FR2949788A1 - SPECIFIC MARKER AND METHOD FOR THE DETECTION AND IDENTIFICATION OF BACTERIUM LEGIONELLA PNEUMOPHILA SEROGROUPE 1 - Google Patents

Abstract

The subject of the present invention is new specific markers and a method for the rapid detection and identification of serogroup of Legionella pneumophila bacteria, in particular serogroup 1, in particular from water or air samples. The invention also includes diagnostic kits for carrying out these methods.

Description

The subject of the present invention is new specific markers and a method for the rapid detection and identification of serogroup of Legionella pneumophila bacteria, in particular serogroup 1, in particular from water or air samples. The invention also includes diagnostic kits for carrying out these methods.

Legionella is an environmental bacterium responsible for legionellosis and Pontiac fever. Legionellosis is an environmental-source infectious disease caused by the inhalation of microdroplets containing Legionella pneumophila (Lp) or rarely Legionella spp. Epidemiological data indicate that only certain isolates are capable of provoking clinical cases. The species L. pneumophila appears to have greater virulence than other species, being responsible for 90% of cases of legionellosis. Within this species, among the 15 serogroups (Sg), isolates of Sg 1 are associated with 80% of cases (9, 10, 17). Legionnaires' disease is also a nosocomial disease with around 100 cases identified in 2005 in nursing homes or retirement homes (4). The natural habitat of Legionella is the water environment. They are present in 90% of water withdrawals from lakes and rivers and 70-80% of water from urban water distribution systems (8). Control of legionella risk is based on the control of the water quality of the various possible environmental sources (domestic hot water networks, cooling towers, spa, ...). As a result, the detection of legionella in water systems, especially the hot water networks and air conditioning systems of hotels, residences and hospitals is extremely important. This surveillance makes it possible to define the risk of legionellosis according to the contamination rate in order to undertake corrective actions, measures which would only be better understood and taken if the species and the serogroup (Sg) were known by one and same technique. To date, no rapid test of monitoring of water networks, and a single test in patients, the detection of urinary antigens, allows the identification of legionella at the level of Sg. In addition, the urine test used in clinical only highlights Sg 1, the other SGs are not detected. Current methods of typing Sg require to obtain the bacterial strain by culture beforehand. Given the dominance of Lp Sg 1 in infections

it is important to be able to identify the species present in the networks as well as to determine the SG quickly and reliably. Improving typing procedures can therefore be considered a priority in public health and for the water industry.

The monitoring of water quality is currently based on the search and enumeration of legionella by culture according to, in France, a standard AFNOR NF T90-431 Search and enumeration of Legionella spp and Lp, method by direct seeding and after concentration by membrane filtration or centrifugation. This technique is long and tedious (3 to 10 days). Its yield is very variable from one laboratory to another and from one sample to another (2). It uses culture media (BCYE and GVPC) that are adapted to the Lp Philadelphia-1 strain isolated during the first legionella outbreak (9). However, our recent results show that strains of Lp freshly isolated from the environment or biological samples have a growth rate on these media different, often slower, than that of the strain of Lp Philadelphia 1. On the other hand, water samples often contain several strains of Legionella (8). The technique of identification by culture allows typing only a few colonies which implies that colonies of Lp Sg 1 can escape this detection technique. In recent years research techniques for Legionella by PCR in water have developed (1, 15, 16). However, these molecular techniques are sometimes difficult to reproduce from one laboratory to another (13). The reagents used must be free of Legionella DNA which is a specific problem of this ubiquitous bacterium in water (14). These different studies show that there is a correlation between culture and PCR, but the genome unit results are often higher than the results in CFU. There are many PCR positive and culture negative samples that can not be determined if it is due to nonspecific amplifications, the presence in the DNA sample of dead bacteria, or the presence of viable bacteria. but not cultivable. In the latter case, legionella PCR would be better than culture to identify a potential health risk. Real-time quantitative PCR reagents have been developed in recent years by several manufacturers (Biorad, Applied Biosystem, Genesystem, AES Chemulex, etc.) allowing standardization according to an experimental standard AFNOR XP T90-471

developed in France. However, no currently proposed technique can identify Lp of Sg 1 by PCR or by in situ hybridization. It remains to be able to have a specific marker of Legionella pneumophila serogroup 1. The identification of these marker genes would allow the development of new tools for typing strains of Legionella based on PCR, or real-time PCR, or directly by in situ hybridization using labeled probes to detect and / or identify Lp Sg 1, including among other legionella, in the environment, in the hospital or in the patient. The new characteristics of these typing tools should be: - High discrimination and specificity between this serogroup 1 of Legionella pneumophila and the other species and serogroups of Legionella; and - Speed and simplicity of use. This is precisely the object of the present invention. The inventors have been able to demonstrate that the sequence of the wzm gene of Legionella pneumophila, in particular certain fragments of this gene, was not only well conserved within serogroup 1 of Legionella pneumophila, but also allowed to distinguish them in legionella and in particular among the other serogroups of bacteria of the species Legionella pneumophila. Thus, the inventors have been able to demonstrate that it was possible to detect and identify the specific presence of Legionella pneumophila serogroup 1 bacteria in a sample by using as a specific marker the sequence of this gene or one of its fragments.

In this study, the inventors were also able to highlight the presence of specific markers of other serogroups of Legionella pneumophila bacteria as well as bacteria of the species Legionella longbeachae.

Thus, in a first aspect, the subject of the present invention is the use of the nucleic acid sequence of the Legionella pneumophila wzm (ABC transporter of LPS 0-antigen) gene, its complementary or reverse sequence, or one of their fragments, As a specific marker for the detection and / or identification of a bacterium belonging to the species Legionella pneumophila serogroup 1 (L. pneumophila Sgl).

In particular, it is preferred here the use of a sequence of the wzm gene selected from the following sequences: a) the sequence of the wzm gene of Legionella pneumophila, strain Paris (NCBI reference sequence: NC 006368.1 dated April 26, 2009, locus tag 1pp0837 SEQ ID NO: 1 sequence below); b) the sequence of a fragment of at least 15 nucleotides, preferably 20, 25, 30, 35, 40, 50, 75, 100, 150, 200 or 250 nucleotides of a sequence as defined in a); c) the sequence of a variant of the wzm gene, having at least 80%, preferably 85%, 90%, 92.5%, 95%, 96%, 97%, 98%, 98.25%, 98, 5%, 98.6%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3 99.4%, 99.5%, 99% , 6, 99, 7%, 99.8% or 99.9% with the sequence SEQ ID NO: 1, the sequence of this variant comprising at least the conserved sequence that it is desired to detect and / or identify for a bacterium L. pneumophila Sgl or comprising at least one sequence having an identity percentage of at least 98%, preferably 98.25%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3 99.4%, 99.5%, 99.6, 99, 7%, 99.8% or 99.9% with said conserved sequence; d) the complementary or inverse sequence of a sequence as defined in a), b) or c). SEQ ID NO: l 1 atgacctcaa tatcctcaaa aactcagacg tttaaagaaa cagtagtcta tggagttgat 61 aagtttaggc ttttagctgt tttaagaaat atatgggatt accgcttgct tttatggatt 121 ttttgtaaac gagatctcaa agggcgttac agtcaaacca tcttgggatt gggttgggtt 181 attttaactc ctttgattac ggttggggtg tttgtcattg tttttggcat catgataaag 241 gtacctaccg atgggctgcc tactgtcatg ttctatttgg ttgcggttat accttggtat 301 tcctttttaa atgttctcaa cccttccata caaatgattg agggaaatgc ttcgttaata 361 acaaaggtct attttccaag agcgttgata ggcggtgcct atgctatggg agctgcggtt 421 gattttctga tggcttatgt gtttttgata accccctttg caatttatta tggcctttgg 481 tctatcaagt tattaattat tatgccattc ctgctgatat ctaccttaat gattggatta 541 ggtattggtt tggttttagc acctatcaat gcaaaatata gggatattaa acattttatg 601 cctctggctt tgcagttatt ttattactcc actccagcga tttaccctgt ttctgctgtg 661 cctgtgtggg ctaaaccatg gtatgctgtt aatccattat ctcttgttat caccagttat 721 cgagaggtgt taatggggca ttggccatca cctactataa taatgacatt atctggtatg

781 gcaattataa ctttccttgt ggggcttgtt gcatttcatc acatggagca taaggtagtt 841 gatattttat ga By the conserved sequence of the wzm gene that one wishes to detect and / or identify for L. pneumophila Sgl bacteria or one of its natural variants, here is meant a consensus sequence partial of the wzm gene common to all L. pneumophila Sgl group bacteria or one of their variants. According to a preferred embodiment, the method for detecting or identifying the presence of a Legionella pneumophila serogroup 1 bacterium (L. pneumophila Sgl) in a sample according to the invention is characterized in that it implements a step of detecting or identifying the presence of a sequence of a conserved region of the wzm gene for the bacteria belonging to serogroup 1 of the Legionella pneumophila species, in particular of a conserved fragment of the sequence SEQ ID NO : 1, or the sequence of one of its variants. Among these conserved fragments, it is further preferable: a fragment of at least 20 consecutive nucleotides, preferably at least 25, 30, 35, 40, 50, 75, 100, 150, 200 or 250 consecutive nucleotides, of the sequence nt 99-392 of the sequence SEQ ID NO: 1; a fragment of at least 20 consecutive nucleotides, preferably at least 25, 30, 35, 40, 50 or 75 consecutive nucleotides, of the sequence nt 138-214 of the sequence SEQ ID NO: 1.

According to a preferred embodiment, in the method for detecting or identifying the presence of L. pneumophila Sgl bacteria in a sample according to the invention, said sample is a liquid or air sample that may be contaminated with a bacterium of the genus Legionella, in particular L. pneumophila, in particular a bacterium belonging to serogroup 1 (L. pneumophila Sgl).

In a preferred embodiment, in the method of detecting or identifying the presence of an L. pneumophila Sgl bacterium according to the present invention, said sample analyzed is a water sample, in particular from a distribution circuit. water, for example but not limited to urban water,

a source, of river or lake, of cooling circuit, such as for example but not limited to a cooling system by spraying or runoff of water that can generate aerosols that can be inhaled. Methods for detecting or identifying the presence of an L. pneumophila Sgl bacterium according to the invention characterized in that said sample is an air sample are also preferred. In another preferred embodiment, the method for detecting or identifying the presence of an L. pneumophila Sgl bacterium according to the present invention comprises a step of amplifying a DNA isolated from said sample, this step involving a pair of primers each of whose sequences is capable of hybridizing specifically under standard hybridization conditions with said sequence of a conserved region of the wzm gene, with its complementary sequence or one of their fragments of at least 15 nucleotides, preferably at least 17, 20, 22, 25 and 30 nucleotides of this conserved sequence.

In general, the nucleic sequences usable here as primers are the primers which can be deduced from the conserved nucleotide sequences which it is desired to amplify in the sample. For the probe sequences that can be used here after amplification, or in in situ hybridization methods, they can also be deduced from the conserved sequence or the PCR products obtained after amplification that it is desired to detect and identify, in particular sequences, capable of to hybridize specifically under standard conditions with these PCR products or with said conserved sequence that it is desired to detect and / or identify. Specific hybridization means that the hybridization is carried out under conditions of high stringency, particularly under conditions of temperature and ionic strength such that they allow the maintenance of hybridization between two globally complementary DNA fragments. As an illustration, conditions of high stringency of the hybridization step for the purpose of defining the nucleotide sequences described above are advantageously as follows.

Hybridization is carried out at a preferred temperature of 65 ° C, in the presence of 6 x SSC buffer, 5 x Denhardt's solution, 0.5% SDS and 100 g / ml salmon sperm DNA. 1 x SSC corresponds to 0.15 M NaCl and 0.05 M sodium citrate and a solution of 1 x Denhardt corresponds to 0.02% Ficoll, 0.02% polyvinylpyrrolidone and 0.02% bovine serum albumin. The washing steps may, for example, be carried out for 5 to 30 minutes. at 65 ° C, in 2 x SSC buffer or 1 x SSC and 0.1% SDS. The high stringency hybridization conditions described above for a polynucleotide of defined size, will be adapted by those skilled in the art for oligonucleotides of larger or smaller size, according to the teaching of Sambrook et al., 1989. Preferably, the hybridization conditions will be said to be specific since only sequences having at least 90% identity with the sequence complementary to the targeted sequence will be able to hybridize, preferably those having at least 92.5%, 95%, 97.5%, 98%, 99%, 99.5% with this sequence complementary to the target sequence. The probes or primers used in the methods according to the invention will have a minimum size of 15 bases and fragments of at least 20, 25, 30 or 50 bases will be preferred. The techniques for detecting, identifying and, where appropriate, quantifying a nucleic sequence that can be used in the methods of the invention are well known to those skilled in the art and will not be developed here. It may be mentioned, but not limited to: In situ hybridization (in particular FISH analysis when the markers are of the fluorescent type) in which: - the contacting of a nucleic probe, if appropriate labeled, with the DNA contained in the biological sample, the latter having, where appropriate, been previously made accessible to hybridization, this under conditions allowing hybridization of the probe to the bacterial DNA contained in the biological sample; and - detecting and, where appropriate, assaying the hybrid formed between the nucleic probe and the DNA of the biological sample; and

PCR (polymerase chain reaction), or related PCR, in which the specific amplification of the targeted DNA is carried out using a specific pair of primers, the detection of the amplified product if appropriate, followed by a quantitative analysis of the amplification products (quantitative PCR).

There may also be mentioned another method for quantifying a target DNA sequence from a total DNA sample extract, optionally enriched in DNA, said method comprising: a first step wherein a first oligonucleotide probe specific for the target DNA or, where appropriate, its amplification products, immobilized on a support with an extract of the total DNA of the sample is contacted, or, where appropriate, optionally, with the PCR products obtained using specific primers, under conditions allowing hybridization of the first probe to the DNA of said sample or, where appropriate, to said PCR products; and a second step in which the hybrid formed between said first probe immobilized on a support and said DNAs or, where appropriate, said PCR products is brought into contact, if appropriate after elimination of the nucleic acids which have not hybridized with the first probe, with a second oligonucleotide probe, in particular labeled capable of hybridizing to the target DNA or, where appropriate, to its PCR products, then removal of the second probes that have not hybridized; and - the quantitative analysis of the triplexes thus formed. By related PCR is meant all methods involving direct or indirect reproductions of nucleic acid sequences, or in which the labeling systems have been amplified. These techniques are of course known. In general, it is the amplification of DNA by a polymerase; there are currently very many methods for this amplification (for example the so-called NASBA Nucleic Acid Sequence Based Amplification, TAS Transcription based Amplification System, LCR Ligase Chain Reaction, Endo Run Amplification (ERA), Cycling Probe Reaction (CPR), and SDA Strand Displacement Amplification well known to those skilled in the art). Also known to those skilled in the art are nucleic acid quantification techniques in which, for example, the nucleic acid to be quantified is amplified by a PCR method and in the presence of a standard nucleic acid of the same size,

amount known and capable of hybridizing to the same primers as the target nucleic acid. By percentage identity between two nucleic acid sequences in the sense of the present invention, is meant to designate a percentage of identical nucleotides between the two sequences to be compared, obtained after the best alignment (optimal alignment), this percentage being purely statistical and the differences between the two sequences being randomly distributed over their entire length. Sequence comparisons between two nucleic acid sequences are traditionally performed by comparing these sequences after optimally aligning them, said comparison being made over the entire length of the reference sequence. The optimal alignment of the sequences for the comparison can be realized, besides manually, by means of the algorithm of local similarity but especially by means of computer software using these algorithms (GAP, BESTFIT, FASTA and TFASTA or by the software of comparison BLAST N or BLAST P (available online at the NCBI website)). The percentage identity between two nucleic acid sequences is determined by comparing these two optimally aligned sequences and is calculated by determining the number of positions for which the nucleotide is identical between the two sequences, by dividing this number of identical positions. by the total number of positions and multiplying the result obtained by 100 to obtain the percentage identity between these two sequences. For example, the BLAST program, BLAST 2 sequences (Tatusova et al., "Blast 2 sequences - FEMS Microbiol Lett 174: 247-250) available on the http site. : //www.ncbi.nlm.nih.gov/gorflbl2.html, the parameters used being those given by default (in particular for the open gap penalty: 5 parameters, and the gap gap penalty extension: 2, the chosen matrix being for example the BLOSUM 62 matrix proposed by the program), the percentage of identity between the two sequences to be compared being calculated directly by the program.

The set of probes and primers used here may be labeled by methods well known to those skilled in the art, in order to obtain a detectable and / or quantifiable signal, in particular by fluorescent markers.

More preferably, the method for detecting or identifying the presence of an L. pneumophila Sgl bacterium according to the invention is characterized in that it comprises the following steps: a) the amplification of a DNA isolated at from said sample using a pair of primers each of whose sequences is capable of hybridizing under standard hybridization conditions with said sequence of a conserved region of the wzm gene, or with its complementary sequence; b) contacting the amplified DNA with a nucleotide probe, optionally labeled, capable of hybridizing specifically under standard hybridization conditions with said amplified DNA; and c) detecting the formation of a possible hybridization complex and, where appropriate, its quantification. By standard hybridization condition is meant here stringency conditions that lead to a specific hybridization of the primers with the DNA to be amplified and the probe with said amplified DNA. In a preferred embodiment, the method for detecting or identifying the presence of an L. pneumophila Sgl bacterium according to the invention is characterized in that in step a), said pair of primer is chosen among the following primer pairs: A) P1: TTACCGCTTGCTTTTATGGA (SEQ ID NO: 2) and P2: CCTATCAACGCTCTTGGAAA (SEQ ID NO: 3); B) P65: CAAAGGGCGTTACAGTCAAACC (SEQ ID NO: 4) and P66: CAAACACCCCAACCGTAATCA (SEQ ID NO: 5).

Also preferably, in step b) of the method for detecting or identifying the presence of L. pneumophila Sgl bacteria according to the invention, said probe is the TCTTGGGATTGGGTTGGGTTATTTTAACTCCT (SEQ ID NO: 6) sequence probe. when the pair of primers used in step a) is the pair of sequences SEQ ID NO: 2 and SEQ ID NO: 3. Preferably, the pair of primers chosen is the pair of primer P1 and P2 of sequence SEQ ID NO: 2 and SEQ ID NO: 3, and the probe is the probe of sequence SEQ ID NO: 6, when the process does not comprise in step c) the quantification of the hybridization complex formed (standard PCR) .

In a also preferred embodiment, the method for detecting or identifying the presence of an L. pneumophila Sgl bacterium according to the invention is characterized in that in step a), said pair of primer is the pair of primer P65 and P66 of sequence SEQ ID NO: 4 and SEQ ID NO: 5, and the probe is the probe of sequence SEQ ID NO: 6, when the method comprises in step c) the quantification of the complex hybridization formed (in particular by qPCR). In a also preferred embodiment, the method for detecting or identifying the presence of an L. pneumophila Sgl bacterium according to the invention is characterized in that it comprises a step of prior filtration of the sample in order to increase the concentration of bacteria present in the initial sample.

In another variant, the method for detecting or identifying the presence of an L. pneumophila Sgl bacterium according to the invention is characterized in that it comprises a step of highlighting said sequence of a conserved region. of the wzm gene, or its complementary sequence, by in situ hybridization with labeled specific probes, in particular by Fluorescent In Situ Hybridization (FISH) analysis using fluorescently labeled probes.

Thus, the subject of the invention is also a method for detecting and / or identifying the presence of an L. pneumophila Sgl bacterium, characterized in that it comprises the following steps: a) contacting the Genomic DNA of said sample with a labeled nucleic acid probe capable of specifically hybridizing under standard hybridization conditions with said genomic DNA; and b) detecting the formation of a possible hybridization complex and, where appropriate, its quantification. Preferably, said labeled probe used for in situ hybridization, in particular for FISH analysis, in the process according to the invention is a probe chosen from among the following sequences: a) the sequence SEQ ID NO: 6, its complementary sequence or a fragment thereof having at least 15, preferably 20, 22, 25 or 30 consecutive nucleotides; or

b) a sequence comprising a sequence as defined in a) and capable of hybridizing specifically with the sequence of the targeted conserved wzm gene.

In another aspect, a subject of the invention is a method for detecting or identifying not only the presence of L. pneumophila Sgl bacteria but also the presence of L. pneumophila bacteria belonging to another serogroups (2- 14) using markers specific to these other groups. Thus, the subject of the invention is a method for detecting or identifying the serogroup of a Legionella pneumophila bacterium present in a sample, characterized in that it implements: a step of detection or identification of the presence a Legionella pneumophila serogroup 1 bacterium by a method according to the invention; and at least one other step of detecting or identifying the presence of a Legionella pneumophila bacterium from another serogroup, in particular selected from serogroups 6 and 12, 13, and, 10 and 14. Under another aspect, the invention also relates to a method for detecting the presence of L. pneumophila bacteria belonging to another serogroups than serogroup 1 selected from serogroups 6 and 12, 13, or, 10 and 14 using specific markers of these other groups as described below. Thus, the subject of the invention is a method for detecting or identifying the serogroup of a Legionella pneumophila bacterium present in a sample, characterized in that it implements at least one other step of detection or identification of the presence of a Legionella pneumophila bacterium of at least one serogroup selected from serogroups 6 and 12, 13, or, 10 and 14. In a particular embodiment, the method for detecting or identifying the presence of Legionella pneumophila serogroup 1 or the presence of Legionella pneumophila serogroups 6 or 12, 13, or 10 or 14 according to the invention is characterized in that: a) when the method of detection or identification comprises a step of amplification, the pair of primers used for the detection or identification of the

presence of a serogroup Legionella pneumophila bacterium selected from serogroups 6 and 12, 13, and 10 and 14 is: - the pair of primers of sequences P87 / P88 of sequences TGAAAATGGAGCCCTATTCTCTTAC (SEQ ID NO: 7) and TGGTTAAAAACTCTAAAGCCCATCTC (SEQ ID NO: 8) for the detection or identification of the presence of Legionella pneumophila serogroup 6 or 12 bacteria; the sequence pair P85 / P86 of sequences AAATGAAGAATTATATCACTCCGATGAG (SEQ ID NO: 9) and AATTTCCCTTTTTTAACCCAATGAG (SEQ ID NO: 10) for the detection or identification of the presence of a bacterium Legionella pneumophila of serogroup 10 or 14; and the primer pair of sequences P91 / P92 of sequences GCGAGATTAGAGTACGGCATTGA (SEQ ID NO: 11) and CATTACTTTCTACTACTAATAGATCAGCATTTCC (SEQ ID NO: 12) for the detection or identification of the presence of a bacterium Legionella pneumophila serogroup 13 and b) when the detection or identification process is carried out by in situ hybridization analysis, in particular by FISH, the probe used for the detection or identification of the presence of a serogroup Legionella pneumophila bacteria selected from serogroups 6 and 12, 13, and, 10 and 14 is a probe whose sequence is chosen from the following sequences: the sequence of the PCR product obtained by the pair of P87 / P88 sequence primers of SEQ ID NO: 7 and SEQ ID NO: 8 for the detection or identification of the presence of a Legionella pneumophila serogroup 6 or 12 bacterium, its complementary sequence, one of their fragments having at least 15, preferably 2 0, 22, 25 or 30 consecutive nucleotides or a sequence comprising one of these sequences; the sequence of the PCR product obtained by the pair of P85 / P86 sequence primers of SEQ ID NO: 9 and SEQ ID NO: 10 sequences for the detection or identification of the presence of a Legionella pneumophila serogroup bacterium 10 or 14, his sequence

complementary, one of their fragments having at least 15, preferably 20, 22, 25 or 30 consecutive nucleotides or a sequence comprising one of these sequences; and the sequence of the PCR product obtained by the pair of P91 / P92 sequence primers of SEQ ID NO: 11 and SEQ ID NO: 12 sequences for the detection or identification of the presence of a serogroup Legionella pneumophila bacterium. 13, its complementary sequence one of their fragments having at least 15, preferably 20, 22, 25 or 30 consecutive nucleotides or a sequence comprising one of these sequences.

The subject of the present invention is the following nucleic sequences, the use of at least one of these sequences or diagnostic kits comprising at least one of these following sequences as specific compounds for the detection or identification of the presence of Legionella pneumophila bacteria of serogroups 6 and 12; 13; and, 10 and 14: the pair of primers of sequences SEQ ID NO: 7 and SEQ ID NO: 8 for the detection or identification of the presence of a Legionella pneumophila serogroup 6 or 12 bacterium; and / or the pair of primers of SEQ ID NO: 9 and SEQ ID NO: 10 sequences for the detection or identification of the presence of a Legionella pneumophila serogroup 10 or 14 bacterium; and / or the pair of primers of SEQ ID NO: 11 and SEQ ID NO: 12 sequences for the detection or identification of the presence of a serogroup 13 Legionella pneumophila bacterium; and / or the probe having for sequence the sequence of the PCR product obtained by the pair of sequence primers SEQ ID NO: 7 and SEQ ID NO: 8 for the detection or identification of the presence of a bacterium Legionella pneumophila serogroup 6 or 12, its complementary sequence, one of their fragments having at least 15, preferably 20, 22, 25 or 30 consecutive nucleotides or a sequence comprising one of these sequences; the probe having for sequence the sequence of the PCR product obtained by the pair of primers of SEQ ID NO: 9 and SEQ ID NO: 10 sequences for the detection or identification of the presence of a Legionella pneumophila serogroup bacterium 10 or 14, its complementary sequence, one of their fragments having at least 15, of

preferably, 20, 22, 25 or 30 consecutive nucleotides or a sequence comprising one of these sequences; and the probe having, for sequence, the sequence of the PCR product obtained by the pair of primers of SEQ ID NO: 11 and SEQ ID NO: 12 sequences for the detection or identification of the presence of a Legionella pneumophila serogroup bacterium. 13, its complementary sequence, one of their fragments having at least 15, preferably 20, 22, 25 or 30 consecutive nucleotides or a sequence comprising one of these sequences.

In another aspect, a subject of the invention is a method for detecting or identifying not only the presence of L. pneumophila Sgl bacteria, serogroups 6 and 12, 13, or 10 and 14 but also the presence of Legionella longbeachae bacterium using markers specific for these bacteria. Thus, the subject of the invention is a method for detecting or identifying the serogroup of a bacterium Legionella pneumophila or a bacterium Legionella longbeachae present in a sample, characterized in that it uses: A) when the process detection or identification comprises an amplification step, a step of detection or identification of the presence of a Legionella pneumophila serogroup 1 bacterium or serogroups 6 and 12, 13, or, 10 and 14 by a method according to the invention; and a step of detecting or identifying the presence of a Legionella longbeachae comprising amplifying a DNA isolated from said sample using a pair selected from the following pairs of primers; The sequence pair P51 / P52 of sequences CTTGCTGACTTCTTCCTTAATTT (SEQ ID NO: 13) and GATTTCTTCGGGGTAGGGAT (SEQ ID NO: 14); the pair of primers of sequences P69 / P70 of sequences GCCATTTTCGTCGACATGCT (SEQ ID NO 15) and TCTTAATTATCTTGGCCGTTTCTTTT (SEQ ID NO: 16); and the sequence pair P73 / P74 of sequences CATGCTCATCATCTGGTTTACCTAA (SEQ ID NO: 17) and CCCGAGAGAAATACCCCGATA (SEQ ID NO: 18), the contacting of the amplified DNA with a nucleic probe, if appropriate Labeled, capable of hybridizing specifically under standard hybridization conditions with said amplified DNA, and, if appropriate, in that the probe selected is the sequence probe: - CGCATGCTCATCATCTGGTTTAC (SEQ ID NO: 19) ( probe Lgbl) when the chosen pair of primers is the pair of P69 / P70 sequence primers; and 10 - AAACGGCCAAGATAATTAAGAGTGTCCG (SEQ ID NO: 20) (Lgb2 probe) when the chosen pair of primers is the pair of P73 / P74 sequence primers, and B) when the detection or identification process is carried out by hybridization in situ, a step of detecting or identifying the presence of Legionella pneumophila serogroup 1 bacteria or serogroups 6 or 12, 13, or 10 or 14 by a method according to the invention; and a step of detecting or identifying the presence of Legionella longbeachae by in situ hybridization and whose probe used for the detection or identification of Legionella longbeachae is a probe whose sequence is chosen from the following sequences the sequence of the PCR product obtained by a pair chosen from the following pairs of primers; the sequence pair P51 / P52 of sequences SEQ ID NO: 13 and SEQ ID NO: 14; The pair of primers with P69 / P70 sequences of SEQ ID NO: 15 and SEQ ID NO: 16; and the sequence pair of P73 / P74 sequences of SEQ ID NO: 17 and SEQ ID NO: 18, in particular: the Lgbl probe of sequence SEQ ID NO: 19 when the chosen pair of primers is the pair of primers with P69 / P70 sequences, or the Lgb2 probe of sequence SEQ ID NO: 20 when the chosen pair of primers is the pair of P73 / P74 sequence primers; and 17

the complementary sequence of these probes, one of their fragments having at least 15, preferably 20, 22, 25 or 30 consecutive nucleotides or a sequence comprising one of these sequences. In another aspect, the subject of the present invention is the following nucleic sequences, the use of at least one of these sequences or diagnostic kits comprising at least one of these following sequences as specific compounds for the detection or the identification of the presence of a bacterium Legionella longbeachae present in a sample: the pair of primers of sequences SEQ ID NO: 13 and SEQ ID NO: 14; the pair of primers with sequences SEQ ID NO: 15 and SEQ ID NO: 16; the pair of primers with sequences SEQ ID NO: 17 and SEQ ID NO: 18; the probe having for sequence the sequence of the PCR product obtained by the pair of primers of sequences SEQ ID NO: 13 and SEQ ID NO: 14, its complementary sequence, one of their fragments having at least 15, preferably, 20, 22, 25 or 30 consecutive nucleotides or a sequence comprising one of these sequences; the probe having for sequence the sequence of the PCR product obtained by the pair of primers of sequences SEQ ID NO: 15 and SEQ ID NO: 16, its complementary sequence, one of their fragments having at least 15, preferably, 20, 22, 25 or 30 consecutive nucleotides or a sequence comprising one of these sequences; the probe having for sequence the sequence of the PCR product obtained by the pair of primers of sequences SEQ ID NO: 17 and SEQ ID NO: 18, its complementary sequence, one of their fragments having at least 15, preferably, 20, 22, 25 or 30 consecutive nucleotides or a sequence comprising one of these sequences; the probe having for sequence the sequence SEQ ID NO: 19 (Lgbl probe); and the probe having for sequence the sequence SEQ ID NO: 20 (Lgb2 probe).

In a preferred embodiment, the invention relates to a method for detecting or identifying the serogroup of a bacterium Legionella pneumophila, in particular serogroup 1, 6 or 12, 13, or, 10 or 14, and, where appropriate, optionally, of a bacterium Legionella longbeachae present in a sample according to the present invention, characterized in that in step a), the amplification of the isolated DNA is carried out by a multiplex PCR method in which the different pairs of primers necessary for

detection of selected serogroups of Legionella pneumophila, or, where appropriate, Legionella pneumophila bacteria, are contacted simultaneously with said DNA isolated from the sample. In a preferred embodiment, the subject of the invention is a method of detection or identification according to the invention, characterized in that the amplified DNA, where appropriate labeled, is brought into contact in step b). with a solid support on which are fixed the nucleic probes capable of hybridizing specifically under standard hybridization conditions with said amplified DNA.

In another aspect, a subject of the invention is a method for detecting or identifying the presence of L. pneumophila bacteria of at least one of the following serogroups Sg1, serogroups 6 or 12, 13, or 10 or 14 and, where appropriate, of Legionella longbeachae bacterium using markers or compounds specific for these bacteria according to the present invention, characterized in that it also comprises a step in which the presence or absence of the gene is demonstrated. mip (macrophage infectivity potentiator) by PCR, or by in situ hybridization (in particular by FISH) according to the technique used for the demonstration of the other markers. This mip marker is associated with the other markers as a positive marker for the presence of L. pneumophila bacteria.

The methods and molecular tools for identifying the presence of L. pneumophila by identifying the presence of the mip gene in a biological sample are well known to those skilled in the art and will not be developed here (by example but not limited to the sequence of the mip gene or its mRNA referenced in Genbank under the number NC 006368 from the strain of Paris Legionella pneumophila).

In another aspect, the present invention provides a diagnostic kit for the detection and / or identification of the presence of Legionella pneumophila serogroup 1 bacteria in a sample, characterized in that it comprises: a nucleic acid having for sequence the sequence of a conserved region of the wzm gene of sequence SEQ ID NO: 1, or the sequence of a conserved region of one of its variants, this conserved sequence preferably being chosen from sequences of the group consisting of: - the sequence of a fragment of at least 25 consecutive nucleotides, preferably at least 50, 75, 100, 200 and 250 consecutive nucleotides, of the sequence nt 99-392 of the 5 sequence SEQ ID NO: 1 or a variant thereof; the sequence of a fragment of at least 25 consecutive nucleotides, preferably at least 50 and 75 consecutive nucleotides, of the sequence nt 138-214 of the sequence SEQ ID NO: 1 or of one of its variants; and - their complementary sequence or their reverse sequence; and, where appropriate, b) - a solid support to which is attached one of these sequences as defined in a). Preferably, the diagnostic kit for the detection and / or identification of the presence of a Legionella pneumophila serogroup 1 bacterium in a sample is characterized in that it comprises: a pair of nucleic primer capable of amplifying the sequence of a conserved region of the wzm gene of sequence SEQ ID NO: 1 or of one of its variants, preferably chosen from the pairs of primers of the group consisting of: P1 (SEQ ID NO: 2) and P2 (SEQ ID NO: 3); and P65 (SEQ ID NO: 4) and P66 (SEQ ID NO: 5), and, if appropriate, a probe, optionally labeled, of SEQ ID NO: 6. The present invention also relates to a kit diagnostic system for the detection and / or identification of the serogroup of a bacterium Legionella pneumophila present in a sample, characterized in that it comprises: a) a kit according to the invention allowing the detection and / or identification of the presence of a serogroup 1 Legionella pneumophila bacterium in a sample, and b) 1) at least one pair of primers selected from the following pairs of primers: - the pair of primers of sequences P87 / P88 of sequences SEQ ID NO: 7 and SEQ ID NO: 8 for the detection or identification of the presence of Legionella pneumophila serogroup 6 or 12 bacteria; The pair of P85 / P86 sequence primers of SEQ ID NO: 9 and SEQ ID NO: 10 sequences for the detection or identification of the presence of a Legionella pneumophila serogroup 10 or 14 bacterium; and

the sequence pair P91 / P92 of sequences SEQ ID NO: 11 and SEQ ID NO: 12 for the detection or identification of the presence of a Legionella pneumophila serogroup 13 bacterium, or 2) at least one nucleic acid whose sequence is a sequence comprising or consisting of one of the PCR products amplified by a pair of primers as defined in b) 1), its complementary or reverse sequence, one of its fragments of at least 15 consecutive nucleotides preferably at least 20, 25, 50, 75, 100, 200 and 250 consecutive nucleotides, and, where appropriate, 3) a solid support to which is attached one of these sequences as defined in 2 ).

The present invention finally relates to a diagnostic kit for the detection and / or identification of the serogroup of a bacterium Legionella pneumophila and / or a bacterium Legionella longbeachae present in a sample, characterized in that it comprises: ) a kit as defined above according to the invention, and B) 1) at least one pair of primers chosen from the following pairs of primers: the pair of primers of sequences P51 / P52 of SEQ ID sequences NO: 13 and SEQ ID NO: 14; The sequence pair P69 / P70 of sequences SEQ ID NO: 15 and SEQ ID NO: 16; and the sequence pair P73 / P74 of sequences SEQ ID NO: 17 and SEQ ID NO: 18, or 2) - at least one nucleic acid whose sequence is a sequence comprising or consisting of one of the products PCR amplified by a pair of primers as defined in B) 1), its complementary or reverse sequence, one of their fragments of at least 15 consecutive nucleotides, preferably at least 20, 25, 50, 75, 100 , 200 and 250 consecutive nucleotides or a sequence comprising one of these sequences; or more preferably

at least one nucleic acid of sequence SEQ ID NO: 19 (Lgb1 probe) or SEQ ID NO: 20 (Lgb2 probe), its complementary or inverse sequence, and, where appropriate, 3) a solid support on which is fixed one of the sequences as defined in B) 2).

In another aspect, the invention provides a kit for detecting or identifying the presence of L. pneumophila bacteria of at least one of the following serogroups Sg1, serogroups 6 or 12, 13, or 10 or 14, and where appropriate, Legionella longbeachae bacterium using the kit of the invention comprising the specific markers of these bacteria according to the present invention, characterized in that it also comprises a pair of primers and / or a probe, which can to be labeled, specific for the mip gene.

Finally, the subject of the present invention is a nucleic primer chosen from the group of primers of sequences SEQ ID NOs. 2-5 and SEQ ID Nos. Preferably, the subject of the invention is a pair of primers chosen from the group of pairs of primers with the following sequences: a) SEQ ID NO: 2 and SEQ ID NO: 3; b) SEQ ID NO: 4 and SEQ ID NO: 5; c) SEQ ID NO: 7 and SEQ ID NO: 8; d) SEQ ID NO: 9 and SEQ ID NO: 10; e) SEQ ID NO: 11 and SEQ ID NO: 12; f) SEQ ID NO: 13 and SEQ ID NO: 14; g) SEQ ID NO: 15 and SEQ ID NO: 16; and h) SEQ ID NO: 17 and SEQ ID NO: 18. Also part of the invention are the nucleic probes chosen from the group of probes with SEQ ID NOs sequences. 6, 19 and 20, where appropriate marked.

Other features and advantages of the invention appear in the following description with the examples described below.

Example 1: Materials and Methods

I) Traditional PCR 1) Reagents used DNase-RNase Free 10X PCR Buffer II (Roche) water MgC12: 25mM solution (Roche) dNTP Set 100 mM (Roche): dilute the 4 dNTPs together at 10 mM AmpliTaq DNA Polymerase 5U / l ( Roche) 2) Primers used: (see Table 1) P2-P2 for L. pneumophila Sgl P51-P52 for L. longbeachae 3) Reaction mixture For a reaction of 50 l: Table 2: Final concentration for 50 l Water 32, 2 μl - Buffer 10x 5 μl 1 × MgCl 2 (25 mM) 4 μl 2 mM dNTP (10 mM) 1 μL 200 M Taq 0.3 μl 1.5 μ Primer F (10 μM) 3 μL 600 nM Primer R (10 μM) ) 3 gl 600 nM Distribute 48.5 g of mix per well.

Add 1.5 g of extracted DNA. 4) PCR program

94 ° C 1 min 94 ° C 30 sec 55 ° C 30 sec x 35 cycles 72 ° C 30 sec 72 ° C 4 min 4 ° C

II) Quantitative PCR 1) Reagents used DNase-RNase Water Free Taqman universal PCR master mix 2X (Applied Biosystems) Exogenous Internal Positive Control (Applied Biosystems) Primers and probes used P65-P66 for L. pneumophila Sgl with Sgl probe (FAM-BHQ1 - Eurogentec P69-70 for L. longbeachae with Lgbl probe (TET-BHQ1 - Eurogentec) (see Table 1 Primers and probes for sequences) Table 1: Sequences of primers and probes used Name Sequence Size Gene Specificity target amplicon P1 TTACCGCTTGCTTTTATGGA 294 WZM Legionella pneumophila P2 CCTATCAACGCTCTTGGAAA Sgl P51 CTTGCTGACTTCTTCCTTAATTT 433 11o3177 Legionella longbeachae GATTTCTTCGGGGTAGGGAT P52 P65 P66 CAAACACCCCAACCGTAATCA CAAAGGGCGTTACAGTCAAACC Legionella pneumophila probe 75 WZM Sgl TCTTGGGATTGGGTTGGGTTATTTTAACTCCT Sg1 P69 P70 TCTTAATTATCTTGGCCGTTTCTTTT GCCATTTTCGTCGACATGCT Legionella longbeachae probe 75 11o3177 LGBL CGCATGCTCATCATCTGGTTTAC P73 P74 CATGCTCATCATCTGGTTTACCTAA Legionella CCCGAGAGAA ATACCCCGATA 75 11o3177 longbeachae probe LGB2 AAACGGCCAAGATAATTAAGAGTGTCCG P95 TGTAATGCTGCTACGCGGTTT Legionella P96 GCATTCCCCGCTGCAA 75 cyoB pneumophila Sg1 strain probe CAGATGCACTCTTAATGCGCTCTCAACAAG Paris Pari s2 P85 AAATGAAGAATTATATCACTCCGATGAG 84 cds013 sg 10 sg 14 P86 AATTTCCCTTTTTTAACCCAATGAG P91 GCGAGATTAGAGTACGGCATTGA 85 cds012 sg 13 P92 CATTACTTTCTACTACTAATAGATCAGCATTTCC P87 TGAAAATGGAGCCCTATTCTCTTAC 74 cds024 sg 6 and sg 12 P88 TGGTTAAAAACTCTAAAGCCCATCTC 25) Reaction mixture For a reaction of 20 gl:

PremixConcentration Final in 5.6 gl 10 Primer Forward (100 M) 0.16 gl 2.86 M Primer Reverse (100 M) 0.16 gl 2.86 M Probe (20 M) 0.20 gl 0.71 M Water 5.08 l - Mix Final Concentration in 20 μl Taqman mix 2X 10 μl 1x IPC mix lOX 2 μl IPC DNA 50X 0.4 μl 1 x premix 5.6 gl primers: 800 nM probe: 200 nM Distribute 18 μl of mix per ml well. Add 2 g of extracted DNA. PCR program

50 ° C 2 min 95 ° C 10 min 95 ° C 15 sec 60 ° C 1 min x 40 cycles III) Matrix Constructs The Legionella biodiversity chip was designed with a focus on genes that are variable among the three strains. For all of these genes, we have designed internal probes in the range of 151 to 600 bp. Genes less than 150 bp were thus excluded and only one probe was conserved for the redundant genes and for the different families of insertion sequences. According to these criteria, 1303 probes were dumped on the Legionella biodiversity chip, including 324, 242 and 227 which were respectively specific for the Paris, Lens and Philadelphia strains. 59 probes are common to strains Paris and Lens but

absent in the Philadelphia strain, 62 are common to the Paris and Philadelphia strains and 24 are common to the Lens and Philadelphia strains but absent in the Paris strain. Finally, 142 probes were added corresponding to known and possible virulence factors (for example, genes coding for type I, II and IV secretion systems and some of their effectors, flagellar genes, type genes). eukaryotic, ...), 31 genes forming a group required for the synthesis of lipopolysaccharides (Luneberg et al., 2000), 30 genes constituting an unstable genetic element responsible for the phase variation of lipopolysaccharides in the Olda strain, 148 specific ORFs of L. longbeachae identified during partial sequencing and 14 control genes. Internal PCR fragments for the genes common to the Paris and Lens strains or common to the Paris and Philadelphia strains were amplified with the genomic DNA of the Paris strain and those common to the Lens and Philadelphia strains were amplified with the genomic DNA of the Lens strain. Primers were designed using a modified version of Primer 3 software (CAATbox (Frangeul et al., 2004)) to amplify a specific fragment of 151 to 600 bp for each gene (melting temperatures were 55 to 65 ° C) (Eurogentec). Three amplification reactions were performed for each probe in a 100 l reaction volume containing 6 ng of chromosomal DNA. The concentration and size of each PCR product were checked on agarose gels. For the preparation of the chips, nylon membranes (Qfilter, Genetix) were soaked in a solution of TE (10 mM Tris, pH: 7, 1 mM EDTA, pH 7.6). Spot blots of pCR products and controls were made by a Qpix robot (Genetix). After the deposition of the spots, the membranes were fixed for 15 min in 0.5 M NaOH-1.5 M NaCl, washed briefly in distilled water, fixed a second time for 1 min under UV and stored wet at room temperature. -20 ° C until use. For verification of the specificity and quality of the macropuce, 70% of all PCR products were randomly selected and sequenced. All 960 sequences corresponded to the expected PCR products. The membrane was then hybridized with the chromosomal DNAs isolated from the three strains of Legionella used to amplify the probes (L. pneumophila Paris, L. pneumophila Lens and L. pneumophila Philadelphia) in order to test the quality and the correct deposit of the probes.

IV) Matrix Hybridization Genomic DNA was extracted using the phenol / chloroform technique and radiolabeled using a random primed DNA labeling kit (Roche). Labeling was performed with 200 ng of genomic DNA and 50 Ci of 33 P-labeled dCTP (Amersham). The labeled DNA was purified using Qiaquick microcolumns (Qiagen). High density chips were wetted in 2X SSC (1X SSC consists of 0.15M NaCl plus 0.015M sodium citrate) and prehybridized for 1h in 10ml of a hybridization solution containing 10% SSC. SSPE 5X (1X SSPE consists of 0.18 M NaCl, 10 mM NaH2PO4 and 1 mM EDTA, pH 7.7), 2% sodium dodecyl sulfate, 1M Denhardt solution (the solution Denhardt 50X consists of 1% Ficoll, 1% polyvinylpyrrolidone and 1% bovine serum albumin), and 1 mg of denatured salmon sperm DNA. Hybridization was performed overnight at 60 ° C in 5m1 of hybridization solution mixed with the purified labeled DNA. The membranes were washed twice at room temperature and twice at 60 ° C in 0.5% SSPE-0.2% sodium dodecyl sulfate. The chips were then sealed in polypropylene bags and exposed to a phosphorimager screen (Molecular Dynamics) for 48 hours. For reading, a model Typhoon 9400 imager (Amersham Biosciences) was used. The chips were then dehybridized using 0.5 N NaOH for 30 min for another use.

V) Matrix Analysis ArrayVision (Imaging Research) software was used for quantification of hybridization intensities. The value of the hybridization intensity of each deposit was normalized by dividing by the median of all significant intensity values on each filter. For the calculation of the ratios, a reference chip was used, which was constructed by combining the averaged data from four replicates of genomic DNA hybridization of L. pneumophila Paris, L. pneumophila Lens, L. pneumophila Philadelphia L. longbeachae 99013058 and L. pneumophila Olda RC1 strain corresponding deposits on the chip. In order to define the threshold value of the ratio for the presence of a gene, we analyzed the results for L. pneumophila Paris genes hybridized with the chromosomal DNA of L. pneumophila Lens and

Philadelphia (and similarly, the L. pneumophila Lens genes hybridized with the chromosomal DNA of L. pneumophila Paris and Philadelphia, the L. pneumophila Philadelphia genes hybridized with the chromosomal DNA of L. pneumophila Paris and Lens) . The data were then converted to binary scores (for ratios> 0.3, the gene score was present [1], and for ratios <0.3, the gene score was absent [0]) (http: //www.pasteur.fr/recherche/unites/gmp/sitegmp/gmpprojects.html). This corresponds to a DNA similarity of 80%, which verified by comparisons of the sequences of these genes for the three genomes. The binary data was analyzed by hierarchical classification with the J-Express program (Dysvik & Jonassen, 2001) and by an expert intensive data mining with Excel spreadsheets.

VI) References of Legionella strains tested n ° species strain 1 L pneumophila 1 Paris 2 L pneumophila 1 Lens 3 L pneumophila 1 Philadelphia 4 L pneumophila 1 Corby 5 L longbeachae NSW150 6 L pneumophila 15 ATCC 35251 7 L pneumophila 1 Lorraine 8 L Pneumophila ATCC 33154 / CIP 103856 Pneumophila ATCC 33155 / CIP 103857 Pneumophila ATCC 33156 / CIP 103858 Pneumophila ATCC 33216 / CIP 103859 Pneumophila ATCC 33737 / CIP 105570 Pneumophila ATCC 33215 CIP 103860 14 L pneumophila 7 ATCC 33823 / CIP 103861 L pneumophila 8 ATCC 35096 / CIP 103862 16 L pneumophila 9 ATCC 35289 / CIP 103863 17 L pneumophila 10 ATCC 43283 / CIP 103864 18 L pneumophila 11 ATCC 43130 / CIP 103865 19 L pneumophila 12 ATCC 43290 / CIP 103866 L pneumophila 13 ATCC 43736 / CIP 103867 21 L pneumonia ATCC 43703 / CIP 103869 22 L pneumophila 14 CIP 103868 23 L anisa ATCC 35292 / CIP 103870 24 L hackeliae ATCC 33250 L micdadei ATCC 33218 26 L sainthelensi ATCC 35248 / CIP 103885 27 L pneumophila 2 HL 0431 5028 29 28 L pneumophila 3 HL 0412 5002 29 L pneumophila 3 HL 0240 3022 30 L pneumophila 4 HL 0451 4011 31 L pneumophila 5 HL 0115 5003 32 L pneumophila 6 HL 0501 3047 33 L pneumophila 7 HL 0242 4004 34 L pneumophila 8 HL 0448 3060 35 L pneumophila 9 HL 0231 3045 36 L pneumophila 10 HL 0441 2051 37 L pneumophila 12 HL 0243 5007 38 Pneumophila 10-13 HL 0317 2047 39 L pneumophila 14 HL 0229 2025 40 L pneumophila 15 HL 0231 1002 41 L anisa HL 0403 3042 42 L Parisiensis AWA 43 L bozemanii ABU 44 L longbeachae 0422 4010 45 L micdadei 93 011 936 46 L gormanii ATCC 33297 47 L jordanis ATCC 33623 48 L erythra ATCC 35303 49 L rubrilucens ATCC 35304 50 L quinlivanii ATCC 43830 51 L moravica ATCC 43877 52 L tusconensis HL 0239 1038 53 L dumoffii ATCC 33279 54 L taurinensis HL 0424 3060 55 Pneumophila Clin. 1 HL 0230 4015 / Paris 56 Pneumophila C 1 HL 0337 4008 57 Pneumophila C 1 HL 0229 5045 58 Pneumophila C 1 HL 0353 2056 59 L pneumophila Env. 1 HL 0229 2010 60 L pneumophila C 1 HL 0045 1020 / Paris 61 L pneumophila C 1 HL 0325 1041 62 L pneumophila C 1 Los Angeles 63 L pneumophila C 1 HL 0329 2037 64 L pneumophila C 1 HL 0334 2029 65 L pneumophila C 1 HL 0239 5039 66 L pneumophila C 1 HL 0228 2021 / Paris 67 L pneumophila C 1 HL 0213 2010 / Paris 68 L pneumophila C 1 94012433 / Paris 69 L pneumophila C 1 HL 0125 3028 70 L pneumophila C 1 HL 0143 5019 71 L pneumophila Pneumophila C 1 HL 0228 5003 Pneumophila C 1 HL 0335 1001 78 L pneumophila C 1 HL 0335 2012 79 L pneumophila C 1 HL 0407 3054 30 80 L pneumophila C HL 0407 5055 81 L pneumophila C HL 0406 2033 82 L pneumophila C HL 0415 5001 83 L pneumophila C HL 0427 1029 84 L pneumophila C HL 0406 3005 85 L oakridgensis ATCC 33761 / CIP 103884 86 L jamestowniensis ATCC 35298 / CIP 103845 87 L lansingensis ATCC 49751 / CIP 103542 88 L gresilensis ATCC 700509 / CIP 106631 89 L cincinnatiensis ATCC 43753 / CIP 103875 90 L birgminghamensis ATCC 43702 / CIP 103871 91 L beliardensis ATCC 700512 / CIP 106632 92 L gratia ATCC 49413 / CIP 105267 93 L longbeachae C4E7 94 L longbeachae 98073 95 L longbeachae 98072 96 L wadsworthii ATCC 33877 / CIP 103886 97 L longbeachae sgl Aust 0425018 98 L longbeachae sg2 Aust 04275008 99 L longbeachae ATCC 33462 100 Longbeachae 3472019 101 Serratia marcescens 504 102 Ser. marcescens 81 103 Ser. marcescens 296 104 Ser. odorifica 1073 105 Ser. fonticola 78 645 106 Ser. fonticola 3965 107 Ser. fonticola 5680 (22) 108 Ser. proteamaculans Ra 1403 109 Ser. proteamaculans C1C 3630 110 Ser. proteamaculans EB 3706 111 Ser. liquefaciens 27592 112 Ser. liquefaciens 866 113 Ser. liquefaciens 507 114 Ser. rubidea 288 115 Ser. Entomophila Al 116 Ser. entomophila 222 117 Ser. entomophila A15 118 Ser. grimesi 390 119 Ser. grimesi 503 120 Ser. ficaria 4024 121 Ser. ficaria 5602 122 Ser. Plymuthica 510 123 Acinetobacter Iwoffii 64 105 124 Pseudomonas putida 2066 type 125 L feeleii CIP 103877 126 T (ex L.) maceachernii CIP 103846 127 Sten. maltophila CIP 60.77 128 Alkali. faecalis CIP 60.80 129 Entero. aerogenes CIP 60.86 130 Aerom. hydrophila CIP 76.14 131 Buckhold. cepacia CIP 80.24 31 132 Klebsiella oxytoca CIP 103434 133 Proteus vulgaris CIP 104989 134 Xanthom. campestris CIP 100069 135 Username. aeruginosa CIP 100720 136 Pseudo. fluorescens CIP 69.13 137 L pneumophila Garches Hospital Legio418 1993 Rebillat 138 L pneumophila Gario Hospital Legio467 1996 Gelin 139 L pneumophila Lp21 140 L pneumophila Lp22 141 L pneumophila Lp23 142 L pneumophila 205409997 143 L pneumophila L3415 / 03 144 L pneumophila Wien 43-2 145 L Pneumophila Wien 47-14 146 Pneumophila USA 2735 147 Pneumophila USA 2733 148 Pneumophila L40 / 04 Pneumophila L2546 / 04 150 Pneumophila L3386 / 03 151 Pneumophila L03-610 Pneumophila L00-549 153 Pneumophila NIIB80 154 Pneumophila NIIB83 155 L Pneumophila NIIB121 156 Pneumophila NIIB122 157 Pneumophila NIIB124 158 Pneumophila NIIB182 159 Pneumophila NIIB217 160 Pneumophila NIIB223 161 Pneumophila NIIB224 162 Pneumophila NIIB225 163 Pneumophila NIIB226 164 Pneumophila NIIB228 165 Pneumophila HL 0232 4052 166 L pneumophila EUL 1 167 L pneumophila 0051 4008 168 L pneumophila HL 0036 4001 169 L pneumophila 0102 3035 170 L pneumophila 2001 No. 5 171 L pneumophil Pneumophila 0230 4020 Pneumophila 0230 4017 Pneumophila 0230 4017 Pneumophila pneumonia Pneumococcal pneumoniae pneumoniae pneumoniae pneumoniae pneumoniae pneumoniae pneumoniae pneumoniae pneumoniae pneumoniae pneumoniae pneumoniae pneumophila HL 0232 4052 180 L pneumophila HL 0337 3012 L pneumophila 1 HL 0703 4031 L pneumophila 1 HL 0707 3023 32 L pneumophila 1 HL 0710 3003 L pneumophila 1 LG 0713 5007 L pneumophila 1 LG 0714 4020 L pneumophila 1 LG 0714 4021 L pneumophila 1 LG 0715 2033 L pneumophila 1 LG 0715 5017 L pneumophila 1 LG 0717 5024 L pneumophila 1 LG 0721 5015 L pneumophila 1 LG 0727 5019 L pneumophila 1 LG 0728 2018 L pneumophila 1 LG 0728 5012 L pneumophila 1 LG 0729 5027 L pneumophila 1 LG 0730 3035 L pneumophila 1 LG 0730 4014 L pneumophila 1 LG 0730 5015 L pneumophila 1 LG 0730 5022 L pneumophila 1 LG 0737 5010 L pneumophila 1 LG 0739 3021 L pneumophila 1 LG 0739 3030 L pneumophila 1 LG 0740 3023 L pneumophila 1 LG 0740 3025 L pneumophila 1 L G 0740 3030 L pneumophila 1 LG 0740 3040 L pneumophila 1 LG 0740 4032 L pneumophila 1 LG 0741 3023 L pneumophila 1 LG 0741 4005 L pneumophila 1 LG 0743 5011 L pneumophila 1 LG 0745 2029 L pneumophila 1 LG 0746 3013 L pneumophila 1 LG 0750 4007 L pneumophila 1 LG 0801 5025 L pneumophila 1 LG 0802 3014 L pneumophila 1 LG 0807 2022 L pneumophila 1 LG 0807 5006 L pneumophila 1 LG 0809 2007 L pneumophila 1 LG 0809 3020 L pneumophila 1 LG 0809 4031 L pneumophila 1 LG 0811 1019 L pneumophila 2 LG 0729 1025 L pneumophila 2 LG 0742 5016 L pneumophila 2 LG 0746 1024 L pneumophila 2 LG 0802 1026 L pneumophila 2 LG 0811 3024 L pneumophila 3 HL 0707 5006 L pneumophila 3 HL 0709 2032 L pneumophila 3 LG 0716 5013 L pneumophila 3 LG 0725 2014 L pneumophila 3 LG 0738 3022 L pneumophila 3 LG 0745 4014 L pneumophila 3 LG 0747 3015 L pneumophila 3 LG 0750 4006 L pneumophila 3 LG 0805 3021 33 L pneumophila 3 LG 0808 2012 L pneumophila 3 LG 0809 4032 L pneumophila 4 HL 0707 5003 L pneumophila 4 LG 0725 4012 L pneumophila 4 LG 0727 5028 L pneumophila 4 LG 0730 5029 L pneumophila 4 LG 0731 5015 L pneumophila 4 LG 0745 2031 L pneumophila 5 LG 0711 4031 L pneumophila 5 LG 0723 3010 L pneumophila 5 LG 0730 3031 L pneumophila 5 LG 0732 1015 L pneumophila 5 LG 0736 4010 L pneumophila 5 LG 0740 3022 L pneumophila 6 HL 0615 1027 L pneumophila 6 HL 0616 5016 L pneumophila 6 HL 0623 5029 L pneumophila 6 HL 0625 1032 L pneumophila 6 HL 0626 2016 L pneumophila 6 HL 0626 2016 L pneumophila 6 HL 0626 3024 L pneumophila 6 HL 0628 4026 L pneumophila 6 HL 0635 5002 L pneumophila 6 HL 0637 5020 L pneumophila 6 HL 0639 5022 L pneumophila 6 HL 0642 5016 L pneumophila 6 HL 0643 1025 L pneumophila 6 HL 0646 5013 L pneumophila 6 HL 0647 3004 Pneumophila 6 HL 0648 1013 Pneumophila 6 HL 0650 3003 Pneumophila 6 HL 0705 1028 Pneumophila 6 HL 0706 2011 Pneumophila 6 HL 0707 1017 Pneumophila 6 HL 0707 5047 Pneumophila 6 LG 0725 2016 Pneumophila 6 LG 0729 1030 Pneumophila 6 LG 0729 5019 L pneumophila 6 LG 0733 4011 L pneumophila 6 LG 0736 4008 L pneumophila 6 LG 0737 5022 L pneumophila 6 LG 0740 3021 L pneumophila 6 LG 0748 1030 L pneumophila 6 LG 0750 2011 L pneumophila 6 LG 0806 2019 Pneumophila 6 LG 0807 5012 L pneumophila 6 LG 0808 3025 L pneumophila 6 LG 0810 5014 L pneumophila 7 HL 0605 4003 L pneumophila 7 HL 0611 1002 L pneumophila 7 HL 0615 4008 L pneumophila 8 HL 0703 1023 L pneumophila L pneumophila L pneumophila L pneumophila L pneumophila L pneumophila L pneumophila L pneumophila L pneumophila Pneumophila Pneumophila Pneumophila Pneumophila Pneumophila Pneumophila Pneumophila Pneumophila Pneumophila Pneumophila Pneumophila Pneumophila Pneumophila Pneumophila Pneumophila Pneumophila Pneumophila Pneumophila Pneumophila Pneumophila L pneumophila L pneumophila L pneumophila L pneumophila L pneumophila L pneumophila L pneumophila L pneumophila Pneumophila pneumophila Pneumophila Pneumophila Pneumophila Pneumophila Pneumophila Pneumophila Pneumophila Pneumophila Pneumophila Pneumophila Pneumophila Pneumophila Pneumophila Pneumophila Pneumophila Pneumophila Pneumococcal Protein Protein 2021 12 LG 0723 1018 12 LG 0740 4025 12 LG 0807 2016 14 LG 0739 2049 14 LG 0745 3016 LG 0738 2088 Strains EWGLI LE 1 - EUL 31 THE 2 - EUL 56 THE 3 - EUL 22 THE 4 - EUL 66 THE 5 - EUL 61 THE 6 - EUL 75 THE 7 - EUL 26 THE 9 - EUL 18 THE 12 - EUL 13 THE 13 THE 14 THE 16 THE 20 - EUL 30 THE 22 THE 24-EUL47 THE 25 - EUL 51 THE 27 - EUL 17 THE 28 - EUL 27 THE 30 THE 31 - EUL 7 THE 33 THE 36 - EUL 14 THE 37 - EUL 78 THE 38 - EUL 106 THE 39 - EUL 74 THE 40 THE 42 - EUL 79 THE 43 - EUL 121 THE 44-EUL71 THE 45 - EUL 72 THE 47 - EUL 73 THE 48 - EUL 16 THE 49 - EUL 67 THE 50 THE 51 - EUL 25 THE 52 - EUL 62 L pneumophila L pneumophila L pneumophila L pneumophila L pneumophila L pneumophila L pneumophila L pneumophila L pneumophila L pneumophila L pneumoph pneumophila L pneumophila L pneumophila L pneumophila L pneumophila L pneumophila L pneumophila L pneumophila L pneumophila L pneumophila L pneumophila L pneumophila L pneumophila L pneumophila L pneumophila L pneumophila L pneumophila L pneumophila pneumophila L pneumophila L pneumophila L pneumophila L pneumophila L pneumophila L pneumophila L pneumophila L pneumophila L pneumophila L pneumophila L pneumophila L pneumophila LE 53 - EUL 6 THE 54 - EUL 64 THE 55 - EUL 95 THE 56 - EUL 54 THE 57 THE 58 - EUL 1 THE 59 - EUL 55 THE 60 THE 64 THE 65 THE 66 - EUL 29 THE 68 - EUL 50 THE 69 - EUL 63 ILE70-EUL32 THE 72 - EUL 52 THE 73 - EUL 53 THE 75-EUL4 THE 77 - EUL 77 THE 78 - EUL 69 THE 80 - EUL 3 THE 81 - EUL 46 THE 82 - EUL 76 THE 83 - EUL 68 THE 84 - EUL 44 THE 85 - EUL 2 THE 87 - EUL 94 THE 88 - EUL 57 THE 89 - EUL 58 THE 90 THE 91 THE 92 THE 93 THE 94 THE 95 - EUL 45 THE 98 THE 99 - EUL 70 THE 100 - EUL 28 THE 101 - EUL 108 NC1 NC 2 NC3 NC4 NC5 NC6 NC7 NC8 NC9 NC10 NC11 NC12 NC13 36 14 L pneumophila 1 NC14 15 L pneumophila 1 NC15 16 L pneumophila 1 NC16 17 L pneumophila 1 NC17 18 L pneumophila 1 NC18 19 L pneumophila 1 NC19 20 L pneumophila 1 NC20 21 L pneumophila 1 NC21 22 L pneumophila 1 NC22 23 L pneumophila 1 NC23 24 L pneumophila 1 NC24 25 L pneumophila 1 NC25 26 L pneumophila 1 NC26 27 L pneumophila 1 NC27 28 L pneumophila 1 NC28 29 L pneumophila 1 NC29 30 L pneumophila 1 NC30 31 L pneumophila 1 NC31 32 L pneumophila 1 NC32 33 L pneumophila 1 NC33 34 L pneumophila 1 NC34 35 L pneumophila 1 NC35 36 L pneumophila 1 NC36 37 L pneumophila 1 NC37 38 L pneumophila 1 NC38 39 L pneumophila 1 NC39 40 L pneumophila 1 NC40 41 L pneumophila 1 NC41 42 L pneumophila 1 NC42 43 L pneumophila 1 NC43 44 L pneumophila 1 NC44 45 L pneumophila 1 NC45 46 L pneumophila 1 NC46 47 L pneumophila 1 NC47 48 L pneumophila 1 NC48 49 L pneumophila 1 NC49 50 L pneumophila 2-14 NC50 51 L pneumophila 2-14 NC51 52 L pneumophila 2-14 NC52 53 Pneumophila 2-14 NC53 54 Pneumophila 2-14 NC54 55 Pneumophila 2-14 NC55 56 Pneumophila 2-14 NC56 57 Pneumophila 2-14 NC57 58 Pneumophila 2-14 NC58 59 Pneumophila 2-14 NC59 60 L pneumophila 2-14 NC60 61 L pneumophila 2-14 NC61 62 L pneumophila 2-14 NC62 63 L pneumophila 2-14 NC63 64 L pneumophila 2-14 NC64 65 L pneumophila 2-14 NC65 37 66 L pneumophila 2-14 NC66 67 L pneumophila 2-14 NC67 68 L pneumophila 2-14 NC68 69 L pneumophila 2-14 NC69 70 L pneumophila 2-14 NC70 71 L pneumophila 2-14 NC71 72 L pneumophila 2-14 NC72 73 Legionella spp. NC72 74 Legionella spp. NC73 75 Legionella spp. NC74 Example 2: Identification of a gene specific to all serogroup 1 strains of Legionella pneumophila The inventors undertook a study of the biodiversity of the genus Legionella by determining and comparing four complete sequences. Three of Lp Sg 1 [Paris, Lens strain and Philadelphia-1 (5, 6)] and a partial sequence of an L. longbeachae isolate being sequenced. Based on these four sequences, a DNA chip was designed and constructed bearing 1303 probes. This chip was hybridized with the genomic DNA of 248 strains of the genus Legionella: 152 Lp Sgl, 64 Lp Sg2-15, 32 Legionella sp. (14 species of the genus Legionella). The results of this study show that the genes encoding the proteins involved in lipopolysaccharide biosynthesis (LPS) are the only ones that have the power to discriminate the different Sg of Lp. Among them, we identified 3 genes present in all strains of Sgl and specific to them (wzm, wzt, lppO831). In addition, three other genes (lppO836, lppO843, lppO827) are also present in all Sgl strains whereas they are present in only one to three non-Sgl strains out of 248 strains tested. Finally, the 1pp0832 gene is specific for Sgl strains and appears to be lacking only in two strains of Sgl. In addition, we identified several genes specific to the Paris strain, a strain found worldwide in cases of human legionellosis. The region carrying the genes lpp0068-lpp0080 is specific to strain Paris. It has been shown here that the cyoABC operon (lppO291-lppO297), the 1pp2111-1pp2125 region and the lppO779 coding for an auto transporter are specific for Sgl Paris strains with one exception (Cazalet et al., 2008, Genome Res. ).

The inventors have therefore defined sets of primers and tested their effectiveness (sensitivity) and specificity by a concordance study between PCR and method of

reference (culture and serotyping). By comparing the sequences of the three Sgl specific genes (wzm, wzt, lpp0831) in the 4 fully sequenced Lp Sg1 strains (Paris, Lens, Philadelphia-1, current Corby, IP and German teams) we were able to define the most conserved regions. We tested 4 primer pairs for each gene and tested them for their specificity and efficacy on a collection of 464 strains. 424 strains belonging to the genera Legionella and 40 usually present in water (species chosen according to AFNOR Standard XP T90-471). The test of each set of primers was performed and as a positive control, a specific amplification of the mip gene (specific to the genus Legionella) was used.

This allowed us to choose specific primers for Sgl.

Current laboratory studies of LPS-specific cluster sequencing in different serogroups of L. pneumophila aim to define serogroup-specific genes that can be used to develop PCR assays for the identification of each serogroup. To date we have sequenced the regions carrying the genes encoding the proteins involved in the LPS biosynthesis of Sg 6, 10, 12, 13 and 14. The sequencing of this region in the strain of Sg 3 (the third Sg involved in the human disease) is ongoing. Thus, the determination of the specific primers of these other SGs was made and their specificity was tested in the same way as for Sgl. We have also sequenced the genome of a strain of L. longbeachae, the second leading cause of human legionellosis in the world, particularly in Oceania. The analyzes show that the genes encoding L. longbeachae LPS are very different from those of Lp. We have also defined specific primers and we have tested them, to develop a universal test grouping the main legionella pathogens.

Example 3: Quantitative PCR with primers P65-P66 (specific Sgl) Results Quantity Quantity Tested theoretical DNA Ct Estimated average Ct (UG) (UG) Estimation of the detection limit y = -2.8117392x + 35.852413; r2 = 0.998 25,000 23.56 25,000 23.45 23.48 25 135 25,000 23.43 2,500 26.15 2,500 25.83 26.05 3,064 2,500 26.17 250 29.18 250 29 52 29.39 199 250 29.46 25 32.63 L. pneumophila 25 32.67 32.72 13 Sgl Philadelphia 25 32.86 15 32.80 15 33.30 33.25 8 15 33.66 35.09 5 34,11 34,87 2 5 35,42 2,5 35,85 2,5 36,26 36,06 1 2,5 ND White 0,0 ND ND First negative result for 2,5UG: detection limit between 2 , 5 and 5 MU Estimated limit of quantification y = -3,3054514x + 38,245598; r2 = 0.999 25 33.15 25 34.10 25 33.61 25 33.52 25 35.41 33.62 25 25 33.65 25 33.30 25 33.19 25 34.33 25 35.03 34.95 35.26 8 L. pneumophila Sgl Philadelphia 40 10 35.23 10 33.82 10 35.06 10 36.90 10 34.77 10 34.77 10 36.91 10 35.63 10 34.55 White 0.0 ND ND Results on different strains of ss 1 y = -3.188165x + 42.18248; r2 = 0.993 L. pneumophila Sgi 25 000 28.11 strain Paris 25 000 27.80 27.95 29 188 25 000 27.93 L. pneumophila Sgi 25 000 27.47 environmental 25 000 27.55 27.51 39 914 n 59 (HL02292010) 25,000 27.52 White 0 ND ND y = -3.0301416x + 41.322914; r2 = 0.986 2 500 30.99 2 500 31.12 31.02 2 506 L. pneumophila Sgi 2500 30.96 strain Paris 25 36.52 25 38.48 37.67 17 25 38.01 2500 30.91 2,500 30.78 30.85 2,859 L. pneumophila Sgi 2,500 30.86 strain Lens 25 38.38 25 36.68 37.08 25 25 36.18 2 500 32.05 2500 31.94 31.97 1 218 L. pneumophila Sgi 2500 31.93 Corby strain 25 39.29 25 37.97 38.38 9 25 37.87 L. pneumophila Sgi 2500 29.49 CNR1-A1 2500 29.85 29.74 6 629 (HL07073023) 2,500 29.89 L. pneumophila Sgi 2,500 28.97 CNR1-B1 2,500 29.09 29.05 11,256 (HL07034031) 2,500 29.08 L. pneumonia Sgi 2,500 27.15 CNR1- C1 2,500 27.36 27.25 43,975 (HL07103003) 2,500 27.25 41 L. pneumonia Sgi 2,500 29.50 CNR1-D1 2,500 29.88 29.72 6,748 (LGO8015025) 2,500 29.78 L. pneumophila Sgi 2,500 28,74 CNR1-G1 2,500 28.70 28.75 14,138 (LG08075006) 2,500 28.80 L. pneumophila Sgi 2,500 27.80 CNR1-C2 2,500 28.13 28.02 24,496 (LG08111019) 2,500 28.14 L. pneumophila Sgi 2,500 29,11 CNR1-E3 2,500 29,16 29,16 10,301 (LG07285012) 2,500 29,22 ND White 0 ND y = -2,1367867x 33, 91827; r2 = 0.964 L. pneumonia Sgi 2500 25.96 CNR1-B1 after purif. 25,82 6,165 Before purifying : 11,256 (HL07034031) 2500 25.68 L. pneumophila Sgi 2500 26.18 CNR1-C1 after purif. 26,23 3,963 Before purifying. : 43 975 (HL07103003) 2500 26.28 L. pneumophila Sgi 2500 25.30 CNR1-G1 after purif. 25,26 11,333 Before purifying. : 14,138 (LG08075006) 2500 25.21 L. pneumophila Sgi 2500 25.51 CNR1-C2 after purif. 25,64 7,525 Before purifying. : 24,496 (LG08111019) 2,500 25.76 L. pneumonia Sgi 2500 25.99 CNR1-E3 after purif. 25.94 5 417 Before purifying. : 10 301 (LG07285012) 2,500 25.89 ND White 0 ND y = -2.8159485x + 39.023796; r2 = 0.998 2 500 28.40 2 500 28.49 28.46 5 626 L. pneumophila Sgi 2500 28.50 No. 165 25 34.03 (HL02324052) 25 33.43 34.08 57 25 34.77 2 500 27.53 2500 27.14 27.34 14 136 L. pneumonia Sgi 2500 27.34 No. 166 (EUL1) 25 31.77 25 32.24 32.11 325 25 32.32 L. pneumonia Sgi 2 500 26.08 26.07 39,934 No. 167 (00514008) 2,500 26.08 2,500 26.04 25 30.44 25 30.31 30.35 1 203 25 30.30 White 0 0 ND -

Results on DNA mixtures sgl and non-y = -3.3251033x + 38.06712; r2 = 0.996 L.pneumophila Sgi 2500 27.82 Philadelphia 2500 27.98 27.83 1 199 + water 2500 27.69 L.pneumophila Sgi 2500 27.79 Philadelphia 2500 27.71 27.77 1 247 + 25,000 UG Lp sg6 2,500 27.82 L. pneumophila Sgi 2,500 27.84 Philadelphia + 25 2,500 27.40 27.80 1,227,000 UG L.longb. 2,500 28.15 White 0 37.38 37.38 1.6 Results on non-sgl DNAs = -3.3251033x + 38.06712; r2 = 0.996 25 000 ND L.pneumophila sg6 000 ND 35.55 5.7 25 No. 13 (CIP103860) 25,000 35.55 25,000 36.73 L. longobeachae No. 5,000 ND 36.73 2.5 25 (NSW150) 25 000 ND 25 000 34.76 L. pneumophila sg2 000 36.96 35.86 4.6 25 No. 8 (CIP103856) 25 000 ND White 0 37.38 37.38 1.6 The presence of Non-sgl DNA did not influence the quantification of sgl DNA. y = -3.0301416x + 41.322914; r2 = 0.986 L. pneumophila sg2 2500 ND CNR1-E10 2500 ND ND (LG07291025) 2500 ND White 0 ND ND y = -3.188165x + 42.18248; r2 = 0.993 L. pneumophila sg7 25 000 ND 25 000 ND no 14 (CIP103861) 25 000 ND White 0 ND ND y = -2.8117392x + 35.852413; r2 = 0.998 Serratia 250 000 ND marcescens No. 102 250 000 ND ND 250 000 ND Serratia plymuthica 250 000 ND 250 000 ND No. 122 250 000 ND Acinetobacter Iwoffii 250 000 ND 250 000 ND ND No. 123 250 000 ND Enterobacter 250 000 ND aerogenes No. 129 250 000 ND ND 250 000 ND White 0 ND ND Example 4: Quantitative PCR with primers P69-P70 (specific L. longbeachae) Standard range Made from DNA L. longbeachae ATCC33462 (extracted by kit Quiagen) Quantity in UG calculated by nanodrop assay, knowing that 1 UG of L. pneumophila = 4.3 fg of DNA or 250,000 UG = 1 ng of DNA (2 l to 0.5 ng / l per reaction). qPCR)

Results DNA tested Theoretical quantity (MU) Ct Average Ct Estimated quantity (MU) Estimation of detection limits and quantification y = -3,78788x + 44,52163; r2 = 0.996 250,000 250,000 250,000 25,000 25,000 Legionella 2,500 longbeachae 2,500 ATCC33462 250 250 250 25 25 25 White 0.0 24.15 23.77 24.01 260 057 24.11 27.98 27.81 25 815 27.64 31.21 31.27 3 151 31.33 35.70 34.24 35.60 227 36.85 ND ND ND - ND ND ND - Results on different DNA L.longbeachae y = -3.78788x +44.52163; r2 = 0.996 Legionella 25 000 29.36 longbeachae No. 93 25 000 29.65 29.43 9 642 (C4E7) 25 000 29.28 Legionella 25 000 28.38 longbeachae No. 94 25 000 28.70 28.53 16 631 (98073) 25 000 28.52 Legionella 25 000 29.40 longbeachae no. 95 25 000 29.30 29.19 11 157 (98072) 25 000 28.87 White 0.0 ND ND - y = -2.4527311x +40.17975; r2 = 0,967 Legionella 2,500 28,89 28,94 38,422 longbeachae No. 5 2,500 28,98 (NSW150) Legionella 2,500 30.77 30.52 8,718 longbeachae No. 97 2,500 30,26 (NSW150) Legionella 2,500 29,80 30,23 11,446 longbeachae No. 98 2,500 30.65 (NSW150) Legionella 2,500 28.46 28.86 41 225 longbeachae No. 100 2,500 29,26 (NSW150) White 0.0 ND ND - Results on non-L.longbeachae DNA y = -3.78788x + 44.52163; r2 = 0.996 Legionella 2,500 ND pneumophila sgl 2,500 ND Philadelphia 2,500 ND Example 5: Quantitative PCR in multiplex with primers P65-P66 / P69-P70 (specific L. longbeachae) Standard ranges P65-P66: Made from DNA L. pneumophila sgl Philadelphia strain (extracted by the Quiagen kit) P69-P70: Made from DNA L. longbeachae ATCC33462 (extracted by the Quiagen kit) The two standard ranges were made separately (not in multiplex).

Results Quantity Theoretical tested DNA Ct (UG) Quantity Estimated average Ct (UG) Remarks P65-P66: y = -3,3054514x + 38,245598; r2 = 0.999 P69-P70: y = -3.78788 + 44.52163; r2 = 0.996 L. pneumophila Sgi 2500 27.02 Philadelphia 2500 27.09 27.17 2 242 2500 27.40 Legionella 2500 32.09 longbeachae 2 500 31.54 31.47 2 785 Good ATCC33462 is obtained 2,500 30.79 multiplexed quantifications, with standard L.pneumophila Sgi 250 30,17 30,55 2,242 sets made in simplex. Philadelphia 250 30.93 The presence of the 4 Legionella 2,500 30,58 primers and 2 probes longbeachae 2,500 32,20 31,77 2,326 in the same reaction ATCC33462 2500 32.53 thus does not influence the quantification. The 2,500 27,15 primers and probes do not appear to affect Philadelphia 2,500 26.92 26.94 together. 2,500 26,74 Legionella 250 35,90 longbeachae 250 34.67 35.38 260 ATCC33462 250 35.56

Claims (29)

REVENDICATIONS1. Use of the nucleotide sequence of the Legionella pneumophila wzm (ABC transporter of LPS 0-antigen) gene, its complementary or reverse sequence, or a fragment thereof as a specific marker for the detection and / or identification of a bacterium belonging to the species Legionella pneumophila serogroup 1 (L. pneumophila Sgl). 2. Use according to claim 1, characterized in that said nucleic sequence used is a sequence chosen from the following sequences: a) the sequence of the wzm gene of Legionella pneumophila, strain Paris (NCBI sequence reference: NC 006368.1 dated April 26, 2009 locus tag 1pp0837 of sequence SEQ ID NO: 1 below); b) the sequence of a fragment of at least 15 nucleotides of a sequence as defined in a); c) the sequence of a variant of the wzm gene, having at least 80% with the sequence SEQ ID NO: 1, the sequence of this variant comprising at least the conserved sequence that it is desired to detect and / or identify for a bacterium L. pneumophila Sgl or comprising at least one sequence having an identity percentage of at least 95%, with said conserved sequence; d) the complementary or inverse sequence of a sequence as defined in a), b) or c), Sequence SEQ ID NO: 1 1 atgacctcaa tatcctcaaa aactcagacg tttaaagaaa cagtagtcta tggagttgat 61 aagtttaggc ttttagctgt tttaagaaatatatgggatt accgcttgct tttatggatt 121 ttttgtaaac gagatctcaa agggcgttac agtcaaacca tcttgggatt gggttgggtt 181 attttaactc ctttgattac ggttggggtg tttgtcattg tttttggcat catgataaag 241 gtacctaccg atgggctgcc tactgtcatg ttctatttgg ttgcggttat accttggtat 301 tcctttttaa atgttctcaa cccttccata caaatgattg agggaaatgc ttcgttaata 361 acaaaggtct attttccaag agcgttgata ggcggtgcct atgctatggg agctgcggtt 421 gattttctga tggcttatgt gtttttgata accccctttg caatttatta tggcctttgg 481 tctatcaagt tattaattat tatgccattc ctgctgatat ctaccttaat gattggatta 541 ggtattggtt tggttttagc acctatcaat gcaaaatata gggatattaa acattttatg 601 cctctggctt tgcagttatt ttattactcc actccagcga tttaccctgt ttctgctgtg 661 cctgtgtggg ctaaaccatg gtatgctgtt aatccattat ctcttgttat caccagttat 721 cgagaggtgt taatggggca ttggccatca cctactat aa taatgacatt atctggtatg 781 gcaattataa ctttccttgt ggggcttgtt gcatttcatc acatggagca taaggtagtt 841 gatattttat ga. 3. A method for detecting or identifying the presence of a Legionella pneumophila serogroup 1 bacterium (L. pneumophila Sgl) in a sample, characterized in that it implements a step of detecting or identifying the presence of a sequence of a conserved region of the wzm gene for bacteria belonging to serogroup 1 of the species Legionella pneumophila. 4. Method of detection or identification according to claim 3, characterized in that said sequence of the conserved region of the wzm gene for L. pneumophila Sgl bacteria is the sequence of a conserved fragment of the sequence SEQ ID NO: 1 , or the sequence of one of its variants having at least 80% identity with the sequence SEQ ID NO: 1, their complementary sequence, or their reverse sequence. 5. Method of detection or identification according to claim 3 or 4, characterized in that said conserved fragment of the sequence SEQ ID NO: 1 is a fragment of at least 25 consecutive nucleotides, preferably at least 50, 75, 100, 200 and 250 consecutive nucleotides, sequence nt 99-392 of the sequence SEQ ID NO: 1. 6. Method of detection or identification according to claim 4, characterized in that said conserved fragment of the sequence SEQ ID NO: 1 is a fragment of at least 25 consecutive nucleotides, preferably at least 50 and 75 nucleotides. consecutive, sequence nt 138-214 of the sequence SEQ ID NO: 1. 7. A method of detection or identification according to one of claims 3 to 6, characterized in that said sample is a liquid sample or air likely to be contaminated by a bacterium of the species L. pneumophila, in particular of a bacterium belonging to serogroup 1 (L. pneumophila Sgl). 8. A method of detection or identification according to claim 7, characterized in that said sample is a water sample, in particular emanating from water distribution circuit or cooling circuit. 9. The detection or identification method according to claim 7, characterized in that said sample is an air sample. 48 10. A method of detection or identification according to one of claims 3 to 9, characterized in that it comprises a step of amplifying a DNA isolated from said sample using a pair of primers each of which sequences is able to hybridize under standard hybridization conditions with said sequence of a conserved region of the wzm gene, or with its complementary sequence. 11. A method of detection or identification according to claim 10, characterized in that it comprises the following steps: a) the amplification of a DNA isolated from said sample using a pair of primers each of which is capable of hybridizing under standard hybridization conditions with said sequence of a conserved region of the wzm gene, or with its complementary sequence; b) contacting the amplified DNA with a nucleotide probe, optionally labeled, capable of hybridizing specifically under standard hybridization conditions with said amplified DNA; and c) detecting the formation of a possible hybridization complex and, where appropriate, its quantification. 12. A method of detection or identification according to claim 10 or 11, characterized in that in step a), said pair of primers is selected from the following pairs of primers: A) Pl: (SEQ ID NO: 2) and P2: (SEQ ID NO: 3); B) P65: (SEQ ID NO: 4) and P66: (SEQ ID NO: 5). 13. A method of detection or identification according to claim 10 or 11, characterized in that: A) in step b), said probe is the sequence probe (SEQ ID NO: 6) when the pair of primers used in step a) is the pair of sequences SEQ ID NO: 2 and SEQ ID NO: 3, preferably when the process does not comprise in step c) the quantification of the hybridization complex formed; or B) in that in step a), said primer pair is the primer pair P65 and P66 of SEQ ID NO: 4 and SEQ ID NO: 5, and the probe is the sequence probe SEQ ID NO: 6, when the process comprises in step c) the quantification of the hybridization complex formed, preferably by qPCR. 14. The method of detection or identification according to one of claims 3 to 13, characterized in that it comprises a step of prior filtration of the sample to increase the concentration of bacteria present in the initial sample. 15. The method of detection or identification according to one of claims 3 to 9, characterized in that it comprises a step of demonstrating said sequence of a conserved region of the wzm gene, or with its complementary sequence, by FISH analysis (Fluorescent In Situ Hybridization). 16. A method of detection or identification according to claim 15, characterized in that it comprises the following steps: a) bringing the genomic DNA of said sample into contact with a labeled nucleic acid probe capable of hybridizing specifically under standard hybridization conditions with said genomic DNA; and c) detecting the formation of a possible hybridization complex and, where appropriate, its quantification. 17. A method of detection or identification according to claim 15 or 16, characterized in that said labeled probe used for FISH analysis is a probe selected from the following sequences: a) the sequence SEQ ID NO: 6, its sequence or a fragment thereof having at least 15 consecutive nucleotides; or b) a sequence comprising a sequence as defined in a) or b). 18. A method for detecting or identifying the serogroup of a bacterium Legionella pneumophila present in a sample, characterized in that it implements: a step of detection or identification of the presence of a bacterium Legionella pneumophila serogroup 1 by a method according to one of claims 3 to 17; and at least one other step of detecting or identifying the presence of a Legionella pneumophila bacterium from another serogroup, in particular chosen from serogroups 6 and 10, 12, or, 13 and 14. 19. A method of detection or identification according to claim 18, characterized in that: a) when the detection or identification method comprises an amplification step, the pair of primers used for the detection or the identification of the presence of a serogroup Legionella pneumophila bacterium selected from serogroups 6, 10, 12, 13 or 14 is: - the pair of primers of sequences P87 / P88 of sequences SEQ ID NO: 7 and SEQ ID NO: 8 for the detection or identification of the presence of Legionella pneumophila serogroup 6 or 12 bacteria; the primer pair of P85 / P86 sequences of SEQ ID NO: 9 and SEQ ID NO: 10 sequences for the detection or identification of the presence of Legionella pneumophila serogroup 10 or 14 bacteria; and the pair of P91 / P92 sequence primers of SEQ ID NO: 11 and SEQ ID NO: 12 sequences for the detection or identification of the presence of a Legionella pneumophila serogroup 13 bacterium, and b) when the method of detection or identification is carried out by FISH analysis, the probe used for the detection or identification of the presence of a serogroup Legionella pneumophila bacterium selected from serogroups 6 and 12, 13, or 10 or 14 is a probe whose sequence is chosen from the following sequences: the sequence of the PCR product obtained by the pair of P87 / P88 sequence primers of sequences SEQ ID NO: 7 and SEQ ID NO: 8 for the detection or the identification of the presence of a Legionella pneumophila serogroup 6 or 12 bacterium, its complementary sequence, one of their fragments having at least 15 consecutive nucleotides, one or a sequence comprising one of these sequences; the sequence of the PCR product obtained by the pair of P85 / P86 sequence primers of SEQ ID NO: 9 and SEQ ID NO: 10 sequences for the detection or identification of the presence of a Legionella pneumophila serogroup bacterium 10 or 14, its complementary sequence, one of their fragments having at least 15 consecutive nucleotides, or a sequence comprising one of these sequences; and the sequence of the PCR product obtained by the pair of P91 / P92 sequence primers of SEQ ID NO: 11 and SEQ ID NO: 12 sequences for the detection or identification of the presence of a serogroup Legionella pneumophila bacterium. 13, its complementary sequence, one of their fragments having at least 15 consecutive nucleotides, or a sequence comprising one of these sequences. 20. A method for detecting or identifying the serogroup of a bacterium Legionella pneumophila or a bacterium Legionella longbeachae present in a sample, characterized in that it uses: A) when the detection or identification process comprises an amplification step, - a step of detecting or identifying the presence of a Legionella pneumophila serogroup 1 bacterium or serogroups 6 and 12, 13, or, 10 and 14 by a method according to one of the claims 3 to 14, 18 and 19; and a step of detecting or identifying the presence of a Legionella longbeachae comprising amplifying a DNA isolated from said sample using a pair of primers selected from the following primer pairs; the sequence pair P51 / P52 of sequences SEQ ID NO: 13 and SEQ ID NO: 14; the pair of primers with P69 / P70 sequences of SEQ ID NO: 15 and SEQ ID NO: 16; and the pair of P73 / P74 sequence primers of SEQ ID NO: 17 and SEQ ID NO: 18 sequences, the contacting of the amplified DNA with a nucleotide probe, where appropriate labeled, capable of hybridizing specifically under standard hybridization conditions with said amplified DNA, and, if appropriate, in that the probe chosen is the sequence probe: SEQ ID NO: 19 (Lgbl probe) when the primer pair chosen is the pair of P69 / P70 sequence primers; and - SEQ ID NO: 20 (Lgb2 probe) when the chosen pair of primers is the pair of primers of P73 / P74 sequences, and B) when the detection or identification process is carried out by in situ hybridization with for example a FISH analysis, - a step of detecting or identifying the presence of a Legionella pneumophila serogroup 1 bacterium or serogroups 6 and 12, 13, or 10 and 14 by a method according to one of claims 15 at 19; and a step of detecting or identifying the presence of a Legionella longbeachae by in situ hybridization, for example by FISH analysis and whose probe used for the detection or identification of Legionella longbeachae is a probe whose sequence is selected from the PCR product sequences obtained by a pair of primers selected from the following pairs of primers; the sequence pair P51 / P52 of sequences SEQ ID NO: 13 and SEQ ID NO: 14; the pair of primers with P69 / P70 sequences of SEQ ID NO: 15 and SEQ ID NO: 16; and the pair of P73 / P74 sequence primers of SEQ ID NO: 17 and SEQ ID NO: 18, in particular: the Lgbl probe of sequence SEQ ID NO: 19 when the chosen pair of primers is the pair of primers of P69 / P70 sequences or the Lgb2 probe of sequence SEQ ID NO: 20 when the chosen pair of primers is the pair of P73 / P74 sequence primers; and the complementary sequence of these probes, one of their fragments having at least 15 consecutive nucleotides, their complementary sequence or fragments of at least 15 nucleotides or a sequence comprising one of these sequences. 21. A method of detection or identification according to one of claims 18 to 20, characterized in that in step a), the amplification of the isolated DNA is carried out by a multiplex PCR method in which the different pairs of primers are contacted simultaneously with said DNA isolated from the sample. 22. A method of detection or identification according to one of claims 3 to 14 and 18 to 21, characterized in that the amplified DNA, where appropriate labeled, is contacted in step b) with a support solid on which are fixed the nucleic probes capable of hybridizing specifically under standard hybridization conditions with said amplified DNA. 23. Diagnostic kit for the detection and / or identification of the presence of a Legionella pneumophila serogroup 1 bacterium in a sample, characterized in that it comprises: a) an isolated nucleic acid having for sequence the sequence a conserved region of the wzm gene of sequence SEQ ID NO: 1, or a variant thereof, in particular a sequence having at least 80% with this sequence, preferably chosen from the sequences of the group consisting of: sequence of a fragment of at least 25 consecutive nucleotides of the sequence nt 99-392 of the sequence SEQ ID NO: 1 or a variant thereof; the sequence of a fragment of at least 25 consecutive nucleotides of the sequence nt 138-214 of the sequence SEQ ID NO: 1 or of one of its variants; and - their complementary sequence or their reverse sequence; or b) a solid support on which is fixed one of the sequences as defined in a). 24. Diagnostic kit for the detection and / or identification of the presence of a Legionella pneumophila serogroup 1 bacterium in a sample, characterized in that it comprises: a nucleic primer pair capable of amplifying the sequence of a conserved region of the wzm gene of sequence SEQ ID NO: 1 or of one of its variants, preferably chosen from primer pairs of the group consisting of: P1 (SEQ ID NO: 2) and P2 (SEQ ID NO: 3); and P65 (SEQ ID NO: 4) and P66 (SEQ ID NO: 5), and, if appropriate, a probe, optionally labeled, of sequence SEQ ID NO: 6. 25. Diagnostic kit for the detection and / or identification of the serogroup of a bacterium Legionella pneumophila present in a sample, characterized in that it comprises: a) a kit as defined in one of claims 23 or 24, and b) 1) at least one pair of primers chosen from the following pairs of primers: the pair of primers of P87 / P88 sequences of SEQ ID NO: 7 and SEQ ID NO: 8 sequences for detection or identification of the presence of Legionella pneumophila serogroup 6 or 12 bacteria; the primer pair of P85 / P86 sequences of SEQ ID NO: 9 and SEQ ID NO: 10 sequences for the detection or identification of the presence of Legionella pneumophila serogroup 10 or 14 bacteria; and the pair of P91 / P92 sequence primers of SEQ ID NO: 11 and SEQ ID NO: 12 sequences for the detection or identification of the presence of Legionella pneumophila serogroup 13 bacteria, or 2) less a nucleic acid whose sequence is a sequence comprising or consisting of one of the PCR products amplified by a pair of primers as defined in b) 1), its complementary or reverse sequence, one of its fragments of at least 15 consecutive nucleotides; or 3) a solid support on which is fixed one of the sequences as defined in 2). 26). Diagnostic kit for the detection and / or identification of the serogroup of a bacterium Legionella pneumophila or a bacterium Legionella longbeachae present in a sample, characterized in that it comprises: A) a kit as defined in the one of claims 23 to 25 and B) 1) at least one pair of primers chosen from the following pairs of primers: the pair of primers of sequences P51 / P52 of sequences SEQ ID NO: 13 and SEQ ID NO : 14; the pair of primers with P69 / P70 sequences of SEQ ID NO: 15 and SEQ ID NO: 16; and the sequence pair of P73 / P74 sequences of SEQ ID NO: 17 and SEQ ID NO: 18, or 2) at least one nucleic acid whose sequence is a sequence comprising or consisting of one of the PCR products amplified by a pair of primers as defined in B) 1), its complementary or reverse sequence, one of its fragments of at least 15 consecutive nucleotides or a solid support on which is fixed one of these sequences, preferably: a nucleic acid of sequence SEQ ID NO: 19 (Lgbl probe) or SEQ ID NO: 20 (Lgb2 probe), its complementary or inverse sequence; or 3) a solid support to which is attached one of the sequences as defined in 2). 27. Primer chosen from the group of primers of sequences SEQ ID NOs. 2-5 and SEQ ID Nos. 7 to 18. 28. Primer pair selected from the primer pair group of the following sequences: a) SEQ ID NO: 2 and SEQ ID NO: 3; b) SEQ ID NO: 4 and SEQ ID NO: 5; c) SEQ ID NO: 7 and SEQ ID NO: 8; d) SEQ ID NO: 9 and SEQ ID NO: 10; e) SEQ ID NO: 11 and SEQ ID NO: 12; f) SEQ ID NO: 13 and SEQ ID NO: 14; g) SEQ ID NO: 15 and SEQ ID NO: 16; and h) SEQ ID NO: 17 and SEQ ID NO: 18. 29. Probe chosen from the group of probes of sequences SEQ ID NOs. 6, 19 and 20.