CN109943624A - A kind of method and its primer special and probe combinations based on RPA- Sidestream chromatography technology detection soybean phytophthora - Google Patents
A kind of method and its primer special and probe combinations based on RPA- Sidestream chromatography technology detection soybean phytophthora Download PDFInfo
- Publication number
- CN109943624A CN109943624A CN201910194830.5A CN201910194830A CN109943624A CN 109943624 A CN109943624 A CN 109943624A CN 201910194830 A CN201910194830 A CN 201910194830A CN 109943624 A CN109943624 A CN 109943624A
- Authority
- CN
- China
- Prior art keywords
- rpa
- detection
- soybean phytophthora
- phytophthora
- primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
It include 1) extracting sample to be tested DNA the invention discloses a kind of method based on RPA- Sidestream chromatography technology detection soybean phytophthora and its primer special and probe combinations, this method;2) using DNA as template, RPA amplification is carried out;3) amplified production detection is carried out using Sidestream chromatography test strips;When two brown bands occur in test strips, one is located in quality control region, and one is located at detection zone, then result is the positive, shows to contain soybean phytophthora in sample;When test strips only have quality control region a brown band occur, detection zone does not have band, then the result is that negative, shows in sample without containing soybean phytophthora.Primed probe group RPA expanding effect used in the present invention is good, band high specificity, with other germ no cross reactions, there is positive reaction in detection zone, increase the sensitivity of detection, new technology platform is provided for the detection of quarantine phytophthora, while identifying pathogen at disease infestation initial stage, the soybean phytophthora in entry and exit soybean can be detected.
Description
Technical field
The invention belongs to field of biotechnology, it is related to detecting soybean phytophthora based on RPA- Sidestream chromatography technology, is exclusively used in sea
It puts highly sensitive quick with soybean phytophthora (Phytophthora sojae) of departure soybean institute into detect, while can be used for field
The early diagnosis of soybean blight and the monitoring of germ.Soybean phytophthora is detected based on RPA- Sidestream chromatography technology more particularly to a kind of
Method and its primer special and probe combinations.
Background technique
Soyabean phytophthora Phytophthora sojae Kaufmann&Gerdemann infects phytophthora root-rot caused by soybean
Disease is one of destructive disease on Soybean production and a kind of quarantine object that China externally announces.Soybean phytophthora root rot
Most it was found earlier than 1948 in Indiana, United States, hereafter, a Soybean production of Canada, Brazil, Argentina etc. more than 20
Country reports the generation of the disease in succession.Su Yanchun is equal to the Heilongjiang soybean main producing region hair for reporting China for 1993 for the first time
Hereafter raw soybean phytophthora root rot finds the harm of soybean phytophthora successively in the major soybean production areas of northern China.It gives every year at present
Economic loss caused by global Soybean production is more than 1,000,000,000 dollars.In order to prevent the continuous expansion of soybean phytophthora spread scope, make
Soybean phytophthora root rot is controlled, and needs quickly and accurately to detect it.
The method of traditional detection soybean phytophthora is to carry out the trapping of Soybean Leaves dish and plate culture or combine the two.
Conventional method has played important function in soybean phytophthora detection, but time-consuming and laborious and operator is required to have the epidemic disease of profession
Mould separation, Morphological Identification knowledge and experience abundant.With the development of the relevant identification method of nucleic acid, the method for based on PCR
It has been used successfully to detection soybean phytophthora, although PCR method is greatly improved in specificity and sensibility, detection time
Still long, general 4~5h, while PCR method relies on accurate temperature cycling device.Its detection sensitivity is relatively high, but
It is detection process complexity, is not able to satisfy the demand quickly detected.
Recombinase-mediated isothermal duplication (Recombinase Polymerase Amlification, RPA) technology is recognized
It is the nucleic acid detection technique that can substitute PCR.Its principle is to form Protein-DNA mixtures, energy in conjunction with primer using recombinase
Homologous sequence is found in double-stranded DNA.Once primer located homologous sequence, Exchange reaction of chain will occur and formed and started
DNA synthesis carries out exponential amplification to the target area in template.In addition, RPA technology has the matching of multiple tools enzyme to carry out effectively
Amplification, amplification efficiency are much higher than traditional round pcr, and the time used is shorter, most short to realize in 5min.Due to RPA technology
Have the characteristics that the amplification used time is short, be not required to expensive instrument, is specific good, making it using more and more extensive.The maximum of RPA technology is special
Point is the amplification for only needing 1 pair of primer that can realize template nucleic acid under 37 DEG C or so of constant temperature, does not need to pass through height
Temperature cycles realize nucleic and melting and annealing, therefore do not need expensive instrument and equipment.And 37 DEG C popular response temperature very
It readily satisfies, is suitble to quick detection of the base to pathogen.Currently, RPA technology has been widely used for human body, animal or plant
On viral diagnosis detected especially for the RPA of quarantine soybean phytophthora, not but in the context of detection of pathogenic oomycetes
See that related application is reported.
