CN107723348A - Identify the NASBA detection methods of Listeria monocytogenes 1/2c serotypes - Google Patents
Identify the NASBA detection methods of Listeria monocytogenes 1/2c serotypes Download PDFInfo
- Publication number
- CN107723348A CN107723348A CN201711229374.0A CN201711229374A CN107723348A CN 107723348 A CN107723348 A CN 107723348A CN 201711229374 A CN201711229374 A CN 201711229374A CN 107723348 A CN107723348 A CN 107723348A
- Authority
- CN
- China
- Prior art keywords
- nasba
- listeria monocytogenes
- serotypes
- detection methods
- molecular beacon
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6865—Promoter-based amplification, e.g. nucleic acid sequence amplification [NASBA], self-sustained sequence replication [3SR] or transcription-based amplification system [TAS]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of NASBA detection primers and method for identifying Listeria monocytogenes 1/2c serotypes, belong to biological technical field.Forward primer sequence is 5 ' GAAATACATTTTGGTCTAG 3 ', reverse primer sequences are 5 ' aattctaatacgactcactatagggATTACTGGGAATAACTTGA 3 ', Listeria monocytogenes 1/2c serotype detection molecular beacon probes sequence is 5 ' JOE CGATCGAGGAAATGCTTATGCAGATATTACGATCG DABCYL 3 ', and detection method comprises the following steps：Listeria monocytogenes RNA is extracted, real-time NASBA reactions, qualitative analysis.Specificity and sensitivity of identification of the primer and molecular beacon that the present invention is built to Listeria monocytogenes 1/2c serological type strains with height, described detection method operating procedure is simple, detection time is short, can carry out real-time qualitative analysis, and viable bacteria and dead bacterium effectively can be distinguished.
Description
Technical field
The present invention relates to a kind of NASBA detection methods for identifying Listeria monocytogenes 1/2c serotypes, belong to biotechnology
Field.
Background technology
In 13 serotypes of Listeria monocytogenes, 1/2a, 1/2b, 1/2c and 4b serological type strain are most often from food
And isolated in clinical case.It is reported that the food-borne Listeria monocytogenes major part in distribution in China is 1/2c serotypes,
Other serotypes are compared to, 1/2c serological type strains can be in the food processing such as room temperature, eutrophy or low nutrition, meta-alkali and sale
Survived under general environmental conditions, produce the material of contaminated food products, such as biofilm, be easily caused food-borne listeriosis and occur,
Therefore it is very necessary to establish quick, effective, the accurate Listeria monocytogenes Serotype Identification method of energy.
When detecting viable bacteria infection, due to DNA stability, even if cell death, it remains to produce in detection architecture
Unnecessary amplified signal, can interference experiment result.Therefore in recent years, researcher start using RNA molecule as target spot come detect with
The activity of identification of cell.Because mRNA and rRNA half-life period is shorter, detected than DNA more suitable for living cells.But if will
MRNA is used as target molecule, then must assure that in its course of reaction to be transcribed.NASBA is using single stranded RNA sequence as target spot
One-step method isothermal amplification reactions, be suitable for living stems.At present NASBA technologies be at home and abroad widely used to virus,
Bacterium etc. detects, and in China, NASBA begins to use as the national standard detection method of avian influenza virus, and NASBA detection methods have
Research, it is that amplification is directly detected with electrophoresis or combines ELISA mostly, and the real-time NASBA based on molecular beacon is detected
The method of food-borne pathogens is rarely reported.
The content of the invention
Technical problem
There is specificity to know Listeria monocytogenes 1/2c serotypes RNA based on NASBA technologies the invention provides one kind
The primer and molecular beacon probe not acted on, at the same it is a kind of quickly, conveniently, accurately using the primer and molecular beacon probe structure
Identification Listeria monocytogenes 1/2c serotypes NASBA detection methods.
Technical scheme
A kind of NASBA detection methods for identifying Listeria monocytogenes 1/2c serotypes, it is characterised in that the NASBA inspections
Survey method specific primer sequence is as follows：
Forward primer NM2c-F sequences are 5 '-GAAATACATTTTGGTCTAG-3 ',
Reverse primer NM2c-R sequences are 5 '-aattctaatacgactcactatagggATTACTGGGAATAACTTGA-
3’；
The NASBA detection methods molecular beacon probe MB2c, its sequence are 5 '-JOE-
CGATCGAGGAAATGCTTATGCAGATATTACGATCG-DABCYL-3 ', described molecular beacon probe are glimmering in 5 ' end marks
Group DABCYL is quenched in light report group JOE, 3 ' end mark fluorescents.
