCC 33737 / CIP 105570

Pneumophila 6 ATCC 33215 / CIP 103860

Pneumophila 7 ATCC 33823 / CIP 103861

Pneumophila 8 ATCC 35096 / CIP 103862

Pneumophila 9 ATCC 35289 / CIP 103863

Pneumophila ATCC 43283 / CIP 103864

Pneumophila 11 ATCC 43130 / CIP 103865

Pneumophila 12 ATCC 43290 / CIP 103866

Pneumophila 13 ATCC 43736 / CIP 103867

Pneumophila 14 ATCC 43703 / CIP 103869

L pneumophila 14 CIP 103868

ATCC Anisa 35292 / CIP 103870

L hackeliae ATCC 33250

L micdadei ATCC 33218

L thelthelensi ATCC 35248 / CIP 103885

L pneumophila 2 HL 0431 5028

L pneumophila 3 HL 0412 5002

Pneumophila 3 HL 0240 3022

Pneumophila 4 HL 0451 4011

Pneumophila 5 HL 0115 5003

Pneumophila 6 HL 0501 3047

Pneumophila 7 HL 0242 4004

Pneumophila 8 HL 0448 3060

Pneumophila 9 HL 0231 3045

Pneumophila 10 HL 0441 2051

Pneumophila 12 HL 0243 5007

L pneumophila 10-13 HL 0317 2047

Pneumophila 14 HL 0229 2025

Pneumophila 15 HL 0231 1002

The anisa HL 0403 3042

L AWA Parisiensis

ABU bozemanii

L longbeachae 0422 4010

L micdadei 93 011 936

L Gormanii ATCC 33297

L jordanis ATCC 33623

L erythra ATCC 35303

L rubrilucens ATCC 35304

L quinlivanii ATCC 43830 L moravica ATCC 43877

L tusconensis HL 0239 1038

L dumoffii ATCC 33279

L taurinensis HL 0424 3060

Pneumophila Clin. 1 HL 0230 4015 / Paris

L. pneumophila C 1 HL 0337 4008

L pneumophila C 1 HL 0229 5045

L. pneumophila C 1 HL 0353 2056

Pneumophila Env. 1 HL 0229 2010

L. pneumophila C 1 HL 0045 1020 / Paris

L. pneumophila C 1 HL 0325 1041

L pneumophila C 1 Los Angeles

L. pneumophila C 1 HL 0329 2037

Pneumophila C 1 HL 0334 2029

L. pneumophila C 1 HL 0239 5039

Pneumophila C 1 HL 0228 2021 / Paris

L. pneumophila C 1 HL 0213 2010 / Paris

L. pneumophila C 1 94012433 / Paris

Pneumophila C 1 HL 0125 3028

L. pneumophila C 1 HL 0143 5019

L pneumophila C 1 HL 0228 5003

L. pneumophila C 1 HL 0229 2016

Pneumophila C 1 HL 0238 1036

L. pneumophila C 1 HL 0351 1069

Pneumophila C 1 HL 0331 1030

Pneumophila C 1 HL 0334 3016

L. pneumophila C 1 HL 0335 1001

L pneumophila C 1 HL 0335 2012

L. pneumophila C 1 HL 0407 3054

Pneumophila C 1 HL 0407 5055

L. pneumophila C 1 HL 0406 2033

Pneumophila C 1 HL 0415 5001

L. pneumophila C 1 HL 0427 1029

L. pneumophila C 1 HL 0406 3005

Oakridgensis ATCC 33761 / CIP 103884

L jamestowniensis ATCC 35298 / CIP 103845

Lansingensis ATCC 49751 / CIP 103542

L gresilensis ATCC 700509 / CIP 106631

Lincinnatiensis ATCC 43753 / CIP 103875

L birgminghamensis ATCC 43702 / CIP 103871

L beliardensis ATCC 700512 / CIP 106632

L gratia ATCC 49413 / CIP 105267

L longbeachae C4E7

L longbeachae 98073

L longbeachae 98072

L wadsworthii ATCC 33877 / CIP 103886

L longbeachae sgl Aust 0425018

L longbeachae sg2 Aust 04275008

L longbeachae ATCC 33462

L longbeachae 3472019

Serratia marcescens 504

Ser. marcescens 81

Ser. marcescens 296

Ser. odorifica 1073

105 Ser. fonticola 78 645

106 Ser. fonticola 3965

107 Ser. fonticola 5680 (22)

108 Ser. proteamaculans Ra 1403

109 Ser. proteamaculans ClC 3630

110 Ser. proteamaculans EB 3706

111 Ser. liquefaciens 27592

112 Ser. liquefaciens 866

113 Ser. liquefaciens 507

114 Ser. rubidea 288

115 Ser. entomophila Al

116 Ser. entomophila 222

117 Ser. entomophila A15

118 Ser. grimes! 390

119 Ser. grimesi 503

120 Ser. ficaria 4024

121 Ser. ficaria 5602

122 Ser. plymuthica 510

123 Acinetobacter Iwoffii 64 105

124 Pseudomonas putida 2066 type

125 L feeleii CIP 103877

126 T (ex L.) maceachernii CIP 103846

127 Sten. maltophila CIP 60.77

128 Alkali, faecalis CIP 60.80

129 Entero. aerogenes CIP 60.86

130 Aerom. hydrophila CIP 76.14

131 Buckhold. Cepacia CIP 80.24

132 Klebsiella oxytoca CIP 103434

133 Proteus vulgaris CIP 104989

Xanthom. campestris CIP 100069

135 Pseudo. aeruginosa CIP 100720

136 Pseudo. fluorescens CIP 69.13

137 L pneumophila 6 Hôpital Garches Légio418 1993 Rebillat

138 L pneumophila 6 Hôpital Garches Légio467 1996 GeNn

139 L pneumophila 1 Lp21

140 L pneumophila 1 Lp22

141 L pneumophila 1 Lp23

142 L pneumophila 1 205409997

143 L pneumophila 1 L3415 / 03

144 L pneumophila 1 Wien 43-2

145 L pneumophila 1 Wien 47-14

146 L pneumophila 1 USA 2735

147 L pneumophila 1 USA 2733

148 L pneumophila 1 LT40 / 04

149 L pneumophila 1 L2546 / 04

150 L pneumophila 1 L3386 / 03

151 L pneumophila 1 L03-610

152 L pneumophila 1 L00-549

153 L pneumophila 1 NIIB80

154 L pneumophila 1 NIIB83

155 L pneumophila 1 NIIB121

156 L pneumophila 1 NIIB122

157 L pneumophila 1 NIIB124

158 L pneumophila 1 NIIB182

159 L pneumophila 1 NIIB217

160 L pneumophila 1 NIIB223

161 L pneumophila 1 NIIB224

162 L pneumophila 1 NIIB225

163 L pneumophila 1 NIIB226

164 L pneumophila 1 NIIB228

165 L pneumophila 1 HL 0232 4052

166 L pneumophila 1 EUL 1

167 L pneumophila 1 0051 4008

168 L pneumophila 1 HL 0036 4001

169 L pneumophila 1 0102 3035

170 L pneumophila 1 2001 n ° 5

171 L pneumophila 1 2001 n ° 7

172 L pneumophila 1 0230 4020

173 L pneumophila 1 0230 4017

174 L pneumophila 1 0230 4016

175 L pneumophila 1 Albuquerque / ATCC 43111

176 L pneumophila 1 Olda / ATCC 43109

177 L pneumophila 1 San Francisco / ATCC 43111

178 L pneumophila 1 HL 0141 1020

179 L pneumophila 1 HL 0232 4052

180 L pneumophila 1 HL 0337 3012

L pneumophila 1 HL 0703 4031

Pneumophila 1 HL 0707 3023

L pneumophila 1 HL 0710 3003

L pneumophila 1 LG 0713 5007

L pneumophila 1 LG 0714 4020

L pneumophila 1 LG 0714 4021

L pneumophila 1 LG 0715 2033

L pneumophila 1 LG 0715 5017

L pneumophila 1 LG 0717 5024

L pneumophila 1 LG 0721 5015

L pneumophila 1 LG 0727 5019

L pneumophila 1 LG 0728 2018

L pneumophila 1 LG 0728 5012

L pneumophila 1 LG 0729 5027

L pneumophila 1 LG 0730 3035

L pneumophila 1 LG 0730 4014

L pneumophila 1 LG 0730 5015

L pneumophila 1 LG 0730 5022

L pneumophila 1 LG 0737 5010

L pneumophila 1 LG 0739 3021

L pneumophila 1 LG 0739 3030

L pneumophila 1 LG 0740 3023

L pneumophila 1 LG 0740 3025

L pneumophila 1 LG 0740 3030

L pneumophila 1 LG 0740 3040

L pneumophila 1 LG 0740 4032

L pneumophila 1 LG 0741 3023

L pneumophila 1 LG 0741 4005

L pneumophila 1 LG 0743 5011

L pneumophila 1 LG 0745 2029

L pneumophila 1 LG 0746 3013 L pneumophila 1 LG 0750 4007

L pneumophila 1 LG 0801 5025

L pneumophila 1 LG 0802 3014

L pneumophila 1 LG 0807 2022

L pneumophila 1 LG 0807 5006

L pneumophila 1 LG 0809 2007

L pneumophila 1 LG 0809 3020

L pneumophila 1 LG 0809 4031

L pneumophila 1 LG 0811 1019

L pneumophila 2 LG 0729 1025

L pneumophila 2 LG 0742 5016

L pneumophila 2 LG 0746 1024

L pneumophila 2 LG 0802 1026

L pneumophila 2 LG 0811 3024

Pneumophila 3 HL 0707 5006

L pneumophila 3 HL 0709 2032

L pneumophila 3 LG 0716 5013

L pneumophila 3 LG 0725 2014

L pneumophila 3 LG 0738 3022

L pneumophila 3 LG 0745 4014

L pneumophila 3 LG 0747 3015

L pneumophila 3 LG 0750 4006

L pneumophila 3 LG 0805 3021

L pneumophila 3 LG 0808 2012

L pneumophila 3 LG 0809 4032

Pneumophila 4 HL 0707 5003

L pneumophila 4 LG 0725 4012

