CN114032331A

CN114032331A - Fusarium proliferatum specific detection target FPRO-09882 and application thereof

Info

Publication number: CN114032331A
Application number: CN202111517635.5A
Authority: CN
Inventors: 戴婷婷; 徐洁莹; 张林巧; 焦彬彬; 俞萱; 吴翠萍
Original assignee: Nanjing Forestry University
Current assignee: Nanjing Forestry University
Priority date: 2021-12-13
Filing date: 2021-12-13
Publication date: 2022-02-11
Anticipated expiration: 2041-12-13
Also published as: CN114032331B

Abstract

The invention discloses a novel detection target FPRO-09882 of a layered Fusarium (Fusarium proliferatum), and a detection primer, a detection kit and a detection method thereof, wherein the protein sequence of the detection target FPRO-09882 is shown as SEQ ID NO: 1, and the DNA sequence for coding the protein is shown as SEQ ID NO: 2, respectively. Meanwhile, the invention also discloses a specific primer and probe combination of the RPA detection technology for specifically detecting the target FPRO-09882, wherein the forward primer sequence is shown as SEQ ID NO: 3, the reverse primer sequence is shown as SEQ ID NO.4, and the probe sequence is shown as SEQ ID NO: 5, respectively. The invention discovers a new detection target of the Fusarium laminarization, provides a new detection way for detecting the Fusarium laminarization, and simultaneously, the RPA-LFD detection primer and the probe developed based on the target can realize the specific detection of the Fusarium laminarization and has high sensitivity.

Description

Fusarium proliferatum specific detection target FPRO-09882 and application thereof

Technical Field

The invention belongs to the technical field of gene detection, and particularly relates to a specific detection target FPRO-09882 of a layered Fusarium (Fusarium proliferatum) and application thereof.

Background

Fusarium proliferatum (F. proliferatum) can infect crops such as rice, wheat, corn, asparagus, garlic, onion and the like and woody plants such as rhododendron, camellia oleifera, cedar and the like to cause root rot. The layered fusarium can grow on a PDA (personal digital assistant) plate, the morphological characteristics of the layered fusarium can be similar to those of fusarium verticillioides F.verteticiloides, bacterial colonies are circular after being cultured for 5 days at 25 ℃, the bacterial colonies are often aggregated into bundles, central mycelia grow vigorously, peripheral mycelia grow sparsely, the mycelia are changed from white to light yellow, and the central mycelia show a light purple shape in the later period. The large conidia are in a fusarium shape or a spindle shape, colorless and transparent, slightly bent, gradually tapered towards two ends, and provided with 2-5 diaphragms, the size of the small conidia (24.2-46.7 mu m) is 1.5-3.7 mu m, the small conidia are observed to be in a long oval shape or an elliptical shape under a microscope, colorless and transparent, the size of the small conidia (4.4-8.4 mu m) is 1.2-3.1 mu m), no diaphragm or one diaphragm exists, the conidia are stringed or pseudocephalic, the pair of spore chains is in a V shape, the number of pseudocephalic is short, the number of single phialides or multiple phialides is large, and the number of multiple phialides is large. No chlamydospores were produced. Under artificial culture conditions, the optimal growth temperature of the strain is 25 ℃, the optimal growth pH value is 5-7, conidia can germinate well when the relative humidity is 100%, and the lethal growth temperature of the strain is 60 ℃ for 10 min. The carbon source with good growth of the germs is soluble starch, and the nitrogen source is ammonium chloride. The optimum growth temperature of the Fusarium proliferatum is 25 deg.C, and the growth of hypha at a high temperature of above 35 deg.C is inhibited. The disease is wide in distribution, serious in harm, difficult to control and difficult to distinguish caused disease history symptoms, and is one of the most serious diseases in plant production. When environmental conditions favor the occurrence of root rot, the plant can be caused to produce a substantial reduction in yield or be dead. The root rot caused by Fusarium proliferatum is a kind of soil-borne disease, and occurs at home and abroad.