Summary of the invention
Goal of the invention: being directed to the deficiencies in the prior art, and the object of the present invention is to provide one kind to be based on RPA- effluent
The method that chromatographic technique detects soybean phytophthora, to establish the New Method for Rapid of soybean phytophthora.It provides and is suitable for the detection
The detection primer special of method, and the kit containing the primer special are another goals of the invention of the invention.
Technical solution: to achieve the above object, the present invention adopts the following technical solutions:
A method of soybean phytophthora is detected based on RPA- Sidestream chromatography technology, comprising the following steps:
1) sample to be tested DNA is extracted;
2) using DNA as template, RPA amplification is carried out;Wherein, forward primer RPA-PSYPT-F:5'-GCCCTCTCGAGC
GGACGCTTTAGAGTCCAGGATG-3';Reverse primer is RPA-PSYPT-R:5 '-[Biotin] AGAATACCAATAATCAG
AAGCGTACACCCACCAG-3';Probe is PSYPT-P:5 '-[FAM] TTCCGATCCAGTTGCTGACAATATTGTGCC
[dSpacer]GTTGTCCCGCCCAGA[C3-spacer]-3';
3) amplified production detection is carried out using Sidestream chromatography test strips;When two brown bands, a position occur in test strips
In in quality control region, one is located at detection zone, then result is the positive, shows to contain soybean phytophthora in sample;When test strips only have matter
It controls area and a brown band occurs, detection zone does not have band, then the result is that it is negative, show in sample without containing soybean phytophthora.
In the above method, a kind of preferred RPA amplified reaction process includes: dry equipped with the detection of RPA nucleic acid amplification agents
29.5 μ L of buffer solution B uffer, 10 μM of 2.1 μ L of upstream primer, 10 μM of downstream primer 2.1 are added in the reaction member pipe of powder
μ L, 0.6 2.0 μ L of μ L, DNA of probe.It reacting while carrying out to guarantee, 2.5 μ L of MgAc should be added on the lid of eight connecting legs,
It being carefully turned over and covers, RPA amplification system is mixed well, 5,000 × g is centrifuged 10s, and it is placed on 39 DEG C of metal baths and reacts 30min,
It takes out reaction tube after incubating 4 minutes and mixes again, be centrifuged 3-5 seconds, be put into water-bath the reaction was continued 30min.The RPA effluent layer
Analysing detection reagent includes Sidestream chromatography test strips, hybridization check buffer (1 × PBS+0.1%Tween20).Sterile double steamings
Water can be used as negative control or supply reaction system use, and preparation method is distilled water after high pressure sterilization, be dispensed into sterilizing
In tubule.Reaction member pipe, the MgAc of buffer solution B uffer, the RPA nucleic acid amplification agents detection dry powder are bought in market
It obtains.
A kind of primer special and probe combinations based on RPA- Sidestream chromatography technology detection soybean phytophthora, specific as follows:
Primer sequence are as follows:
RPA-PSYPT-F:5'-GCCCTCTCGAGCGGACGCTTTAGAGTCCAGGATG-3';
RPA-PSYPT-R:5 '-[Biotin] AGAATACCAATAATCAGAAGCGTACACCCACCAG-3 ';
Probe sequence are as follows:
PSYPT-P:5 '-[FAM] TTCCGATCCAGTTGCTGACAATATTGTGCC [dSpacer]
GTTGTCCCGCCCAGA[C3-spacer]-3’。
Application of the primer and probe combination in detection soybean phytophthora.
The primer sets and probe can be used in production practices the fast and reliable of soybean phytophthora in incidence tissue and soil
Testing and appraisal.When for there are when soybean phytophthora, the DNA of soybean phytophthora to be extracted using NaOH rapid cleavage method in incidence tissue,
Detailed process is as follows: taking the tissue sample of one section of morbidity, every milligram of tissue is added 10 μ L 0.5M NaOH, sufficiently grinds in mortar
It is transferred to after mill in the EP pipe of 1.5mL, 12000rpm is centrifuged 5min, takes 5 μ L supernatants that 495 μ L 0.1mM Tris (pH are added
8.0) 1 μ L, is taken to be directly used in RPA reaction after mixing.Each reaction is at least in triplicate.
A kind of kit based on RPA- Sidestream chromatography technology detection soybean phytophthora, including at least institute more than 1 dosage
The primer special and probe combinations reagent stated.
The kit based on RPA- Sidestream chromatography technology detection soybean phytophthora, forward primer and reverse primer are dense eventually
Degree is 0.42 μm of ol/L, final concentration of 0.12 μm of ol/L of probe.
The kit based on RPA- Sidestream chromatography technology detection soybean phytophthora, further includes: standard positive DNA, delay
Fliud flushing, eight union of enzymatic amplification, aseptic double-distilled water, reaction driving liquid, product dilution and Sidestream chromatography test strips.
The described kit based on RPA- Sidestream chromatography technology detection soybean phytophthora, containing slow in every 50 μ L amplification system
Corresponding 4.7 μ L of primed probe liquid of 29.5 μ L of fliud flushing, soybean phytophthora RPA, 11.2 μ L of aseptic double-distilled water, sample to be tested DNA are sun
Property control be respectively 2 μ L or using aseptic double-distilled water be 2 μ L of blank control, reaction drive 2.5 μ L of liquid.