L pneumophila 4 LG 0727 5028

L pneumophila 4 LG 0730 5029

L pneumophila 4 LG 0731 5015

L pneumophila 4 LG 0745 2031

L pneumophila 5 LG 0711 4031

L pneumophila 5 LG 0723 3010

L pneumophila 5 LG 0730 3031

L pneumophila 5 LG 0732 1015

L pneumophila 5 LG 0736 4010

L pneumophila 5 LG 0740 3022

Pneumophila 6 HL 0615 1027

Pneumophila 6 HL 0616 5016

Pneumophila 6 HL 0623 5029

Pneumophila 6 HL 0625 1032

L pneumophila 6 HL 0626 2016

Pneumophila 6 HL 0626 3024

Pneumophila 6 HL 0628 4026

Pneumophila 6 HL 0635 5002

Pneumophila 6 HL 0637 5020

Pneumophila 6 HL 0639 5022

Pneumophila 6 HL 0642 5016

Pneumophila 6 HL 0643 1025

Pneumophila 6 HL 0646 5013

Pneumophila 6 HL 0647 3004

Pneumophila 6 HL 0648 1013

Pneumophila 6 HL 0650 3003

Pneumophila 6 HL 0705 1028

L pneumophila 6 HL 0706 2011

Pneumophila 6 HL 0707 1017

Pneumophila 6 HL 0707 5047

L pneumophila 6 LG 0725 2016

L pneumophila 6 LG 0729 1030

Pneumophila 6 LG 0729 5019

L pneumophila 6 LG 0733 4011

L pneumophila 6 LG 0736 4008

L pneumophila 6 LG 0737 5022

L pneumophila 6 LG 0740 3021

Pneumophila 6 LG 0748 1030

L pneumophila 6 LG 0750 2011

L pneumophila 6 LG 0806 2019

L pneumophila 6 LG 0807 5012

L pneumophila 6 LG 0808 3025

L pneumophila 6 LG 0810 5014

Pneumophila 7 HL 0605 4003

Pneumophila 7 HL 0611 1002

Pneumophila 7 HL 0615 4008

Pneumophila 8 HL 0703 1023

Pneumophila 8 HL 0703 1024

L pneumophila 8 LG 0712 2030

L pneumophila 8 LG 0714 5048

L pneumophila 8 LG 0747 4021

Pneumophila 9 HL 0707 5019

L pneumophila LG 0727 5026

L pneumophila LG 0740 4034

L pneumophila LG 0745 2028

Pneumophila 12 LG 0721 2021

L pneumophila 12 LG 0723 1018

L pneumophila 12 LG 0740 4025

L pneumophila 12 LG 0807 2016

L pneumophila 14 LG 0739 2049

L pneumophila 14 LG 0745 3016

L pneumophila LG 0738 2088

EWGLI strains

Pneumophila LE 1 - EUL 31

Pneumophila LE 2 - EUL 56

Pneumophila LE 3 - EUL 22

Pneumophila LE 4 - EUL 66

Pneumophila LE 5 - EUL 61

Pneumophila LE 6 - EUL 75

Pneumophila LE 7 - EUL 26

Pneumophila LE 9 - EUL 18

Pneumophila LE 12 - EUL 13

Pneumophila LE 13

Pneumophila LE 14

Pneumophila LE 16

Pneumophila LE 20 - EUL 30

Pneumophila LE 22

Pneumophila LE 24 - EUL 47

Pneumophila LE 25 - EUL 51

Pneumophila LE 27 - EUL 17 Pneumophila LE 28 - EUL 27

Pneumophila LE 30

Pneumophila LE 31 - EUL 7

Pneumophila LE 33

Pneumophila LE 36 - EUL 14

Pneumophila LE 37 - EUL 78

Pneumophila LE 38 - EUL 106

Pneumophila LE 39 - EUL 74

Pneumophila LE 40

Pneumophila LE 42 - EUL 79

Pneumophila LE 43 - EUL 121

Pneumophila LE 44 - EUL 71

Pneumophila LE 45 - EUL 72

Pneumophila LE 47 - EUL 73

Pneumophila LE 48 - EUL 16

Pneumophila LE 49 - EUL 67

Pneumophila LE 50

Pneumophila LE 51 - EUL 25

Pneumophila LE 52 - EUL 62

Pneumophila LE 53 - EUL 6

Pneumophila LE 54 - EUL 64

Pneumophila LE 55 - EUL 95

Pneumophila LE 56 - EUL 54

Pneumophila LE 57

Pneumophila LE 58 - EUL 1

Pneumophila LE 59 - EUL 55

Pneumophila LE 60

Pneumophila LE 64

Pneumophila LE 65

Pneumophila LE 66 - EUL 29

Pneumophila LE 68 - EUL 50

Pneumophila LE 69 - EUL 63

Pneumophila \ LE 70 - EUL 32

Pneumophila LE 72 - EUL 52

Pneumophila LE 73 - EUL 53

Pneumophila LE 75 - EUL 4

Pneumophila LE 77 - EUL 77

Pneumophila LE 78 - EUL 69

Pneumophila LE 80 - EUL 3

Pneumophila LE 81 - EUL 46

Pneumophila LE 82 - EUL 76

Pneumophila LE 83 - EUL 68

Pneumophila LE 84 - EUL 44

Pneumophila LE 85 - EUL 2

Pneumophila LE 87 - EUL 94

Pneumophila LE 88 - EUL 57

Pneumophila LE 89 - EUL 58

Pneumophila LE 90

Pneumophila LE 91

Pneumophila LE 92

Pneumophila LE 93

Pneumophila LE 94

Pneumophila LE 95 - EUL 45

Pneumophila LE 98

Pneumophila LE 99 - EUL 70

Pneumophila LE 100 - EUL 28

Pneumophila LE 101 - EUL 108

Pneumophila 1 NCl

Pneumophila 1 NC2

Pneumophila 1 NC3

Pneumophila 1 NC4

L pneumophila 1 NC5

L pneumophila 1 NC6

Pneumophila 1 NC7

Pneumophila 1 NC8

Pneumophila 1 NC9

Pneumophila 1 NClO

Pneumophila 1 NCI l

Pneumophila 1 NC12

L pneumophila 1 NC13

L pneumophila 1 NC14

L pneumophila 1 NC15

L pneumophila 1 NC16

L pneumophila 1 NC17

Pneumophila 1 NC18

Pneumophila 1 NC19

Pneumophila 1 NC20

Pneumophila 1 NC21

L pneumophila 1 NC22

Pneumophila 1 NC23

Pneumophila 1 NC24

Pneumophila 1 NC25

Pneumophila 1 NC26

L pneumophila 1 NC27

L pneumophila 1 NC28

Pneumophila 1 NC29

L pneumophila 1 NC30

Pneumophila 1 NC31

Pneumophila 1 NC32

Pneumophila 1 NC33

Pneumophila 1 NC34

Pneumophila 1 NC35

Pneumophila 1 NC36

L pneumophila 1 NC37

Pneumophila 1 NC38

Pneumophila 1 NC39

Pneumophila 1 NC40

L pneumophila 1 NC41

Pneumophila 1 NC42

Pneumophila 1 NC43

Pneumophila 1 NC44

Pneumophila 1 NC45

Pneumophila 1 NC46

L pneumophila 1 NC47

Pneumophila 1 NC48

L pneumophila 1 NC49

Pneumophila 2-14 NC50 Pneumophila 2-14 NC51

L pneumophila 2-14 NC52

L pneumophila 2-14 NC53

L pneumophila 2-14 NC54

L pneumophila 2-14 NC55

L pneumophila 2-14 NC56

L pneumophila 2-14 NC57

L pneumophila 2-14 NC58

Pneumophila 2-14 NC59

Pneumophila 2-14 NC60

L pneumophila 2-14 NC61

L pneumophila 2-14 NC62

L pneumophila 2-14 NC63

Pneumophila 2-14 NC64

Pneumophila 2-14 NC65

L pneumophila 2-14 NC66

L pneumophila 2-14 NC67

L pneumophila 2-14 NC68

L pneumophila 2-14 NC69

L pneumophila 2-14 NC70

L pneumophila 2-14 NC71

L pneumophila 2-14 NC72

Legionella spp. NC72

Legionella spp. NC73

Legionella spp. NC74

Table 4A: Strains used in this study

Genus Specie Serogroup Number of strains tested Total

Legionella pneumophila 1,254

6 54

404

3 20

others sg 76

Legionella longbeachae 19

50

sp. (non-pneumophila) 31

Serratia sp. 22

38

Others 16

492

Table 4B: Strains and primers used for amplification of the LPS-gene cluster of Sg6, 9, 10, 12,

13 and 14

Table 5: Specific region of L. pneumophila SgI LPS gene cluster and its comparison with serogroups Sg6, 9, 10, 12, 13 and 14

Comparisons were made from the amino acid sequences (BlastP software used). The values shown represent the percentage identity between the sequences.

Table 5

Table 6: Specific region of L. pneumophila Sg6 LPS gene cluster and its comparison with serogroups Sg6, 9, 10, 12, 13 and 14

Comparisons were made from the amino acid sequences (BlastP software used). The values shown represent the percentage identity between the sequences. Table 6

Table 7: Specific primers and probe of L. pneumophila SgI used in this study Sequence 5 '- 3' Length amplicon

Pl Primer Meaning - PCR TTACCGCTTGCTTTTATGGA 294 pb

P2 Primer antisense - PCR CCTATCAACGCTCTTGGAAA P65 Primer sense - qPCR CAAAGGGCGTTACAGTCAAACC 75bp

P66 Antisense primer / qPCR CAAACACCCCAACCGTAATCA

sgl-pb Probe / qPCR

FAM-TCTTGGGATTGGGTTGGGTTATTTTAACTCCT- BHQ 1

Table 9: Qualitative comparison of qPCR-Sgl to culture method for L. pneumophila SgI

Culture

L. pneumophila SgI

positive negative

negative 149 143 ₆ a

qPCR-Sgl

positive 60 27 "33

Total 209 170 39

Table 8: Quantification of 209 water samples with L. pneumophila according to culture method and qPCR results.

Quantification with the nar culture method

positive negative non-quantifiable positive positive positive>

<50 CFU / l <250 CFU / l 250 - 1 000 1 000 - 10 000 10 000 CFU / 1

Leeionella SD. 125 22 21 19 22 209

negative 14 1 0 0 0 15

Quantification with positive <480 UGU / 1 66 8 3 1 1

qPCR for L. spp positive 480 - 1000 GU / 1 18 4 5 4 2 194

(Biorad) positive 1,000 - 10,000 GU / 1 11 5 9 10 5

nositive> 10,000 GU / 1 16 4 4 4 14 O \

L. vneumovhila 140 20 15 16 18 209

negativ 92 0 0 0 98

Quantification with positive <480 GU / 1 29 8 2 2

qPCR for positive L. 480 - 1000 GU / 1 2 2 4 1 111

pneumophila (Biorad) positive 1,000 - 10,000 GU / 1 14 4 3

positive> 10,000 GU / 1 1 12

L. DneumovhilaSel 170 11 10 209

negative 143 5 0 1 149

Quantification with Sg £ ^osi * ^ve < ⁴ _n ⁸ 0 GU / 1 17 4 10 4

PΓR positive 480 - 1000 GU / 1 4 1 0 1

60 q positive 1,000 - 10,000 GU / 1 6 1 0 i

positive> 10,000 GU / 1 0 0 0 0

CFU / 1: colony forming unit / liter; GU / L: genome / liter units

Table 1OA: Characterization of samples positive for L. pneumophila SgI by culture but negative by qPCR-Sgl.

Quantification Identification qPCR qPCR qPCR No.

by culture L. sp L. pneumophila L. pneumophila SgI sample

(CFU / 1) (agglutination (GU / 1) (GU / 1) (GU / 1) lons

latex)

ND - NQ NQ NQ 7

ND - NQ 480 - 10,000 NQ 2

ND - 480 - 10,000 NQ NQ 1

ND - 480 - 10,000 negative NQ 2

ND - 480 - 10,000 480 - 10,000 NQ 2

ND - 480 - 10,000 480 - 10,000 480 - 10,000 2

ND -> 10,000> 10,000 NQ 1

ND -> 10,000> 10,000 480 - 10,000 1 κ>

ND -> 10,000 480 - 10,000 480 - 10,000 2

250 - 10,000 L sp. 480 - 10,000 NQ NQ 1

> 10,000 Lp 2-14> 10,000> 10,000 NQ 4

250 - 10,000 Lp 2-14> 10,000> 10,000 480 - 10,000 1

250 - 10,000 L sp., Lp 2-14> 10,000> 10,000 480 - 10,000 1

27

Table 1OB: Characterization of QPCR-SgI positive samples but negative for L. pneumophila SgI per culture

Quantification Identification qPCR qPCR qPCR No.

by culture L. sp L. pneumophila L. pneumophila SgI sample

(CFU / 1) (agglutination (GU / 1) (GU / 1) (GU / 1) lons

latex)

NQ LpI negative negative negative 1

NQ LpI NQ negative negative 1

NQ LpI NQ NQ negative 3

5,300 LpI NQ NQ negative 1

ND: not detected, NQ: not quantifiable, L sp: species Legionella, Lp 2-14: L. pneumophila Sg 2-14, LpI: L. pneumophila SgI

Table 11: Distribution of water samples positive for L. pneumophila SgI by culture or by qPCR in relation to the characteristics of buildings and samples

Negative for SgI by

Positive for SgI by Positive for SgI by

culture and positive for

qPCR SgI culture

SgI by qPCR SgI

n = n =% n =% n =%

Main 109 20 18.3 31 28.4 14 12.8

Size of the building

Secondary 100 19 19.0 29 29.0 13 13.0

Age of the system> 30 years 109 20 18.3 31 28.4 15 13.8

feeding

water <30 years 100 19 19.0 29 29.0 12 12.0

Water Production Instant 149 30 20.1 47 31.5 21 14.1 c

\ hot Storage 60 9 15.0 13 21.7 6 10.0

Hot water

Rob. representative 65 9 13.8 21 32.3 13 20.0

Rob. little used 81 19 23.5 25 30.9 9 11.1

Release

Sample type 4.8 19.0 14.3

production 21 1 4 3

Loop return 21 5 23.8 6 28.6 2 9.5

Cold water 21 5 23.8 4 19.0 0 0.0

23 ⁰ C <T ^c ¹ C <55 ⁰ C 129 28 21.7 37 28.7 13 10.1

Temperature

<23 ⁰ C or> 55 ° C 80 11 13.8 23 28.8 14 17.5

yes 108 27 25.0 43 39.8 20 18.5

chlorination

no 101 12 11.9 17 16.8 7 6.9

Table 12

Results of the QPCR-SgI

+ - Total

Legionella case ... culture (LpI) or search

21 1 * 22 confirmed by ... antigen in urine LpI

... PCR-Z. pneumophila 1 3

... FCR-Legionella spp. 0 2 2

Total 22 5 27

Pneumonia case other

69 69 Legionella

Total 96

* antigen test in urine positive, negative culture, negative PCR-Lp, Nested SBT negative (no amplification for 7 alleles)

** The culture method and antigen test results in urine that were negative or unavailable for these samples but positive with PCR-Lp or nested SBT indicate that these cases were caused by LpI or Lp2 strains. -15.

Table 13: References of the Legionella strains tested (see Example 6, Par.I.2)

_N c Species Sg Strain N ^c Species Sg Strain

1 Legionella pneumophila 1 Paris 247 Legionella pneumophila 1 LG 0841 4021

2 Legionella pneumophila 1 Lens 248 Legionella pneumophila 1 LG 0842 5013

Philadelphia /

3 Legionella pneumophila 1 ATCC 33152 249 Legionella pneumophila 1 LG 0843 1010 54 Legionella pneumophila 1 Corby 250 Legionella pneumophila 1 LG 0845 5003

5 Legionella pneumophila 1 Lorraine 251 Legionella pneumophila 1 LG 0848 4020

HL 0230 4015 /

6 Legionella pneumophila 1 Paris 252 Legionella pneumophila 1 LG 0809 5002

I Legionella pneumophila 1 HL 0337 4008 253 Legionella pneumophila 1 LG 0817 3027

8 Legionella pneumophila 1 HL 0229 5045 254 Legionella pneumophila 1 LG 0832 3016

9 Legionella pneumophila 1 HL 0353 2056 255 Legionella pneumophila 1 LG 0902 5013

10 Legionella pneumophila 1 HL 0229 2010 256 Legionella pneumophila 1 LG 0905 1032

HL 0045 1020 /

I I Legionella pneumophila 1 Paris 257 Legionella pneumophila 1 LG 0905 1096

ATCC 33154 /

12 Legionella pneumophila 1 HL 0325 1041 258 Legionella pneumophila 2 CIP 103856

13 Legionella pneumophila 1 Los Angeles 259 Legionella pneumophila 2 HL 0431 5028

14 Legionella pneumophila 1 HL 0329 2037 260 Legionella pneumophila 2 LG 0729 1025

15 Legionella pneumophila 1 HL 0334 2029 261 Legionella pneumophila 2 LG 0742 5016

16 Legionella pneumophila 1 HL 0239 5039 262 Legionella pneumophila 2 LG 0746 1024

HL 0228 2021 /

17 Legionella pneumophila 1 Paris 263 Legionella pneumophila 2 LG 0802 1026

HL 0213 2010 /

18 Legionella pneumophila 1 Paris 264 Legionella pneumophila 2 LG 0811 3024

ATCC 33155 /

19 Legionella pneumophila 1 94012433 / Paris 265 Legionella pneumophila 3 CIP 103857

20 Legionella pneumophila 1 HL 0125 3028 266 Legionella pneumophila 3 HL 04125002

21 Legionella pneumophila 1 HL 0143 5019 267 Legionella pneumophila 3 HL 02403022

22 Legionella pneumophila 1 HL 0228 5003 268 Legionella pneumophila 3 HL 07075006

23 Legionella pneumophila 1 HL 0229 2016 269 Legionella pneumophila 3 HL 07092032

24 Legionella pneumophila 1 HL 0238 1036 270 Legionella pneumophila 3 LG 07165013

25 Legionella pneumophila 1 HL 0351 1069 271 Legionella pneumophila 3 LG 07252014

26 Legionella pneumophila 1 HL 0331 1030 272 Legionella pneumophila 3 LG 07383022

27 Legionella pneumophila 1 HL 0334 3016 273 Legionella pneumophila 3 LG 07454014

28 Legionella pneumophila 1 HL 0335 1001 274 Legionella pneumophila 3 LG 07473015

29 Legionella pneumophila 1 HL 0335 2012 275 Legionella pneumophila 3 LG 07504006

30 Legionella pneumophila 1 HL 0407 3054 276 Legionella pneumophila 3 LG 08053021

31 Legionella pneumophila 1 HL 0407 5055 277 Legionella pneumophila 3 LG 08082012

32 Legionella pneumophila 1 HL 0406 2033 278 Legionella pneumophila 3 LG 08094032

33 Legionella pneumophila 1 HL 0415 5001 279 Legionella pneumophila 3 LG 09051089 Legionella pneumophila 1 HL 0427 1029 280 Legionella pneumophila 3 LG 09051090 Legionella pneumophila 1 HL 0406 3005 281 Legionella pneumophila 3 LG 09051091 Legionella pneumophila 1 Lp21 282 Legionella pneumophila 3 LG 09051093 Legionella pneumophila 1 Lp22 283 Legionella pneumophila 3 LG 09051097

ATCC 33156 / Legionella pneumophila 1 Lp23 284 Legionella pneumophila 4 CIP 103858 Legionella pneumophila 1 205409997 285 Legionella pneumophila 4 HL 04514011 Legionella pneumophila 1 L3415 / 03 286 Legionella pneumophila 4 HL 07075003 Legionella pneumophila 1 Wien 43-2 287 Legionella pneumophila 4 LG 07254012 Legionella pneumophila 1 Wien 47-14 288 Legionella pneumophila 4 LG 07275028 Legionella pneumophila 1 USA 2735 289 Legionella pneumophila 4 LG 07305029 Legionella pneumophila 1 USA 2733 290 Legionella pneumophila 4 LG 07315015 Legionella pneumophila 1 LT40 / 04 291 Legionella pneumophila 4 LG 07452031

ATCC 33216 / Legionella pneumophila 1 L2546 / 04 292 Legionella pneumophila 5 CIP 103859

ATCC 33737 / Legionella pneumophila 1 L3386 / 03 293 Legionella pneumophila 5 CIP 105570 Legionella pneumophila 1 L03-610 294 Legionella pneumophila 5 HL 01155003 Legionella pneumophila 1 L00-549 295 Legionella pneumophila 5 LG 07114031 Legionella pneumophila 1 NIIB80 296 Legionella pneumophila 5 LG 07233010 Legionella pneumophila 1 NIIB83 297 Legionella pneumophila 5 LG 07303031 Legionella pneumophila 1 NIIB121 298 Legionella pneumophila 5 LG 07321015 Legionella pneumophila 1 NIIB 122 299 Legionella pneumophila 5 LG 07364010 Legionella pneumophila 1 NIIB 124 300 Legionella pneumophila 5 LG 07403022 Legionella pneumophila 1 NIIB 182 301 Legionella pneumophila 5 LG 09051079 Legionella pneumophila 1 NIIB217 302 Legionella pneumophila 5 LG 09051080 Legionella pneumophila 1 NIIB223 303 Legionella pneumophila 5 LG 09051081 Legionella pneumophila 1 NIIB224 304 Legionella pneumophila 5 LG 09051084 Legionella pneumophila 1 NIIB225 305 Legionella pneumophila 5 LG 09051087

ATCC 33215 / Legionella pneumophila 1 NIIB226 306 Legionella pneumophila 6 CIP 103860 Legionella pneumophila 1 NIIB228 307 Legionella pneumophila 6 HL 0501 3047 Legionella pneumophila 1 HL 0232 4052 308 Legionella pneumophila 6 RPC Legio418 Legionella pneumophila 1 EUL 1 309 Legionella pneumophila 6 RPC Legio467 Legionella pneumophila 1 514 008 310 Legionella pneumophila 6 HL 0615 1027 Legionella pneumophila 1 HL 0036 4001 311 Legionella pneumophila 6 HL 0616 5016 Legionella pneumophila 1 1 023 035 312 Legionella pneumophila 6 HL 0623 5029 Legionella pneumophila 1 2001 No. 5 313 Legionella pneumophila 6 HL 0625 1032 Legionella pneumophila 1 2001 n ° 7 314 Legionella pneumophila 6 HL 0626 2016 Legionella pneumophila 1 2 304 020 315 Legionella pneumophila 6 HL 0626 2016 Legionella pneumophila 1 2 304 017 316 Legionella pneumophila 6 HL 0626 3024 Legionella pneumophila 1 2 304 016 317 Legionella pneumophila 6 HL 0628 4026

Albuquerque /

Legionella pneumophila 1 ATCC 43111 318 Legionella pneumophila 6 HL 0635 5002 Legionella pneumophila 1 Olda / ATCC 319 Legionella pneumophila 6 HL 0637 5020 43109

San Francisco /

74 Legionella pneumophila 1 ATCC 43111 320 Legionella pneumophila 6 HL 0639 5022

75 Legionella pneumophila 1 HL 0141 1020 321 Legionella pneumophila 6 HL 0642 5016

76 Legionella pneumophila 1 HL 0232 4052 322 Legionella pneumophila 6 HL 0643 1025

II Legionella pneumophila 1 HL 0337 3012 323 Legionella pneumophila 6 HL 0646 5013

78 Legionella pneumophila 1 HL 0703 4031 324 Legionella pneumophila 6 HL 0647 3004

79 Legionella pneumophila 1 HL 0707 3023 325 Legionella pneumophila 6 HL 0648 1013

80 Legionella pneumophila 1 HL 0710 3003 326 Legionella pneumophila 6 HL 0650 3003

81 Legionella pneumophila 1 LG 0713 5007 327 Legionella pneumophila 6 HL 0705 1028

82 Legionella pneumophila 1 LG 0714 4020 328 Legionella pneumophila 6 HL 0706 2011

83 Legionella pneumophila 1 LG 0714 4021 329 Legionella pneumophila 6 HL 0707 1017

84 Legionella pneumophila 1 LG 0715 2033 330 Legionella pneumophila 6 HL 0707 5047

85 Legionella pneumophila 1 LG 0715 5017 331 Legionella pneumophila 6 LG 0725 2016

86 Legionella pneumophila 1 LG 0717 5024 332 Legionella pneumophila 6 LG 0729 1030

87 Legionella pneumophila 1 LG 0721 5015 333 Legionella pneumophila 6 LG 0729 5019

88 Legionella pneumophila 1 LG 0727 5019 334 Legionella pneumophila 6 LG 0733 4011

89 Legionella pneumophila 1 LG 0728 2018 335 Legionella pneumophila 6 LG 0736 4008

90 Legionella pneumophila 1 LG 0728 5012 336 Legionella pneumophila 6 LG 0737 5022

91 Legionella pneumophila 1 LG 0729 5027 337 Legionella pneumophila 6 LG 0740 3021

92 Legionella pneumophila 1 LG 0730 3035 338 Legionella pneumophila 6 LG 0748 1030

93 Legionella pneumophila 1 LG 0730 4014 339 Legionella pneumophila 6 LG 0750 2011

94 Legionella pneumophila 1 LG 0730 5015 340 Legionella pneumophila 6 LG 0806 2019

95 Legionella pneumophila 1 LG 0730 5022 341 Legionella pneumophila 6 LG 0807 5012

96 Legionella pneumophila 1 LG 0737 5010 342 Legionella pneumophila 6 LG 0808 3025

97 Legionella pneumophila 1 LG 0739 3021 343 Legionella pneumophila 6 LG 0810 5014

98 Legionella pneumophila 1 LG 0739 3030 344 Legionella pneumophila 6 LE 91

99 Legionella pneumophila 1 LG 0740 3023 345 Legionella pneumophila 6 LG 0905 1050

100 Legionella pneumophila 1 LG 0740 3025 346 Legionella pneumophila 6 LG 0905 1099

101 Legionella pneumophila 1 LG 0740 3030 347 Legionella pneumophila 6 LG 0905 1100

102 Legionella pneumophila 1 LG 0740 3040 348 Legionella pneumophila 6 LG 0813 3009

103 Legionella pneumophila 1 LG 0740 4032 349 Legionella pneumophila 6 LG 0821 5010

104 Legionella pneumophila 1 LG 0741 3023 350 Legionella pneumophila 6 LG 0829 3011

105 Legionella pneumophila 1 LG 0741 4005 351 Legionella pneumophila 6 LG 0847 3008

106 Legionella pneumophila 1 LG 0743 5011 352 Legionella pneumophila 6 LG 0850 1008

107 Legionella pneumophila 1 LG 0745 2029 353 Legionella pneumophila 6 LG 0833 2006

108 Legionella pneumophila 1 LG 0746 3013 354 Legionella pneumophila 6 LG 0821 5012

109 Legionella pneumophila 1 LG 0750 4007 355 Legionella pneumophila 6 LG 0838 5006

110 Legionella pneumophila 1 LG 0801 5025 356 Legionella pneumophila 6 LG 0838 5007

I I I Legionella pneumophila 1 LG 0802 3014 357 Legionella pneumophila 6 LG 0847 2013

ATCC 33823 /

112 Legionella pneumophila 1 LG 0807 2022 358 Legionella pneumophila 7 CIP 103861

113 Legionella pneumophila 1 LG 0807 5006 359 Legionella pneumophila 7 HL 0242 4004 114 Legionella pneumophila 1 LG 0809 2007 360 Legionella pneumophila I HL 0605 4003

115 Legionella pneumophila 1 LG 0809 3020 361 Legionella pneumophila 7 HL 0611 1002

116 Legionella pneumophila 1 LG 0809 4031 362 Legionella pneumophila 7 HL 0615 4008

ATCC 35096 /

117 Legionella pneumophila 1 LG 0811 1019 363 Legionella pneumophila 8 CIP 103862

118 Legionella pneumophila 1 LG 0738 2088 364 Legionella pneumophila 8 HL 04483060

119 Legionella pneumophila 1 LE 1 - EUL 31 365 Legionella pneumophila 8 HL 07031023

120 Legionella pneumophila 1 LE 2 - EUL 56 366 Legionella pneumophila 8 HL 07031024

121 Legionella pneumophila 1 LE 3 - EUL 22 367 Legionella pneumophila 8 LG 07122030

122 Legionella pneumophila 1 LE 4 - EUL 66 368 Legionella pneumophila 8 LG 07145048

123 Legionella pneumophila 1 LE 5 - EUL 61 369 Legionella pneumophila 8 LG 07474021

124 Legionella pneumophila 1 LE 6 - EUL 75 370 Legionella pneumophila 8 LG 09051086

ATCC 35289 /

125 Legionella pneumophila 1 LE 7 - EUL 26 371 Legionella pneumophila 9 CIP 103863

126 Legionella pneumophila 1 LE 9 - EUL 18 372 Legionella pneumophila 9 HL 02313045

127 Legionella pneumophila 1 LE 12 - EUL 13 373 Legionella pneumophila 9 HL 07075019

ATCC 43283 /

128 Legionella pneumophila 1 LE 13 374 Legionella pneumophila 10 CIP 103864

129 Legionella pneumophila 1 LE 14 375 Legionella pneumophila 10 HL 04412051

130 Legionella pneumophila 1 LE 16 376 Legionella pneumophila LG 07275026

131 Legionella pneumophila 1 LE 20 - EUL 30 377 Legionella pneumophila LG 07404034

132 Legionella pneumophila 1 LE 24 - EUL 47 378 Legionella pneumophila LG 07452028

133 Legionella pneumophila 1 LE 25 - EUL 51 379 Legionella pneumophila 10 LE 22

134 Legionella pneumophila 1 LE 27 - EUL 17 380 Legionella pneumophila 10 LG 09051088

135 Legionella pneumophila 1 LE 28 - EUL 27 381 Legionella pneumophila 10 LG 09051095

136 Legionella pneumophila 1 LE 30 382 Legionella pneumophila 10 LG 09051098

ATCC 43130 /

137 Legionella pneumophila 1 LE 31 - EUL 7,383 Legionella pneumophila II CIP 103865

ATCC 43290 /

138 Legionella pneumophila 1 LE 33 384 Legionella pneumophila 12 CIP 103866

139 Legionella pneumophila 1 LE 36 - EUL 14 385 Legionella pneumophila 12 HL 02435007

140 Legionella pneumophila 1 LE 37 - EUL 78 386 Legionella pneumophila 12 LG 07212021

141 Legionella pneumophila 1 LE 38 - EUL 106387 Legionella pneumophila 12 LG 07231018

142 Legionella pneumophila 1 LE 39 - EUL 74 388 Legionella pneumophila 12 LG 07404025

143 Legionella pneumophila 1 LE 40 389 Legionella pneumophila 12 LG 08072016

ATCC 43736 /

144 Legionella pneumophila 1 LE 42 - EUL 79 390 Legionella pneumophila 13 CIP 103867

ATCC 43703 /

145 Legionella pneumophila 1 LE 43 - EUL 121 391 Legionella pneumophila 14 CIP 103869

146 Legionella pneumophila 1 LE 44 - EUL 71 392 Legionella pneumophila 14 CIP 103868

147 Legionella pneumophila 1 LE 45 - EUL 72 393 Legionella pneumophila 14 HL 02292025

148 Legionella pneumophila 1 LE 47 - EUL 73 394 Legionella pneumophila 14 LG 07392049

149 Legionella pneumophila 1 LE 48 - EUL 16 395 Legionella pneumophila 14 LG 07453016

0819 2016-

150 Legionella pneumophila 1 LE 49 - EUL 67 396 Legionella pneumophila 14 08224 clinic

151 Legionella pneumophila 1 LE 50 397 Legionella pneumophila 14 LG 0905 1082 152 Legionella pneumophila 1 LE 51 - EUL 25 398 Legionella pneumophila 14 LG 0905 1083

153 Legionella pneumophila 1 LE 52 - EUL 62 399 Legionella pneumophila 14 LG 0905 1085

154 Legionella pneumophila 1 LE 53 - EUL 6 400 Legionella pneumophila 15 ATCC 35251

155 Legionella pneumophila 1 LE 54 - EUL 64 401 Legionella pneumophila 15 HL 0231 1002

156 Legionella pneumophila 1 LE 55 - EUL 95 402 Legionella pneumophila ND HL 0317 2047

157 Legionella pneumophila 1 LE 56 - EUL 54 403 Legionella pneumophila ND LG 0905 1092

158 Legionella pneumophila 1 LE 57 404 Legionella pneumophila ND LG 0905 1094

159 Legionella pneumophila 1 LE 58 - EUL 1 405 Legionella longbeachae - NSW150

160 Legionella pneumophila 1 LE 59 - EUL 55 406 Legionella longbeachae - 4 224 010

161 Legionella pneumophila 1 LE 60 407 Legionella longbeachae - C4E7

162 Legionella pneumophila 1 LE 64 408 Legionella longbeachae - 98073

163 Legionella pneumophila 1 LE 65 409 Legionella longbeachae - 98072

sgl Aust

164 Legionella pneumophila 1 LE 66 - EUL 29 410 Legionella longbeachae - 0425018 sg2 Aust

165 Legionella pneumophila 1 LE 68 - EUL 50 411 Legionella longbeachae - 04275008

166 Legionella pneumophila 1 LE 69 - EUL 63 412 Legionella longbeachae - ATCC 33462

167 Legionella pneumophila 1 LE 70 - EUL 32 413 Legionella longbeachae - 3472019

ATCC 39462

168 Legionella pneumophila 1 LE 72 - EUL 52 414 Legionella longbeachae - (USA)

169 Legionella pneumophila 1 LE 73 - EUL 53 415 Legionella longbeachae - D4968 (USA)

170 Legionella pneumophila 1 LE 75 - EUL 4 416 Legionella longbeachae - D4969 (USA)

171 Legionella pneumophila 1 LE 77 - EUL 77 417 Legionella longbeachae - D4973 (USA)

172 Legionella pneumophila 1 LE 78 - EUL 69 418 Legionella longbeachae - LG 0902 4055

173 Legionella pneumophila 1 LE 80 - EUL 3 419 Legionella longbeachae - LG 0905 2014

174 Legionella pneumophila 1 LE 81 - EUL 46 420 Legionella longbeachae - HL 0625 5022

175 Legionella pneumophila 1 LE 82 - EUL 76 421 Legionella longbeachae - HL 0422 4011

176 Legionella pneumophila 1 LE 83 - EUL 68 422 Legionella longbeachae - HL 0426 1008

177 Legionella pneumophila 1 LE 84 - EUL 44 423 Legionella longbeachae - HL 0441 2061

ATCC 35292 /

178 Legionella pneumophila 1 LE 85 - EUL 2 424 Legionella anisa - CIP 103870

179 Legionella pneumophila 1 LE 87 - EUL 94 425 Legionella anisa - HL 0403 3042

180 Legionella pneumophila 1 LE 88 - EUL 57 426 Legionella anisa - LG 0905 1102

181 Legionella pneumophila 1 LE 89 - EUL 58 427 Legionella anisa - LG 0905 1103

182 Legionella pneumophila 1 LE 90 428 Legionella anisa - LG 0905 1104

183 Legionella pneumophila 1 LE 92 429 Legionella hackeliae - ATCC 33250

184 Legionella pneumophila 1 LE 93,430 Legionella micdadei - ATCC 33218

185 Legionella pneumophila 1 LE 94 431 Legionella micdadei - 93 011 936

ATCC 35248 /

186 Legionella pneumophila 1 LE 95 - EUL 45 432 Legionella sainthelensi - CIP 103885

187 Legionella pneumophila 1 LE 98 433 Legionella parisiensis - AWA

188 Legionella pneumophila 1 LE 99 - EUL 70 434 Legionella bozemanii - ABU

189 Legionella pneumophila 1 LE 100 - EUL 28435 Legionella gormanii - ATCC 33297

THE EUL EUL

190 Legionella pneumophila 1 108 436 Legionella jordanis - ATCC 33623 191 Legionella pneumophila 1 LG 09051031 437 Legionella erythra - ATCC 35303

192 Legionella pneumophila 1 LG 09051033 438 Legionella rubrilucens - ATCC 35304

193 Legionella pneumophila 1 LG 09051034 439 Legionella quinlivanii - ATCC 43830

194 Legionella pneumophila 1 LG 09051035 440 Legionella moravica - ATCC 43877

195 Legionella pneumophila 1 LG 09051036 441 Legionella tusconensis - HL 0239 1038

196 Legionella pneumophila 1 LG 09051037 442 Legionella dumoffii - ATCC 33279

197 Legionella pneumophila 1 LG 09051038 443 Legionella taurinensis - HL 0424 3060

ATCC 33761 /

198 Legionella pneumophila 1 LG 0905 1039 444 Legionella oakridgensis - CIP 103884

Legionella ATCC 35298 /

199 Legionella pneumophila 1 LG 0905 1040 445 jamestowniensis - CIP 103845

ATCC 49751 /

200 Legionella pneumophila 1 LG 0905 1041 446 Legionella lansingensis - CIP 103542

ATCC 700509

201 Legionella pneumophila 1 LG 0905 1042 447 Legionella gresilensis - / CIP 106631

Legionella ATCC 43753 /

202 Legionella pneumophila 1 LG 0905 1043 448 cincinnatiensis - CIP 103875

Legionella ATCC 43702 /

203 Legionella pneumophila 1 LG 0905 1044 449 birgminghamensis - CIP 103871

ATCC 700512

204 Legionella pneumophila 1 LG 0905 1045 450 Legionella beliardensis - / CIP 106632

ATCC 49413 /

205 Legionella pneumophila 1 LG 0905 1046 451 Legionella gratiana - CIP 105267

ATCC 33877 /

206 Legionella pneumophila 1 LG 09051047 452 Legionella wadsworthii - CIP 103886

207 Legionella pneumophila 1 LG 09051048 453 Legionella feeleii - CIP 103877

208 Legionella pneumophila 1 LG 09051049 454 Legionella rubrilucens - LG 09051074

209 Legionella pneumophila 1 LG 09051051 455 Serratia marcescens - 504

210 Legionella pneumophila 1 LG 09051052 456 Serratia marcescens - 81

211 Legionella pneumophila 1 LG 09051053 457 Serratia marcescens - 296

212 Legionella pneumophila 1 LG 09051055 458 Serratia odorifica - 1073

213 Legionella pneumophila 1 LG 09051057 459 Serratia fonticola - 78645

214 Legionella pneumophila 1 LG 09051058 460 Serratia fonticola - 3965

215 Legionella pneumophila 1 LG 09051059 461 Serratia fonticola - 5680 (22)

216 Legionella pneumophila 1 LG 09051060 462 Serratia proteamaculans - Ra 1403

217 Legionella pneumophila 1 LG 09051061 463 Serratia proteamaculans - ClC 3630

218 Legionella pneumophila 1 LG 09051062 464 Serratia proteamaculans - EB 3706

219 Legionella pneumophila 1 LG 09051063 465 Serratia liquefaciens - 27592

220 Legionella pneumophila 1 LG 09051064 466 Serratia liquefaciens - 866

221 Legionella pneumophila 1 LG 09051065 467 Serratia liquefaciens - 507

222 Legionella pneumophila 1 LG 09051067 468 Serratia rubidea - 288

223 Legionella pneumophila 1 LG 09051068 469 Serratia entomophila - Al

224 Legionella pneumophila 1 LG 09051069 470 Serratia entomophila - 222

225 Legionella pneumophila 1 LG 09051070 471 Serratia entomophila - A15

226 Legionella pneumophila 1 LG 09051071 472 Serratia grimesi - 390

227 Legionella pneumophila 1 LG 09051072 473 Serratia grimesi - 503

228 Legionella pneumophila 1 LG 09051073 474 Serratia ficaria - 4024 229 Legionella pneumophila 1 LG 0905 1075 475 Serratia ficaria - 5602

230 Legionella pneumophila 1 LG 0905 1076 476 Serratia plymuthica - 510

231 Legionella pneumophila 1 LG 0905 1077 477 Acinetobacter Iwoffii - 64 105

232 Legionella pneumophila 1 LG 0905 1078 478 Pseudomonas putida - 2066 type

233 Legionella pneumophila 1 LG 0902 5003 479 Tatlockia maceachernii - CIP 103846

Stenotrophomonas

234 Legionella pneumophila 1 LG 0902 5004 480 maltophilia - CIP 60.77

235 Legionella pneumophila 1 LG 0903 5005 481 Alcaligenes faecalis - CIP 60.80

236 Legionella pneumophila 1 LG 0804 4003 482 Enterobacter aerogenes - CIP 60.86

237 Legionella pneumophila 1 LG 0808 3024 483 Aeromonas hydrophila - CIP 76.14

238 Legionella pneumophila 1 LG 0816 4001 484 Buckholderia cepacia - CIP 80.24

239 Legionella pneumophila 1 LG 0816 4002 485 Klebsiella oxytoca - CIP 103434

240 Legionella pneumophila 1 LG 0817 2018 486 Proteus vulgaris - CIP 104989

Xanthommonas

241 Legionella pneumophila 1 LG 0820 3005 487 campes sorted - CIP 100069

Pseudomonas

242 Legionella pneumophila 1 LG 0821 1032 488 aeruginosa - CIP 100720

Pseudomonas

243 Legionella pneumophila 1 LG 0829 4004 489 fluorescens - CIP 69.13

244 Legionella pneumophila 1 LG 0829 4018 490 no Legionella - LG 0905 1030

245 Legionella pneumophila 1 LG 0825 3028 491 no Legionella - LG 0905 1066

246 Legionella pneumophila 1 LG 0830 3006 492 no Legionella - LG 0905 1101

Table 14: Comparison between SgI and Sg9 (blastn and blastp) for the wzm and wzt genes

% id with sg1 (DNA / DNA)% id with sg1 (amino acids) wzm 58.00% 49, 00% wzt 68% (on 1/3 of the sequence) 41, 00%

Table 15: Alignment of the probes with the corresponding sequence of Sg9 Primer size

(in base pairs) Number of mismatch

Pl 20 6

P2 20 7

P65 22 9

P66 21 4 sgl-pb 32 11

References 1. Albert-Weissenberger, C., C. Cazalet, and C. Buchrieser. 2007. Legionella pneumophila - a human pathogen that co-evolved with fresh water protozoa. This is Mol Life Sci 64: 432-448.

2. Behets, J., P. Declerck, Y. Delaedt, B. Creemers, and F. Ollevier. 2006. Development and evaluation of a Taqman duplex real-time PCR quantification method for reliable enumeration of Legionella pneumophila in water samples. J Microbiol Methods 68: 137-144.

3. Benson, R. F., and B. S. Fields. 1998. Classification of the genus Legionella. Semin Respir Infect. 13: 90-99.

4. Carver, T.J., K.Mr. Rutherford, M.Berriman, A. Rajandream, B.G. Barrell, and J. Parkhill. 2005. ACT: the Artemis Comparison Tool. Bioinfromatics (Oxford,

England) 21: 3422-3423.

5. Cazalet, C., L. Gomez-Valero, C. Rusniok, M. Lomma, D. Dervins-Ravault, HJ Newton, FM Sansom, S. Jarraud, N. Zidane, L. Ma, C. Bouchier, J. Etienne, EL Hartland, and C. Buchrieser. 2010. The Legionella longbeachae genome and transcriptome uncovers unique strategies to cause Legionnaires' disease. PLoS Broom 6: el000851.

6. Cazalet, C., S. Jarraud, Y. Ghavi-Helm, F. Kunst, P. Glaser, J. Etienne, and C. Buchrieser. 2008. Multigenome analysis identified a Worldwide distributed epidemic Legionella pneumophila clone that was reported within a highly diverse species. Genome Res 18: 431-441.

7. Cazalet, C., Rusniok C., Bruggemann H., Zidane N., Magnier A., Ma L., Tichit M., Jarraud S., Bouchier C., Vandenesch F., Kunst F., Etienne J. P. Glaser, and C. Buchrieser. 2004. Evidence in the Legionella pneumophila genome for exploitation of host cell functions and high genome plasticity. Nat. Genet 36: 1165-1173.

8. Chang, B., K. Sugiyama, T. Taguri, J. Amemura-Maekawa, F. Kura, and H. Watanabe. 2009. Specifies detection of viable Legionella cells by combined use of photoactivated ethidium monoazide and PCR / real-time PCR. Appl Environ Microbiol 75: 147-53. 9. Chen, NT, and CW Chang. 2010. Rapid quantification of viable legionellae in water and biofilm using ethidium monoazide coupled with real-time quantitative PCR. J Microbiol Appl.

10. Delgado-Viscogliosi, P., L. Solignac, and J. Delattre. 2009. Viability PCR, a culture-independent method for rapid and selective quantification of viable Legionella pneumophila cells in environmental water samples. Appl. Microbiol 75: 3502-3512.

11. Diederen, B. M., C. M. de Jong, F. Marmouk, J. A. Kluytmans, M. F. Peeters, and A. Van der Zee. 2007. Evaluation of real-time PCR for the early detection of Legionella pneumophila DNA in serum samples. J Med Microbiol 56: 94-101.

12. Diederen, B. M., J. A. Kluytmans, C. M. Vandenbroucke-Grauls, and M. F. Peeters. 2009. Utility of real-time PCR for diagnosis of Legionnaires' disease in routine clinical practice. J Clin Microbiol 46: 671-677.

13. Direction, General, of, and Health. 2002. Circular DGS / SD7A / SD5C / DHOS / E4 n ° 2002/243 of 22 April 2002 on the prevention of the risk related to legionella in health establishments Official Bulletin

14. Doleans, A., H. Aurell, M. Reyrolle, G. Lina, J. Freney, F. Vandenesch, J. Etienne, and S. Jarraud. 2004. Clinical and environmental distributions of Legionella strains in France are different. J Clin Microbiol 42: 458-460.

15. Dusserre, E., C. Ginevra, S. Hallier-Soulier, F. Vandenesch, G. Festoc, J. Etienne, S. Jarraud, and M. Molmeret. 2008. A PCR-based method for monitoring Legionella pneumophila in water samples detects viable noncultivable legionellae that can recover their cultivability. Appl. Microbiol 74: 4817-4824.

16. Fields, B.S. 2008. Legionella in the environment, p. 85-91. In P. Hoffmann, H. Friedman, and M. Bendinelli (eds.), Legionella pneumophila: Pathogenesis and

Immunity. Springer, New York.

17. Fields, B. S., R. F. Benson, and R. E. Besser. 2002. Legionella and Legionnaires' disease: 25 years of investigation. Clin Microbiol Rev 15: 506-526.

18. Fleiss, JL 1981. The Measurement of Interrater Agreement, vol. Second Edition. John Wiley & Sons, Inc., New York. 19. Frangelo, L., P. Glaser, C. Rusniok, C. Buchrieser, E. Duchaud, P. Dehoux, and F. Kunst. 2004. CAAT-Box, Contigs-Assembly and Annotation toolbox for genome sequencing projects. Bioinformatics 20: 790-797.

20. Ginevra, C., M. Lopez, F. Forey, M. Reyrolle, H. Meugnier, F. Vandenesch, J. Etienne, S. Jarraud, and M. Molmeret. 2009. Evaluation of a nested-PCR-derived sequence-based typing method applied directly to respiratory samples from patients with Legionnaires' disease. J Clin Microbiol 47: 981-7.

21. Glaser, P., Frangeul L., Buchrieser C., Rusniok C., Amenda A., Baquero F., Berche P., Bloecker H., Brandt P., Chakraborty T., Charbit A., Chetouani F. , E. Couve, A. de Daruvar, P. Dehoux, E. Domann, G. Dominguez-Bernal, E. Duchaud, L. Durant, O. Dussurget, KD Entian, H. Fsihi, FG Portillo, P. Garrido, L. Gautier, W. Goebel, N. Gomez-Lopez, T. Hain, J. Hauf, D. Jackson, LM Jones, U. Kaerst, J. Kreft, M. Kuhn,

F. Kunst, G. Kurapkat, E. Madueno, A. Maitournam, J. Vicente M., E. Ng, H. Nedjari,

G. Nordsiek, S. Novella, B. de Pablos, JC Perez-Diaz, R. Purcell, B. Remmel, M. Rosé, T. Schlueter, N. Simoes, A. Tierrez, JA Vazquez-Boland, H. Voss , J. Wehland, and P. Cossart. 2001. Comparative genomics of Listeria species. Science 294: 849-852.

22. Hay, J., D. V. Seal, B. Billcliffe, and J. H. Freer. 1995. Non-culturable Legionella pneumophila associated with Acanthamoeba castellanii: detection of the bacterium using DNA amplification and hybridization. J Appl Bacteriol 78: 61-65.

23. Hayden, R. T., J. R. UhI, X. Qian, M. K. Hopkins, M. C. Aubry, A. H. Limper, R. V. Lloyd, and F. R. Cockerill. 2001. Direct detection of Legionella species from bronchoalveolar lavage and open lung biopsy specimens: comparison of LightCycler PCR, in situ hybridization, direct fluorescence antigen detection, and culture. J Clin Microbiol 39: 2618-2626.

24. Helbig, JH, S. Bernander, M. Castellani Pastoris, J. Etienne, V. Gaia, S. Lauwers, D. Lindsay, PC Luck, T. Marques, S. Mentula, F. Peeters, C. Pelaz, M. Struelens, Uldum SA, Wewalka G., and TG Harrison. 2002. Pan-European study on culture-Proven legionnaires' disease: distribution of Legionella pneumophila serogroups and monoclonal subgroups. E. Eur J Clin Microbiol Infect Dis 21: 710-716.

25. Hui, SL, and SD Walter. 1980. Estimating the error rates of diagnostic tests. Biometries 36: 167-171. 26. International, Organization, for, and Standardization. 1998. Water quality - Detection and enumeration of Legionella ISO 1731: 1998.

27. JoIy, P., P. Falconnet, J. Andre, N. Weill, M. Reyrolle, F. Vandenesch, M. Maurin, J. Etienne, and S. Jarraud. 2006. Quantitative real-time Legionella PCR for environmental water samples: data interpretation. Appl. Microbiol 72: 2801-2808.

28. Koide, M., F. Higa, M. Tateyama, I. Nakasone, N. Yamane, and J. Fujita. 2006. Detection of Legionella Species in Clinical Samples: Comparison of Polymerase Chain Reaction and Urinary Antigen Detection Kits. Infection. 34: 264-268.

29. Luck, C. P., E. Jacobs, I. Roske, U. Schroter-Bobsin, R. Dumke, and S. Gronow. 2009. Legionella dresdenensis sp. nov. isolated from the river Elbe near Dresden in Germany. Int J Syst Evol Microbiol.

30. Morio, F., S. Corvée, N. Caroff, F. Le Gallou, H. Drugeon, and RA 2008. Real-time PCR assay for the detection and quantification of Legionella pneumophila in environmental water samples: utility for daily practice . Int J Hyg Environ Health 211: 403-411.

31. Nazarian, E.J., D.J. Bopp, A. Saylors, R.J. Limberger, and K. A. Musser. 2008. Design and implementation of a protocol for the detection of Legionella in clinical and environmental samples. Diagn Microbiol Infect Dis 62: 125-132.

32. Ratcliff, R. M., J. A. Lanser, P. A. Manning, and M. W. Heuzenroeder. 1998. Sequence-based classification scheme for the genus Legionella targeting the mip gene. J Clin Microbiol 36: 1560-7.

33. Reyrolle, M., C. Ratat, M. Leportier, S. Jarraud, J. Freney, and J. Etienne. 2004. Rapid identification of Legionella pneumophila serogroups by latex agglutination. Eur J Clin Microbiol Infect Dis 23: 864-866.

34. Standard, O. F. 2003. Water quality. Detection and enumeration of Legionella spp. and Legionella pneumophila. By inoculation and after concentration by membrane filtration of centrifugation. In A. F. d. Standardization (ed.), Vol. AFNOR NF T90-431

35. Standards, OF 2006. Water quality. Detection and quantification of Legionella and / or Legionella pneumophila by concentration and engineering amplification by polymerase chain reaction (PCR). In AF d. Standardization (ed.), Vol. AFNOR XP T90-471 36. Steinert, M., U. Hentschel, and J. Hacker. 2002. Legionella pneumophila: An aquatic microbe goes astray. FEMS Microbiol Rev 26: 149-162.

37. Thermer, A., J. Helbig, H., E. Jacobs, and P. C. Luck. 2009. PCR-based 'serotyping' of Legionella pneumophila. J Med Microbiol 58: 588-95.

38. Wellinghausen, N., C. Frost, and R. Marre. 2001. Detection of Legionellae in hospital water samples by quantitative real-time LightCycler PCR. Appl. Microbiol. 67: 3985-93.

39. Yaradou, DF, S. Hallier-Soulier, S. Moreau, F. Poty, Y. Hillion, M. Reyrolle, J. Andre, G. Festoc, K. Delabre, F. Vandenesch, J. Etienne, and S Jarraud. 2007. Integrated real-time PCR for detection and monitoring of Legionella pneumophila in water Systems. Appl. Microbiol 73: 1452-1456.

40. Yong, S. F., F. N. Goh, and Y. F. Ngeow. Legionella species and serogroups in Malaysian water cooling towers: identification by latex agglutination and PCR-DNA sequencing of isolates. J Water Health 8: 92-100.

41. Yu, V.L., J. F. Plouffe, M. C. Pastoris, J. E. Stout, M. Schousboe, A. Widmer, J. Summersgill, T. File, C.M.Heath, D. L. Paterson, and A. Chereshsky. 2002. Distribution of Legionella species and serogroups isolated by culture in patients with sporadic community-acquired legionellosis: an international collaborative survey. J Infect Dis 186: 127-128.

Claims

1. Use of the Legionella pneumophila wzm (ABC transporter of LPS O-antigen) nucleic acid sequence, its complementary or reverse sequence, or a fragment thereof as a specific marker for the detection and / or identification of a bacterium belonging to the species Legionella pneumophila serogroup 1 (L. pneumophila SgI).

2. Use according to claim 1, characterized in that said nucleic sequence used is a sequence chosen from the following sequences:

a) the sequence of the wzm gene of Legionella pneumophila, strain Paris (NCBI reference sequence: NC 006368.1 dated April 26, 2009, "locus tag lppO837") of sequence SEQ ID NO: 1;

b) the sequence of a fragment of at least 15 nucleotides of a sequence as defined in a);

c) the sequence of a variant of the wzm gene having at least 80% identity with the sequence SEQ ID NO: 1, the sequence of this variant comprising at least the conserved sequence that it is desired to detect and / or identify for L. pneumophila SgI bacteria or comprising at least one sequence having an identity percentage of at least 95%, with said conserved sequence;

3. A method for detecting or identifying the presence of a Legionella pneumophila serogroup 1 bacterium (L. pneumophila SgI) in a sample, characterized in that it implements a step of detecting or identifying the presence of a sequence of a conserved region of the wzm gene for bacteria belonging to serogroup 1 of the species Legionella pneumophila.

4. Method of detection or identification according to claim 3, characterized in that said sequence of the conserved region of the wzm gene for L. pneumophila SgI bacteria is the sequence of a conserved fragment of the sequence SEQ ID NO: 1 , or the sequence of a conserved fragment of one of its variants having at least 80% identity with the sequence SEQ ID NO: 1, their complementary sequence, or their reverse sequence.

5. Method of detection or identification according to claim 3 or 4, characterized in that said conserved fragment of the sequence SEQ ID NO: 1 is a fragment of at least 25 consecutive nucleotides, preferably at least 50, 75, 100, 200 and 250 consecutive nucleotides, sequence nt 99-392 of the sequence SEQ ID NO: 1.

6. Method of detection or identification according to claim 4, characterized in that said conserved fragment of the sequence SEQ ID NO: 1 is a fragment of at least 25 consecutive nucleotides, preferably at least 50 and 75 nucleotides. consecutive, sequence nt 138-214 of the sequence SEQ ID NO: 1.

7. A method of detection or identification according to one of claims 3 to 6, characterized in that said sample is a liquid sample or air likely to be contaminated by a bacterium of the species L. pneumophila, in particular of a bacterium belonging to serogroup 1 (L. pneumophila SgI).

8. A method of detection or identification according to claim 7, characterized in that said sample is a water sample, in particular emanating from water distribution circuit or cooling circuit.

9. The detection or identification method according to claim 7, characterized in that said sample is an air sample.

10. A method of detection or identification according to one of claims 3 to 9, characterized in that it comprises a step of amplifying a DNA isolated from said sample using a pair of primers each of which sequences is able to hybridize under standard hybridization conditions with said sequence of a conserved region of the wzm gene, or with its complementary sequence.

11. Detection or identification method according to claim 10, characterized in that it comprises the following steps:

b) contacting the amplified DNA with a nucleotide probe, optionally labeled, capable of hybridizing specifically under standard hybridization conditions with said amplified DNA; and c) the detection of the formation of a possible hybridization complex and, where appropriate, its quantification.

12. A method of detection or identification according to claim 10 or 11, characterized in that in step a), said pair of primers is chosen from the following pairs of primers:

A) P1: (SEQ ID NO: 2) and P2: (SEQ ID NO: 3);

B) P65: (SEQ ID NO: 4) and P66: (SEQ ID NO: 5).

Detection or identification method according to claim 10 or 11, characterized

A) in that in step b), said probe is the sequence probe (SEQ ID NO: 6) when the pair of primers used in step a) is the pair of sequences SEQ ID NO: 2 and SEQ ID NO: 3, preferably when the process does not comprise in step c) the quantification of the hybridization complex formed; or

B) in that in step a), said pair of primer is the pair of primer P65 and P66 of sequence SEQ ID NO: 4 and SEQ ID NO: 5, and the probe is the probe of sequence SEQ ID NO: 6, when the process comprises in step c) the quantification of the hybridization complex formed, preferably by qPCR.

14. The method of detection or identification according to one of claims 3 to 13, characterized in that it comprises a step prior filtration of the sample to increase the concentration of bacteria present in the initial sample.

15. A method of detection or identification according to one of claims 3 to 9, characterized in that it comprises a step of demonstrating said sequence of a conserved region of the wzm gene, or its complementary sequence, by FISH analysis (Fluorescent In Situ Hybridization).

16. The method of detection or identification according to claim 15, characterized in that it comprises the following steps:

a) contacting the genomic DNA of said sample with a labeled nucleic acid probe capable of hybridizing specifically under standard hybridization conditions with said genomic DNA; and

17. A method of detection or identification according to claim 15 or 16, characterized in that said labeled probe used for the FISH analysis is a probe chosen from the following sequences:

a) the sequence SEQ ID NO: 6, its complementary sequence or one of their fragments having at least 15 consecutive nucleotides; or

b) a sequence comprising a sequence as defined in a).

18. A method for detecting or identifying a Legionella pneumophila serogroup 1 bacterium, Paris strain present in a sample, characterized in that it implements:

a step of detecting or identifying the presence of a Legionella pneumophila serogroup 1 bacterium by a method according to one of claims 3 to 17; and

at least one other step of detecting or identifying the presence, or the expression of the cyoB gene.

19. A method for detecting or identifying a Legionella pneumophila serogroup 1 bacterium, Paris strain according to claim 18, characterized in that the step of detecting or identifying the presence or expression of the cyoB gene. implements the use of the pair of primers P95 and P96 of sequence SEQ ID NOs. : 21 and 22 and / or a probe of sequence SEQ ID NO. : 23.

20. A method for detecting or identifying the serogroup of a Legionella pneumophila bacterium present in a sample, characterized in that it implements:

a step of detecting or identifying the presence of a Legionella pneumophila serogroup 1 bacterium by a method according to one of claims 3 to 19; and

at least one other step of detecting or identifying the presence of a Legionella pneumophila bacterium from another serogroup, in particular chosen from serogroups 6 and 10, 12, or, 13 and 14.

21. A detection or identification method according to claim 20, characterized in that:

a) when the detection or identification method comprises an amplification step, the pair of primers used for the detection or identification of the presence of a serogroup Legionella pneumophila bacterium selected from serogroups 6, 10, 12, 13 or 14 is: the primer pair of P87 / P88 sequences of SEQ ID NO: 7 and SEQ ID NO: 8 sequences for the detection or identification of the presence of a Legionella pneumophila serogroup 6 or 12 bacterium;

the primer pair of P85 / P86 sequences of SEQ ID NO: 9 and SEQ ID NO: 10 sequences for the detection or identification of the presence of Legionella pneumophila serogroup 10 or 14 bacteria; and

the pair of P91 / P92 sequence primers of SEQ ID NO: 11 and SEQ ID NO: 12 sequences for the detection or identification of the presence of a Legionella pneumophila serogroup 13 bacterium,

and

b) when the method of detection or identification is carried out by FISH analysis, the probe used for the detection or identification of the presence of Legionella pneumophila serogroup bacteria selected from serogroups 6 and 12, 13, or 10 or 14 is a probe whose sequence is chosen from the following sequences:

the sequence of the PCR product obtained by the pair of P87 / P88 sequence primers of SEQ ID NO: 7 and SEQ ID NO: 8 sequences for the detection or identification of the presence of a Legionella pneumophila serogroup 6 bacterium or 12, its complementary sequence, one of their fragments having at least 15 consecutive nucleotides, or a sequence comprising one of these sequences;

the sequence of the PCR product obtained by the pair of P85 / P86 sequence primers of SEQ ID NO: 9 and SEQ ID NO: 10 sequences for the detection or identification of the presence of a Legionella pneumophila serogroup bacterium 10 or 14, its complementary sequence, one of their fragments having at least 15 consecutive nucleotides, or a sequence comprising one of these sequences; and

the sequence of the PCR product obtained by the pair of P91 / P92 sequence primers of sequences SEQ ID NO: 11 and SEQ ID NO: 12 for the detection or identification of the presence of a Legionella pneumophila serogroup 13 bacterium , its complementary sequence, one of their fragments having at least 15 consecutive nucleotides, or a sequence comprising one of these sequences.

22. Method for detecting or identifying serogroup of a bacterium

Legionella pneumophila or a bacterium Legionella longbeachae present in a sample, characterized in that it implements: A) when the detection or identification process comprises an amplification step,

a step of detecting or identifying the presence of Legionella pneumophila serogroup 1 or serogroups 6 and 12, 13, or, 10 and 14 by a method according to one of claims 3 to 14, 18 to 21; and

a step of detecting or identifying the presence of a Legionella longbeachae comprising the amplification of a DNA isolated from said sample by using a pair of primers chosen from the following pairs of primers;

the sequence pair P51 / P52 of sequences SEQ ID NO: 13 and SEQ ID NO: 14;

contacting the amplified DNA with a nucleotide probe, optionally labeled, capable of hybridizing specifically under standard hybridization conditions with said amplified DNA, and, where appropriate,

in that the chosen probe is the sequence probe:

SEQ ID NO: 19 (Lgb1 probe) when the chosen pair of primers is the pair of P69 / P70 sequence primers; and

SEQ ID NO: 20 (Lgb2 probe) when the chosen pair of primers is the pair of primers of P73 / P74 sequences, and

B) when the detection or identification process is carried out by in situ hybridization, for example a FISH analysis,

a step of detecting or identifying the presence of a Legionella pneumophila serogroup 1 bacterium or serogroups 6 and 12, 13, or 10 and 14 by a method according to one of claims 15 to 19; and

a step of detecting or identifying the presence of a Legionella longbeachae by in situ hybridization, for example by FISH analysis and whose probe used for the detection or identification of Legionella longbeachae is a probe whose sequence is selected from the PCR product sequences obtained by a pair of primers selected from the following pairs of primers; the sequence pair P51 / P52 of sequences SEQ ID NO: 13 and SEQ ID NO: 14;

the probe Lgbl of sequence SEQ ID NO: 19 when the chosen pair of primers is the pair of primers of sequences P69 / P70 or

the complementary sequence of these probes, one of their fragments having at least 15 consecutive nucleotides, their complementary sequence or fragments of at least 15 nucleotides or a sequence comprising one of these sequences.

23. A method of detection or identification according to one of claims 18 to 22, characterized in that in step a), the amplification of the isolated DNA is carried out by a multiplex PCR method in which the different pairs of primers are contacted simultaneously with said DNA isolated from the sample.

24. The method of detection or identification according to one of claims 3 to 14 and 18 to 23, characterized in that the amplified DNA, where appropriate labeled, is contacted in step b) with a support. solid on which are fixed the nucleic probes capable of hybridizing specifically under standard hybridization conditions with said amplified DNA.

25. Diagnostic kit for the detection and / or identification of the presence of a Legionella pneumophila serogroup 1 bacterium in a sample, characterized in that it comprises:

a) an isolated nucleic acid having for sequence the sequence of a conserved region of the wzm gene of sequence SEQ ID NO: 1, or of one of its variants, in particular a sequence having at least 80% identity with this sequence preferably selected from the group consisting of:

the sequence of a fragment of at least 25 consecutive nucleotides of the sequence nt 99-392 of the sequence SEQ ID NO: 1 or of one of its variants; the sequence of a fragment of at least 25 consecutive nucleotides of the sequence nt 138-214 of the sequence SEQ ID NO: 1 or of one of its variants; and

- their complementary sequence or their inverse sequence; or

b) a solid support on which is fixed one of the sequences as defined in a).

26. Diagnostic kit for the detection and / or identification of the presence of a Legionella pneumophila serogroup 1 bacterium in a sample, characterized in that it comprises: preferably chosen from the group of primers of the group made of :

P1 (SEQ ID NO: 2) and P2 (SEQ ID NO: 3); and

P65 (SEQ ID NO: 4) and P66 (SEQ ID NO: 5),

and optionally,

a probe, possibly labeled, of sequence SEQ ID NO: 6.

27. Diagnostic kit for the detection and / or identification of the presence of a Legionella pneumophila serogroup 1 strain, Paris strain, in a sample, characterized in that it comprises:

the elements of the kit according to one of claims 25 or 26; and

P95 and P96 of sequence SEQ ID NOs. : 21 and 22:

and optionally,

28. Diagnostic kit for the detection and / or identification of the serogroup of a bacterium Legionella pneumophila present in a sample, characterized in that it comprises:

a) a kit as defined in one of claims 25 to 27, and

b) 1) at least one pair of primers chosen from the following pairs of primers: the pair of primers with sequences P87 / P88 of SEQ ID NO: 7 and SEQ ID

NO: 8 for the detection or identification of the presence of Legionella pneumophila serogroup 6 or 12 bacteria; the primer pair of P85 / P86 sequences of SEQ ID NO: 9 and SEQ ID NO: 10 sequences for the detection or identification of the presence of Legionella pneumophila serogroup 10 or 14 bacteria; and

2) at least one nucleic acid whose sequence is a sequence comprising or consisting of one of the PCR products amplified by a pair of primers as defined in b) 1), its complementary or inverse sequence, one of their fragments of at least 15 consecutive nucleotides; or

3) a solid support on which is fixed one of the sequences as defined in 2).

29). Diagnostic kit for the detection and / or identification of the serogroup of a bacterium Legionella pneumophila or a bacterium Legionella longbeachae present in a sample, characterized in that it comprises:

A) a kit as defined in one of claims 25 to 28 and

the sequence pair P51 / P52 of sequences SEQ ID NO: 13 and SEQ ID NO: 14;

or

2) at least one nucleic acid whose sequence is a sequence comprising or consisting of one of the PCR products amplified by a pair of primers as defined in B) I), its complementary or inverse sequence, one of their fragments of at least 15 consecutive nucleotides or a solid support to which one of these sequences is attached, preferably:

a nucleic acid of sequence SEQ ID NO: 19 (Lgbl probe) or SEQ ID NO: 20 (Lgb2 probe), its complementary or inverse sequence; or 3) a solid support on which is fixed one of the sequences as defined in 2).

30. Primer selected from the group of primers of sequences SEQ ID NOs. 2-5 and SEQ ID Nos. 7 to 18.

31. Primer pair selected from the group of primer pairs of the following sequences:

a) SEQ ID NO: 2 and SEQ ID NO: 3;

b) SEQ ID NO: 4 and SEQ ID NO: 5;

c) SEQ ID NO: 7 and SEQ ID NO: 8;

d) SEQ ID NO: 9 and SEQ ID NO: 10;

e) SEQ ID NO: 11 and SEQ ID NO: 12;

f) SEQ ID NO: 13 and SEQ ID NO: 14;

g) SEQ ID NO: 15 and SEQ ID NO: 16; and

h) SEQ ID NO: 17 and SEQ ID NO: 18.

32. Probe chosen from the group of probes of sequences SEQ ID NOs. 6, 19 and

20.