In recent years, molecular detection methods for Fusarium hierarchii have been developed. In 2010G mu ue et al used a part of calmodulin gene sequences (calmodulin gene sequences) to design specific primers for Fusarium delavayi (F. proliferum) isolated from Asparagus officinalis, and detected by general PCR. Huofang et al, in 2009, isolated Fusarium proliferatum (F. proliferum) from Camellia oleifera root rot, and designed specific primers according to ITS, with a sensitivity of up to 1pg, and a sensitivity of up to 100ag after nested pcr amplification. Riikka Peltomaa et al detected Fusarium in food in 2016 using Fusarium sensors, species-specific capture and detection probes, bound to the IGS region. The oligonucleotide functionalized magnetic microbead is used for capturing target DNA, and then the target DNA is detected by using a biotinylation detection probe and a streptavidin coupled label, wherein the detection sensitivity of the oligonucleotide functionalized magnetic microbead on Fusarium proliferatum (F.pr oligospora) can reach 2.0 pg. In 2012, Jonathan and the like design a probe of real-time fluorescence quantitative PCR by using Cal gene, and the sensitivity can reach 11 pg. Yan Wang et al utilized the TEF-1 alpha region as the target of LAMP detection in 2020, and the minimum detection concentration of the target gene was 10pg by SYBR Green I visual evaluation and agarose gel electrophoresis detection. Maria et al designed a probe for real-time fluorescent quantitative PCR based on TEF gene and could be used to infect Fusarium proliferatum in early stage of rice seed. The primers designed in these methods are mainly derived from conserved genes such as the transcribed spacer (ITS) or TEF gene. These regions or genes are high copy in the genome and are therefore easily detected. However, more and more researches show that the ITS sequences of part of phytophthora species have small difference, and primers designed by using the sequence as a target are difficult to distinguish different species. The specificity and sensitivity of different target sequence detection have certain difference, and the result has great difference due to different selected target sequences and different fragment sizes. Therefore, the discovery of target genes with good specificity is the core of the current detection technology of Fusarium japonicum.

Disclosure of Invention

Aiming at the problems of long period, poor specificity, low sensitivity and fewer specific detection targets of a detection method for Fusarium proliferatum (F.proliferatum) in the prior art, the invention provides a new detection target FPRO-09882 of Fusarium proliferatum (F.proliferatum) and an RPA-LFD detection primer composition based on the new detection target. Another object of the present invention is to provide the above kit for detecting RPA-LFD of Fusarium proliferatum (F.proliferatum).

In a first aspect, the present invention provides a fusarium proliferatum specific detection target FPRO _09882, wherein the protein sequence of the detection target is as shown in SEQ ID NO: 1, and the following components:

MRRVLGPIAHDKWKNKSTMIGWCLYRAEAGEFTHLLRHWNATEVETAGRLIAWGVPNFVLPALLGLPLAEARTGDDETIYRWVKDEERILEHQYDPFQEGRFNDGGSSADNGYGRSENPYRGRENISGPLGVTHVSARRGNSGSLQQDNRLQEERPGRAGNSTETSHETEAHTLGEIDGLGGFDNFGYREPSNRTRGEGPRSVGNGTKNPYKSNRDGLDR(SEQ ID NO.1)。

in another aspect, the invention provides a fusarium proliferatum-specific detection target FPRO _09882, wherein the nucleotide sequence of the detection target is set forth in SEQ ID NO: 2, as shown in the figure:

ATGCGACGCGTCCTCGGCCCCATCGCTCACGACAAATGGAAAAACAAGTCGACAATGATAGGCTGGTGTTTATATCGGGCTGAGGCCGGCGAATTTACTCACTTACTAAGGCATTGGAATGCTACAGAGGTGGAAACGGCTGGGAGGTTAATAGCATGGGGAGTACCAAATTTTGTCCTTCCAGCTCTGCTGGGTCTACCGTTGGCAGAGGCTCGAACCGGGGATGATGAGACGATTTACCGATGGGTGAAGGATGAAGAGAGGATACTGGAGCATCAATATGATCCGTTCCAAGAGGGGCGATTCAACGATGGTGGAAGCAGTGCCGACAATGGGTATGGGAGAAGTGAGAATCCGTATAGGGGACGGGAGAACATATCGGGGCCTTTGGGGGTGACTCACGTATCAGCAAGACGTGGGAACTCCGGGAGTTTGCAGCAAGACAATCGTCTTCAGGAGGAGAGACCCGGGAGGGCTGGTAACAGTACCGAGACGTCACATGAGACGGAAGCGCATACCTTGGGGGAGATAGACGGGCTAGGAGGTTTCGACAACTTTGGGTATAGGGAGCCAAGCAATCGTACCCGAGGAGAGGGACCCAGGAGTGTTGGTAACGGTACCAAGAACCCGTACAAGTCGAACCGGGATGGTTTAGACCGTTAA(SEQ ID NO.2)。

in another aspect, the invention also provides a primer and probe combination for detecting fusarium stratiotes, wherein the forward primer FPRO _09882F1 has the sequence shown in SEQ ID NO: 3, and the sequence of a reverse primer FPRO-09882R 1 is shown as SEQ ID NO:4, the sequence of the probe sequence FPRO-09882P is shown in SEQ ID NO: 5, respectively.

Fpro_09882F1:AACGGCTGGGAGGTTAATAGCATGGGGAGTACCA(SEQ ID NO：3)；

Fpro_09882R1:ATACGGATTCTCACTTCTCCCATACCCATTGTCG(SEQ ID NO：4)；

Fpro _09882P:5'-GCTCGAACCGGGGATGATGAGACGATTTACGATGGGT GAAGGATG-3' (SEQ ID NO: 5), which was labeled with FAM at the 5' end, modified with C3Spacer at the 3' end, and THF-modified at 30bp apart from the 5' end in the sequence of the probe.

In another aspect, the invention provides a kit for detecting Fusarium stratifying bacteria, comprising at least 1 dose of detection solution comprising the primer and probe combination described above.

Further, the kit further comprises: the kit comprises a twist Amp reaction unit tube filled with freeze-dried enzyme powder, a Buffer, MgAc, deionized water, a HybriDetect assay Buffer and a lateral flow chromatography test strip.

In another aspect, the invention also provides the specific detection target FPRO-09882, the primer and probe combination, and the application of the kit in detecting Fusarium proliferatum.

On the other hand, the invention also provides a method for detecting the layered Fusarium, which is characterized in that,

1) extracting DNA of a sample to be detected;

2) using DNA as a template, and carrying out RPA amplification by using the combination of the primers (SEQ ID NO.3 and SEQ ID NO.4) and the probe (SEQ ID NO.5) or the kit;

3) wherein the RPA amplification: to a 0.2ml LTwistAmp reaction unit tube (Twist enzymes nfo kits, Twist) containing lyophilized enzyme powder, 29.5. mu.L of Buffer, 2.1. mu.L of 10. mu.M upstream primer (SEQ ID NO.3), 2.1. mu.L of 10. mu.M downstream primer (SEQ ID NO.4), 0.6. mu.L of probe (SEQ ID NO.5), 2.0. mu.L of DNA, and 2.5. mu.L of MgAc were added inside the PCR tube cap, and deionized water was added to 50. mu.L; fully and uniformly mixing the RPA amplification system, centrifuging for 10s at 5,000 Xg, placing on a metal bath at 39 ℃ for reaction for 30min, incubating for 4 min, uniformly mixing the reaction tube again, centrifuging for 3-5s, and placing in a water bath kettle at 39 ℃ for further reaction for 30 min.

4) Detecting the RPA amplification product by using a lateral flow chromatography test strip;

mu.L of the RPA reaction product was diluted by adding 190. mu.L of HybriDetect assay buffer (Milenia Biotec, Giessen, Germany), and 10. mu.L of the diluted product was dropped onto a HybriDetect 1strip of a test strip. The other strip was inserted vertically into 100. mu.L of HybriDetect assay buffer and left at room temperature for 5 min.

When the test strip has two brown strips, one is positioned in the quality control area and the other is positioned in the detection area, the result is positive, and the sample contains Fusarium proliferatum (F.proliferum); when only the quality control area of the test strip has a brown strip and the detection area has no strip, the result is negative, which indicates that the sample does not contain Fusarium proliferatum (F.proliferatum).

Compared with the conventional PCR, the method has the advantages of high detection speed, no need of three steps of denaturation, annealing and extension, the optimum temperature of the RPA reaction is between 25 and 40 ℃, no need of denaturation, and the reaction can be completed at normal temperature for about 20 min. Thus, isothermal amplification is realized, thermal cycle is not necessary like a PCR method, dependence on a thermal cycle instrument is eliminated, stable heat source RPA reaction can be generated, the use range of RPA is greatly expanded, and portable field rapid nucleic acid detection can be really realized. The PCR reaction time needs 1 half hour, while the RPA reaction time only needs 15 minutes, thus greatly shortening the detection time.

Compared with the prior art, the invention has the beneficial effects that:

1) the invention provides a novel specific Fusarium stratifying molecule detection target FPRO-09882 with high reliability, and provides a novel detection way for detecting Fusarium stratifying.

2) The method can quickly, conveniently, efficiently, specifically and sensitively detect the layered fusarium under the isothermal condition, does not need complex instruments, can better meet the field detection of the layered fusarium, and has important effects on promoting the quick molecular detection research of the layered fusarium and the early diagnosis of diseases caused by the detection.

3) The detection method provided by the invention has high accuracy: according to the sequence of a new target FPRO-09882 for detecting fusarium laminariiformis, a specific detection primer and probe combination is designed, the target band is analyzed according to the detection result of an LFD lateral flow chromatography test strip, and the RPA detection concentration is 1 pg.mu.L^-1The sensitivity of the RPA lateral flow chromatography test strip detection method is 100 times higher than that of the PCR method.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments will be briefly described below.

FIG. 1 is a graph showing the results of interspecies-specific detection of an RPA-LFD lateral flow chromatography test strip based on a primer FPRO _14873 for detecting a layered Fusarium discovery target;

FIG. 2 is a graph showing the results of interspecies-specific detection of an RPA-LFD lateral flow chromatography test strip based on a newly discovered detection target FPRO-09882 of Fusarium sporogenes (F. proliferum);

FIG. 3 is a chart showing the results of intergeneric specificity of a lateral flow chromatography test strip based on RPA-LFD of a newly discovered detection target FPRO-09882 of Fusarium proliferatum (F.proliferum);

FIG. 4 is a diagram showing the result of sensitivity detection of a lateral flow chromatography test strip based on a designed specific primer RPA-LFD for detecting a new target FPRO-09882 newly discovered by Fusarium proliferatum;

FIG. 5 is a general PCR sensitivity-verified electrophoresis diagram of specific primers designed for the new discovery and detection of a new target FPRO-09882 of Fusarium proliferatum;

FIG. 6 is a graph showing the results of detection by an RPA-LFD lateral flow test strip of Fusarium proliferated in a living tissue.

Detailed Description

Embodiments of the present invention will be described in detail below with reference to the accompanying drawings. The following examples are only for illustrating the technical solutions of the present invention more clearly, and therefore are only examples, and the protection scope of the present invention is not limited thereby. It is to be noted that, unless otherwise specified, technical or scientific terms used herein shall have the ordinary meaning as understood by those skilled in the art to which the invention pertains.

Example 1

The present study was carried out on the basis of the whole genome sequence analysis of 17 Fusarium species such as Fusarium partially belonging to the genus Fusarium (F.proliferum, Fusarium circinatum, F.oxysporum, F.graminearum, F.solani, F.fujikuroi, F.odorationssimum, F.verteticiloides, F.odorationssimum, F.vannettenii, F.virgulforme, F.clavum, F.mangiferae, F.cerealis, F.redoles, F.sacchara, F.flexiforme, F.sporotrotrichioides, etc., the whole genome sequence search, sequence extraction, alignment and analysis were carried out, a large-scale genome database was excavated to discover the detection target of Phytophthora, F.proliferum specific detection target was obtained by whole genome alignment, F.proliferum specific detection target was obtained, and more than 1000 genes were selected as a candidate gene specific primer (1.1000 gene target gene) from the list, and the list was selected as a candidate gene (1.1000).

TABLE 1F sequence listing of 6 specific genes of proliferum pathogenic bacteria

Different species (Fusarium proliferatum), Fusarium verticillium, pine gum ulcer pathogen (f.circinatum), Fusarium granatum (f.fujikuroi), Fusarium solani (f.solani), Fusarium asiae (f.asiticum), and Fusarium oxysporum (f.oxysporum) were selected from among different species (Fusarium proliferatum), Fusarium verticillium, Fusarium oxysporum, and Fusarium oxysporum) to design each target primer for RPA-LFD detection.

Sample detection: to a 0.2mL Twist reaction unit tube (Twist p Basic kits, Twist) containing lyophilized enzyme powder, Buffer 29.5. mu.L, 10. mu.M upstream primer 2.1. mu.L, 10. mu.M downstream primer 2.1. mu.L, probe 0.6. mu.L, DNA 2.0. mu.L, MgAc 2.5. mu.L was added inside the PCR tube cap, and deionized water was made up to 50. mu.L; fully and uniformly mixing the RPA amplification system, centrifuging for 10s at 5,000 Xg, placing on a metal bath at 39 ℃ for reaction for 30min, incubating for 4 min, uniformly mixing the reaction tube again, centrifuging for 3-5s, and placing in a water bath kettle at 39 ℃ for further reaction for 30 min.

Negative control: the operation steps are the same as those of sample detection, 2.0 mu L of template DNA is changed into 2.0 mu L of sterilized ddH₂And O. And after the RPA reaction is finished, detecting the amplification product by using a lateral flow chromatography test strip. When two brown strips appear on the Test strip, one is positioned in a Control line (quality Control area) and the other is positioned in a Test line (Test line), the result is positive, and the sample contains the layered fusarium; when only the quality control area of the Test strip has a brown strip and the detection area (Test line) has no strip, the result is negative, which indicates that the sample does not contain Fusarium proliferatum.

The remaining 5 primers and probes designed to detect the target, exemplified by target FPRO — 14873, have the primer sequence: Fpro-14873F: AAACAGAGCGAACAAGTAAGACTAGGGTCGACGA (SEQ ID NO: 6); fpro _14873R: GTGGCACATTTTGCAACTCCCTAAGCGTGTCTTT (SEQ ID NO:7), different species from Fusarium stratifying (Fusarium stratifying), Fusarium verticillium (F.verticillium), Fusarium pini canker (F.circinatum), Fusarium gambosum (F.fujikuroi), Fusarium solani (F.solani), Fusarium asiainum (F.asiticum), Fusarium oxysporum (F.oxysporum), and the results of RPA-LFD detection show poor primer specificity based on FPRO _14873 target design, as shown in FIG. 1.

Considering the detection specificity and sensitivity of the molecular target comprehensively, the molecular detection target FPRO-09882 obtained by screening is a new detection target for fusarium solani and a specific primer and probe combination, wherein the forward primer sequence is shown as SEQ ID NO: 3, the reverse primer sequence is shown as SEQ ID NO.4, and the probe sequence is shown as SEQ ID NO: 5, respectively.

Example 2

In order to verify the specific primer sequence of the layered fusarium (f.proliferatum), this example uses the layered fusarium (f.proliferatum) strain and pathogenic fungi and other oomycetes as test materials (table 2), and extracts the DNA of the layered fusarium (f.proliferatum) in the diseased tissue by the CTAB method. The specific method comprises the following steps: adding 900 μ L2% CTAB extractive solution and 90 μ L10% SDS into a small amount of mycelium powder, mixing, and turning upside down every 10min in 60 deg.C water bath for 1 h. Centrifuging at 12000rpm for 10min, collecting supernatant, adding equal volume of phenol/chloroform/isoamyl alcohol (25: 24: 1), mixing by inversion, and centrifuging at 12000rpm for 10 min; the supernatant was transferred to a new tube, added with an equal volume of chloroform, mixed by gentle inversion and centrifuged at 12000rpm for 5 min. The supernatant was transferred to a new tube, 2 volumes of absolute ethanol and 1/10 volumes of 3M NaAc (pH 5.2), precipitated at-20 ℃ (>1 h). Centrifuging at 12000rpm for 10min, decanting the supernatant, washing the precipitate with 70% ethanol twice, and air drying at room temperature. Adding appropriate amount of sterilized ultrapure water or TE (pH 8.0) to dissolve precipitate (containing 20 μ g/mL RNase), treating at 37 deg.C for 1h, and storing at-20 deg.C for use.

TABLE 2 fungal and oomycete strains for detection of Fusarium delavayi (F. proliferum) RPA-LFD

The assay was carried out according to the method of example 1, and the assay results are shown in FIGS. 2 to 3.

FIG. 2 is a graph showing the results of an RPA-LFD lateral flow chromatography test strip specific assay based on the novel discovery of a novel target FPRO-09882 by Fusarium delaminate (F. proliferatum); 1, 2, Fusarium proliferatum (Fusarium proliferatum); 3, pine resin ulcer pathogenic bacteria (f. circinatum); 4, fusarium granatum (f. fujikuroi); fusarium solani (f.solani); 6, fusarium verticillium (f. verticillium iodides); fusarium asiaticum (f.); 8, N negative control. Fig. 2 shows that there are 2 bands in No. 1, one of which is a Control Line (Control Line), one of which is a detection Line (Test Line), and thus is positive, and the other bands having only one Control Line (Control Line) are negative, indicating that the sample contains fusarium laminarium (f.proliferum); the newly discovered detection target FPR O _09882 has interspecies specificity.

FIG. 3 is a chart showing the detection results of the intergeneric specificity detection of an RPA-LFD lateral flow chromatography test strip based on the high reliability specificity molecule detection new target FPRO _ 09882; 1: fusarium sporophorum (f. proliferatum); 2: pythium ultimum (Pythium ultimum); 3: phytophthora syringae (Phytop hthora syringae); 4: colletotrichum truncatum (Colletotrichum truncatum); 5: verticillium dahliae (Verticillium dahliae); 6: rhizoctonia solani (Rhizoctonia solani); 7: rice blast (Magnaporthe grisea); 8: negative control; FIG. 3 shows 2 bands in lane 1, one of which is a Control line and the other is a detection line, and thus is positive, indicating that the sample contains Fusarium proliferatum; the remaining bands with only one Control line (Control line) were negative. The new discovery detection target FPRO-09882 is shown to have intergeneric specificity. Therefore, after the primer designed in the embodiment 1 is used for carrying out the RPA amplification reaction, the detection result of the LFD lateral flow chromatography test strip shows 2 brown bands, and the target band is analyzed, so that Fusarium proliferatum can be effectively detected. While other fungi and oomycetes only have a brown band in the quality control area, and the negative control only has a brown band in the quality control area.

Example 3

After the amplification reaction of RPA of the present invention using the genomic DNA of the standard strain of Fusarium stratified at the same concentration as the amplification template, the detection result of LFD lateral flow chromatography test strip was analyzed as the target band shown in FIG. 4. Therefore, the detection result of the RPA lateral flow chromatography test strip detection method based on the newly discovered target FPRO _09882 is shown in FIG. 4, and the sensitivity is 1 pg. mu.L^-1The PCR detection result is shown in FIG. 5, and the detection concentration is 100 pg. mu.L^-1Target bands were seen indicating that the sensitivity of RPA detection was higher than that of PCR. The RPA detection time is only 30min, expensive instruments such as a PCR instrument and the like are not needed, the operation procedure is simple and convenient, and the method is more favorable for popularization and application in production.

Example 4

The DNA of the diseased pine needles inoculated with fusarium is extracted by adopting an NaOH alkaline lysis method and is used as a template for PCR amplification. Using 1uL of the DNA solution, the RPA-LFD assay was performed in the same manner as in example 3. The results are shown in fig. 6, which shows the test results as 1 from the left to the right, and the DNA extracted from fusarium solani (f. proliferatum) was used as a positive control; 2-4 artificially inoculating DNA extracted from pine needles (Cedrus dedara) of Fusarium (F.proliferum); 5-7 DNA extracted from pine needles (Cedrus deodara) artificially inoculated with agar blocks; 8 DNA extracted from pine needles (Cedrus deodara); 9 sterile water (negative control).

After RPA amplification reaction, the detection result of the LFD lateral flow chromatography test strip shows that the diseased pine needles (2, 3 and 4) inoculated with the layered fusarium can display 2 brown bands, and the target bands are analyzed and can effectively detect the layered fusarium. While other fungi and oomycetes only have a brown band in the quality control area, and the negative control only has a brown band in the quality control area.

Unless specifically stated otherwise, the numerical values set forth in these examples do not limit the scope of the invention. In all examples shown and described herein, unless otherwise specified, any particular value should be construed as merely illustrative, and not restrictive, and thus other examples of example embodiments may have different values.

Sequence listing

<110> Nanjing university of forestry

<120> specific detection target FPRO-09882 of Fusarium proliferatum and application thereof

<130> 2021

<160> 20

<170> SIPOSequenceListing 1.0

<210> 1

<211> 220

<212> PRT

<213> Fusarium proliferatum (Fusarium proliferatum)

<400> 1

Met Arg Arg Val Leu Gly Pro Ile Ala His Asp Lys Trp Lys Asn Lys

1 5 10 15

Ser Thr Met Ile Gly Trp Cys Leu Tyr Arg Ala Glu Ala Gly Glu Phe

20 25 30

Thr His Leu Leu Arg His Trp Asn Ala Thr Glu Val Glu Thr Ala Gly

35 40 45

Arg Leu Ile Ala Trp Gly Val Pro Asn Phe Val Leu Pro Ala Leu Leu

50 55 60

Gly Leu Pro Leu Ala Glu Ala Arg Thr Gly Asp Asp Glu Thr Ile Tyr

65 70 75 80

Arg Trp Val Lys Asp Glu Glu Arg Ile Leu Glu His Gln Tyr Asp Pro

85 90 95

Phe Gln Glu Gly Arg Phe Asn Asp Gly Gly Ser Ser Ala Asp Asn Gly

100 105 110

Tyr Gly Arg Ser Glu Asn Pro Tyr Arg Gly Arg Glu Asn Ile Ser Gly

115 120 125

Pro Leu Gly Val Thr His Val Ser Ala Arg Arg Gly Asn Ser Gly Ser

130 135 140

Leu Gln Gln Asp Asn Arg Leu Gln Glu Glu Arg Pro Gly Arg Ala Gly

145 150 155 160

Asn Ser Thr Glu Thr Ser His Glu Thr Glu Ala His Thr Leu Gly Glu

165 170 175

Ile Asp Gly Leu Gly Gly Phe Asp Asn Phe Gly Tyr Arg Glu Pro Ser

180 185 190

Asn Arg Thr Arg Gly Glu Gly Pro Arg Ser Val Gly Asn Gly Thr Lys

195 200 205

Asn Pro Tyr Lys Ser Asn Arg Asp Gly Leu Asp Arg

210 215 220

<210> 2

<211> 663

<212> DNA

<213> Fusarium proliferatum (Fusarium proliferatum)

<400> 2

atgcgacgcg tcctcggccc catcgctcac gacaaatgga aaaacaagtc gacaatgata 60

ggctggtgtt tatatcgggc tgaggccggc gaatttactc acttactaag gcattggaat 120

gctacagagg tggaaacggc tgggaggtta atagcatggg gagtaccaaa ttttgtcctt 180

ccagctctgc tgggtctacc gttggcagag gctcgaaccg gggatgatga gacgatttac 240

cgatgggtga aggatgaaga gaggatactg gagcatcaat atgatccgtt ccaagagggg 300

cgattcaacg atggtggaag cagtgccgac aatgggtatg ggagaagtga gaatccgtat 360

aggggacggg agaacatatc ggggcctttg ggggtgactc acgtatcagc aagacgtggg 420

aactccggga gtttgcagca agacaatcgt cttcaggagg agagacccgg gagggctggt 480

aacagtaccg agacgtcaca tgagacggaa gcgcatacct tgggggagat agacgggcta 540

ggaggtttcg acaactttgg gtatagggag ccaagcaatc gtacccgagg agagggaccc 600

aggagtgttg gtaacggtac caagaacccg tacaagtcga accgggatgg tttagaccgt 660

taa 663

<210> 3

<211> 34

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 3

aacggctggg aggttaatag catggggagt acca 34

<210> 4

<211> 34

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 4

atacggattc tcacttctcc catacccatt gtcg 34

<210> 5

<211> 45

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 5

gctcgaaccg gggatgatga gacgatttac gatgggtgaa ggatg 45

<210> 6

<211> 660

<212> DNA

<213> Fusarium proliferatum (Fusarium proliferatum)

<400> 6

atgagccaag agctaaatga caagcagttt taccaagctt cggccccatt attaacgatc 60

gaaaggaaag catttatcaa tgctacatgg aagtcttcca aagccttcaa cgaatttgaa 120

ttgtcaggct actttaggtt ccttgaaaca gagcgaacaa gtaagactag ggtcgacgat 180

cccgcatact ctcacctttg ttttaaacac attttcgaca ttcaaagtat tctctacgaa 240

aacctcaatg aacctccgct acgcctacaa gacttagtcc aaagaagctt agtcttgtgg 300

gaactagagc tcgaagtcgt tcaggactta atcattctcg ttattaagtt aacatttatg 360

gttcgggccg agttcccaaa ctcctactcg catccttcgc cattccaaat gcagatgcaa 420

gacaaccaaa gccttaaaga cacgcttagg gagttgcaaa atgtgccacc tttacagaat 480

ttgggtacac aaaatgagct gccgtcgtgg tttaatgtta ttgatctgga gaaaaaggct 540

aacctgagaa ttggttggac tgaccatctt gatgaacatc tgactttcca aagtggaact 600

cttgtgatat ttcgacatat cgcagtcctc atgtatatga gagaatcagg aatcttgtga 660

<210> 7

<211> 34

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 7

aaacagagcg aacaagtaag actagggtcg acga 34

<210> 8

<211> 34

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 8

gtggcacatt ttgcaactcc ctaagcgtgt cttt 34

<210> 9

<211> 660

<212> DNA

<213> Fusarium proliferatum (Fusarium proliferatum)

<400> 9

atgactcgat tcagcaccac ggtagaagat gttcagaaca tcccgcaagg cggtgttagg 60

ctactcttac gtagagagaa tgctggagaa acagacactt ggtatgagga ggatttcgat 120

catcttgtcg tcgcgacggg ccacaacagt gtcccccgcg tgcccaagat acccggcctc 180

gaggcctgga acggaagcct gcaacatgcc tccacatggc gatcggcaca agagttcaag 240

ggcaagaaaa tcttagtggt cggtaccagt gagagtgcca tcgatctcgt tcttcagtct 300

cttcctcatg ccaagggcga tattcatgtg tctcaaagaa aaccgcaccc ccggtatcct 360

aacgtgtttg atcggcctgg cgtcaaactc gtgaccacga ttgaccattt taccgaagac 420

tctattcatc tagatgacgg ttctgtcttg ggaggcatcg atgtggtagt ttttgcgacg 480

gggtacttct acacgtaccc cttcctctcg aatgtccgcc cacctgtatc ctgcaggagt 540

ttagtctgtc ctgagagaga aaaacaagta gggtcgccaa tgcgtccaaa tttaacctgc 600

aaagcaacaa caaagggaaa ctggagctat ttcttaatcc gatggggttc aatcaactag 660

<210> 10

<211> 34

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 10

caacagtgtc ccccgcgtgc ccaagatacc cggc 34

<210> 11

<211> 34

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 11

cacatcgatg cctcccaaga cagaaccgtc atct 34

<210> 12

<211> 651

<212> DNA

<213> Fusarium proliferatum (Fusarium proliferatum)

<400> 12

atgtttgtat cagaaatcat cagccctctc ctcctcgtcg ccagcgccgc actggcggct 60

gccaatcctc agccctcctt tgcggctgtt gtggctcccc gtctgcaggt ttccgtcgaa 120

gcagtcgacg aactcctgat gagcaacact actgagcatc tcacaagcat tgatatcgcc 180

aaatgggctc ctgctctcgg gcagccagtc gaggttctca ccagcttgga ctctgaaacc 240

aagttcaagg tgttctattt cctccaccaa gccatttccg aggggcctgg atcgctttct 300

aagcgtgacc aggcgactgc tgataaagat gccgccatca tcagggagaa ggcagaatcc 360

taccaaagca cagtcacagt tgaggcagcg gaagatgagc ttcgttgcca gaataccgct 420

tcttgtgttc tctgtatcgg tgcagctgca actaccgcgg gaggtctcat ttcttcatgc 480

tctgcagttg cactacgagc caacaacctt cgtgttgcag gaaacgctag cccaacagct 540

gccgaggtta gcggtgctgt cattatcgcg gagctcttag catgcgccgc caagcctctt 600

accggtttcc tcgttgctac tggtgtctgc ctcaaggtta caggccatta a 651

<210> 13

<211> 34

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 13

acactactga gcatctcaca agcattgata tcgc 34

<210> 14

<211> 34

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 14

gacctcccgc ggtagttgca gctgcaccga taca 34

<210> 15

<211> 507

<212> DNA

<213> Fusarium proliferatum (Fusarium proliferatum)

<400> 15

atggcaactc cgatttccca agaaccctct gggccgtgtt cagaacaaga acaaatgaat 60

gaaatgtcta gaaatttcta ttacgttaga aagagagaag tccgtatgtt tccaggcgca 120

acggctttgc taaaaatgtc gattcagaag tacatggcga agtacgaggt agaatttatg 180

gatgacgacc aaaagcttcg cgttttgctg cctctggatg tgaataggga ggactctgat 240

aagaaattcc aactgctgat ggaaatgccc gataatatga agaaggcgaa gcttttgacc 300

ttctttcgtg tcgatacgat caaggaattc gaaaaacatg tccagatgac agagatctct 360

atcttaggcc tcgaaaggag aaatacctgc acaagtcgga gaggcaggac ctcaaagatc 420

aacgagattt ctagcaatac acaaggcaga actggcaaaa cagaaacaaa ttcagggaga 480

atagaagagc tgagactcag gagctag 507

<210> 16

<211> 34

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 16

aatttctatt acgttagaaa gagagaagtc cgta 34

<210> 17

<211> 34

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 17

gatcgtatcg acacgaaaga aggtcaaaag cttc 34

<210> 18

<211> 558

<212> DNA

<213> Fusarium proliferatum (Fusarium proliferatum)

<400> 18

atgcctcgta attcgtctcg cagaaagtct cgccgcagcg agaggtctgc ttcccagtct 60

acacctgagt ctacatcccc atctgcaacc ccgcctactt cacaggattc cccgcgccct 120

cggtcttcga gaccgaccac tcccggctct tcaggccctc agtcttcgag accgaccact 180

cccggctctt caggccctca gtctccctgg tcaagcggct ttgaggaaca gggtgtaact 240

ggtctgccca gtcctccagc atcacaatct ccgtctcttg gaacctcgag ccctgctaat 300

gtcgctctat catcctctgg aatctcaaca ccatcaattg aggaacatga accttatcgc 360

tccgccactc cgatagagga tatgactgca cccccatcta cgactgctag tcagtcgtcg 420

gccaaatcta ttaaggctga ccctttggag gatgaaactc tacccaacga tcaggataca 480

ggctacgtga tcgagacaat ttaccttctc cattccaaag ccatctggag ttacatccag 540

ttcatacttg ggaactag 558

<210> 19

<211> 34

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 19

gctcttcagg ccctcagtct tcgagaccga ccac 34

<210> 20

<211> 34

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 20

agatgggggt gcagtcatat cctctatcgg agtg 34

Claims

1. A fusarium proliferatum-specific detection target FPRO _09882, wherein the protein sequence of the detection target is set forth in SEQ ID NO: 1 is shown.

2. A fusarium proliferatum-specific detection target FPRO _09882, wherein the nucleotide sequence of said detection target is set forth in SEQ ID NO: 2, respectively.

3. A primer and probe combination for detecting Fusarium stratifying, which is characterized in that the primer comprises a forward primer and a reverse primer, and the sequence of the forward primer is shown as SEQ ID NO: 3, and the reverse primer sequence is shown as SEQ ID NO:4, and the probe sequence is shown as SEQ ID NO: 5, respectively.

4. A kit for detecting Fusarium stratifying bacteria, comprising at least 1 dose of a detection solution comprising the primer and probe combination of claim 3.

5. The kit of claim 4, further comprising: a Twist Amp reaction unit tube filled with freeze-dried enzyme powder, a Buffer, MgAc, deionized water, a HybriDetect assay Buffer and a lateral flow chromatography test strip.

6. Use of the specific detection target FPRO _09882 of claim 1 or 2, the primer and probe combination of claim 3, and the kit of claim 4 or 5 for detecting fusarium solani.

7. A method for detecting a layered Fusarium species,

1) extracting DNA of a sample to be detected;

2) performing RPA amplification using the primer and probe combination of claim 3 or the kit of claim 4 using DNA as a template;

3) detecting the RPA amplification product by using a lateral flow chromatography test strip; when the test strip has two brown strips, one is positioned in the quality control area, and the other is positioned in the detection area, the result is positive, and the fusarium laminariiformis is contained in the sample; when only the quality control area of the test strip has a brown strip and the detection area has no strip, the result is negative, which indicates that the sample does not contain Fusarium proliferatum.