Specifically, detecting the kit of soybean phytophthora, 29.5 μ L of buffer solution B uffer is contained in every 50 μ L amplification system,
10 μM of upstream primer 2.1 μ L, 10 μM of 2.1 μ L of downstream primer, 0.6 2.0 2.5 μ L of μ L, MgAc of μ L, DNA of probe;
Ypt1 gene is the relevant gene of a Ras, and a gtp binding protein relevant to Ras is encoded in yeast.
Ypt1 gene includes multiple intrones, and conserved sequence and evolution region are spaced apart from each other, and is suitable as phytophthora Molecular Detection
Target.The present invention first against soybean phytophthora Ypt1 gene as target sequence, it is soft using Primer Premier 5.0
Part devises a series of RPA primer, and optimizes screening to designed primer by experiment, obtains a pair and is used for
The primer special and probe of RPA detection cherry ash arrhizus bacteria.Different from routine PCR reaction, the length of primer needed for RPA reacts is logical
Often be 30-35bp, the length of probe sequence is 46-52bp, formed inside primer when design of primers and between two
Level structure, the increase of length also make design of primers and select the increase of difficulty, and therefore, the design and selection of primer are to RPA's
As a result most important.RPA technology is in starting conceptual phase, there is no special primer, probe design software, also without a large amount of
Data provide foundation for its design of primers principle.Therefore, primer and probe of the invention combination is needed from target sequence two
It designs multipair primer and optimizes, screens and can just obtain in end.
The utility model has the advantages that compared with prior art, present invention has the advantage that
1) method that present invention system establishes quickly detection soybean phytophthora using RPA- Sidestream chromatography technology for the first time, and pass through spy
Anisotropic and sensitivity evaluation, can be used for the detection of actual sample, and for the on-site test of soybean phytophthora, to provide one kind sensitive, reliable
New method.The YPT1 gene primer that the present invention selects be through many experiments screen obtain, specificity it is good, with other pathogens without
Cross reaction.Primed probe expanding effect used in the present invention is good, band high specificity, can be formed in detection zone higher
The primer-probe heterodimer of concentration, thus make test strips that strong positive reaction be presented, increase the sensitivity of detection, institute of the present invention
Establishing detection method can detect the phytophthora sojae gene group of 100pg.
2) RPA technology of the invention and the method for combining Sidestream chromatography technology detection soybean phytophthora, both have molecular biosciences
The highly sensitive, high-throughput of detection is learned, and has the advantages that the specificity of immunology detection is good, easy to operate, is further without complicated instrument
Device, particularly suitable for the soybean phytophthora rapid screening detection of laboratories and quarantine scene.
3) detection speed is fast: compared with Standard PCR, it is not necessary to by denaturation, annealing, extend three steps, RPA reacts most
Thermophilic degree is between 37 DEG C -40 DEG C, and without denaturation, reaction is can be completed in 20min or so at normal temperature.
4) complicated instrument and equipment is not needed, on-site test is suitable for.Constant-temperature amplification is realized, unlike PCR method has to
Thermal cycle thus gets rid of the dependence to thermal cycler instrument, as long as having stable heat source RPA reaction, greatly
The range for extending RPA and using, can really realize portable live Rapid nucleic acid detection.
5) present invention can be used for carrying disease germs the quick detection of soybean phytophthora in plant tissue, only need an about 2h that detection can be completed
Process is a kind of effective means for detecting soybean phytophthora.
6) prediction of the detection method for morbidity the early period detection and disease of soybean phytophthora, it is anti-for determining
Optimum period is controlled, disease is effectively prevented and has a very important significance.
Detailed description of the invention
Fig. 1 is specific detection result figure of the Sidestream chromatography test strips in different phytophthora inter-species of RPA sensitivity;In figure,
1: soybean phytophthora (P.sojae);2: cloves phytophthora (Phytophthora syringae);3: phytophthora parasitica
(P.parasitica);4: phytophthora infestans (P.infestans);5: radix aucklandiae phytophthora (P.tentaculata);6: strawberry phytophthora
(P.fragariae);7: ramie mould (P.boehmeriae);8: negative control;
Fig. 2 is specific detection result figure testing result figure of the Sidestream chromatography test strips of RPA sensitivity between category;Figure
In, 1: soybean phytophthora (P.sojae);2: Pythium ultimum (Pythium ultimum);3: scouring rush's Fusariumsp (Fusarium
equiseti);4: tack anthrax-bacilus (Colletotrichum truncatum);5: verticillium dahliae (Verticilium
dahliae);6: Rhizoctonia solani Kuhn (Rhizoctonia solani);7: Pyricularia oryzae (Magnaporthegrisea);8: yin
Property control;
Fig. 3 is the sensitivity test result figure and regular-PCR sensitivity test knot of RPA Sidestream chromatography test strips detection method
Fruit figure.
Specific embodiment
The present invention is described further combined with specific embodiments below, but the present invention is not by the limit of following embodiment
System.
Embodiment 1
RPA primer length is generally 30 to 35 nucleotide.The too short activity that can seriously affect recombinase of primer, long primer
Amplification capability may not be able to be improved, will increase a possibility that forming secondary structure instead, increases the noise from primer.This
Outside, secondary structure easy to form, primer-primer interaction, the sequence of hairpin structure should be avoided when design of primers as far as possible, reduces primer
The formation of dimer.Amplified production size is no more than 500bp.
1, it according to the Ypt1 sequence (ID:DQ162958.1) of soybean phytophthora, is devised using Primer Premier 5.0
Forward primer sequence RPA-PSYPT-F, reverse primer sequences RPA-PSYPT-R, probe sequence PSYPT-P.Particular sequence is as follows:
RPA-PSYPT-F:5'-GCCCTCTCGAGCGGACGCTTTAGAGTCCAGGATG-3';
RPA-PSYPT-R:5 '-[Biotin] AGAATACCAATAATCAGAAGCGTACACCCACCAG-3 ';
PSYPT-P:5 '-[FAM] TTCCGATCCAGTTGCTGACAATATTGTGCC [dSpacer]
GTTGTCCCGCCCAGA[C3-spacer]-3’。
2, the genomic DNA for trying cause of disease bacteria strain is extracted.Specific extraction process is as follows:
A small amount of hypha powder is taken, adds 900 μ L 2%CTAB extracting solutions and 90 μ L 10%SDS, whirlpool mixes, in 60 DEG C of water-baths
1h, intermediate every 10min turn upside down several times.12000rpm is centrifuged 10min, takes supernatant that isometric phenol/chloroform/isoamyl alcohol is added
(25:24:1), is mixed by inversion, and 12000rpm is centrifuged 10min;Supernatant is transferred in new pipe, isometric chloroform is added, gently
It is gently mixed by inversion, 12000rpm is centrifuged 5min.It takes supernatant to be transferred in new pipe, adds the dehydrated alcohol and 1/10 body of 2 times of volumes
Long-pending 3M NaAc (pH5.2), -20 DEG C of precipitatings (> 1h).12000rpm is centrifuged 10min, and incline supernatant, precipitates 70% ethyl alcohol
It washes twice, room temperature is dried.Add appropriate sterilizing ultrapure water or TE (pH8.0) dissolution precipitating (containing 20 μ g mL-1RNase), at 37 DEG C
After managing 1h, -20 DEG C are saved backup.Each soil sample is dried pulverize first, then weighed respectively by the extraction for DNA in soil
0.5g soil sample is used as sample is extractedThe extraction of SPIN kit (Q-Biogene Ltd, USA) progress DNA.
The specific steps that soil DNA extracts are referring to kit specification.
3, using the DNA of extraction as template, using the RPA primer of design, RPA reaction is carried out in following reaction systems:
Sample detection: 29.5 μ L of Buffer, 10 μM of upstream primer are added into the reaction member pipe equipped with detection dry powder
2.1 μ L, 10 μM of 2.1 μ L of downstream primer, 0.6 2.0 μ L of μ L, DNA of probe;2.5 μ L of MgAc is added on reaction member pipe lid,
It being carefully turned over and covers, RPA amplification system is mixed well, 5,000 × g is centrifuged 10s, and it is placed on 39 DEG C of metal baths and reacts 30min,
It takes out reaction tube after incubating 4min and mixes again, be centrifuged 3-5s, be put into water-bath the reaction was continued 30min.
Negative control: 2.0 μ L template DNAs are changed to that 2.0 μ L sterilizing ddH is added by the same sample detection of operating procedure2O。
RPA carries out amplified production detection after reaction, using Sidestream chromatography test strips.When two browns occur in test strips
Band, one is located in quality control region, and one is located at detection zone, then result is the positive, shows to contain soybean phytophthora in sample;Work as examination
Paper slip only has quality control region a brown band occur, and detection zone does not have band, then the result is that negative, shows in sample without containing big
Beans phytophthora.
Embodiment 2
It is other with 2 plants of soybean phytophthora bacterial strains and 14 kinds in order to verify the specificity of RPA Sidestream chromatography test strips detection method
Oomycetes and 17 kinds of disease fungus are material to be tested (table 1), RPA Sidestream chromatography test strips detection method it is 2 plants big as the result is shown
There are two brown bands in the test strips of beans phytophthora, and one is located in quality control region, and one is located at detection zone, then result is the positive,
The test strips of remaining 14 kinds of oomycetes and 17 kinds of disease fungus only have quality control region a brown band occur, and detection zone does not have item
Band, then the result is that it is negative, show in sample without containing soybean phytophthora.Selection and soybean phytophthora (cloves phytophthora not of the same race;Parasitic epidemic disease
It is mould;Phytophthora infestans;Radix aucklandiae phytophthora;Strawberry phytophthora;Ramie mould etc.) and bacterium (the tack anthrax-bacilus that does not belong to;Eggplant sickle-like bacteria;Rice
Seasonal febrile diseases bacterium;Rhizoctonia solani Kuhn;Verticillium dahliae;Pythium ultimum) DNA as template, carry out the inspection of RPA Sidestream chromatography test strips
It surveys.
Table 1 is used to detect fungi and the oomycetes bacterial strain of soybean phytophthora specificity
Testing result is as depicted in figs. 1 and 2.Fig. 1 is the Sidestream chromatography test strips of RPA sensitivity in different phytophthora inter-species
Specific detection is as a result, 1: soybean phytophthora (P.sojae);2: cloves phytophthora (Phytophthora syringae);3: parasitic epidemic disease
Mould (P.parasitica);4: phytophthora infestans (P.infestans);5: radix aucklandiae phytophthora (P.tentaculata);6: strawberry phytophthora
(P.fragariae);7: ramie mould (P.boehmeriae);8: negative control;Test strips two brown bands of appearance, one
In quality control region, one is located at detection zone, then result is the positive, shows to contain soybean phytophthora in sample;When test strips only have
There is a brown band in quality control region, and detection zone does not have band, then the result is that negative, shows in sample without containing soybean phytophthora;
The 1st article of aobvious 2 bands are shown in figure, are positive;Remaining 1 band, is negative.
Fig. 2 is specific detection result figure testing result of the Sidestream chromatography test strips of RPA sensitivity between category, in figure,
1: soybean phytophthora (P.sojae);2: Pythium ultimum (Pythium ultimum);3: scouring rush's Fusariumsp (Fusarium
equiseti);4: tack anthrax-bacilus (Colletotrichum truncatum);5: verticillium dahliae (Verticilium
dahliae);6: Rhizoctonia solani Kuhn (Rhizoctonia solani);7: Pyricularia oryzae (Magnaporthe grisea);8: yin
Property control;There are two brown bands in test strips, and one is located in quality control region, and one is located at detection zone, then result is the positive, table
Contain soybean phytophthora in bright sample;When test strips only have quality control region a brown band occur, detection zone does not have band, then result
It is feminine gender, shows in sample without containing soybean phytophthora;The 9th article of aobvious 2 bands are shown in figure, are positive;Remaining 1 band, is negative.
As it can be seen that after carrying out RPA amplified reaction with the primer that embodiment 1 designs, Sidestream chromatography test strips 2 palm fibres as the result is shown
Vitta band (Fig. 1, Fig. 2), target stripe is analysed clearly, can effectively detect soybean phytophthora.And other fungies and oomycetes are only in Quality Control
There is a brown band in area, and negative control also only a brown band occurs in quality control region.
Embodiment 3
Measuring embodiment 2 to extract the concentration of DNA using 2000 micro-spectrophotometer of Nanodro is 100ng μ L-1。
It is successively diluted to 100pg μ L-1、10pgμL-1、1pgμL-1With 100fg μ L-1, adopted according to 1 embodiment of embodiment
Primer, reaction system and reaction condition carry out RPA and PCR to the DNA of various concentration and detect.
As a result as shown in figure 3, containing 100ng μ L in the reaction system of 25 μ L respectively-1、10ngμL-1、1ngμL-1、100pgμ
L-1There are two brown bands in the test strips of soybean phytophthora DNA, are positive, contain 10pg respectively in the reaction system of 25 μ L
μL-1、1pgμL-1、100fgμL-1There is a brown band in the paper slip of soybean phytophthora DNA, negative;Colour developing the result shows that
The sensitivity of loop-mediated isothermal amplification reaches 100pg μ L-1;With the gene of the reference culture of the soyabean phytophthora of same concentration
Group DNA carries out pcr amplification reaction, compares the sensitivity of two methods as amplification template;Experiment 3 times is repeated, to determine PCR
The sensitivity of method detection soyabean phytophthora genomic DNA;The result of 3 repetition experiments is consistent.It is 1ng μ in genomic DNA concentration
L-1When, PCR detection is capable of detecting when specific band, it was demonstrated that specific amplification occurs, testing result is judged to the positive.And in gene
Group DNA concentration is 100pg μ L-1When, PCR product is detected without discovery specific band, it was demonstrated that there is no specific amplification,
Testing result is judged to feminine gender, i.e. the sensitivity of PCR method detection soyabean phytophthora genomic DNA is 1ng μ L-1.It can be seen that RPA
The sensitivity of Sidestream chromatography test strips detection method is higher by 10 times than PCR method.
The result shows that RPA detectable concentration is 10pg μ L-1, and PCR detectable concentration is 1ng μ L-1When remain to see target item
Band illustrates the high sensitivity of RPA detection in PCR.But PCR detection process needs 2.5h, and RPA detection time only needs 30min, and
The instrument and equipment of the valuableness such as PCR instrument is not needed, operation sequence is easy, more favorably promotes and applies in production.
Embodiment 4
The present embodiment carries out actual sample experiment detection from field morbidity soybean and artificial infection bean seedlings.
First using the pathogen in the NaOH rapid cleavage method rapidly extracting morbidity soybean and healthy soybean of embodiment 2
DNA.RPA reaction is carried out using the pathogen DNA that the primer pair that above-described embodiment 1 designs is extracted: to equipped with the anti-of detection dry powder
Answer addition Buffer 29.5 μ L, 10 μM of upstream primer 2.1 μ L, 10 μM of downstream primer 2.1 μ L, 0.6 μ of probe in unit pipes
2.0 μ L of L, DNA;2.5 μ L of MgAc is added on reaction member pipe lid, is carefully turned over and is covered, and RPA amplification system is sufficiently mixed
Even, 5,000 × g is centrifuged 10s, is placed on 39 DEG C of metal baths and reacts 30min, takes out reaction tube after incubating 4 minutes and mixes again, from
Heart 3-5s is put into water-bath the reaction was continued 30min.RPA carries out amplified production inspection after reaction, using Sidestream chromatography test strips
It surveys.When two brown bands occur in test strips, one is located in quality control region, and one is located at detection zone, then result is the positive, shows
Contain soybean phytophthora in sample;When test strips only have quality control region a brown band occur, detection zone do not have band, then the result is that
Feminine gender shows in sample without containing soybean phytophthora.And healthy fruit does not amplify band, again demonstrates RPA Sidestream chromatography
Test strips detection method testing result is accurate and reliable, there is very strong practicability.
Embodiment 5
The method that the soybean phytophthora RPA Sidestream chromatography test strips detection method of embodiment 1 is used to detect soybean phytophthora, packet
It includes:
1) in soil egg spore enrichment: take 40~80g of pedotheque to be checked, grind, successively use 200 mesh screen places to go
Then larger grogs passes through 400,500,800 mesh net filtrations, while with 3~10 liters of water repeated flushing, from 800 mesh screens
Egg spore is collected, with 1mL aqueous suspension.Since egg spore cannot penetrate 800 mesh screens, processing, which can achieve, in this way keeps egg spore rich
The effect of collection.
2) DNA is extracted from micro egg spore: by the centrifuge tube for being transferred to 1.5mL with the egg spore of sterile aqueous suspension,
It is centrifuged 5 minutes under 12000rpm revolving speed, pours out liquid;50 μ L CTAB buffer are added, grinds, adds 500 μ L CTAB
Buffer, water-bath 30 minutes;Isometric chloroform is added, is centrifuged 10 minutes under 12000rpm revolving speed, draws supernatant;It is added
The 3M NaAc of 1/10 volume, 2 times of volumes without water-ice ethyl alcohol, precipitation at room temperature 30 minutes, be centrifuged 10min under 12000rpm revolving speed,
Dry liquids;Add 1mL 70% (V/V) ethanol washing, 12000r.min-1Be centrifuged 10 minutes under revolving speed, dry liquids, dry to
Alcohol-free taste;10 μ L aseptic double-distilled waters are added to dissolve, the template for RPA amplification.
3) soybean phytophthora RPA- Sidestream chromatography detects, the pathogen DNA extracted using the primer pair that above-described embodiment 1 designs
It carries out RPA reaction: Buffer 29.5 μ L, 10 μM of 2.1 μ of upstream primer being added into the reaction member pipe equipped with detection dry powder
L, 10 μM of 2.1 μ L of downstream primer, 0.6 2.0 μ L of μ L, DNA of probe;2.5 μ L of MgAc is added on reaction member pipe lid, carefully
Overturning covers, and RPA amplification system is mixed well, and 5,000 × g is centrifuged 10s, is placed on 39 DEG C of metal baths and reacts 30min, incubates
Reaction tube is taken out after 4 minutes to mix again, is centrifuged 3-5 seconds, water-bath is put into the reaction was continued 30min.RPA after reaction, is answered
Amplified production detection is carried out with Sidestream chromatography test strips.When two brown bands occur in test strips, one is located in quality control region, and one
Item is located at detection zone, then result is the positive, shows to contain soybean phytophthora in sample;When test strips only have quality control region a palm fibre occur
Vitta band, detection zone do not have band, then the result is that negative, show in soil sample without containing soybean phytophthora.
Claims (8)
1. a kind of method based on RPA- Sidestream chromatography technology detection soybean phytophthora, which comprises the following steps:
1) sample to be tested DNA is extracted;
2) using DNA as template, RPA amplification is carried out;Wherein, forward primer RPA-PSYPT-F:5'-GCCCTCTCGAGCGGAC
GCTTTAGAGTCCAGGATG-3';Reverse primer is RPA-PSYPT-R:5 '-[Biotin] AGAATACCAATAATCAGAAGC
GTACACCCACCAG-3';Probe is PSYPT-P:5 '-[FAM] TTCCGATCCAGTTGCTGACAATATTGTGCC
[dSpacer]GTTGTCCCGCCCAGA[C3-spacer]-3';
3) amplified production detection is carried out using Sidestream chromatography test strips;When two brown bands occur in test strips, one is located at matter
It controls in area, one is located at detection zone, then result is the positive, shows to contain soybean phytophthora in sample;When test strips only have quality control region
There is a brown band, detection zone does not have band, then the result is that it is negative, show in sample without containing soybean phytophthora.
2. the method according to claim 1 based on RPA- Sidestream chromatography technology detection soybean phytophthora, which is characterized in that step
It is rapid 2) in, RPA amplification: to equipped with detection dry powder reaction member pipe in be added 29.5 μ L of buffer solution B uffer, 10 μM of upstream
Primer 2 .1 μ L, 10 μM of 2.1 μ L of downstream primer, 0.6 2.0 μ L of μ L, DNA of probe;2.5 μ L of MgAc is added in the lid of eight connecting legs
On, amount to 50 μ L amplification systems, be carefully turned over and cover, RPA amplification system is mixed well, 5,000 × g is centrifuged 10s, is placed in 39
30min is reacted on DEG C metal bath, reaction tube is taken out after incubating 4 minutes and mixes again, is centrifuged 3-5 second, is put into water-bath and is continued instead
Answer 30min.
3. a kind of primer special and probe combinations based on RPA- Sidestream chromatography technology detection soybean phytophthora, which is characterized in that tool
Body is as follows:
Primer sequence are as follows:
RPA-PSYPT-F:5'-GCCCTCTCGAGCGGACGCTTTAGAGTCCAGGATG-3';
RPA-PSYPT-R:5 '-[Biotin] AGAATACCAATAATCAGAAGCGTACACCCACCAG-3 ';
Probe sequence are as follows:
PSYPT-P:5 '-[FAM] TTCCGATCCAGTTGCTGACAATATTGTGCC [dSpacer] GTTGTCCCGCCCAGA
[C3-spacer]-3’。
4. application of the primer and probe combination as claimed in claim 3 in detection soybean phytophthora.
5. a kind of kit based on RPA- Sidestream chromatography technology detection soybean phytophthora, which is characterized in that include at least 1 dosage
Above primer special as claimed in claim 3 and probe combinations reagent.
6. the kit according to claim 5 based on RPA- Sidestream chromatography technology detection soybean phytophthora, which is characterized in that
Forward primer and reverse primer final concentration are 0.42 μm of ol/L, final concentration of 0.12 μm of ol/L of probe.
7. the kit according to claim 5 based on RPA- Sidestream chromatography technology detection soybean phytophthora, which is characterized in that
Further include: standard positive DNA, buffer, eight union of enzymatic amplification, aseptic double-distilled water, reaction driving liquid, product dilution and effluent
Chromatograph test strip.
8. the kit according to claim 5 based on RPA- Sidestream chromatography technology detection soybean phytophthora, which is characterized in that
Contain corresponding 4.7 μ L of primed probe liquid of 29.5 μ L of buffer, soybean phytophthora RPA, aseptic double-distilled water in every 50 μ L amplification system
11.2 μ L, sample to be tested DNA are that positive control is respectively 2 μ L or drives liquid by 2 μ L of blank control, reaction of aseptic double-distilled water
2.5μL。
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201910194830.5A CN109943624A (en) | 2019-03-14 | 2019-03-14 | A kind of method and its primer special and probe combinations based on RPA- Sidestream chromatography technology detection soybean phytophthora |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201910194830.5A CN109943624A (en) | 2019-03-14 | 2019-03-14 | A kind of method and its primer special and probe combinations based on RPA- Sidestream chromatography technology detection soybean phytophthora |
Publications (1)
Publication Number | Publication Date |
---|---|
CN109943624A true CN109943624A (en) | 2019-06-28 |
Family
ID=67009876
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201910194830.5A Pending CN109943624A (en) | 2019-03-14 | 2019-03-14 | A kind of method and its primer special and probe combinations based on RPA- Sidestream chromatography technology detection soybean phytophthora |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN109943624A (en) |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN110878373A (en) * | 2019-11-14 | 2020-03-13 | 南京农业大学 | Recombinase polymerase amplification detection kit for phytophthora infestans and application thereof |
CN116516058A (en) * | 2023-06-28 | 2023-08-01 | 海南大学三亚南繁研究院 | Method and kit for visually detecting phytophthora sojae |
Citations (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20040034890A1 (en) * | 2002-05-10 | 2004-02-19 | Steven St. Martin | Identification of soybeans having resistance to Phytophthora sojae |
CN101519697A (en) * | 2009-04-07 | 2009-09-02 | 福建省农业科学院植物保护研究所 | Phytophthora sojae molecule detecting primer and detection reagent kit thereof |
CN101705293A (en) * | 2009-12-04 | 2010-05-12 | 天津出入境检验检疫局动植物与食品检测中心 | Specific primer pairs for soybean phytophthora PCR detection |
CN101805796A (en) * | 2010-04-13 | 2010-08-18 | 南京农业大学 | Primer for detecting the soybean phytophthora and kit and method thereof |
CN102643925A (en) * | 2012-05-16 | 2012-08-22 | 南京农业大学 | Loop-mediated isothermal amplification (LAMP) primer composition for detecting phytophthora rot and application thereof |
-
2019
- 2019-03-14 CN CN201910194830.5A patent/CN109943624A/en active Pending
Patent Citations (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20040034890A1 (en) * | 2002-05-10 | 2004-02-19 | Steven St. Martin | Identification of soybeans having resistance to Phytophthora sojae |
CN101519697A (en) * | 2009-04-07 | 2009-09-02 | 福建省农业科学院植物保护研究所 | Phytophthora sojae molecule detecting primer and detection reagent kit thereof |
CN101705293A (en) * | 2009-12-04 | 2010-05-12 | 天津出入境检验检疫局动植物与食品检测中心 | Specific primer pairs for soybean phytophthora PCR detection |
CN101805796A (en) * | 2010-04-13 | 2010-08-18 | 南京农业大学 | Primer for detecting the soybean phytophthora and kit and method thereof |
CN102643925A (en) * | 2012-05-16 | 2012-08-22 | 南京农业大学 | Loop-mediated isothermal amplification (LAMP) primer composition for detecting phytophthora rot and application thereof |
Non-Patent Citations (3)
Title |
---|
J. ALEJANDRO ROJAS等: "Development and Application of qPCR and RPA Genus- and Species-Specific Detection of Phytophthora sojae and P. sansomeana Root Rot Pathogens of Soybean", 《PLANT DISEASE》 * |
戴婷婷等: "基于Ypt1靶标的大豆疫霉环介导等温扩增技术的研究", 《植物病理学报》 * |
郭正洋等: "重组酶聚合酶扩增技术的研究进展", 《食品科技》 * |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN110878373A (en) * | 2019-11-14 | 2020-03-13 | 南京农业大学 | Recombinase polymerase amplification detection kit for phytophthora infestans and application thereof |
CN116516058A (en) * | 2023-06-28 | 2023-08-01 | 海南大学三亚南繁研究院 | Method and kit for visually detecting phytophthora sojae |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN108103240A (en) | Prawn infectivity muscle necrosis virus(IMNV)RAA constant temperature fluorescence detection method and reagent | |
CN109182591A (en) | A kind of sword-leaved cymbidium Pathogen LAMP detection primer group and its rapid detection method | |
CN104862420B (en) | RPA Sidestream chromatographies detect primer, probe and the kit of foot and mouth disease virus aerosol | |
CN104372104B (en) | A kind of LAMP detection primer composition of camphor tree phytophthora and LAMP detection kit thereof and LAMP detection method | |
CN110066885A (en) | A kind of primer and probe combination and its application based on RPA- Sidestream chromatography technology detection chestnut Heisui River phytophthora | |
CN108977508A (en) | Primer combination and its application based on LAMP detection succulent Pathogen | |
CN110358866A (en) | Novel goose astrovirus SYBR Green dye method fluorescent quantificationally PCR detecting kit | |
CN107815505A (en) | A kind of Glorosprium musarum Cookeet Mass LAMP detection primer group and its detection method | |
CN101575640A (en) | Primer group for bovine tuberculosis mycobacterium detection, rapid detection method and detection kit | |
CN110283936A (en) | A kind of African swine fever virus LAMP-HNB Visual retrieval kit | |
CN109943624A (en) | A kind of method and its primer special and probe combinations based on RPA- Sidestream chromatography technology detection soybean phytophthora | |
CN108893557A (en) | A kind of method of three kinds of wheat rhizome portion diseases of quick detection | |
CN108048589A (en) | The Real-time PCR specific primers and probe and detection kit and detection method of ox two-pressure humidity generator | |
CN109988823A (en) | Recombinase-mediated isothermal duplication-Sidestream chromatography technology detection Oak Tree phytophthora primer and probe combination and its application | |
CN107475389A (en) | For detecting primer sets, kit and the method for mycoplasma pneumoniae | |
CN106381341A (en) | Phytophthora colocasiae nested PCR detection primer and application thereof | |
CN106868164A (en) | A kind of primer and nested PCR detection method for detecting camphor tree phytophthora | |
CN104372092B (en) | The LAMP detection primer composition of a kind of banksia rose phytophthora and LAMP detection kit thereof and LAMP detection method | |
CN110093432A (en) | It is a kind of for distinguishing the sRNA marker and application thereof of tubercle bacillus and BCG vaccine | |
CN109897910A (en) | A method of pinch outs are detected based on RPA- Sidestream chromatography Lateral Flow Strip fast accurate | |
CN101381767A (en) | Universal real time fluorescent PCR detection method of trichinella | |
US20180195135A1 (en) | Method for examining microorganism, kit for examining microorganism, microarray for examining microorganism, carrier for detecting fungi, method for detecting fungi and kit for detecting fungi | |
CN109825628B (en) | A kind of primer and probe combination and its application based on RPA- Sidestream chromatography technology detection Fusarium solani | |
CN110093446A (en) | Recombinase-mediated isothermal duplication-Sidestream chromatography technology detection camphor tree phytophthora primer and probe combination and its application | |
CN106282386A (en) | A kind of Glorosprium musarum Cookeet Mass molecular detection primer and detection method |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
RJ01 | Rejection of invention patent application after publication |
Application publication date: 20190628 |
|
RJ01 | Rejection of invention patent application after publication |