CN104774955A - Botryosphaeria dothidea detection method - Google Patents
Botryosphaeria dothidea detection method Download PDFInfo
- Publication number
- CN104774955A CN104774955A CN201510201075.0A CN201510201075A CN104774955A CN 104774955 A CN104774955 A CN 104774955A CN 201510201075 A CN201510201075 A CN 201510201075A CN 104774955 A CN104774955 A CN 104774955A
- Authority
- CN
- China
- Prior art keywords
- primer
- probe
- detection
- dothidea
- stevensii
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
Abstract
The invention relates to a botryosphaeria dothidea detection method, and in particular relates to a triplex real-time fluorescent polymerase chain reaction (PCR) detection method for botryosphaeria dothidea, belonging to the technical field of inspection and quarantine. According to the method disclosed by the invention, three groups of botryosphaeria dothidea specific primers and probes are designed and a reaction system is optimized, so that a triplex real-time fluorescent quantitative PCR detection method is established, and the detection method can be used for simultaneously detecting and identifying multiple pathogenic fungi and determining a composite invading pathogen. By applying nano magnetic microparticles to the extraction of fungal nucleic acid, the fungal nucleic acid extraction is simpler and more efficient in operation; and meanwhile, in combination with a real-time fluorescent detection technology, the detection method is applicable to the monitoring of disease occurrence in fields as well as the rapid and high-throughput detection and identification of pathogenic bacteria.
Description
Technical field
The present invention relates to the detection method of a kind of grape seat chamber bacterium, refer in particular to triple real-time fluorescence PCR detection methods of grape seat chamber bacterium, belong to inspection and quarantine technical field.
Background technology
Grape seat chamber Cordycepps (Botryosphaeriaceae) fungi host range is extensive, do not exist only in soil and parasitize healthy plant as endogenetic fungus yet, run into control environment condition and just infect plant initiation disease, cause plant that the diseases such as withered, rotten and ulcer occur.Apple shell look list is every spore ulcer bacteria (Botryosphaeriastevensii and Botryosphaeria obtusa, Botryosphaeria dothidea) be China Import quarantine harmful organism, produce the multiple fruit trees such as toxin serious harm apple, pears, grape, huge financial loss is caused to Apple Industry.
Accurate, the rapid detection qualification of pathogenic bacteria is that research disease occurs, the important foundation of development and group structure, but utilize traditional pathogenicbacteria separation method to carry out isolation identification to the sick sample in field, need to consume the plenty of time, require that appraiser possesses the pathogen identification technical ability of specialty simultaneously.The Perfect stage feature that grape seat chamber bacterium can be used for classifying is less, and very difficult culture medium culturing, therefore identify that grape seat chamber bacterium is mainly identified according to its Invisible element feature at present, but this genus fungi Invisible element feature is unstable, easily by the impact of envrionment conditions.Therefore, exploitation is a kind of to such fungi detection method fast and accurately, carries out monitoring have great importance to the generation development of field diseases.
Chinese patent application 201210229358, denomination of invention " grape ulcer bacterium rapid detection primer and application thereof " disclose a kind of technology utilizing round pcr to detect grape ulcer bacterium, which use Auele Specific Primer group, good Detection results can be had to multiple grape ulcer bacterium and Spike-stalk Brown Spot of Grape bacterium, grape branch rot bacterium, grape anthracnose, Botrytis cinerea, fruit white rot of grape bacterium, grape didymella bryoniae.
(the multiplex PCR detection technique of dothiorella gregaria cause of disease such as Feng little Hui, 2012) disclose and utilize multiplex PCR detection technique to detect 4 kinds of dothiorella gregaria pathogenic strains (Botryosphaeria dothidea, Valsasordida, Leucostoma sp., Valsa ambiens) achieve good Detection results.But the method still uses traditional round pcr, need to carry out isolation identification to pcr amplification result, therefore needing the discrimination considering amplified production when designing primer, the present invention three kinds of pathogenic bacterias to be measured can not be suitable for simultaneously, thus constrain related application.
Real-time fluorescence PCR technology is a kind of nucleic acid quantitation technique grown up on Standard PCR basis, utilizes the real-time monitoring of the accumulation of fluorescent signal realization to whole PCR process.Whole reaction is carried out under an airtight state, does not need to carry out follow-up test and just can obtain result, effectively reduce the crossed contamination of sample room, highly sensitive, is just being widely used at present in the Testing and appraisal of pathogenic bacteria and virus.
Chinese patent application 200910236112, denomination of invention " detect the primer of grape bitter rot bacterium and probe and detection method thereof " and Chinese patent application 201310631946, denomination of invention " the real-time PCR detection reagent of grape Phoma asparagi Sacc and detection method " all disclose the technology of quantitative fluorescent PCR specific detection grape epidemic disease, wherein by designing the combination of high specific primer and highly sensitive fluorescent probe, good Detection results can be obtained.
Huanghai Sea spring (" progress that Real-Time Fluorescent Quantitative PCR Technique is applied in Plant Quarantine ", " hubei agricultural science ", 2012) report Real-Time Fluorescent Quantitative PCR Technique be widely used in fungus-caused plant pest detect in, but this article points out still do not have suitable real-time fluorescence PCR technology to detect three kinds of grape seat chamber bacterium (B.stevensii at present, B.obtusa, B.dothidea).
Although multiple fluorescence PCR method has the advantage that conventional multiplex PCR does not have, its fluorophor limited amount used, also can there is fluorescence in quencher dyes or group, thus cause certain interference.In addition, affecting the most important factor of multiplex PCR is consistency between multi-primers.Be ideally that all primer pairs have identical amplification efficiency and melting temperature(Tm), complementary strand could be separated so at the same temperature, and amplification could be carried out simultaneously, and it is identical or close as far as possible to address this problem most importantly primer annealing temperature.Therefore, annealing temperature and time and the time of extension comparatively obvious on amplification impact, and cycle index impact is less.Described in comprehensive, along with primer pair increases, the melting temperature(Tm) difference of each primer pair is excessive, and selects inappropriate fluorescent probe and quenching group, and multiplex PCR difficulty also can increase, thus have impact on the accuracy in detection of multiple fluorescence PCR,
Due to the production of above three kinds of grape Zuo Qiangjun serious harm China Apple Industries, be therefore badly in need of a kind of real-time fluorescence PCR technology at present and effectively detect above three kinds of grape seat chamber bacterium.
Summary of the invention
The principle of the invention is the primer selecting particular design, and abandons the fluorophor using identical type, and designs dissimilar fluorophor to modify probe, thus provides new detection method for Multiplex real-time PCR detects grape seat chamber bacterium.Therefore, the technical problem to be solved in the present invention is to provide the technology that one is quick, accurate, high-throughput triple fluorescent quantitative PCR detects three kinds of grape seat chambeies bacterium (B.stevensii, B.obtusa, B.dothidea).
Therefore, the present invention's first object is the detection composition providing a kind of triple fluorescent quantitative PCR, comprising:
B.stevensii primer Bst-F:TCATCGAGAAGTTCGAGAAGGTAAG (SEQ ID No.1)
B.stevensii primer Bst-R:CAAGTGCGGCCAGTTTGC (SEQ ID No.2)
b.stevensii probe Bst-T:TGCGCTTATCTGCCGCCGTG (SEQ ID No.3)
B.obtusa primer Bob-F:TCATCGAGAAGTTCGAGAAGGTAAG (SEQ ID No.1)
B.obtusa primer Bob-R:CAAGTGCGGCCAGTTTGC (SEQ ID No.2)
b.obtusa probe Bob-T:ACAGCCCACCTTATCGCTCGGTGAG (SEQ ID No.4)
B.dothidea primer Bod-F:TCATCGAGAAGTTCGAGAAGGTAAG (SEQ ID No.1)
B.dothidea primer Bod-R:GGAGATTTTGCCGAAGACCA (SEQ ID No.5)
b.dothidea probe Bod-T:ACATTTTCTGTGCCTGCACGTGTGCTG (SEQ ID No.6).
In one embodiment, article three, the fluorophor of probe mark is respectively FAM (being applicable to probe Bst-T), NED (being applicable to probe Bob-T), JOE (being applicable to probe Bod-T), and corresponding quenching group is BHQ1, BHQ2, BHQ1.
In a specific embodiment, described B.stevensii probe Bst-T, fluorophor and 3 ' the end quenching group of 5 ' end mark are FAM, BHQ1; The fluorophor that B.obtusa probe Bob-T marks and quenching group are NED, BHQ2; The fluorophor that B.dothidea probe Bod-T marks and quenching group are JOE, BHQ1.
The present invention's second object is to provide and utilizes above-mentioned detection composition, detects the method for three kinds of grape seat chamber bacterium for triple fluorescent quantitative PCR.
In one embodiment, said method comprising the steps of:
(1) sample to be tested is gathered;
(2) sample genomic dna is extracted;
(3) detect by multiple real time fluorescence PCR method;
Wherein, described three kinds of grape seat chamber bacterium are selected from B.stevensii, B.obtusa, B.dothidea.
In one embodiment, wherein said step (1) gathers sample to be tested, refers to and gets plant site of pathological change tissue or fungi is ground fully in beveller, get 100mg lapping liquid and carry out total DNA extraction.
In another embodiment, wherein said step (2) extract sample genomic dna, be adopt be magnetic bead extraction method.Key step is as follows: get lapping liquid and be positioned in 1.5mL centrifuge tube; In centrifuge tube, add 600 μ L lysates, vortex concussion mixing 15s, room temperature leaves standstill 10min, the centrifugal 2min of 12000rpm; Get 200 μ L supernatants in new centrifuge tube, add 200 μ L magnetic beads, concussion mixing, leaves standstill 10min, collects magnetic bead, abandons supernatant; Add 500 μ L washingss, abandon waste collection magnetic bead; Add 500 μ L absolute ethanol washings, abandon waste collection magnetic bead; Add 70% washing with alcohol, abandon waste collection magnetic bead; Add 50TE buffer to dissolve, Aspirate supernatant is in new EP pipe, for subsequent use.
In another embodiment, wherein said step (3) multiple real time fluorescence PCR method detects, and refers to react with following primer and probe sequence: identify that B.stevensii primer is Bst-F and Bst-R, probe is Bst-T; Identify that B.obtusa primer is Bob-F and primer Bob-R, probe is Bob-T; B.dothidea primer is Bod-F and Bod-R, and probe is Bod-T.In a specific embodiment, wherein said step (3) multiple real time fluorescence PCR method detects, and refers to react with following primer and probe sequence:
B.stevensii primer Bst-F:TCATCGAGAAGTTCGAGAAGGTAAG (SEQ ID No.1)
B.stevensii primer Bst-R:CAAGTGCGGCCAGTTTGC (SEQ ID No.2)
B.stevensii probe Bst-T:TGCGCTTATCTGCCGCCGTG (SEQ ID No.3)
B.obtusa primer Bob-F:TCATCGAGAAGTTCGAGAAGGTAAG (SEQ ID No.1)
B.obtusa primer Bob-R:CAAGTGCGGCCAGTTTGC (SEQ ID No.2)
B.obtusa probe Bob-T:ACAGCCCACCTTATCGCTCGGTGAG (SEQ ID No.4)
B.dothidea primer Bod-F:TCATCGAGAAGTTCGAGAAGGTAAG (SEQ ID No.1)
B.dothidea primer Bod-R:GGAGATTTTGCCGAAGACCA (SEQ ID No.5)
B.dothidea probe Bod-T:ACATTTTCTGTGCCTGCACGTGTGCTG (SEQ ID No.6).
In above-mentioned arbitrary embodiment, wherein said real-time fluorescence quantitative PCR reaction system cumulative volume is 25 μ L, three kinds of fungal DNA templates increase simultaneously and can produce interference, are optimized whole reaction system, and final multiple real time fluorescence PCR method detection reaction system is as follows:
Sample genomic dna 2 μ L;
2xTaqman Express PCR Master Mix(Applied Biosystems,USA)，12.5μL；
B.stevensii probe Bst-T:0.25 μ L, concentration is 10 μm of ol/L;
B.obtusa probe Bob-T:0.25 μ L, concentration is 10 μm of ol/L;
B.dothidea probe Bod-T:0.25 μ L, concentration is 10 μm of ol/L;
B.stevensii primer Bst-F:1 μ L, concentration is 10 μm of ol/L;
B.stevensii primer Bst-R:0.5 μ L, concentration is 10 μm of ol/L;
B.dothidea primer Bod-R:0.5 μ L, concentration is 10 μm of ol/L;
RNase-free Water，7.75μL。
In above-mentioned arbitrary embodiment, the reaction conditions that wherein step (3) multiple real time fluorescence PCR detects is 95 DEG C of denaturation 10min; 95 DEG C of sex change 30s, 60 DEG C of annealing/extension 1min, totally 40 circulations.In the enterprising performing PCR amplification of ABI7900HT (Applied Biosystems, USA) fluorescing system, Ct value is calculated automatically by SDS 2.4software.
The present invention's the 3rd object is to provide above-mentioned detection composition, for the preparation of the purposes of the testing product of detection three kinds of grape seat chambeies bacterium (B.stevensii, B.obtusa, B.dothidea).
In one embodiment, described testing product comprises: detection reagent, detection kit, detection chip etc.
Test-results availability deciding of the present invention:
There is amplification curve and Ct value in FAM layer, and NED, JOE layer is without amplification curve and Ct value <35, then judge that detecting sample carries B.stevensii and do not contain B.obtusa, B.dothidea;
There is amplification curve and Ct value <35 in NED layer, and FAM, JOE layer is without amplification curve and Ct, then judge that sample carries B.obtusa and do not contain B.stevensii, B.dothidea;
There is amplification curve and Ct value <35 in JOE layer, and FAM, NED layer is without amplification curve and Ct, then judge that detecting sample carries B.dothidea and do not contain B.stevensii, B.obtusa;
All there is amplification curve and Ct value <35 in FAM, NED, JOE, then judges that detecting sample carries three kinds of fungies.
Term and principle
Generally speaking, the multiple connotation of Multiplex real-time PCR has two kinds: one to be select conservative probe and primer, utilizing different dye marker probes, can judge different products when detecting according to the color of fluorescence.Another kind of for selecting conservative primer, the object fragment of amplification different lengths, add different probes in reaction, wherein this probe should be modified with the fluorophor of identical type, finally judges different products according to the Tm value of different object fragment.But, the present invention has above two types concurrently, that is: 1. except for except the reverse primer difference of B.dothidea, the forward primer of three kinds of primers to be measured is identical for guarding with reverse primer, by designing general primer, the interference between different primers can be prevented to a certain extent, improve the consistency between multi-primers; 2. add different probes in reaction, and this probe modification there is dissimilar fluorophor.Wherein, fluorophor FAM and JOE belongs to green Fluoresceincarboxylic acid, and NED probe belongs to yellow fluorescence element.
" nanometer magnetic bead ", for a kind of surface is with the super-paramagnetism nano microballoon of carboxyl, general diameter is less than 500-1000nm.Its inside is a superminiature magnetic core, under outside the action of a magnetic field, the biomolecules of absorption can be driven to carry out displacement.The company of nanometer magnetic bead commercially available at present has: Promega, Roche etc.
" testing product " refers to the common product for correlation detection or carrier format, and it includes but not limited to detection reagent, detection kit, detection chip etc.
" annealing temperature " be primer and template in conjunction with time temperature parameter, the primer when 50% and complementary sequence show as temperature during double chain DNA molecule, and it affects the specific more important factor of PCR.For multiplex PCR, ideally that all primer pairs have identical amplification efficiency and melting temperature(Tm), complementary strand could be separated so at the same temperature, amplification could be carried out simultaneously, and it is identical or close as far as possible to address this problem most importantly primer annealing temperature, if annealing temperature difference will affect its effect of unwinding more than 0.5 DEG C, systematic error will be caused more than more than 1 DEG C, cause occurring false negative or false positive results, more than more than 3 DEG C by severe jamming test-results.Therefore, annealing temperature and time and the time of extension comparatively obvious on amplification impact, and cycle index impact is less.But, the present invention should ensure that each primer specificity combines thus unavoidably occurs that annealing temperature is poor, also the interference effect of annealing temperature difference to test will be taken into account, therefore by repetition test and optimization, final design efficient specific primer Bst-F, Bst-R, Bod-R, its annealing temperature is respectively 59.1 DEG C, 60 DEG C, 58.7 DEG C, and probe Bst-T, Bob-T, Bod-T annealing temperature is respectively 68.2 DEG C, 68.9 DEG C, 70.5 DEG C, experiment results proved its there is good discrimination and susceptibility, accuracy.
Technique effect
The present invention devises three groups of grape seat chamber bacterium Auele Specific Primers and probe, and is optimized reaction system, establishes triple real-time fluorescence quantitative PCR detection method, can the simultaneously multiple pathogenic fungi of Testing and appraisal and determine Combined Infection cause of disease.Nano magnetic particulate applies to, in fungal nucleic acid extraction, fungal nucleic acid be extracted more simple to operate, efficient, combine simultaneously with real-time fluorescence detection technique by the present invention, can be used for field diseases and monitoring and quick, the high-throughout Testing and appraisal of pathogenic bacteria occur.
The invention has the beneficial effects as follows:
(1) fungal gene group and real-time fluorescence PCR technology in nanometer magnetic bead separation and Extraction plant tissue organically combine by the present invention, can separation purification of epiphyte DNA quickly and efficiently, effectively avoid the toxic reagent contact contacted in the conventional nucleic acid leaching process such as phenol chloroform extraction method, operation is more simple, quick, nucleic acid purity is high, effectively can improve the recall rate of pathogenic bacteria.
(2) the present invention is according to grape seat chamber bacterium EF1a gene conserved regions, devise three groups of real-time fluorescence PCR Auele Specific Primers and probe, the interference that specificity is good, highly sensitive, overcome annealing temperature difference, in conjunction with the real-time PCR detection system of autonomous design, realize grape seat chamber bacterium three kinds of fungi detection by quantitative, detectability can reach 10
-3ng/ μ L.
(3) the present invention breaches the thinking about probe and fluorophor design in traditional multiple fluorescence PCR technology, select fluorescent probe and the group thereof of particular combination, this combination has the advantage of tradition two kinds of modes concurrently, and compared to conventional array mode, it has higher sensitivity and accuracy rate.
(4) the present invention also introduces nano magnetic particulate and applies to during fungal nucleic acid extracts, fungal nucleic acid be extracted more simple to operate, efficient, ensure the purity of nucleic acid extracted simultaneously, and be applicable to the detection of extremely low nucleic acid concentration sample.
(5) the TaqMan real-time fluorescence PCR method fast and accurately that the invention provides detects, and by detecting the accumulation of fluorescent signal, realizing the detection by quantitative to DNA, can monitor in real time whole PCR process.Whole reaction is carried out in closed system, do not need to carry out electrophoresis detection simultaneously, effectively can prevent crossed contamination, the present invention can also by detecting different fluorescent signals, realize carrying out detection by quantitative to multiple pathogenic bacteria in same pipe, highly sensitive, good resolution, can the simultaneously multiple pathogenic fungi of Testing and appraisal and determine Combined Infection cause of disease, significant to agriculture production.
Accompanying drawing illustrates:
Fig. 1 be embodiment 2 multiple real time fluorescence quantifying PCR specific detection result is carried out to three kinds of fungies.
Fig. 2 be embodiment 3 multiple real time fluorescence quantifying PCR sensitivity technique result is carried out to three kinds of fungies.
Fig. 3 is that embodiment 4 utilizes three kinds of method for extracting nucleic acid to carry out multiple real time fluorescence quantifying PCR detected result to the incidence tissue after inoculation B.stevensii.
Fig. 4 is that embodiment 4 utilizes three kinds of method for extracting nucleic acid to carry out multiple real time fluorescence quantifying PCR detected result to the incidence tissue after inoculation B.obtusa.
Fig. 5 is that embodiment 4 utilizes three kinds of method for extracting nucleic acid to carry out multiple real time fluorescence quantifying PCR detected result to the incidence tissue after inoculation B.dothidea.
Embodiment
Describe the present invention in detail below in conjunction with the drawings and specific embodiments, do not limit practical range of the present invention with this.The equivalent replacement of all any this areas of carrying out according to the disclosure of invention, all belongs to protection scope of the present invention.
Embodiment 1: the foundation of real-time fluorescence PCR system
1. detect three kinds of fungi primers and probe design
According to the grape seat chamber bacterium EF1a gene order that GenBank announces, carry out multiple ratio to finding out conserved genetic sequences, according to primer and probe design principle, Primer Express3.0 (Applied Biosystems) and Primer premier 5.0 is utilized to design the Auele Specific Primer probe of three kinds of fungies, verified the specificity of primer and probe again by BLAST instrument (http://blast.ncbi.nlm.nih.gov/Blast.cgi), sequence is as follows:
B.stevensii primer Bst-F:TCATCGAGAAGTTCGAGAAGGTAAG (SEQ ID No.1)
B.stevensii primer Bst-R:CAAGTGCGGCCAGTTTGC (SEQ ID No.2)
B.stevensii probe Bst-T:TGCGCTTATCTGCCGCCGTG (SEQ ID No.3)
B.obtusa primer Bob-F:TCATCGAGAAGTTCGAGAAGGTAAG (SEQ ID No.1)
B.obtusa primer Bob-R:CAAGTGCGGCCAGTTTGC (SEQ ID No.2)
B.obtusa probe Bob-T:ACAGCCCACCTTATCGCTCGGTGAG (SEQ ID No.4)
B.dothidea primer Bod-F:TCATCGAGAAGTTCGAGAAGGTAAG (SEQ ID No.1)
B.dothidea primer Bod-R:GGAGATTTTGCCGAAGACCA (SEQ ID No.5)
B.dothidea probe Bod-T:ACATTTTCTGTGCCTGCACGTGTGCTG (SEQ ID No.6).
2. fluorescent mark
B.stevensii probe Bst-T, fluorophor and 3 ' the end quenching group of 5 ' end mark are FAM, BHQ1; The fluorophor that B.obtusa probe Bob-T marks and quenching group are NED, BHQ2; The fluorophor that B.dothidea probe Bod-T marks and quenching group are JOE, BHQ1.Primer synthesis and probe mark are completed by the precious biotech company in Dalian and AB company.
3. real-time fluorescence PCR reaction system and program
Reaction cumulative volume is 252 μ L, comprising: sample DNA is 2 μ L, 2xTaqman Express PCR MasterMix (Applied Biosystems, USA), 12.5 μ L; Probe Bst-T:0.25 μ L, concentration is 10 μm of ol/L; Probe Bob-T:0.25 μ L, concentration is 10 μm of ol/L; Probe Bod-T:0.25 μ L, concentration is 10 μm of ol/L; Primer Bst-F:1 μ L, concentration is 10 μm of ol/L; Primer Bst-R:0.5 μ L, concentration is 10 μm of ol/L; Primer Bod-R:0.5 μ L, concentration is 10 μm of ol/L; RNase-free Water, 7.75 μ L.
Real-time fluorescence quantitative PCR response procedures is: 95 DEG C of denaturation 10min; 95 DEG C of sex change 30s, 60 DEG C of annealing/extension 1min, totally 40 circulations.Ct value is calculated automatically by SDS 2.4software.
4. method for extracting nucleic acid
Get plant site of pathological change tissue or hypha,hyphae grinds fully in beveller, be positioned in 1.5mL centrifuge tube; In centrifuge tube, add 600 μ L lysates (5M guanidinium isothiocyanate), vortex or concussion mixing 15s, room temperature leaves standstill 10min, the centrifugal 2min of 12000rpm; Get 200 μ L supernatants in new centrifuge tube, add 200 μ L magnetic beads (5 μ g/ μ L), concussion mixing, leaves standstill 10min, collects magnetic bead, abandons supernatant; Add 500 μ L washingss (100% ethanol, 2mol/L guanidinium isothiocyanate, 100mM Tris-HCl, 20mM EDTA), abandon waste collection magnetic bead; Add 500 μ L absolute ethanol washings, abandon waste collection magnetic bead; Add 70% washing with alcohol, abandon waste collection magnetic bead; Add 50TE buffer to dissolve, careful Aspirate supernatant is in new EP pipe, for subsequent use.
Embodiment 2:real-time PCR detection method specific test
1. material source
Gather apple, pears ulcer branch and rotten symptom fruit, what adopt routine organizes PDA partition method, separation and purification bacterial strain, part bacterial strain is purchased from ATCC and China Forest Organism Depositary CFCC, B.stevensiiATCC60259, B.stevensii ATCC64483, B.stevensii CFCC84208, B.obtusa CFCC86564, B.dothidea bjsd-1, B.rhodina CFCC88424, B.rhodina CFCC88423, B.parvaCFCC-88098, Lasiodiplodia crassispora CFCC87129.B.iberica bjbi-1.Nano magnetic particulate is purchased from Promega company.
2. fungal DNA extracts
Strains tested cultivates 5-7 days on PDA substratum at 28 DEG C, gets bacterium cake and shakes in PDB and accompany 5-7 days, aseptically get mycelia and dry for subsequent use.Get about 100mg mycelia and be loaded on 1.5ml centrifuge tube, use paramagnetic particle method to carry out nucleic acid extraction.
3. real-time fluorescence PCR specific detection test-results
Result as shown in Figure 1, real-time fluorescent PCR amplification is carried out to 10 strain bacterium, target bacterium B.stevensii (ATCC60259, ATCC64483, CFCC84208), B.obtusa CFCC-86564, B.dothidea bjsd-1, all has obvious amplification curve, and other fungal detection result becomes negative, show that the method has stronger specificity, can realize three kinds of fungi specific detection.
Embodiment 3: the susceptibility test of multiple real-time PCR detection method
1. method
Extract strains tested B.stevensiiATCC60259 respectively, B.obtusa CFCC-86564, B.dothideabjsd-1 genomic dna, utilize ultraviolet spectrophotometer (NanoDrop Nano-1000, Thermo scientific) measure DNA concentration, then carry out 10 times of series concentration gradient dilutions, dilute for 10ng/ μ L, 1ng/ μ L, 10
-1ng/ μ L, 10
-2ng/ μ L, 10
-3ng/ μ L, 10
-4ng/ μ L, 10
-5ng/ μ L, 10
-6ng/ μ L eight concentration gradients, by the mixing of three kinds of fungal DNA equal proportions, carry out real-time fluorescence detection, each concentration in triplicate, not add DNA profiling for negative control, according to Ct value Criterion curve.
2. result
B.dothidea, B.obtusa, B.stevensii tri-kinds of fungal DNA equal proportions mix 10 times of gradient dilutions, carry out multiple real time fluorescence PCR detection, with initial template concentration logarithm for X-coordinate, take threshold value as ordinate zou, drawing standard curve.Result shows (see accompanying drawing 2), and detectable level lower limit is 10
-3ng/ μ L.
As can be seen here, three kinds of genomic dna concentration are 10
1-10
-3ng/ μ L scope and Ct value all have good linear relationship, inversely, and R
2be respectively 0.999,0.995,0.998, slope is-3.55 ,-3.56 ,-3.65.
Embodiment 4: incidence tissue multiple real time fluorescence PCR detects
1. method
By B.stevensiiATCC60259, B.obtusa CFCC86564, after B.dothidea bjsd-1 bacterial strain cultivates 7d on PDA substratum at 28 DEG C, for subsequent use from the bacterium cake of colony edge punch tool cut-off footpath 5mm, with 75% alcohol, surface sterilization is carried out to apple, dry after aseptic water washing 3 times, the bacterium cake front of 5mm is attached in vaccination, above covers the absorbent cotton speckling with sterilized water, then use preservative film moisturizing, carry out mark, often kind of inoculation in triplicate.Postvaccinal apple is put into pallet, and 25 DEG C of moisturizings are cultivated.Get apple site of pathological change and to be organized in beveller grinding fully, often kind of sick sample lapping liquid is got 100mg and is carried out total DNA extraction.
In order to whether clearly different disease plant Extraction Methods of Genomes has an impact to fungal detection, CTAB method, sky root Plant Genome extraction RNA isolation kit and paramagnetic particle method three kinds of methods are adopted to extract disease sample genomic dna, carry out real-time PCR detection, the Ct value of more often kind of method, evaluate three kinds of extracting method, often kind of extracting method in triplicate.
CTAB method: the CTAB lysate (2%CTAB, 50mM Tris-HCl, 0.7M NaCl, 10mM EDTA) adding 700 μ L in every centrifuge tube, bathes 20 ~ 40min in 65 DEG C of temperature after putting upside down mixing, puts upside down mixing once at interval of 5min; 700 μ L phenol are added: chloroform: primary isoamyl alcohol (25:24:1), mixing of turning upside down in ventilating kitchen, after leaving standstill 3 ~ 5min, 4 DEG C, the centrifugal 10min of 12000rpm; Get supernatant liquor respectively in the centrifuge tube of 1.5mL, add equal-volume chloroform: primary isoamyl alcohol (V/V, 24:1) carries out secondary extracting, 4 DEG C, the centrifugal 10min of 12000rpm; Careful Aspirate supernatant, joins in new 1.5mL centrifuge tube, adds the Virahol of 0.6 times of volume subsequently, and mixing of turning upside down is placed in-20 DEG C of standing 2h or overnight precipitation; Wait leave standstill or overnight precipitation after, at 4 DEG C, the centrifugal 10min of 12000rpm; Abandon supernatant, often pipe adds the ethanol centrifuge washing of 500 μ L 75%, the centrifugal 10min of 12000rpm; Blot remaining liquid with pipettor, dry under room temperature; DNA precipitation is dissolved in 50 μ L TE damping fluids, carries out concentration determination with Nanodrop, be placed in-20 DEG C and save backup.
It root Plant Genome extracts RNA isolation kit, and carry out according to test kit step, concrete grammar Jian Tiangen biochemical technology company limited article No. DP305, magnetic bead extraction method is shown in embodiment 1.
2. result
Multiple real time fluorescence PCR is utilized to detect the DNA extracted, detected result shows, inoculate three kinds of fungi B.stevensii ATCC60259, B.obtusa CFCC-86564, apple result after B.dothidea bjsd-1 all becomes the positive in table 1 and accompanying drawing 3-5, illustrates that set up method can detect incidence tissue.
Utilize paramagnetic particle method, sky root Plant Genome to extract RNA isolation kit and improved method of CTAB extraction inoculation incidence tissue lapping liquid DNA, utilize real-time fluorescence quantitative PCR to detect.Amplification is as shown in accompanying drawing 3-Fig. 5, and adopt the DNA that CTAB method and paramagnetic particle method extract, real-time fluorescence detects Ct value does not have significant difference in 0.05 level, and thing genomic kit method is taken root in these two kinds of methods and sky, and there were significant differences, in table 1.The DNA quality that paramagnetic particle method and CTAB method are extracted for the tissue sample of B.stevensii, B.obtusa, B.dothidea tri-kinds of fungal infections is suitable, extracts than sky root Plant Genome the real-time PCR detection that test kit is more suitable for for pathogenic bacteria.Paramagnetic particle method extraction time is short simultaneously, does not need to use the organic solvent such as phenol, chloroform.Therefore three kinds of method for extracting nucleic acid are compared, and paramagnetic particle method is better than other two kinds of extracting method.
Table 1 multiple real time fluorescence PCR detects incidence tissue's result
Comparative examples:
According to the pcr amplification technology that Feng little Hui etc. introduces, multiplex PCR optimal conditions is adopted to detect dothiorella gregaria cause of disease:
Utilize fungi universal primer ITS1/ITS4 amplification ribosome internal transcribed spacer ITS1-5.8S-ITS2, utilize primer EF1-728F/EF1-986R amplification elongation factor EF-1 α.Amplification system is 50 μ L, answers component to be: 25 μ L2 × Taq PCR MasterMix (sky root is biochemical), and forward and reverse primer concentration is 0.2 μm of each 1 μ L of olL-1,2 μ L DNA profilings (0.5ng/ μ L), and aqua sterilisa supplies 50 μ L; Response procedures is: 94 DEG C of denaturation 4min; 94 DEG C of sex change 30s, 55.6 DEG C of annealing 30s, 72 DEG C extend 1min, 31 circulations; Last 72 DEG C extend 4min.Without obvious band during electrophoresis.
Result shows that to B.dothidea genome detection sensitivity be 1ng, the sensitivity utilizing multiple real time fluorescence quantifying PCR to detect in the present invention.But the method can not detect B.obtusa, B.stevensii, B.dothidea Combined Infection sample simultaneously.
In addition, by contrast, the present invention does not need to carry out follow-up PCR order-checking, just can realize the detection to B.dothidea, B.obtusa, B.stevensii tri-kinds of fungies, therefore have more real Clinical significance of detecting.
Claims (10)
1. a detection composition of triple fluorescent quantitative PCR, comprising:
B.stevensii primer Bst-F:TCATCGAGAAGTTCGAGAAGGTAAG (SEQ ID No.1)
B.stevensii primer Bst-R:CAAGTGCGGCCAGTTTGC (SEQ ID No.2)
B.stevensii probe Bst-T:TGCGCTTATCTGCCGCCGTG (SEQ ID No.3)
B.obtusa primer Bob-F:TCATCGAGAAGTTCGAGAAGGTAAG (SEQ ID No.1)
B.obtusa primer Bob-R:CAAGTGCGGCCAGTTTGC (SEQ ID No.2)
B.obtusa probe Bob-T:ACAGCCCACCTTATCGCTCGGTGAG (SEQ ID No.4)
B.dothidea primer Bod-F:TCATCGAGAAGTTCGAGAAGGTAAG (SEQ ID No.1)
B.dothidea primer Bod-R:GGAGATTTTGCCGAAGACCA (SEQ ID No.5)
B.dothidea probe Bod-T:ACATTTTCTGTGCCTGCACGTGTGCTG (SEQ ID No.6).
2. the detection composition of claim 1, wherein the fluorophor of three probe marks is respectively FAM, NED, JOE, and corresponding quenching group is BHQ1, BHQ2, BHQ1.
3. the detection composition described in claim 1 or 2, detects the method for three kinds of grape seat chamber bacterium for triple fluorescent quantitative PCR.
4. the method for claim 3, comprises the following steps:
(1) sample to be tested is gathered;
(2) sample genomic dna is extracted;
(3) detect by multiple real time fluorescence PCR method;
Wherein, described three kinds of grape seat chamber bacterium are selected from B.stevensii, B.obtusa, B.dothidea.
5. the method for claim 4, wherein said step (2) extract sample genomic dna, be adopt be magnetic bead extraction method.Key step is as follows: get lapping liquid and be positioned in 1.5mL centrifuge tube; In centrifuge tube, add 600 μ L lysates, vortex concussion mixing 15s, room temperature leaves standstill 10min, the centrifugal 2min of 12000rpm; Get 200 μ L supernatants in new centrifuge tube, add 200 μ L magnetic beads, concussion mixing, leaves standstill 10min, collects magnetic bead, abandons supernatant; Add 500 μ L washingss, abandon waste collection magnetic bead; Add 500 μ L absolute ethanol washings, abandon waste collection magnetic bead; Add 70% washing with alcohol, abandon waste collection magnetic bead; Add 50TE buffer to dissolve, Aspirate supernatant is in new EP pipe, for subsequent use.
6. the method for claim 5, wherein said step (3) multiple real time fluorescence PCR method detects, and refers to react with following primer and probe sequence: identify that B.stevensii primer is Bst-F and Bst-R, probe is Bst-T; Identify that B.obtusa primer is Bob-F and primer Bob-R, probe is Bob-T; B.dothidea primer is Bod-F and Bod-R, and probe is Bod-T.
7. the method for claim 3-6, wherein said real-time fluorescence quantitative PCR reaction system cumulative volume is 25 μ L, three kinds of fungal DNA templates increase simultaneously and can produce interference, are optimized whole reaction system, and final multiple real time fluorescence PCR method detection reaction system is as follows:
Sample genomic dna 2 μ L;
2xTaqman Express PCR Master Mix(Applied Biosystems,USA)，12.5μL；
B.stevensii probe Bst-T:0.25 μ L, concentration is 10 μm of ol/L;
B.obtusa probe Bob-T:0.25 μ L, concentration is 10 μm of ol/L;
B.dothidea probe Bod-T:0.25 μ L, concentration is 10 μm of ol/L;
B.stevensii primer Bst-F:1 μ L, concentration is 10 μm of ol/L;
B.stevensii primer Bst-R:0.5 μ L, concentration is 10 μm of ol/L;
B.dothidea primer Bod-R:0.5 μ L, concentration is 10 μm of ol/L;
RNase-free Water，7.75μL。
8. the method for claim 3-7, the reaction conditions that wherein step (3) multiple real time fluorescence PCR detects is 95 DEG C of denaturation 10min; 95 DEG C of sex change 30s, 60 DEG C of annealing/extension 1min, totally 40 circulations.In the enterprising performing PCR amplification of ABI7900HT (Applied Biosystems, USA) fluorescing system, Ct value is calculated automatically by SDS 2.4software.
9. the detection composition of claim 1-2, for the preparation of the purposes of the testing product of detection three kinds of grape seat chambeies bacterium (B.stevensii, B.obtusa, B.dothidea).
10. the purposes of claim 9, wherein said testing product comprises: detection reagent, detection kit, detection chip etc.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510201075.0A CN104774955B (en) | 2015-04-25 | 2015-04-25 | The detection method of a kind of grape seat chamber bacterium |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510201075.0A CN104774955B (en) | 2015-04-25 | 2015-04-25 | The detection method of a kind of grape seat chamber bacterium |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104774955A true CN104774955A (en) | 2015-07-15 |
| CN104774955B CN104774955B (en) | 2016-01-20 |
Family
ID=53616719
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510201075.0A Expired - Fee Related CN104774955B (en) | 2015-04-25 | 2015-04-25 | The detection method of a kind of grape seat chamber bacterium |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104774955B (en) |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106701970A (en) * | 2017-01-22 | 2017-05-24 | 江苏出入境检验检疫局动植物与食品检测中心 | Molecular biological method for identifying three Botryosphaeria on apples |
| CN106811506A (en) * | 2015-11-27 | 2017-06-09 | 李保华 | A kind of method for detecting Botryosphaeria berengeriana f. sp and its relative populations |
| CN110343619A (en) * | 2019-07-01 | 2019-10-18 | 福建农林大学 | A kind of endogenetic fungus that Schima superba height of seedling and ground diameter can be promoted to increase under low-phosphorous environment |
| CN111020056A (en) * | 2020-01-07 | 2020-04-17 | 北京林业大学 | LAMP primer and kit for detecting Lasiodipodia curvata |
| CN111088386A (en) * | 2020-01-09 | 2020-05-01 | 北京林业大学 | LAMP primer and kit for detecting Lasiodipia paraphysoides |
| CN112877463A (en) * | 2021-03-11 | 2021-06-01 | 中国海关科学技术研究中心 | Primer probe set, kit and detection method for real-time fluorescent PCR (polymerase chain reaction) detection of apple shell color monascus dissimilatons |
| CN113186336A (en) * | 2021-06-03 | 2021-07-30 | 中国海关科学技术研究中心 | Primer probe set, kit and detection method for real-time fluorescent PCR (polymerase chain reaction) detection of grape stem blight bacteria |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101899506A (en) * | 2010-05-18 | 2010-12-01 | 华南农业大学 | Detection primer for No.1 and No.4 physiological strains of fusarium oxysporum f. sp cubense and rapid detection method |
| CN103509856A (en) * | 2013-06-13 | 2014-01-15 | 四川农业大学 | Specific primer used for rapid detection of kiwi fruit soft rot pathogenic bacterium Botryosphaeria dothidea, and detection method of Botryosphaeria dothidea |
| CN103667468A (en) * | 2013-11-29 | 2014-03-26 | 宁波检验检疫科学技术研究院 | Real-time fluorescence polymerase chain reaction (PCR) detection reagent and detection method for grape stem pseudomonas solanacearum |
| CN104131115A (en) * | 2014-08-26 | 2014-11-05 | 严东辉 | Gene chip for detecting pathogenic fungi of poplar canker and application thereof |
-
2015
- 2015-04-25 CN CN201510201075.0A patent/CN104774955B/en not_active Expired - Fee Related
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101899506A (en) * | 2010-05-18 | 2010-12-01 | 华南农业大学 | Detection primer for No.1 and No.4 physiological strains of fusarium oxysporum f. sp cubense and rapid detection method |
| CN103509856A (en) * | 2013-06-13 | 2014-01-15 | 四川农业大学 | Specific primer used for rapid detection of kiwi fruit soft rot pathogenic bacterium Botryosphaeria dothidea, and detection method of Botryosphaeria dothidea |
| CN103667468A (en) * | 2013-11-29 | 2014-03-26 | 宁波检验检疫科学技术研究院 | Real-time fluorescence polymerase chain reaction (PCR) detection reagent and detection method for grape stem pseudomonas solanacearum |
| CN104131115A (en) * | 2014-08-26 | 2014-11-05 | 严东辉 | Gene chip for detecting pathogenic fungi of poplar canker and application thereof |
Non-Patent Citations (2)
| Title |
|---|
| 冯小慧, 等: "杨树溃疡病病原的多重PCR检测技术", 《林业科学》, vol. 48, no. 5, 31 May 2012 (2012-05-31) * |
| 黄海泉: "实时荧光定量PCR 技术在植物检疫中应用的研究进展", 《湖北农业科学》, vol. 51, no. 1, 31 January 2012 (2012-01-31) * |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106811506A (en) * | 2015-11-27 | 2017-06-09 | 李保华 | A kind of method for detecting Botryosphaeria berengeriana f. sp and its relative populations |
| CN106701970A (en) * | 2017-01-22 | 2017-05-24 | 江苏出入境检验检疫局动植物与食品检测中心 | Molecular biological method for identifying three Botryosphaeria on apples |
| CN110343619A (en) * | 2019-07-01 | 2019-10-18 | 福建农林大学 | A kind of endogenetic fungus that Schima superba height of seedling and ground diameter can be promoted to increase under low-phosphorous environment |
| CN111020056A (en) * | 2020-01-07 | 2020-04-17 | 北京林业大学 | LAMP primer and kit for detecting Lasiodipodia curvata |
| CN111088386A (en) * | 2020-01-09 | 2020-05-01 | 北京林业大学 | LAMP primer and kit for detecting Lasiodipia paraphysoides |
| CN112877463A (en) * | 2021-03-11 | 2021-06-01 | 中国海关科学技术研究中心 | Primer probe set, kit and detection method for real-time fluorescent PCR (polymerase chain reaction) detection of apple shell color monascus dissimilatons |
| CN113186336A (en) * | 2021-06-03 | 2021-07-30 | 中国海关科学技术研究中心 | Primer probe set, kit and detection method for real-time fluorescent PCR (polymerase chain reaction) detection of grape stem blight bacteria |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104774955B (en) | 2016-01-20 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104774955B (en) | The detection method of a kind of grape seat chamber bacterium | |
| CN101974650B (en) | Polymerase chain reaction (PCR) method for detecting fusarium oxysporum and kit | |
| Li et al. | Simultaneous detection and quantification of Phytophthora nicotianae and P. cactorum, and distribution analyses in strawberry greenhouses by duplex real-time PCR | |
| CN104313175A (en) | LAMP detection primer composition for phytophthora infestans and LAMP detection kit and LAMP detection method of LAMP detection primer composition | |
| CN111534621A (en) | Primer and detection method for real-time fluorescent quantitative PCR (polymerase chain reaction) detection of colletotrichum gloeosporioides | |
| CN104561278A (en) | Detection primer, detection kit and detection method for watermelon wilt disease fungi | |
| CN104818339B (en) | A kind of detection method of real-time fluorescent RCR ulcer bacteria | |
| Shen et al. | Development of a loop‐mediated isothermal amplification assay for rapid and sensitive detection of Sporisorium scitamineum in sugarcane | |
| Kang et al. | Simple detection of Cochliobolus fungal pathogens in maize | |
| Sarkes et al. | Detection of Xanthomonas translucens pv. undulosa, pv. translucens, and pv. secalis by quantitative PCR | |
| CN104313128A (en) | Loop-mediated isothermal amplification (LAMP)-based method and primer composition for detection of fusarium graminearum | |
| Jun-Hai et al. | Development and evaluation of a loop-mediated isothermal amplification assay for rapid detection of bacterial blight pathogen (Xanthomonas axonopodis pv. dieffenbachiae) in anthurium | |
| Zouhar et al. | Quantification of Tilletia caries and Tilletia controversa mycelium in wheat apical meristem by real-time PCR. | |
| CN104232782A (en) | PCR (polymerase chain reaction) primer for detecting tobacco soil-borne fungal pathogens as well as application and method of PCR primer | |
| CN102796825B (en) | Specificity polymerase chain reaction (PCR) method for detecting heterodera elachista ohshima | |
| KR101642772B1 (en) | Composition for detecting pepper anthracnose and method of detecting pepper anthracnose using the same | |
| CN116516058A (en) | Method and kit for visually detecting phytophthora sojae | |
| CN108384881B (en) | Fluorescent quantitative PCR detection method of cercospora fuscogilva | |
| CN103882109B (en) | The molecular detecting method of sugarcane toppers maize ear rot pathogenic bacteria microspecies gx1 | |
| CN105200122A (en) | Quantitative detection kit for wheat stripe rust and application thereof | |
| Sharma et al. | PCR based assay for the detection of Alternaria brassicicola in crucifers | |
| CN112176080B (en) | Nested PCR primer group, kit and detection method for specifically detecting purple sisal leaf roll disease phytoplasma | |
| CN105648107B (en) | A kind of southern corn leaf blight molecular detection primer and rapid detection method | |
| CN108411017A (en) | Detect the LAMP primer and method of pseudomonas syringae tomato pvs oryzae and oryzicola | |
| CN106676193B (en) | Molecular marker, primer and probe for identifying penicillium |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| EXSB | Decision made by sipo to initiate substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C41 | Transfer of patent application or patent right or utility model | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20151126 Address after: 101312 Beijing city Chaoyang District tianshuiyuan Street No. 6 Applicant after: Beijing Entry-exit Inspection and Quarantine Bureau, the People's Republic of China Address before: 410128 Hunan province Changsha Furong District of Hunan Agricultural University Riverside District 34 Building Room 303 Applicant before: Xiang Hua |
|
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20160120 Termination date: 20170425 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |