CN101899506A

CN101899506A - Detection primer for No.1 and No.4 physiological strains of fusarium oxysporum f. sp cubense and rapid detection method

Info

Publication number: CN101899506A
Application number: CN 201010181211
Authority: CN
Inventors: 姜子德; 李敏慧; 余雄涛; 周佳暖; 习平根
Original assignee: South China Agricultural University
Current assignee: South China Agricultural University
Priority date: 2010-05-18
Filing date: 2010-05-18
Publication date: 2010-12-01
Anticipated expiration: 2030-05-18
Also published as: CN101899506B

Abstract

The invention discloses a detection primer for No.1 and No.4 physiological strains of fusarium oxysporum f. sp cubense and a rapid detection method. The invention provides a universal primer for the No.1 and the No.4 physiological strains of the fusarium oxysporum f. sp cubense and fusarium oxysporum, which can realize the specific simultaneous detection of the No.1 and the No.4 physiological strains of the fusarium oxysporum f. sp cubense in one PCR reaction, and lead the detection sensitivity to achieve 0.2 mu g of fresh mycelium. As the invention simultaneously provides the universal detection primer for a group of the fusarium oxysporum, and the universal detection primer can be used as an internal reference for detecting the DNA quality, the detection primer can avoid the appearance of false negative. The detection method can not only accurately and quickly identify the physiological strains of the fusarium oxysporum f. sp cubense on a template of DNA extracted from banana tissues with the diseases, but also detect the fusarium oxysporum f. sp cubense in the soil, thereby having the advantages of saving time, being simple, simultaneously identifying the No.1 and the No.4 physiological strains, avoiding the false negative and the like.

Description

No. 1, banana blight bacteria and No. 4 physiological strains detect primer and method for quick

Technical field

The invention belongs to control of plant disease and pathogenic detection technique field, be specifically related to detection primer and the method for quick of No. 1 and No. 4 physiological strain of banana blight bacteria.

Background technology

The vascular bundle diseases of banana blight dependent territory biography property, development is rapid, and control is difficult, and mortality ratio is high, and because this disease morbidity is being taken out flower bud phase to the phase of bearing fruit more, the as easy as rolling off a log big area that causes is lost receipts, is called as " banana cancer ".Take place in Panama as far back as banana blight in 1890, so the descendant is called Panama disease.Afterwards, this disease took place in Hawaii, America in 1904, and this disease took place in Asia Indonesia in 1916, between nineteen thirty-five to nineteen thirty-nine, the outburst of South America banana blight big area causes 40,000 hectares of bananas to be ruined, and along with the outlet of local banana propagates into all over the world (Sun Shougong, 1996; Ploetz and Pegg, 1999).By 1987, nearly all there was the generation (Stover and Simmonds, 1987) of banana blight in global banana producing region except the country of Papua New Guinea, island, the South Pacific and Mediterranean Sea bank.

In China mainland, (Wang Bisheng etc., 1997) should disease only take place in the some areas in China Guangxi, Guangdong in nineteen sixty, and the later dwarf banana of yet just causing harm over more than 30 year does not see the banana of causing harm.But, blight has taken place No. 2 in the banana variety Brazil any of several broadleaf plants and the Guangdong in ten thousand hectares of husky towns, Fanyu, Guangzhou in 1996, banana blight has also taken place in ground such as Lin Jin banana producing region Zhong Shan, Zhuhai, Dongguan in succession afterwards, sick garden sickness rate is 10%～40%, serious reach (Qi Peikun, 2000 more than 90%; Woods Lan Wen etc., 2003); By seedling, this disease now has been transmitted to banana producing region (woods time lag etc., 2000 in Hainan, Fujian; Pu Jinji etc., 2003).At present, the generation of banana blight and constantly spread China's banana production has been constituted great threat has become urgent problem in the banana production.

The pathogenic bacteria of banana blight [Fusarium oxysporum f.sp.cubense (E.F.Smith) Snyder et Hansen] is subordinate to Fusarium, sharp sickle spore Cuba specialized form, be that a kind of soil habit occupies fungi, so far also find no condition (Snyder and Hansen, 1940; Bu Si, 1988).According to cause harm host's difference of this bacterium, can be divided into 3 physiological strains, No. 1 physiological strain (FOC1) infects cultivar " big honey what " [Grosmichel (AAA)], fossilia dentis mastodi any of several broadleaf plants (MusaAAB) and the short banana [Dwarf cavendish (AAA)] of banana, this physiological strain is worldwide distribution, and the banana blight that China mainland was reported before 1996 is all caused by this physiological strain; No. 2 physiological strains in Central America, Honduras, El Salvador, Puerto Rico, the Dominican Republic and Virgin Islands, infect triploid hybrid rib banana [Bluggoe (AAB)], do not infect " big honey what " (Stover and Waite, 1960); No. 4 physiological strains (FOC4) are new physiological strains of at first reporting in China Taiwan in 1967, can infect " big honey what ", short banana, wild any of several broadleaf plants (BB) and rib and refer to any of several broadleaf plants, especially can infect all Cavendish (AAA) strain of anti-No. 1 physiological strain, crushing maximum (Persley and De Langhe, 1987), banana industry (Su et al., 1986 in Taiwan in about 10 years time, have almost been destroyed; Hwang, 2004).Afterwards, No. 4 physiological strains are found and report (Ploetz etal., 1990) in Australia, South Africa, Canary Islands and Philippines again.In view of the hazardness of banana wilt germina number-four biological strain, the national Ministry of Agriculture classified it as national plant quarantine object in 2005.

Present No. 4 physiological strains are just caused harm in local banana producing region in China mainland, and implementing quarantine control will be the key that prevents its diffusion.But the banana blight invasioning delitescence is long and the appearance symptom is not obvious, has caused the difficulty in the quarantine.

Existing authenticate technology to the wilt physiological strain, the methods that adopt traditional pathogenic bacteria separation and Culture, pathogenic evaluation, the biological tests such as colonial morphology observation of bacterial strain on the Komada improved culture medium more, it takes longer, can't adapt to the production actual needs.

Simultaneously, except planting fragrant bud any of several broadleaf plants (AAA), also plant dwarf banana (ABB) in the banana production, if dwarf banana infects blight, its cause of disease or No. 4 physiological strains or No. 1 physiological strain or two physiological strains compound, present detection technique mostly is the detection method at banana wilt germina number-four biological strain, and for example application number is 200710032118.2 patent application disclosed " a kind of method for quick of banana wilt germina number-four biological strain ".There are two significant defectives in existing detection technique: (1) can only judge and determine whether the plant (comprising fragrant bud any of several broadleaf plants and dwarf banana) of doubtful banana blight is that No. 4 physiological strains are caused a disease, if determine not to be No. 4 physiological strains by detecting, it is just unknown whether to be that No. 1 physiological strain is done; (2) do not detect the technique means of DNA quality, can not avoid occurring false-negative detected result.

Therefore the banana blight bacteria detection technique of quick, accurate and No. 1 and No. 4 physiological strain of complete detection is explored in research, for its spread in china that prevents disease, take Preventing Countermeasures early, guarantee that China's banana safety in production has important significance for theories and using value.

Summary of the invention

An object of the present invention is the existing banana blight cause of disease at China, (F.oxysporum f.sp.cubense race 1 race4), designs new detection primer for No. 1, sharp sickle spore Cuba specialized form and No. 4 physiological strains.

Another object of the present invention is to set up a kind of detection method, utilizes above-mentioned detection primer, in the hope of in the shortest time, uses the easiest method and identifies that simultaneously the banana blight pathogenic bacteria is No. 1 or No. 4 physiological strains, still haves both at the same time.

Purpose of the present invention is achieved by following technical proposals:

Provide three pairs to detect primer, be shown in Table 1:

No. 1, No. 4 physiological strains of table 1 banana blight bacteria and sharp sickle spore specific detection primer sequence

The present invention provides the method for utilizing No. 1 and/or No. 4 physiological strain of above-mentioned primer rapid detection banana blight bacteria simultaneously, may further comprise the steps:

1, the extracting banana disease is organized total DNA;

2, organizing extractive total DNA with banana disease is template, carries out the triple PCR amplification with No. 1, No. 4 physiological strains of banana blight bacteria and sharp sickle spore confidential reference items primer;

3, amplified production is detected with 1.0% agarose gel electrophoresis.

Gather the diseased tissues that preferably adopts the banana bulb when banana disease is organized, adopt the CTAB method to carry out extracting, specifically may further comprise the steps:

(1) gets the curved shot stem disease and organize 2g, diseased tissues is shredded, place mortar to add liquid nitrogen and grind to form finely powdered with the sterilization scissors; The extraction buffer [2%CTAB, 0.1mol/L Tris-HCl (pH 8.0), 1.4mol/LNaCl, 20mmol/L EDTA (pH 8.0), 1% beta-mercaptoethanol (time spent adds)] that adds 65 ℃ of preheatings of 5～6mL rapidly, gentle mixing; Lapping liquid is changed in the 15mL centrifuge tube, and in 65 ℃ of following water-bath 1h, every 10min shakes once;

(2) add 5mL phenol chloroform, behind the abundant mixing of thermal agitation, under the room temperature 12,000g, centrifugal 15min;

(3) carefully pipette supernatant liquor (every pipe 600 μ L) in new 1.5mL centrifuge tube, add the equal-volume chloroform, behind the abundant mixing of short term oscillation, under the room temperature 12,000g, centrifugal 10min;

(4) carefully pipette supernatant liquor (every pipe 600 μ L) in new 1.5mL centrifuge tube, add 1/10 3mol/L NaAc (pH 5.2) that gets the supernatant liquor volume and with the isopyknic Virahol of getting supernatant liquor, gentle mixing, under the room temperature 12,000g, centrifugal 4min;

(5) abandoning supernatant liquor to the greatest extent, is that 70% ethanol cleans twice, air-dry precipitation under the room temperature with volumetric concentration;

(6) precipitation of all same samples is dissolved in the ddH of 65 ℃ of preheatings of 600 μ L ₂Among the O, add 4 μ L RNase A (final concentration is 20 μ g/mL) simultaneously, mixing, 37 ℃ of water-bath 1h fully clear up RNA;

(7) add 600 μ L chloroforms, mixing fully vibrates, the centrifugal 10min of 12000g under the chamber then, draw in the new 2mL centrifuge tube of supernatant liquor to, add 1/10 and get the 3mol/LNaAc of supernatant liquor volume and the precooling dehydrated alcohol of 2 times of supernatant liquor volumes of getting, behind the mixing this mixed solution moved to DNA column (commercially available DNA extraction agent box provides), the centrifugal 1min of 10000g under the room temperature then gently;

(8) abandon filtrate, add 700 μ L concentration and be 70% ethanol to the DNA column, the centrifugal 1min of 10000g under the room temperature abandons filtrate and repeated washing DNA column, abandons after the filtrate the centrifugal empty DNA column 1min of 10000g under the room temperature, to guarantee to abandon to the greatest extent ethanol;

(9) the DNA column is contained on the new 1.5mL centrifuge tube, the 1 * TE solution that adds 65 ℃ of preheatings of 100 μ L is placed 2min in the pillar center under the room temperature, behind the abundant dissolving DNA, and the centrifugal 1min of 10000g, centrifugal gained is extractive DNA;

(10) get purity and the concentration that the extractive DNA of 1～2 μ L utilizes UV spectrophotometer measuring DNA sample, with OD ₂₆₀/ OD ₂₈₀Ratio be 1.8～2.0 o'clock the bests, the concentration of adjusting DNA is that 10ng/ μ L～50ng/ μ L is advisable; It is standby to place-20 ℃ of refrigerators to preserve then.

The phenol chloroform of using in the extracting DNA process of the present invention is phenol: chloroform: the mixed solution of primary isoamyl alcohol volume ratio=25: 24: 1, chloroform is chloroform: the mixed solution of primary isoamyl alcohol volume ratio=24: 1.

The system of the described triple PCR amplification of step (2) is as shown in table 2:

The reaction system (25 μ L) that table 2 triple PCR detects

Method for quick of the present invention promptly can be applicable to the detection of banana disease tissue DNA, can be applicable to be separated on diseased tissues the detection of fungal DNA again, also can be directly used in the detection of existing banana blight bacteria physiological strain in the soil.

Beneficial effect of the present invention is mainly reflected in two aspects:

One, the designed primer of the present invention.They are to analyze design on the basis of the isolating a large amount of banana wilt germina number-four biological strain pathogenic related gene sequences in research department, inventor place (Agricultural University Of South China tropical and subtropical zone fungal studies chamber), three pairs of primers that from No. 4 physiological strain Auele Specific Primers obtaining, No. 1 physiological strain Auele Specific Primer, sharp sickle spore universal primer, filter out through combined authentication, its stripe size of PCR product and the quantity of every pair of primer also are not quite similar, therefore directly pathogen identification to the physiological strain rank of banana blight bacteria.

Two, the banana blight bacteria triple PCR detection method that the present invention set up, described method has following superiority:

1. the DNA with the banana disease tissue is a template, can detect simultaneously No. 1 and No. 4 physiological strains in a PCR reaction;

2. the sharp sickle spore universal primer in the while combination of primers can be used as the quality that internal reference detects DNA simultaneously, has avoided false-negative appearance;

3. detection method of the present invention can be used for from falling ill the detection of banana separate tissue fungal DNA, and the fresh mycelia that the sensitivity of detection reaches 0.2 μ g can detect the existence of this pathogenic bacteria;

4. detection architecture of the present invention can also detect the banana blight bacteria in the soil, and this is significant to the pollution whether detection any of several broadleaf plants garden mould earth is subjected to banana blight bacteria or other sharp sickle spore.

Description of drawings

Fig. 1 banana wilt germina number-four biological strain Auele Specific Primer pcr amplification product electrophorogram;

No. 1 physiological strain Auele Specific Primer of Fig. 2 banana blight bacteria pcr amplification product electrophorogram;

Fig. 3 point sickle spore universal primer PCR amplified production electrophorogram;

Fig. 4 triple PCR detection architecture is to the amplification electrophorogram of banana blight bacteria and control strain DNA;

The sensitivity of Fig. 5 triple PCR detection architecture detects electrophorogram;

Fig. 6 triple PCR detection architecture is to the amplification electrophorogram of the banana tissue DNA of falling ill;

The amplification electrophorogram of the pathogenic bacteria DNA that Fig. 7 triple PCR detection architecture obtains separation;

Fig. 8 triple PCR detection architecture is to mixing the amplification electrophorogram of soil bacteria DNA;

Fig. 9 triple PCR detection architecture detects electrophorogram to mixing soil bacteria DNA sensitivity.

Embodiment

Further describe the present invention below in conjunction with accompanying drawing and concrete each example of implementing.

Embodiment 1: the design and the screening of No. 1, banana blight bacteria and No. 4 physiological strain Auele Specific Primers and sharp sickle spore universal primer sequence

Design primer according to this research department at the distinguished sequence that No. 4, banana blight bacteria of clone and No. 1 physiological strain pathogenic related gene are obtained.

Wherein, No. 1 physiological strain specific DNA sequence of banana blight bacteria table is shown in SEQ ID NO:1, and banana wilt germina number-four biological strain specific DNA sequence table is shown in SEQ ID NO:4, and sharp sickle spore bacterium specific DNA sequence is shown in table SEQ ID NO:7.According to dna sequence dna information provided by the invention, those skilled in the art also can easily obtain the dna sequence dna that is equal to by the following method: (1) obtains from the genomic dna of the corresponding physiological strain bacterial strain of this pathogenic bacteria with the method for pcr amplification according to described dna sequence dna information design primer; (2) method with chemosynthesis obtains.

Primer sequence according to the Rule Design different lengths that designs primer, guarantee its annealing temperature (54 ℃～56 ℃) in a metastable scope, guaranteeing that different detection primers can bring into play best detection effect under same annealing temperature, and it is synthetic to transfer to dna primer Synesis Company.Through conventional PCR reaction system screening, the Auele Specific Primer of obtain detecting banana blight bacteria No. 1, No. 4 physiological strains and sharp sickle spore is respectively shown in table SEQ ID NO:2 and SEQ ID NO:3, table SEQ ID NO:5 and table SEQ ID NO:6, table SEQ ID NO:8 and table SEQ ID NO:9; Behind the screening experiment of the different amounts of primer, sum up the PCR reaction system that obtains suiting again, be shown in Table 3.Under this system, react the physiological strain that to identify banana blight bacteria through once conventional PCR.

The reaction system (25 μ L) that table 3 Auele Specific Primer PCR detects

Embodiment 2: the separation of banana blight bacteria, the extracting of DNA and Auele Specific Primer screening and evaluation

Gather the banana blight sample from the banana region of disease that China is different, cut the sick strong little block organization of intersection of diseased plant bulb, adopt the conventional organization partition method to separate (Fang Zhongda, 1998), in PDA (potato dextrose agar), 25 ℃ of following dark culturing 2～3d, after waiting to grow bacterium colony, choose the most advanced and sophisticated mycelia pure culture of colony edge, carry out the monospore separation after producing conidium, and single-ascospore strain is carried out pathogenic mensuration, it is standby to preserve pathogenic single-ascospore strain.Bacterium source and numbering see Table 4.The bacterial strain of preserving is activated on the PDA flat board, 25 ℃ of following dark culturing 3～4d, the picking inoculated by hypha block is to YPD nutrient solution (yeast powder peptone glucose culture solution, 2% glucose, 1% yeast extract powder, 2% peptone) in, shaking culture 3d under 25 ℃, 200rpm.Leach mycelia with B, standby through the water thorough washing final vacuum lyophilize collection mycelia of sterilization.

Table 4 is for No. 1, banana blight bacteria of examination and No. 4 physiological strain strain numbers, source and little type

With the DNA of improved SDS method extracting banana blight bacteria, concrete steps are as follows:

(1) takes by weighing 100～200mg freeze-drying mycelia and put into the mortar of precooling, adding liquid nitrogen is ground to Powdered, the rapid then DNA extraction damping fluid that goes to it in 1.5mL centrifuge tube and add 65 ℃ of preheatings of 750 μ L [prescription: 50mmol/L Tris-HCl (pH 7.2), 50mmol/L EDTA, 3%SDS, 1% beta-mercaptoethanol (time spent adds)], abundant mixing, place 65 ℃ of water-bath water-bath 1h then, every 10min shakes once;

(2) add equal-volume (750 μ L) phenol chloroform, the abundant mixing of short term oscillation, the centrifugal 15min of 12000g under the room temperature;

(3) carefully pipette supernatant liquor and in a new 1.5mL centrifuge tube, (note not drawing the cell debris of layering intersection), add the equal-volume chloroform, behind the vibration mixing, the centrifugal 10min of 12000g under the room temperature;

(4) carefully pipette supernatant liquor in a new 1.5mL centrifuge tube, add 1/10 3mol/L NaAc that gets the supernatant liquor volume and with the isopyknic Virahol of supernatant liquor, in 4 ℃ of refrigerators, place 30min behind the mixing gently, then the centrifugal 10min of 12000g under the room temperature;

(5) carefully outwell supernatant liquor and also wash twice (centrifuge tube several times gently overturn) of precipitation, outwell ethanol, blot mouth of pipe drop with sterilization filter paper then with 70% ethanol of precooling, air-dry;

(6) add 300 μ L ddH ₂O dissolving DNA precipitation adds 2～4 μ L RNase A (final concentration is 20 μ g/mL) simultaneously, mixing, and 37 ℃ of water-bath 1h fully clear up RNA;

(7) add 300 μ L phenol chloroforms, mixing fully vibrates, then in the centrifugal 15min of room temperature 12000g, draw in the new 1.5mL centrifuge tube of supernatant liquor to, add 1/10 3mol/L NaAc that gets the supernatant liquor volume and with the isopyknic Virahol of getting supernatant liquor, in 4 ℃ of refrigerators, place 30min behind the mixing gently, then the centrifugal 10min of 12000g under the room temperature;

(8) carefully removing supernatant liquor is twice (centrifuge tube gently overturns) of 70% washing with alcohol precipitation with the volume by volume concentration of precooling also, air-dry DNA precipitation;

(9) add 100 μ L and be preheated to 65 ℃ ddH ₂O or TE dissolving DNA after treating to dissolve fully, are got purity and concentration that 1～2 μ L utilizes UV spectrophotometer measuring DNA sample, with OD ₂₆₀/ OD ₂₈₀Ratio be 1.8～2.0 o'clock for best, the concentration of adjusting DNA is that 10ng/ μ L～50ng/ μ L is advisable, it is standby to place-20 ℃ of refrigerators to preserve then.

With No. 1, banana blight bacteria and No. 4 physiological strains and control strain through identifying the genomic dna of totally 20 bacterial strains be template, so that being carried out PCR, No. 1, No. 4 physiological strains and the specific primer of sharp sickle spore detect respectively, amplification system is with reference to table 3, and establishes the clear water contrast.Amplified production detects with 1.0% agarose gel electrophoresis.The result is shown in accompanying drawing 1～3, in accompanying drawing 1, accompanying drawing 2 and accompanying drawing 3: M is DL2000; 1～6 is FOC4; 7～11 is FOC1; 12 are the clear water contrast; 13 is the balsam pear wilt; 14 are joint cucurbit wilt bacterium; 15 is the wax gourd blight; 16 is cotton-wilt fusarium; 17 is the eggplant wilt; 18 is the tomato wilt bacterium; 19 is cucumber fusarium axysporum; 20 is half-naked sickle spore; 21 is dry thread Pyrenomycetes; 22 positive contrasts, wherein accompanying drawing 1 is that XJZ2, accompanying drawing 2 are XJZ2 for FJZ3, accompanying drawing 3; 23 are the clear water contrast.No. 4 physiological strain Auele Specific Primers, No. 1 physiological strain Auele Specific Primer and the specific primer of sharp sickle spore can amplify specific band respectively, and size is respectively 593bp, 354bp, 729bp, and peripheral bacterial strain does not then have amplified production.

The primer that the explanation of present embodiment experimental result is filtered out has excellent specificity, can identify the physiological strain of pathogenic bacteria respectively.

Embodiment 3: the triple PCR detection architecture is identified the detection of banana blight bacteria DNA and contrast and peripheral bacterial strain DNA

With No. 1, banana blight bacteria and No. 4 physiological strains and control strain the genomic dna of totally 20 bacterial strains be template, triple PCR detects primer (seeing Table 1) and carries out pcr amplification, amplification system sees Table 2, and establishes the clear water contrast.Amplified production detects with 1.0% agarose gel electrophoresis.The result as shown in Figure 4, in the accompanying drawing 4, M is DL2000; 1～6 is FOC4; 7～11 is FOC1; 12～13 is FOC4+FOC1; 14 are the clear water contrast; 15 is the balsam pear wilt; 16 are joint cucurbit wilt bacterium; 17 is the wax gourd wilt; 18 is cotton-wilt fusarium; 19 is the eggplant wilt; 20 is the tomato wilt bacterium; 21 is cucumber fusarium axysporum; 22 is half-naked sickle spore; 23 is dry thread Pyrenomycetes; 24 positive contrasts (XJZ2); 25 positive contrasts (FJZ3); 26 are the clear water contrast.It is 593bp and 729bp that No. 4 physiological strain bacterial strains can get two stripe size, No. 1 the physiological strain bacterial strain also has two bands, and size is 354bp and 729bp, and the bacterial strain of sharp sickle spore has a band simultaneously, size is 729bp, and the half-naked sickle spore of clear water and peripheral bacterial strain, dry thread Pyrenomycetes then do not have amplified production.

By experimental result as seen, use triple PCR detection primer and system and can in same reaction, detect banana blight bacteria simultaneously No. 1 and No. 4 physiological strains; Simultaneously, because the sharp sickle spore Auele Specific Primer that can be used as internal reference is arranged, thus can check the quality of the DNA that puies forward again, thus the appearance of false negative result avoided.

Embodiment 4: the sensitivity of triple PCR detection architecture detects to be identified

Be dissolved in the water of 50 μ L after getting the fresh mycelia 100mg extracting DNA of No. 4 physiological strain strain X JZ2, detect with carrying out triple PCR as template behind 10 times of concentration gradient doubling dilutions, and establish the clear water contrast.Amplified production detects with 1.0% agarose gel electrophoresis.Triple PCR detection architecture sensitivity detected result is seen accompanying drawing 5, and the DNA extract is in dilution 10 ⁴Still can amplify specific band doubly, show that this system can detect the minimum existence that is equivalent to the fresh mycelia of 0.2 μ g.In the accompanying drawing 5, M is DL2000; 1～7 is the genomic dna dilution gradient (10 of XJZ2 ⁰～10 ^-6); 8 are the clear water contrast.

Embodiment 5: the triple PCR detection architecture is identified the detection of morbidity banana tissue DNA

Gather banana disease sample from banana blight region of disease, Guangdong Province, carry out the extracting of the total DNA of banana method diseased tissues by detection of the present invention, and be template, use clear water simultaneously, the bacterial strain DNA of known No. 1 and No. 4 physiological strain does contrast, carries out triple PCR and detects.Amplified production detects with 1.0% agarose gel electrophoresis.As shown in Figure 6, it is 729bp and 593bp amplified band that banana disease tissue DNA and known No. 4 physiological strain DNA obtain two sizes, and two amplified productions of dwarf banana tissue DNA of falling ill and known No. 1 physiological strain size is for Wei not 729bp and 354bp.Can judge that thus the banana disease sample of being gathered is caused that by No. 4 physiological strains the disease of dwarf banana is then caused by No. 1 physiological strain.In the accompanying drawing 6, M is DL2000; 1 is XJZ2 bacterium DNA; 2 is FJZ1 bacterium DNA; 3 is Zhuhai banana disease sample; 4 is the sick sample of Zhuhai dwarf banana; 5 is Dongguan banana disease sample; 6 is the sick sample of Dongguan dwarf banana; 7 are the clear water contrast.

Embodiment 6: the triple PCR detection architecture is identified the detection of the pathogenic bacteria DNA that separation obtains

The disease sample that embodiment 5 is gathered carries out the separation and Culture of pathogenic bacteria, and concrete steps are with shown in the embodiment 2, the DNA of extracting pathogenic strains, method is with embodiment 2, and, do contrast with clear water and known No. 1, No. 4 physiological strain bacterial strain DNA simultaneously as template, carry out triple PCR and detect.Amplified production detects with 1.0% agarose gel electrophoresis.As shown in Figure 7, by pathogenic bacteria that is separated on the banana of falling ill and known No. 4 physiological strains two sizes that all can increase is 729bp and 593bp amplified band, and pathogenic bacteria that is separated to from dwarf banana and known No. 1 physiological strain then obtain two sizes for Wei not 729bp and the product of 354bp.In the accompanying drawing 7, M is DL2000; 1 is XJZ2 bacterium DNA; 2 is FJZ1 bacterium DNA; 3 is Zhuhai banana disease sample; 4 is the sick sample of Zhuhai dwarf banana; 5 is Dongguan banana disease sample; 6 is the sick sample of Dongguan dwarf banana; 7 are the clear water contrast.

Experimental result has further been verified the result of embodiment 5, thereby no matter the explanation triple PCR detection architecture that the present invention set up is at the banana tissue of falling ill, the DNA of the pathogenic bacteria that still therefrom is separated to all can obtain reliable qualification result.

Embodiment 7: the triple PCR detection architecture is identified the detection of mixing soil bacteria

The fresh mycelia that in three parts of 200mg sterile soils, adds No. 4 physiological strain strain X of 10mg JZ2, No. 1 physiological strain bacterial strain FJZ3 and balsam pear wilt respectively, mixing separately.Extract the genomic dna of each bacterium in the soil with E.Z.N.ASoil DNA kit (OMEGA) test kit (commercial), concrete steps are as follows:

(1) sample of adding mixing in the 15mL centrifuge tube, the SLX solution that adds 1 milliliter again, vortex 3 minutes is broken up until sample under top speed, the DS damping fluid that adds 100 μ L again, the vortex mixing, place 70 ℃ of water-bath temperature to bathe 10min then, concussion sample 2 times is with abundant mixing sample in the process of hatching;

(2) add the SP2 solution of 200 μ L, the 2 minutes abundant mixing samples that vibrates, leave standstill 5min on ice after, 4 ℃ times 13,000g, centrifugal 5min;

(3) the careful transfer got in supernatant liquor to the new 2mL centrifuge tube, notes not being drawn onto precipitation or cell debris, add and the isopyknic Virahol of institute's supernatant liquor of getting, and upset centrifuge tube 5～10 times is with the mixing sample, and under the room temperature 13,000g, centrifugal 10min;

(4) carefully outwell supernatant liquor and guarantee that DNA precipitation is not poured out, and is upside down in air-dry DNA sample on the thieving paper with centrifuge tube;

(5) ddH of adding 200 μ L ₂O and vortex 10 seconds, 65 ℃ of temperature are bathed 10～20min and are precipitated with complete dissolving DNA, of short durationly centrifugally are bonded at liquid on the centrifugal tube wall with collection.

(6) add 100 μ L by evenly resuspended HTR solution and after shaking 10 seconds, leave standstill 2min under the room temperature, 13,000g, centrifugal 2min;

(7) shift in supernatant liquor to the new centrifuge tube.Attention:, repeat HTR extraction steps 6 if supernatant still presents the color of attaching most importance to;

(8) add 2 μ L RNase A (25mg/ml) and shake 10s, 37 ℃ down temperature bathe 10min to eliminate the DNA in the sample;

(9) add 300 μ L XP2 solution, vibration mixing sample moves in the HiBind DNA column that the 2ml collection tube is housed, under the room temperature 13, and 000g, centrifugal 1min discards filtrate;

(10) HiBind DNA column is placed original collection tube, add the XP2 solution of 300 μ L, under the room temperature 13,000g, centrifugal 1min discards filtrate;

(11) the DNA column is moved on another collection tube, add under 700 μ L SPW washing lotion (diluting with the dehydrated alcohol) room temperatures 13,000g, centrifugal 1min discards filtrate, repeats this step once;

(12) under the room temperature 13,000g, centrifugal empty DNA column 2min is to abandon the SPW washing lotion to the greatest extent;

(13) the DNA column is moved on the new 1.5ml centrifuge tube, add TE (or the ddH of 50 μ L ₂O) to the central authorities of pillar, after 65 ℃ of temperature are bathed at least 5min, room temperature 13,000g is centrifugal with eluted dna.

(14) get purity and the concentration that the extractive DNA of 1～2 μ L utilizes UV spectrophotometer measuring DNA sample, with OD ₂₆₀/ OD ₂₈₀Ratio be 1.8～2.0 o'clock the bests, the concentration of adjusting DNA is that 10ng/ μ L～50ng/ μ L is advisable; It is standby to place-20 ℃ of refrigerators to preserve then.

What obtain required detection mixes soil bacteria DNA, and carries out triple PCR as template and detect.Amplified production detects with 1.0% agarose gel electrophoresis.Detected result as shown in Figure 8, in the accompanying drawing 8, M is DL2000 Marker; 1 pedotheque for inoculation XJZ2; 2 pedotheques for inoculation FJZ3; 3 pedotheques for inoculation balsam pear wilt; 4 are the contrast of sterilization soil; 5 is the FOC4 positive control; 6 is the FOC1 positive control; 7 is sharp sickle spore positive control; 8 are the clear water contrast.The triple PCR detection architecture can detect No. 1, No. 4 physiological strains of banana blight bacteria and other the sharp sickle spore in the soil.Carry out triple PCR after with 10 times of gradient dilutions and increase by extracting DNA in the soil that is mixed with strain X JZ2, amplification such as accompanying drawing 9, in the accompanying drawing 9, M is DL2000 Marker; 1～6 pedotheque DNA dilution gradient (10 for inoculation XJZ2 ⁰～10 ^-5); 7 is the FOC4 positive control; 8 are the clear water contrast.Experimental result shows that dna profiling can also effectively detect in the soil that is mixed with XJZ2 after diluting 100 times.Embodiment 7 shows that the triple PCR detection architecture can be applicable to the detection of DNA in the banana blight lesion soil, to identify this growing area whether is arranged existing of cause of disease, provides convenience and technical guarantee for producing plantation.

SEQUENCE?LISTING

＜110〉Agricultural University Of South China

＜120〉No. 1, banana blight bacteria and No. 4 physiological strains detect primer and method for quick

<130>

<160>9

<170>PatentIn?version?3.5

<210>1

<211>1441

<212>DNA

＜213〉No. 1 physiological strain specific DNA sequence

<400>1

ggtgagcttt?gtatcatcgt?cgccttacgc?tggatcactc?tcattttccc?tcttaattgc 60

cttagcttca?agtttgcgcg?ttctctatgg?acggtgttgc?tcgagccctc?tttttttact 120

tcttgttcga?atggacataa?gatgggatat?aaataaataa?ggcattgttc?agaagcagat 180

atcggttttt?acttgtgtat?tttgatgcct?ttcggctgta?gcaagaacta?cgtttattgt 240

tgtttgtctt?aacgccgaaa?tgtcgcccct?acgaatagac?caatcatggc?tgacattgaa 300

gttatcgccg?aaacccactt?gcgtcacatc?tccgttgcca?tcggcgttca?gctaagcacc 360

aaacagggaa?cgagaaggat?cacaatgcca?agactccagt?cggccgcgta?taaatggtca 420

atggaaatac?aattgctgac?ttgatcattc?tcactcagtc?ataaccatgg?attcacgacg 480

aaactttcag?actcttgagg?gtaaggtcgc?tatcatcaca?ggcgcttctc?gaggccttgg 540

ggcaggcttt?gcttatgagc?ttgcaaaaag?gggtgcaaag?gtgagaaatc?tgttgagtct 600

cgataaacag?caatactgag?catggcaggt?cgtcgctaca?tacacttccc?caagcagcga 660

aaggctggtg?aaggagttgt?ccgacaaaat?cgcatcactc?gatccaccat?cagaatgcat 720

tggtgttaaa?gcagatctca?aggacgagtc?gtcgcccgct?gagatcgtcc?gacaggcagt 780

cgctgcattc?ggttctcaaa?tcgatgtact?cgtcaacaac?gccggcatgg?aagtcgtcaa 840

atctcatgcc?gacatcacaa?catccgactt?tgactcaatc?ttctacctca?acgtccgcgc 900

tcctcttctg?ctcctccaag?cagtaagacc?atatctcccc?tcgtccggcg?gtggccgcat 960

catcaacatt?tcatcagtag?gcgcccgctg?cggtttcaag?aacctctctc?tgtattgcgc 1020

ttccaaagct?gcactcgaag?gacttacgcg?ctcatgggca?gttgagctgg?gtgagaaggg 1080

tcatacggtc?aatgcggtta?accctggacc?tgttcaaagt?gatttattgg?acaacattcc 1140

caaagagatc?attgagatgc?agaagaagca?gaccgcagcg?gggcatagac?tgggtgaggt 1200

tgatgatgtt?gcgcagattg?ttgcttggtt?ggcttcggag?gagagtagat?ggattacggg 1260

acaggcgtta?tctgctagtg?gtggattaga?gatgtattag?agtcgtttaa?cactgaagtt 1320

tgctcgtaaa?gaccgtcagg?cctatagaaa?ccgaggccgc?tcgtgaatca?aaacaggttc 1380

caggatgtaa?agcatatggc?tacattctca?taccaaatct?ctgtcaacag?cacgcatgat 1440

c 1441

<210>2

<211>23

<212>DNA

＜213〉No. 1 special primer of going up of physiological strain

<400>2

gttgagtctc?gataaacagc?aat 23

<210>3

<211>19

<212>DNA

＜213〉No. 1 special primer down of physiological strain

<400>3

gacgagggga?gatatggtc 19

<210>4

<211>789

<212>DNA

＜213〉No. 4 physiological strain specific DNA sequences

<400>4

gaggcttcca?gaccgacaag?atattataat?cgaacagttt?gcgaatatcg?tgtatgggct 60

ctcaaccggt?cgtgctcttt?gagtcagaat?caaggccaag?cagtagagca?acaattaagc 120

cgatgtcttc?gtcaggtata?gatcatgaac?acatgaagtt?tatcaagatt?aatagttatc 180

tacgacttat?ctagcggttg?atgtggctaa?aaataagtga?caattaagag?tcgatcaagg 240

cgccgattcc?gctccggact?tggatgaatc?tgggcattat?ygtgcgatcg?agtggagttg 300

aagggtaggg?gtcttcgggg?gagctagctg?aactccagaa?atcagatttg?gccgagaccg 360

acgacccatt?gtctgtgctg?ataatgagat?ggagacgacg?tggggccaat?gttgaatccg 420

agagcggtag?tcttcgcctc?tataccaagt?cgaccaagct?gcataccgcc?ggagatttcc 480

agaaagcttg?aatgtagagc?caagacttgc?cgaacttcac?tacgtacatg?ccagctaacc 540

ccaggttctt?gtaatagggc?tgtttaaccc?gaatttacac?tacgtaatac?ttgtcagtgg 600

ttctcggcag?tctactgacc?ttgctctacg?gaaatgagtg?gggagcgggt?agaagcgact 660

gtgtgattag?tttaccatgc?acaaatcata?ttcatgcagc?acgagtctca?gattatgata 720

gattgtaacg?agtgtccatt?tatgctatac?tgactccata?tcctctttgc?cttcaactcc 780

actcgatcg 789

<210>5

<211>20

<212>DNA

＜213〉primer on No. 4 physiological strain specificitys

<400>5

gccgatgtct?tcgtcaggta 20

<210>6

<211>20

<212>DNA

＜213〉primer under No. 4 physiological strain specificitys

<400>6

ctgagactcg?tgctgcatga 20

<210>7

<211>1133

<212>DNA

＜213〉sharp sickle spore specific DNA sequence

<400>7

catctcaggc?tcgaagagca?ctgagtaaag?gtcacccatg?acagggtcta?ccgtactgaa 60

tggcagtcgt?acgtcatcga?ccttacctgt?cagccacccc?gagatagtga?caatgaggtt 120

gactcgcttg?ttgttgtgaa?ggggacgata?ttcgaacgtc?ctaaccgcgc?cagttcttcg 180

gtccgcagcc?ctgcctccga?tgatactgcc?tgacgccgct?gcgcccgagg?tgatgatggc 240

tgcgcctcct?acaccaccga?ggaaacttcc?cgtgccagtc?actccgatgg?ctgttaatcc 300

ggtagccagg?tccgcaccga?tgacaggagc?aagcaaacct?gccgaaagac?caatgaccaa 360

cccaccacct?acggtggcca?atcccatcat?cacatatcgc?cgggtcaatg?cgttcttcct 420

gcgagtctcc?gtgtgctcct?cctcgttcca?gttctctttc?tcggcagctt?gctgcatctc 480

cagagcctct?gtgaccttct?tctcgaaacg?gcagatatca?acccacgtaa?tatcaagact 540

ctcaccaact?cgctccaaga?gaaccctcga?gcgggaatcg?taaatagaat?ctgcgatcaa 600

gaggaggaag?aggtcgcaaa?gtacagtcca?ccgaagatca?atatcgatct?ttgcggtggt 660

ggggagctgt?gatggtgtct?tcacgtcaga?gagctcctcc?ccgtcaagcg?cctcatatgg 720

cggcggcgcc?tctgcaggct?tctcgtccag?tgatggggtg?cttggcatcg?atgactcgcc 780

atctgccatg?ggatttgata?ctcgagcatt?agtattgagc?gcgggtgcca?agtcctgcgg 840

cataactcca?tgttctgcca?actgttcaat?cataatctgc?tcagcttcat?tgatctccat 900

gtgagcgtac?agtcgaagca?tcattttttg?gccccacatc?agcatggatt?caactgatat 960

accaacctcc?ttcttcgtct?tcttgaacga?tttcattttt?tccgcctctt?tcacaagtct 1020

gacgatttcg?agacggaaca?atccaacgta?tgcaactctt?tggccttcgg?tcaagagatc 1080

tttggtagcc?tgcatctgac?caatagcatc?tcgtccttca?tctcactcga?cca 1133

<210>8

<211>20

<212>DNA

＜213〉the general primer of going up of sharp sickle spore

<400>8

gcagtcgtac?gtcatcgacc 20

<210>9

<211>20

<212>DNA

＜213〉the general primer down of sharp sickle spore

<400>9

ccatggcaga?tggcgagtca 20

Claims

1. No. 1, banana blight bacteria and No. 4 physiological strains detect primer, have following sequence:

No. 1 physiological strain specific detection primer sequence is:

Last primer: 5 ' GTTGAGTCTCGATAAACAGCAAT 3 ';

Following primer: 5 ' GACGAGGGGAGATATGGTC 3 ';

No. 4 physiological strain specific detection primer sequence is:

Last primer: 5 ' GCCGATGTCTTCGTCAGGTA 3 ';

Following primer: 5 ' CTGAGACTCGTGCTGCATGA 3 ';

Point sickle spore universal primer sequence is:

Last primer: 5 ' GCAGTCGTACGTCATCGACC 3 ';

Following primer: 5 ' CCATGGCAGATGGCGAGTCA 3 '.

2. method of utilizing the described primer of claim 1 to detect the banana blight bacteria physiological strain is characterized in that may further comprise the steps:

(1) the extracting banana of falling ill is organized total DNA;

(2) organizing extractive total DNA with the banana of falling ill is template, carries out the triple PCR amplified reaction with the described primer of claim 1;

(3) amplified production is detected with 1.0% agarose gel electrophoresis.

3. method according to claim 2 is characterized in that the described banana of falling ill of step (1) is organized as banana bulb tissue.

4. method according to claim 2 is characterized in that the described triple PCR amplification reaction system of step (2) is:

The volume final concentration

10 * damping fluid (contains Mg ²⁺) 2.5 μ L 1 *

dNTP(2.5mmol/L) 2μL 0.2mmol/L

Primer on No. 1 physiological strain specificity (5 μ mol/L) 1 μ L 0.2 μ mol/L

Primer under No. 1 physiological strain specificity (5 μ mol/L) 1 μ L 0.2 μ mol/L

Primer on No. 4 physiological strain specificitys (5 μ mol/L) 1 μ L 0.2 μ mol/L

Primer under No. 4 physiological strain specificitys (5 μ mol/L) 1 μ L 0.2 μ mol/L

General primer (5 μ mol/L) the 1 μ L 0.2 μ mol/L that goes up of Fusarium oxysporum

General primer (5 μ mol/L) the 1 μ L 0.2 μ mol/L down of Fusarium oxysporum

Taq enzyme (5U/ μ l) 0.2 μ L 0.04U/ μ L

Dna profiling 1 μ L 10-50ng

ddH ₂O 13.3μL。

5. the application of the described method of claim 2 is characterized in that being applied to detect branch physiological strain under the fungal DNA of banana blight strain detects.

6. the application of the described method of claim 2 is characterized in that being applied to detect contained physiological strain among the total DNA of banana blight strain diseased tissues.

7. the application of the described method of claim 2 is characterized in that being applied to detect existing banana blight bacteria physiological strain in the soil.