The NASBA detection methods comprise the following steps：
(1) Listeria monocytogenes RNA is extracted
The bacteria suspension cell of late log phase is collected, adds lysozyme, RNA extractions are carried out using Trizol methods.By obtained by
RNA solution be placed in -70 DEG C of preservations；
(2) NASBA reactions in real time
Reaction dissolvent and KCl solution are mixed, it is standby, RNA templates are added in eight unions, add reaction mixture,
Primer and molecular beacon are added simultaneously, is mixed；65 DEG C of heating 2min, 41 DEG C of warm bath 2min, are rapidly added enzyme mixation, and 41 DEG C anti-
90min is answered, first order fluorescence signal is collected per 2min, blank control is used as using NASBA water；
(3) qualitative analysis
Reaction result judges that Ct values are more than 35 for feminine gender, and Ct values are less than 35 for the positive by Ct values.
The NASBA reaction systems are as follows:
Beneficial effect
The present invention is applied to food samples, especially birds meat products.Primer, molecular beacon and detection side of the present invention
Method specificity is stronger, can detect object bacteria, high sensitivity from the complicated sample of background, the detection to object bacteria is limited to
101Fg/ μ L levels, while alive and dead Listeria monocytogenes can effectively, be accurately distinguished, it is real under the background containing dead bacterium
Now to the quick detection of viable bacteria (including VBNC states).
Brief description of the drawings
Detection knots of the Fig. 1 for NASBA reaction systems in embodiment 3 to the 1/2c serotype Listeria monocytogenes of fresh cultured
Fruit.
1~4 is respectively quiescent culture 0h, 6h, 12h, 24h in figure；CK is blank control
Detection knots of the Fig. 2 for NASBA reaction systems in embodiment 3 to the 1/2c serotype Listeria monocytogenes of VBNC states
Fruit.
1~4 is respectively quiescent culture 0h, 6h, 12h, 24h in figure；CK is blank control
Detection knots of the Fig. 3 for NASBA reaction systems in embodiment 3 to the 1/2c serotype Listeria monocytogenes of Thermal killed
Fruit.Figure
In 1~4 be respectively quiescent culture 0h, 6h, 12h, 24h；CK is blank control
Embodiment
Carry out the description and interpretation present invention below by the mode of embodiment and accompanying drawing, but the present invention is not just limited in institute
The scope of embodiments stated.In this example, all primers and molecular beacon probe deliver Shanghai life work biotechnology service
Co., Ltd synthesizes.
Primer and molecular beacon probe of the present invention are to be based on comparative genomics and bioinformatics method, choosing
The full-length genome of 12 Listeria monocytogenes serotypes and 4 non-Listeria monocytogenes is taken, by each coding of these representative strains
Gene is compared by Blastn programs respectively, choose it is higher with target gene homology, while with other non-targeted bacterium bacterium
Gene of the pnca gene without homology is as its candidate's specificity target spot.The candidate's specificity base excavated according to sequence alignment
Cause, homology analysis is carried out to these gene orders using software ClustalX v2.0, finds out conserved sequence therein.Pass through
Software Primer Premier 5.0 design primer, screening scoring is high, itself without hairpin structure, without primer caused by dimer,
Blastn is carried out again in ncbi database and compares analysis, then passes through online bioinformatic tools " in silico " (http://
Insilico.ehu.es/PCR the PCR amplifications of primer to be selected, the high primer synthesis checking target spot of selection specificity) are simulated
The actual specificity of gene.In the 16 quasi- specific target point genes of Listeria monocytogenes 1/2c serotypes screened, utilize
Beacon Design 8.0, RNA structure5.3 and OligoWalk screening be suitable for NASBA reaction carry ring-type
The target sequence of structure, and design corresponding specific primer and molecular beacon.Choose specificity in target gene conserved sequence
Preferable hybridization portion of the sequence fragment as molecular beacon, the space structure of molecular beacon are entered by software RNAstructure
Row prediction, and neck structure of the CGATCG sequences as beacon is added in 5 ' and 3 ' end positions, added again in the outside of the structure
JOE fluorophors and DABCYL quenching groups, and specific primer is designed in the both sides of molecular beacon sequences, while draw in downstream
5 ' end positions addition T7 the polymerase recognition sites of thing, are carried out special by the Listeria monocytogenes bacterial strain RNA of different serotypes
Property checking.
A kind of NASBA detection methods for being used to identify Listeria monocytogenes 1/2c serotypes of the present invention, the NASBA detections
Method specific primer sequence is as follows：
Forward primer NM2c-F sequences are 5 '-GAAATACATTTTGGTCTAG-3 ',
Reverse primer NM2c-R sequences are 5 '-aattctaatacgactcactatagggATTACTGGGAATAACTTGA-
3’；
The NASBA detection methods molecular beacon probe MB2c, its sequence are 5 '-JOE-
CGATCGAGGAAATGCTTATGCAGATATTACGATCG-DABCYL-3 ', described molecular beacon probe are glimmering in 5 ' end marks
Light reporter group 6-JOE, 3 ' end mark fluorescent quenching group DABCYL；
The NASBA detection methods comprise the following steps：
(1) Listeria monocytogenes RNA is extracted
The bacteria suspension cell of late log phase is collected, adds the μ L of lysozyme 200 (50mg/mL, Shanghai life work bioengineering share
Co., Ltd), using 1mLTrizol reagents (total RNA extraction reagent, Shanghai Sheng Gong bioengineering limited company), according to
Product description carries out RNA extractions.Resulting RNA solution is placed in -70 DEG C of preservations.
(2) NASBA reactions in real time
Reaction dissolvent and KCl solution (1.5 μ L, 5mM, French Mei Liai biotech firms) are mixed, it is standby, in eight unions
RNA templates are added, add reaction mixture, while add primer and molecular beacon, are mixed.65 DEG C of heating 2min, 41 DEG C of temperature
2min is bathed, is rapidly added enzyme mixation, 41 DEG C of reaction 90min collect first order fluorescence signal per 2min, sky is used as using NASBA water
White control；
NASBA reaction systems are as follows:
(3) qualitative analysis
Reaction result passes through the (circulation that the fluorescence signal in each reaction tube is undergone when reaching the threshold value of setting of Ct values
Number) judge, it is feminine gender more than 35, is the positive less than 35.
Embodiment 1：The specificity verification of NASBA detection methods
With 36 plants of Listeria monocytogenes (including 13 serotypes, wherein 1/2c serological type strains have 4 plants) and 24 plants of non-lists
The RNA for increasing Listeria is template, and Evaluation on specificity is carried out to the NASBA reaction systems of foundation.Each sample setting 3 is parallel
Sample, blank control is used as using NASBA water.Reaction result is judged by Ct values, is feminine gender more than 35, is sun less than 35
Property.Testing result is as shown in table 2, the results showed that, 4 plants of Listeria monocytogenes 1/2c serological type strains can produce obvious fluorescence and expand
Increase signal, and other non-1/2c serological type strains have no fluorescence signal, reaction is negative, and illustrates the real-time NASBA reactions established
It is specific good.
The experimental strain of table 2 and NASBA reaction detection results
The test limit measure of example 2NASBA reaction systems
(1) total serum IgE test limit determines
Take 1mL to extract total serum IgE by cultivating to the Listeria monocytogenes 1/2c serological type strains FSIS 57115 of logarithmic phase, lead to
The concentration of nucleic acid concentration analyzer measure total serum IgE is crossed, then with RNase-free ddH2O carries out continuous 10 times of gradient dilutions, carries out
Real-time NASBA reactions.Testing result is shown in Table 3.When Listeria monocytogenes concentration is in the range of 13.8ng/ μ L~13.8fg/ μ L,
NASBA detection architectures can obtain believable positive findings, and now fluorescence signal is still very strong.And when RNA concentration continues to decline,
Effective Ct values can not be obtained, result judgement is negative, inspection of the reaction system to Listeria monocytogenes 1/2c serotype total serum IgEs
Survey is limited to 13.8fg/ μ L.
3 real-time NASBA of table RNA template detections limit measure
(2) bacterial clump sensitivity evaluation
Listeria monocytogenes 1/2c serological type strains FSIS 57115 is cultivated to logarithmic phase, at the beginning of calculating it with plate count
Beginning concentration, gradient dilution then being carried out with physiological saline, each dilution factor takes 1mL bacterium solutions to be forwarded to increasing bacterium 8h in BHI culture mediums,
Extract RNA and carry out NASBA reactions, the sensitivity of pure strains cultivation thing, which is divided into, does not increase bacterium and two parts progress after increasing bacterium.Testing result
It is shown in Table 4.When bacterial concentration is more than 1.92 × 101During CFU/mL, NASBA reactions can produce effective Ct values, and reaction result is
The positive, the reaction system are limited to 1.92 × 10 to the detection for not increasing the pure strains cultivation thing of bacterium1CFU/mL；On the other hand, concentration is taken
For 1.92 × 10-1CFU/mL~1.92 × 104CFU/mL is inoculated in BHI culture mediums, by 8h Zengjing Granule, NASBA inspections
Survey system can obtain effective fluorescence threshold to the pure strains cultivation thing of all inoculum concentrations, and the detection architecture is to the pure bacterium after increasing bacterium
The detection of culture is limited to 1.92 × 10-1CFU/mL。
4 real-time NASBA's of table does not increase bacterium pure strains cultivation analyte detection limit measure
Detection of the example 3NASBA reaction systems to viable bacteria, Thermal killed bacterium and VBNC bacterium in chicken meat sample
Listeria monocytogenes 1/2c serological type strains FSIS 57115 is cultivated to logarithmic phase, 1mL bacterium solutions are taken, with sterile life
Reason salt solution washing thalline is resuspended afterwards twice, and the cell concentration for adjusting resuspended bacterium solution is N × 107CFU/mL, as viable bacteria sample
This is to be detected.Thermal killed bacterium uses the heat inactivation method for handling 15min in boiling water bath to prepare, and confirms to be somebody's turn to do by plate count
Bacteria liquid sample produces without bacterium colony.Viable but non-culturable state bacterium (viable but non-culturable, VBNC) is lured with low temperature
Guiding method is carried out.
Freezing chicken 40g is taken, determines that sample itself to be polluted does not contain Listeria monocytogenes by National Standard Method.Using three
The Listeria monocytogenes of kind different conditions carry out artificial contamination, including exponential phase bacterium, VBNC bacterium and Thermal killed bacterium to chicken.
Chicken is divided into 4 parts, every part of 10g mixes immersion 30min with tri- kinds of different conditions bacterium solutions of 20mL respectively, and sample is filtered dry under aseptic condition
Product, it is sealed against packaging, is positioned over 4 degrees Celsius and stands preservation, then sampled in 0h, 6h, 12h and 24h, use 20mLPBS
Sample is rinsed, 200rpm concussion and cultivate 30min, takes 1mL liquid extraction RNA, carries out NASBA reactions.
As a result Fig. 1-3 is seen.Viable bacteria sample and VBNC bacterium samples for the different resting periods, the equal energy of NASBA reaction systems
Effective fluorescence signal is produced, the fluorescence signal of viable bacteria sample is slightly better than the amplified signal of VBNC bacterium, and is detected in Thermal killed bacterium
Only occur amplification curve in sample after inactivation treatment, its threshold value is also effective, judges its testing result for the positive, it may be possible to
Because microorganism is after sterilization treatment, target mRNA is not degradable in thalline, so causing the system to detect heat
The RNA signals of lethal bacterium.
Sequence table
<110>Agricultural University Of Nanjing
<120>Identify the NASBA detection methods of Listeria monocytogenes 1/2c serotypes
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 19
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<220>
<221> 5’UTR
<222> (1)..(19)
<400> 1
gaaatacatt ttggtctag 19
<210> 2
<211> 44
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<220>
<221> 5’UTR
<222> (1)..(44)
<400> 2
aattctaata cgactcacta tagggattac tgggaataac ttga 44
<210> 3
<211> 40
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<220>
<221> 5’UTR
<222> (1)..(40)
<400> 3
cgatcgagga aatgcttatg cagatattac gatcgdabcy 40
Claims (5)
- A kind of 1. NASBA detection methods for identifying Listeria monocytogenes 1/2c serotypes, it is characterised in that the NASBA detections Method specific primer sequence is as follows：Forward primer NM2c-F sequences are 5 '-GAAATACATTTTGGTCTAG-3 ',Reverse primer NM2c-R sequences are 5 '-aattctaatacgactcactatagggATTACTGGGAATAACTTGA-3 '；The NASBA detection methods molecular beacon probe MB2c, its sequence are 5 '-JOE- CGATCGAGGAAATGCTTATGCAGATATTACGATCG-DABCYL-3 ', described molecular beacon probe are glimmering in 5 ' end marks Group DABCYL is quenched in light report group JOE, 3 ' end mark fluorescents.
- 2. the NASBA detection methods of Listeria monocytogenes 1/2c serotypes are identified according to claim 1, it is characterised in that The NASBA detection methods comprise the following steps：(1) Listeria monocytogenes RNA is extractedThe bacteria suspension cell of late log phase is collected, adds lysozyme, RNA extractions are carried out using Trizol methods, by resulting RNA Solution is placed in -70 DEG C of preservations；(2) NASBA reactions in real timeReaction dissolvent and KCl solution are mixed, it is standby, RNA templates are added in eight unions, add reaction mixture, simultaneously Primer and molecular beacon are added, is mixed；65 DEG C of heating 2min, 41 DEG C of warm bath 2min, it is rapidly added enzyme mixation, 41 DEG C of reactions 90min, first order fluorescence signal is collected per 2min, blank control is used as using NASBA water；(3) qualitative analysisReaction result judges that Ct values are more than 35 for feminine gender, and Ct values are less than 35 for the positive by Ct values.
- 3. the NASBA detection methods of identification Listeria monocytogenes 1/2c serotypes according to claim 1 or claim 2, its feature exist In the NASBA reaction systems are as follows:
- 4. identify that the specificity used in the NASBA detection methods of Listeria monocytogenes 1/2c serotypes is drawn described in claim 1-3 Thing NM2c-F/R.
- 5. the molecular beacon used in the NASBA detection methods of Listeria monocytogenes 1/2c serotypes is identified described in claim 1-3 Probe MB2c.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711229374.0A CN107723348B (en) | 2017-11-29 | 2017-11-29 | NASBA detection method for identifying Listeria monocytogenes 1/2c serotype |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711229374.0A CN107723348B (en) | 2017-11-29 | 2017-11-29 | NASBA detection method for identifying Listeria monocytogenes 1/2c serotype |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107723348A true CN107723348A (en) | 2018-02-23 |
| CN107723348B CN107723348B (en) | 2021-03-30 |
Family
ID=61220456
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711229374.0A Active CN107723348B (en) | 2017-11-29 | 2017-11-29 | NASBA detection method for identifying Listeria monocytogenes 1/2c serotype |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107723348B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112763640A (en) * | 2019-11-06 | 2021-05-07 | 中国检验检疫科学研究院 | Novel method for identifying four serotype differential metabolites of listeria monocytogenes |
| CN113984728A (en) * | 2021-10-28 | 2022-01-28 | 南京农业大学 | Fluorescent biosensor construction method for rapid detection of Listeria monocytogenes |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103146835A (en) * | 2013-03-25 | 2013-06-12 | 华南师范大学 | Method and kit for detecting pathogenic bacterium of food source by test strip based on NASBA (Nucleic Acid Sequence Based Amplification) |
| CN104450940A (en) * | 2014-12-29 | 2015-03-25 | 南京农业大学 | Nucleotide sequence for detecting listeria monocytogenes and detection method and detection kit |
-
2017
- 2017-11-29 CN CN201711229374.0A patent/CN107723348B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103146835A (en) * | 2013-03-25 | 2013-06-12 | 华南师范大学 | Method and kit for detecting pathogenic bacterium of food source by test strip based on NASBA (Nucleic Acid Sequence Based Amplification) |
| CN104450940A (en) * | 2014-12-29 | 2015-03-25 | 南京农业大学 | Nucleotide sequence for detecting listeria monocytogenes and detection method and detection kit |
Non-Patent Citations (5)
| Title |
|---|
| ANNA NADAL 等: "A molecular beacon-based real time NASBA assay for detection of Listeria monocytogenes in food products: Role of target mRNA secondary structure on NASBA design", 《JOURNAL OF MICROBIOLOGICAL METHODS》 * |
| BURTON W. BLAIS 等: "A NUCLEIC ACID SEQUENCEBASED AMPLIFICATION (NASBA) SYSTEM FOR Listeria monocytogenes AND SIMPLE METHOD FOR DETECTION OF AMPLIMERS", 《BIOTECHNOLOGY TECHNIQUES》 * |
| M. UYTTENDAELE 等: "Development of NASBA@, a nucleic acid amplification system, for identification of Listeria monocytogenes and Icomparison to ELISA and a modified FDA method", 《INTERNATIONAL JOURNAL OF FOOD MICROBIOLOGY》 * |
| S.W. NHO 等: "Identification of high-risk Listeria monocytogenes serotypes in lineage I (serotype 1/2a, 1/2c, 3a and 3c) using multiplex PCR", 《JOURNAL OF APPLIED MICROBIOLOGY》 * |
| 冯可 等: "单核细胞增生性李斯特菌分子生物学检测技术的研究进展", 《食品工业科技》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112763640A (en) * | 2019-11-06 | 2021-05-07 | 中国检验检疫科学研究院 | Novel method for identifying four serotype differential metabolites of listeria monocytogenes |
| CN112763640B (en) * | 2019-11-06 | 2024-04-09 | 中国检验检疫科学研究院 | Novel method for identifying four serotypes of listeria monocytogenes differential metabolites |
| CN113984728A (en) * | 2021-10-28 | 2022-01-28 | 南京农业大学 | Fluorescent biosensor construction method for rapid detection of Listeria monocytogenes |
| CN113984728B (en) * | 2021-10-28 | 2023-10-27 | 南京农业大学 | Construction method of fluorescent biosensor for rapid detection of listeria monocytogenes |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107723348B (en) | 2021-03-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106167821A (en) | A kind of staphylococcus aureus CRISPR site detection kit and detection method | |
| CN101638687B (en) | Gene chip, kit and method for detecting common pathogenic bacteria of piglets | |
| CN106434917A (en) | LAMP primer group and detection kit for staphylococcus aureus and use method of detection kit | |
| CN103898208A (en) | Quick high-throughput intestines source pathogenic bacterium detection method | |
| CN109735638B (en) | Multiple PCR detection primers, kit, method and application for identifying Listeria monocytogenes ST121 with persistency | |
| CN102618662A (en) | GenomeLab eXpress Profiling (GeXP) multiplex quick detection primers and detection method for 6 food-borne pathogens | |
| CN103627812B (en) | Main pathogen of bovine mastitis Quadruple-PCR quick detection kit | |
| CN102676664B (en) | Fluorescent quantitative polymerase chain reaction (PCR) primers and probes for detecting pathogenic bacteria of multiple aquatic products simultaneously and detection method | |
| CN110016512A (en) | The multiple fluorescence quantitative PCR detection kit and method of three kinds of bovine respiratory pathogen are detected simultaneously | |
| CN102154497A (en) | M-PCR (Multiplex Polymerase Chain Reaction) primers, probes and detection methods for vibrio cholerae, vibrio parahaemolyticus and salmonella | |
| CN107723348A (en) | Identify the NASBA detection methods of Listeria monocytogenes 1/2c serotypes | |
| CN104152546A (en) | Kit and method for simultaneously detecting salmonella, listeria monocytogenes and staphylococcus aureus | |
| CN103436623A (en) | Rapid detection kit for viable salmonella in food and use method thereof | |
| CN102154488B (en) | Double PCR (polymerase chain reaction) rapid detection method for escherichia coli O157:H7 and kit | |
| CN106435007A (en) | Primer, probe, kit and method for detecting bacillus erysipelatos-suis by fluorescent quantitative PCR (Polymerase Chain Reaction) | |
| CN106048001A (en) | Method for analyzing relation between pathogenic pestalotiopsis and endophytic pestalotiopsis | |
| AU2020103778A4 (en) | Primer Set for Detection of Streptococcus agalactiae, Detection Kit and Multiplex PCR Detection Method | |
| CN112795673B (en) | CRISPR (clustered regularly interspaced short palindromic repeats) detection method for Cronobacter in food and kit thereof | |
| CN104450929A (en) | Molecular detection method of salmonella and application thereof | |
| Zhang et al. | Detection of Haemophilus parasuis isolates from South China by loop-mediated isothermal amplification and isolate characterisation | |
| CN100395348C (en) | Primer for detecting E. coli 0157:H7 nucleotide segment and probe sequence | |
| CN106591464B (en) | Method for detecting gene expression quantity of fusarium oxysporum cellulase | |
| CN104152583B (en) | Goat capripoxvirus Taqman-MGB probe for real-time fluorescence quantitative PCR detection primer, test kit and detection method | |
| RU2532845C1 (en) | FLUORESCENCE-LABELLED OLIGONUCLEOTIDE PROBE MS8 Flip-R FOR IDENTIFYING HISTOPLASMOSIS CAUSATIVE AGENT, Histoplasma capsulatum | |
| CN112538543B (en) | Specific primer for detecting salmonella and kit thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |