CN110669858B - Triple fluorescence quantitative PCR detection method and kit for cruciferous vegetable rhizoctonia solani - Google Patents
Triple fluorescence quantitative PCR detection method and kit for cruciferous vegetable rhizoctonia solani Download PDFInfo
- Publication number
- CN110669858B CN110669858B CN201910717500.XA CN201910717500A CN110669858B CN 110669858 B CN110669858 B CN 110669858B CN 201910717500 A CN201910717500 A CN 201910717500A CN 110669858 B CN110669858 B CN 110669858B
- Authority
- CN
- China
- Prior art keywords
- rhizoctonia solani
- quantitative pcr
- triple
- detection
- kit
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
Abstract
The invention discloses a triple fluorescence quantitative PCR detection kit for cruciferous vegetable rhizoctonia solani, which comprises 3 pairs of primers and probes: AG-2-1-F, AG-2-1-R, AG-2-1-P, AG-1-IB-F, AG-1-IB-R, AG-1-IB-P, AG-4HGII-F, AG-4HGII-R, AG-4 HGII-P. The kit also comprises a triple fluorescent quantitative PCR detection premix solution, a blank reference substance, a negative reference substance and a positive reference substance. The invention takes 3 dominant fusion group standard strains of the rhizoctonia solani disease as positive materials, takes Chinese cabbage plant tissues as negative materials, takes other soil-borne pathogenic bacteria as identification materials, uses multiplex fluorescence quantitative PCR for detection, has accurate result, high sensitivity and good repeatability, has extremely high specificity of primers and probes, and can quickly and accurately identify the rhizoctonia solani of cruciferous vegetables.
Description
Technical Field
The invention relates to the technical field of molecular biology, in particular to a triple fluorescence quantitative PCR detection method and a kit for predominant fusion groups AG-2-1, AG-1-IB and AG-4HGII of rhizoctonia solani of cruciferous vegetables.
Background
Rhizoctonia solani (Rhizoctonia solani) belongs to anepithomycota, is an important soil-borne fungus, and is divided into 14 different fusion groups (AG) and at least 20 fusion subgroups according to hyphal fusion, pathogenicity, phylogenetic difference and the like. The pathogenic bacteria have wide host range, and can infect vegetables of Solanaceae, Cucurbitaceae, Chenopodiaceae, Brassicaceae, etc., and crops of rice, corn, wheat and cotton, etc., to cause various symptoms such as rhizoctonia rot, leaf rot, root rot, and sheath blight. Among them, the fusion group infecting cruciferous vegetables mainly contains AG-2-1, AG-1-IB and AG-4HGII, which may cause serious economic loss. Therefore, the disease can be better controlled by detecting and early warning the rhizoctonia solani of the cruciferous vegetables.
The method for diagnosing the diseases by the conventional plant tissue separation and identification method is time-consuming and labor-consuming, has low accuracy, and is difficult to accurately separate and identify plant tissues infected by multiple fungi in a complex way.
Therefore, a molecular biological method which has high accuracy and can rapidly identify rhizoctonia solani is urgently needed, diagnosis, detection and identification of fusion groups can be carried out in the early stage of diseases, disease control can be effectively carried out in time, economic loss is reduced, and important technical support is provided for field disease control.
Disclosure of Invention
The invention aims to solve the technical problem of providing a triple fluorescence quantitative PCR detection method and a triple fluorescence quantitative PCR detection kit for rhizoctonia solani of cruciferous vegetables, which solve the practical problems that the detection of diseases of the rhizoctonia solani of the cruciferous vegetables by the traditional method wastes time and labor and other fungi are difficult to distinguish and identify during compound infection. The detection kit can be used for synchronously detecting 3 main fusion groups AG-2-1, AG-1-IB and AG-4HGII by a single tube, and can be used for diagnosing the rhizoctonia solani diseases of the cruciferous vegetables in the field.
The technical problem to be solved by the invention is realized by the following technical scheme:
a triple fluorescence quantitative PCR detection kit for detecting rhizoctonia solani of cruciferous vegetables is characterized in that the detection kit comprises 3 pairs of primers and respective corresponding probes for amplifying and detecting fusion groups AG-2-1, AG-1-IB and AG-4HGII of the rhizoctonia solani, and the 3 pairs of primers and the respective corresponding probe sequences are respectively as follows:
the upstream primer AG-2-1-F: GCTACAACCCCAAGTCGG, respectively;
downstream primer AG-2-1-R: GTAAAAGCGTAAACCTGGGTG, respectively;
fluorescent probe AG-2-1-P: 5 '-FAM-CCTATCTCTGGATGGCACGGTGAC-TAMRA-3';
the upstream primer AG-1-IB-F: AACAAGATGGACACTACCAAGG, respectively;
downstream primer AG-1-IB-R: GGTCCTCGCTCCACTATAAAG, respectively;
fluorescent probe AG-1-IB-P: 5 '-VIC-AGTACAAACTCCACTCGGGTAACGACA-TAMRA-3';
the upstream primer AG-4 HGII-F: GCGCGGTAAAGGAATTTTGC, respectively;
downstream primer AG-4 HGII-R: GACAATAAATTTCGCTACCTTAGGC, respectively;
fluorescent probe AG-4 HGII-P: 5 '-CY 5-AAGGAGCCCTGCGGGTTATAAATATGTG-BHQ 2-3'.
Preferably, in the above technical solution, the detection kit comprises: detecting the premix solution, a blank reference substance, a negative reference substance and a positive reference substance by triple fluorescence quantitative PCR; the triple fluorescent quantitative PCR detection premix comprises the 3 pairs of primers and probes, qPCR MIX and double distilled water; the positive control is a plasmid mixture of AG-2-1, AG-1-IB and AG-4 HGII; the negative reference substance is a soil-borne pathogen; the blank reference substance is DEPC-H2O。
Preferably, in the above technical solution, the positive control comprises:
a rhizoctonia solani fusion group AG-2-1 plasmid with a sequence shown as SEQ ID NO. 10;
a rhizoctonia solani fusion group AG-1-IB plasmid with a sequence shown as SEQ ID NO. 11;
a rhizoctonia solani fusion group AG-4HGII plasmid with a sequence shown as SEQ ID NO. 12;
wherein the content of the first and second substances,
the SEQ ID NO. 10 sequence is:
5’-GCTACAACCCCAAGTCGGTCGCTTTCGTCCCTATTTCTGGATGGCACGGTGACAACATGTTGGAGGAGTCCGTCAAGTACGTCATACTGTCGCACCCAGGTTTACGCTTTTAC-3’；
the SEQ ID NO. 11 sequence is:
5’-GGTCCTCGCTCCACTATAAAGGTTGTCAGTACAAACTCCACTCGGGTAACGACATTATATGTACCTTGGTAGTGTCCATCTTGTT-3’；
the SEQ ID NO. 12 sequence is:
5’-GCGCGGTAAAGGAATTTTGCTTTTGATGATATAGTCCACATATTTATAACCCGCAGGGCTCCTTCGGAGTCCGGAGGGACCCCTCAGGGTAATATAAATATTAAAGCCTAAGGTAGCGAAATTTATTGTC-3’。
preferably, in the above technical scheme, the concentration of the AG-2-1 plasmid is 1.0X 109copies/. mu.L; the concentration of the AG-1-IB plasmid is 1.0X 109copies/. mu.L; the concentration of the AG-4HGII plasmid was 1.0X 109copies/μL。
Preferably, in the above technical scheme, the soil-borne pathogenic bacteria are fusarium oxysporum, fusarium solani, colletotrichum gloeosporioides, alternaria brassicae, pythium aphanidermatum, and the like.
Preferably, in the above technical scheme, the template DNA is subjected to PCR amplification by using primers and probes, and the rhizoctonia solani of brassicaceae is analyzed and detected according to the intensity of a fluorescent signal after PCR amplification.
Preferably, in the above technical solution, the detection method includes:
(1) preparing a PCR reaction system: taking 1 mu L of each of the positive control, the negative control and the blank control, and respectively adding 19 mu L of triple fluorescent quantitative PCR detection premix to obtain PCR reaction systems of the positive control, the negative control and the blank control;
(2) PCR amplification reaction: the reaction condition is 98 ℃ for 1 min; alternately cycling 40 times at 98 ℃ for 5sec and 62 ℃ for 32 sec;
(3) fluorescence detection: after the PCR reaction is finished, detecting the fluorescence signal value of the PCR reaction system;
(4) and analyzing and judging the result.
Preferably, in the above technical solution, in a 20 μ L PCR reaction system, each substance comprises:
the upstream primer AG-2-1-F: 0.2. mu.L, downstream primer AG-2-1-R: 0.2. mu.L, fluorescent probe AG-2-1-P: 1 mu L of the solution;
the upstream primer AG-1-IB-F: 0.3. mu.L, downstream primer AG-1-IB-R: 0.3. mu.L, fluorescent probe AG-1-IB-P: 1 mu L of the solution;
the upstream primer AG-4 HGII-F: 0.2. mu.L, downstream primer AG-4 HGII-R: 0.2. mu.L, fluorescent probe AG-4 HGII-P: 1 mu L of the solution;
qPCR MIX: 10.4 mu L; double water distillation: 4.2. mu.L.
Preferably, in the above technical solution, in the fluorescence detection in step (3), the fluorescence channel is selected from FAM, VIC and CY5 channels.
The technical scheme of the invention has the following beneficial effects:
the invention designs three pairs of PCR primers which are respectively sequences of specific amplification Rhizoctonia solani fusion groups AG-2-1, AG-1-IB and AG-4HGII, and the three pairs of PCR primers can be simultaneously amplified in the same PCR reaction tube, so that triple detection is realized, the detection time is greatly shortened, and the operation is simple and convenient. The design of the specific primers and the probes ensures the high conservation and specificity of the primers and the probes, and avoids the condition that no complementary pairing or cross amplification exists between two pairs of primers and probes.
The fluorescence wavelengths of the three selected fluorescent groups have larger difference and the signal intensities are similar, so that the mutual interference among signals is avoided.
The kit and the primer probe can be used for rapidly detecting predominant fusion groups AG-2-1, AG-1-IB and AG-4HGII of rhizoctonia solani of cruciferous vegetables, and have the advantages of simple and convenient operation, high sensitivity, good specificity and the like; can diagnose the early diseases in the field and provides technical support for early prevention and treatment.
Drawings
FIG. 1: example 5 common PCR primer sensitivity detection electropherograms of Rhizoctonia solani AG-2-1, AG-1-IB and AG-4HGII, wherein A is an AG-2-1 electropherogram, B is an AG-1-IB electropherogram, and C is an AG-4HGII electropherogram;
FIG. 2: example 5 fluorescent quantitative PCR primer sensitivity detection profiles of Rhizoctonia solani AG-2-1, AG-1-IB and AG-4HGII based on SYBRGreen, wherein A is a profile of AG-2-1, B is a profile of AG-1-IB, and C is a profile of AG-4 HGII;
FIG. 3: example 5A graph of TaqMan-based fluorescent quantitative PCR sensitivity detection of Rhizoctonia solani AG-2-1, AG-1-IB and AG-4HGII, wherein A is a graph of AG-2-1, B is a graph of AG-1-IB and C is a graph of AG-4 HGII;
FIG. 4: example 6 sensitivity detection profile of Rhizoctonia solani fusion group AG-2-1;
FIG. 5: example 6 sensitivity detection profile of Rhizoctonia solani fusion group AG-1-IB;
FIG. 6: example 6 graph showing the sensitivity detection of Rhizoctonia solani fusion group AG-4 HGII;
FIG. 7: sample 1 detection profile in example 7;
FIG. 8: sample 2 detection profile in example 7;
FIG. 9: sample 3 detection profile in example 7;
FIG. 10: sample 4 in example 7 is a test graph.
Detailed Description
The following detailed description of specific embodiments of the invention is provided to facilitate a further understanding of the invention.
EXAMPLE 1 Synthesis of primers and probes
The synthesis of primers and probes for triple fluorescent quantitative PCR detection of rhizoctonia solani fusion groups AG-2-1, AG-1-IB and AG-4HGII comprises the following specific steps:
primers and probes of rhizoctonia solani fusion group AG-2-1:
AG-2-1 upstream primer: 5'-GCTACAACCCCAAGTCGG-3' (SEQ ID NO:1)
AG-2-1 downstream primer: 5'-GTAAAAGCGTAAACCTGGGTG-3' (SEQ ID NO:2)
AG-2-1 Probe: 5 '-FAM-CCTATCTCTGGATGGCACGGTGAC-TAMRA-3' (SEQ ID NO: 3);
(II) primers and probes of rhizoctonia solani fusion group AG-1-IB:
AG-1-IB upstream primer: 5'-AACAAGATGGACACTACCAAGG-3' (SEQ ID NO:4)
AG-1-IB downstream primer: 5'-GGTCCTCGCTCCACTATAAAG-3' (SEQ ID NO:5)
AG-1-IB Probe: 5 '-VIC-AGTACAAACTCCACTCGGGTAACGACA-TAMRA 3' (SEQ ID NO: 6);
(III) primers and probes of Rhizoctonia solani fusion group AG-4 HGII:
(1) AG-4HGII upstream primer: GCGCGGTAAAGGAATTTTGC (SEQ ID NO:7)
(2) AG-4HGII downstream primer: GACAATAAATTTCGCTACCTTAGGC (SEQ ID NO:8)
(3) AG-4HGII probe: 5 '-CY 5-AAGGAGCCCTGCGGGTTATAAATATGTG-BHQ 2-3' (SEQ ID NO:9)
Example 2 preparation of a premix for triple fluorescent quantitative PCR detection
The preparation method of the mixed solution for triple fluorescent quantitative PCR detection comprises the following specific steps:
the following components synthesized in example 1 were mixed to obtain a triple fluorescent quantitative PCR detection mixture of Rhizoctonia solani fusion groups AG-2-1, AG-1-IB and AG-4 HGII.
AG-2-1 upstream primer: 0.2 μ L/test;
AG-2-1 downstream primer: 0.2 μ L/test;
AG-2-1 Probe: 1 μ L/test;
AG-1-IB upstream primer: 0.3 μ L/test;
AG-1-IB downstream primer: 0.3 μ L/test;
AG-1-IB Probe: 1 μ L/test;
AG-4HGII upstream primer: 0.2 μ L/test;
AG-4HGII downstream primer: 0.2 mu L/test;
AG-4HGII probe: 1 μ L/test;
qPCR MIX：10.4μL/test；
double water distillation: 4.2 μ L/test.
EXAMPLE 3 preparation of Positive control
Preparing a positive reference substance in a triple fluorescent quantitative PCR detection kit for rhizoctonia solani fusion groups AG-2-1, AG-1-IB and AG-4 HGII:
(first) construction of plasmid
1. Construction of a Rhizoctonia solani fusion group AG-2-1 plasmid: the PCR method is adopted to amplify the nucleic acid of a rhizoctonia solani fusion group AG-2-1 sample (preserved by vegetable and flower research institute of Chinese academy of agricultural sciences), and the obtained sequence is as follows:
5'-GCTACAACCCCAAGTCGGTCGCTTTCGTCCCTATTTCTGGATGGC ACGGTGACAACATGTTGGAGGAGTCCGTCAAGTACGTCATACTGTCGCACCCAGGTTTACGCTTTTAC-3' (SEQ ID NO:10), and the primer sequence is shown in SEQ ID NO: 1-3. And (3) after purifying the amplified fragment, cloning the amplified fragment to a pMD19-T vector through TA, carrying out sequencing identification, transforming a recombinant vector with a correct sequencing result into DH5 alpha, and amplifying to obtain an AG-2-1 plasmid.
2. Construction of a Rhizoctonia solani fusion group AG-1-IB plasmid: amplifying nucleic acid of a fusion group AG-1-IB sample (preserved by vegetable and flower research institute of Chinese academy of agricultural sciences) by using a PCR method to obtain a sequence:
5'-GGTCCTCGCTCCACTATAAAGGTTGTCAGTACAAACTCCACTCGG GTAACGACATTATATGTACCTTGGTAGTGTCCATCTTGTT-3' (SEQ ID NO:11), and the primer sequence is shown in SEQ ID NO: 4-6. And (3) after purifying the amplified fragment, cloning the amplified fragment to a pMD19-T vector through TA, carrying out sequencing identification, transforming a recombinant vector with a correct sequencing result into DH5 alpha, and amplifying to obtain an AG-1-IB plasmid.
3. Construction of a Rhizoctonia solani fusion group AG-4HGII plasmid: the nucleic acid of the fusion group AG-4HGII sample (preserved by vegetable flower research institute of Chinese academy of agricultural sciences) was amplified by PCR to obtain the sequence:
5'-GCGCGGTAAAGGAATTTTGCTTTTGATGATATAGTCCACATATTTATAACCCGCAGGGCTCCTTCGGAGTCCGGAGGGACCCCTCAGGGTAATATAAATATTAAAGCCTAAGGTAGCGAAATTTATTGTC-3' (SEQ ID NO:12) nucleic acid fragment of the target amplification sequence, the primer sequence is shown in SEQ ID NO: 7-9. And (3) after purifying the amplified fragment, cloning the amplified fragment to a pMD19-T vector through TA, carrying out sequencing identification, transforming a recombinant vector with a correct sequencing result into DH5 alpha, and amplifying to obtain an AG-4HGII plasmid.
Preparation of positive control
The concentration obtained in the step (one) is 1.0 multiplied by 107copies/. mu.L of AG-2-1 plasmid, AG-1-IB plasmid and AG-4HGII plasmid were mixed in equal volumes and mixed at 1:10, 1:100, 1:1000, 1:10000 and 1: the dilution was carried out at 100000 to obtain 6 positive control products S1 to S6 at different concentrations.
EXAMPLE 4 kit Assembly
The assembly of the triple fluorescent quantitative PCR detection kit for the rhizoctonia solani fusion groups AG-2-1, AG-1-IB and AG-4HGII comprises the following specific steps:
assembling 6 groups of detection kits, respectively comprising:
(1) 19 μ L of the triple fluorescent quantitative PCR detection mixture prepared in example 2;
(2) the positive control products S1-S6 prepared in example 3 each contained 1. mu.L, which are specifically shown in Table 1;
(3) negative control: 1 mu L of DNA of other fusion groups of rhizoctonia solani and fusarium, alternaria and the like;
(4) blank control: DEPC-H2O 1μL。
TABLE 15 composition of triple fluorescent quantitative PCR detection kit for Rhizoctonia solani fusion groups AG-2-1, AG-1-IB and AG-4HGII
Example 5 primer sensitivity detection and comparison
1. The concentration obtained in the step (one) is 1.0 multiplied by 109copies/. mu.L AG-2-1 plasmid, 1.0X 109copies/. mu.L AG-1-IB plasmid and 1.0X 109The AG-4HGII plasmids were expressed in a ratio of 1:10, 1:100, 1:1000, 1:10000, 1: 100000, 1: 1000000 and 1: 10000000, 8 positive reference substances with different concentrations are obtained respectively, and common PCR, primer sensitivity detection based on SYBR Green and TaqMan probes and comparison are carried out.
2. PCR amplification
(1) The common PCR reaction tube is arranged on a PCR gene amplification instrument, and reaction parameters are set as follows:
5min at 94 ℃; circulating for 30 times at 94 ℃ for 30s, at 62 ℃ for 30s and at 72 ℃ for 1 min; 5min at 72 ℃. The reaction system was 25. mu.L.
(2) The SYBR Green-based fluorescent quantitative PCR reaction tube is arranged on a quantitative fluorescent quantitative PCR instrument, and the following cycle parameters are set:
15min at 95 ℃; circulating 40 times at 95 ℃ for 10sec and 62 ℃ for 32 sec; the reaction system was 20. mu.L.
(3) Placing a fluorescent quantitative PCR reaction tube based on a TaqMan probe on a quantitative fluorescent quantitative PCR instrument, and setting the following cycle parameters:
1min at 98 ℃; cycling 40 times at 98 ℃ for 5sec and 62 ℃ for 32 sec; the reaction system was 20. mu.L.
3. The detection results are detailed in Table 2, and the amplification curves are shown in FIGS. 1-3.
TABLE 2 primer sensitivity test results
EXAMPLE 6 sensitivity analysis of the kit
The sensitivity analysis of the triple fluorescent quantitative PCR detection kit for the rhizoctonia solani fusion groups AG-2-1, AG-1-IB and AG-4HGII comprises the following steps:
1. preparation of reagents:
taking the triple fluorescent quantitative PCR detection mixed solution (19 muL each) in the triple fluorescent quantitative PCR detection kit 1-6 of rhizoctonia solani fusion groups AG-2-1, AG-1-IB and AG-4HGII assembled in the example 4, shaking and mixing the mixed solution for several seconds, centrifuging the mixed solution at 3000rpm for several seconds, placing the mixed solution into a PCR tube, adding a positive control product S1-6 (1 muL each) into the 6 groups of PCR tubes respectively, covering the tube covers, and immediately carrying out PCR amplification reaction.
2. And (3) PCR amplification:
the reaction tube is placed on a quantitative fluorescent quantitative PCR instrument, and the following cycle parameters are set:
1min at 98 ℃; cycling 40 times at 98 ℃ for 5sec and 62 ℃ for 32 sec; the reaction system was 20. mu.L.
3. And (3) detection results: see tables 3-5 for details, and FIGS. 4-6 for amplification curves.
TABLE 3 kit sensitivity test results
TABLE 4 kit sensitivity test results
| RS-IB-S1 | RS-IB-S2 | RS-IB-S3 | RS-IB-S4 | RS-IB-S5 | RS-IB-S6 |
| + | + | + | + | + | + |
TABLE 5 kit sensitivity test results
| RS-HG-S1 | RS-HG-S2 | RS-HG-S3 | RS-HG-S4 | RS-HG-S5 | RS-HG-S6 |
| + | + | + | + | + | + |
The results in tables 3, 4 and 5 show that the detection of S1-S6 in FAM, VIC and CY5 channels is positive, and that the detection sensitivity of the kit for detecting rhizoctonia solani fusion groups AG-2-1, AG-1-IB and AG-4HGII reaches 1.0 x 102copies/μL。
Example 7 verification
The application of the triple fluorescent quantitative PCR detection kit for the rhizoctonia solani fusion groups AG-2-1, AG-1-IB and AG-4HGII is verified. Taking the detection kit 3 prepared in the example 4 as an example, the use verification is carried out, and the specific steps are as follows:
1. the experimental method comprises the following steps:
the vegetable root pathogens Rhizoctonia solani (Rhizoctonia solani), 3 kinds of Fusarium oxysporum (Fusarium oxysporum), Fusarium equiseti (Fusarium equiseti) and Fusarium solani (Fusarium solani), Colletotrichum gloeosporioides (Colletotrichum gloeosporioides), Alternaria brassicae (Alternaria brassica), Pythium aphanidermatum (Pythium aphanidermatum), Phytophthora infestans (Phytophthora infestans), Erwinia australis (Erwinia), Flavobacterium paragallinarum campestris var campestris (Xanthomonas campestris. pv. camptoseisis (Pam.) Dosson were isolated and cultured by conventional plant tissue isolation methods, respectively. Obtaining each pathogenic bacteria purified strain;
the dominant fusion group (Anastomosis group) causing rhizoctonia solani disease of cruciferous vegetables comprises AG-2-1, AG-1-IB and AG-4 HGII. The method comprises the steps of taking a main fusion group standard strain capable of causing the rhizoctonia solani disease of a Chinese cabbage plant tissue as a positive material, taking the Chinese cabbage plant tissue as a negative material, taking other soil-borne pathogenic bacteria as identification materials, and respectively extracting genome DNA of each tissue by adopting a conventional molecular biology technology.
The primers and probes specific to Rhizoctonia solani are designed according to the transcription spacer region (ITS) and translation elongation factor (TEF-1 alpha, 1-alpha) or ribosome Large Subunit (LSU) of the fungal pathogen of Chinese cabbage.
The sample is identified as 1 part of a sample of Rhizoctonia solani fusion groups AG-2-1, AG-1-IB and AG-4HGII and 1 part of a sample of healthy Chinese cabbage tissue by other standard methods (such as fungus culture and separation), and the samples are sequentially numbered as samples 1-4.
(1) Extraction of DNA of a detection sample:
weighing 0.1-0.2 g of the fungal pathogenic tissue and healthy cabbage tissue of the cabbage, respectively, grinding the fungal pathogenic tissue and healthy cabbage tissue into powder by liquid nitrogen, extracting DNA of each detection sample by a kit method (purchased from Tiangen Biochemical technology Co., Ltd., product number: DP305-03), and storing at 4 ℃ for later use.
(2) Preparation of reagents:
6 test kits were assembled as in example 4, each containing 19. mu.L of a triple fluorescent quantitative PCR assay mixture, 1. mu.L of a negative control, and a blank control (DEPC-H)2O) 1. mu.L and a positive control S31. mu.L.
(3) Sample adding:
taking 19 μ L of the triple fluorescence quantitative PCR detection mixed solution, placing in 5 PCR tubes, respectively, and then placing DNA template, negative control, and blank control (DEPC-H) of samples 1-52O) and a positive control (S3 in example 3) were added to each PCR tube in an amount of 1. mu.L each, and the PCR amplification reaction was immediately carried out with the tube lid closed. The reaction system was 20. mu.L each.
(4) And (3) PCR amplification:
the reaction tube is arranged on a fluorescent quantitative PCR instrument, and the recommended cycle parameter setting is as follows:
1min at 98 ℃; cycling was performed 40 times at 98 ℃ for 5sec and 62 ℃ for 32 sec.
(5) Setting a threshold value:
the threshold setting principle is that the threshold line just exceeds DEPC-H2The highest point of O.
(6) And (3) quality control:
the positive control (S3 in example 3) must meet the requirements of table 6, otherwise the experiment is deemed invalid.
TABLE 6 quality standards of kits
In the above result judgment, judgment criteria of the sample DNA detection result are shown in table 7:
TABLE 7 judgment standards for test results
2. And (3) test results: see Table 8 for details, and the amplification curves are shown in FIGS. 7-10.
TABLE 8 test results
As can be seen from the data in Table 8, the detection result of sample 1 is positive for the fusion group AG-2-1 of Rhizoctonia solani; the detection result of the sample 2 is positive to rhizoctonia solani fusion group AG-1-IB; the detection result of the sample 3 is positive of a rhizoctonia solani fusion group AG-4 HGII; the detection result of the sample 4 is negative; the positive control 3 fusion populations were all positive and the negative control three fusion populations were negative. Therefore, the detection result of the kit is consistent with the detection result of the field sample, and the kit has better specificity.
Although the present invention has been described with reference to the above embodiments, it should be understood that the present invention is not limited thereto, and various changes and modifications may be made by those skilled in the art without departing from the spirit and scope of the present invention.
Sequence listing
<110> vegetable and flower institute of Chinese academy of agricultural sciences
<120> triple fluorescence quantitative PCR detection method and kit for cruciferous vegetable rhizoctonia solani
<130> PN20190101F
<160> 12
<170> SIPOSequenceListing 1.0
<210> 1
<211> 18
<212> DNA
<213> Artificial sequence ()
<400> 1
<210> 2
<211> 21
<212> DNA
<213> Artificial sequence ()
<400> 2
gtaaaagcgt aaacctgggt g 21
<210> 3
<211> 24
<212> DNA
<213> Artificial sequence ()
<400> 3
cctatctctg gatggcacgg tgac 24
<210> 4
<211> 22
<212> DNA
<213> Artificial sequence ()
<400> 4
aacaagatgg acactaccaa gg 22
<210> 5
<211> 21
<212> DNA
<213> Artificial sequence ()
<400> 5
ggtcctcgct ccactataaa g 21
<210> 6
<211> 27
<212> DNA
<213> Artificial sequence ()
<400> 6
agtacaaact ccactcgggt aacgaca 27
<210> 7
<211> 20
<212> DNA
<213> Artificial sequence ()
<400> 7
<210> 8
<211> 25
<212> DNA
<213> Artificial sequence ()
<400> 8
gacaataaat ttcgctacct taggc 25
<210> 9
<211> 28
<212> DNA
<213> Artificial sequence ()
<400> 9
aaggagccct gcgggttata aatatgtg 28
<210> 10
<211> 113
<212> DNA
<213> Artificial sequence ()
<400> 10
gctacaaccc caagtcggtc gctttcgtcc ctatttctgg atggcacggt gacaacatgt 60
tggaggagtc cgtcaagtac gtcatactgt cgcacccagg tttacgcttt tac 113
<210> 11
<211> 85
<212> DNA
<213> Artificial sequence ()
<400> 11
ggtcctcgct ccactataaa ggttgtcagt acaaactcca ctcgggtaac gacattatat 60
gtaccttggt agtgtccatc ttgtt 85
<210> 12
<211> 130
<212> DNA
<213> Artificial sequence ()
<400> 12
gcgcggtaaa ggaattttgc ttttgatgat atagtccaca tatttataac ccgcagggct 60
ccttcggagt ccggagggac ccctcagggt aatataaata ttaaagccta aggtagcgaa 120
atttattgtc 130
Claims (9)
1. A triple fluorescence quantitative PCR detection kit for detecting rhizoctonia solani of cruciferous vegetables is characterized in that the detection kit comprises 3 pairs of primers and respective corresponding probes for amplifying and detecting fusion groups AG-2-1, AG-1-IB and AG-4HGII of the rhizoctonia solani, and the 3 pairs of primers and the respective corresponding probe sequences are respectively as follows:
the upstream primer AG-2-1-F: GCTACAACCCCAAGTCGG, respectively;
downstream primer AG-2-1-R: GTAAAAGCGTAAACCTGGGTG, respectively;
fluorescent probe AG-2-1-P: 5 '-FAM-CCTATCTCTGGATGGCACGGTGAC-TAMRA-3';
the upstream primer AG-1-IB-F: AACAAGATGGACACTACCAAGG, respectively;
downstream primer AG-1-IB-R: GGTCCTCGCTCCACTATAAAG, respectively;
fluorescent probe AG-1-IB-P: 5 '-VIC-AGTACAAACTCCACTCGGGTAACGACA-TAMRA-3';
the upstream primer AG-4 HGII-F: GCGCGGTAAAGGAATTTTGC, respectively;
downstream primer AG-4 HGII-R: GACAATAAATTTCGCTACCTTAGGC;
fluorescent probe AG-4 HGII-P: 5 '-CY 5-AAGGAGCCCTGCGGGTTATAAATATGTG-BHQ 2-3'.
2. The triple fluorescent quantitative PCR detection method of Rhizoctonia solani of cruciferous vegetables according to claim 1A test kit, characterized in that the test kit comprises: detecting the premix solution, a blank reference substance, a negative reference substance and a positive reference substance by triple fluorescence quantitative PCR; the triple fluorescent quantitative PCR detection premix solution comprises the 3 pairs of primers and probes, qPCR MIX and double distilled water; the positive control substance is a plasmid mixture of AG-2-1, AG-1-IB and AG-4 HGII; the negative reference substance is a soil-borne pathogen; the blank reference substance is DEPC-H2O。
3. The triple fluorescence quantitative PCR detection kit for rhizoctonia solani of brassicaceae vegetables according to claim 2, wherein the positive control comprises:
a rhizoctonia solani fusion group AG-2-1 plasmid with a sequence shown as SEQ ID NO. 10;
a rhizoctonia solani fusion group AG-1-IB plasmid with a sequence shown as SEQ ID NO. 11;
a rhizoctonia solani fusion group AG-4HGII plasmid with a sequence shown as SEQ ID NO. 12;
wherein the content of the first and second substances,
the SEQ ID NO. 10 sequence is:
5’-GCTACAACCCCAAGTCGGTCGCTTTCGTCCCTATTTCTGGATGGCACGGTGACAACATGTTGGAGGAGTCCGTCAAGTACGTCATACTGTCGCACCCAGGTTTACGCTTTTAC-3’；
the SEQ ID NO. 11 sequence is:
5’-GGTCCTCGCTCCACTATAAAGGTTGTCAGTACAAACTCCACTCGGGTAACGACATTATATGTACCTTGGTAGTGTCCATCTTGTT-3’；
the SEQ ID NO. 12 sequence is:
5’-GCGCGGTAAAGGAATTTTGCTTTTGATGATATAGTCCACATATTTATAACCCGCAGGGCTCCTTCGGAGTCCGGAGGGACCCCTCAGGGTAATATAAATATTAAAGCCTAAGGTAGCGAAATTTATTGTC-3’。
4. the triple fluorescence quantitative PCR detection kit for rhizoctonia solani of brassicaceae vegetables according to claim 3, wherein the concentration of AG-2-1 plasmid is 1.0 x 109copies/. mu.L; the concentration of the AG-1-IB plasmid is 1.0X 109copies/. mu.L; concentration of the AG-4HGII plasmidDegree of 1.0X 109copies/μL。
5. The triple fluorescence quantitative PCR detection kit for rhizoctonia solani of cruciferous vegetables according to claim 2, wherein the soil-borne pathogens are Fusarium oxysporum, Fusarium solani, colletotrichum gloeosporioides, Alternaria brassicae and Pythium aphanidermatum.
6. The detection method of the triple fluorescence quantitative PCR detection kit for the rhizoctonia solani of brassicaceae vegetables based on any one of claims 1-5, characterized in that primers and probes are used for carrying out PCR amplification on template DNA, and the rhizoctonia solani of brassicaceae is analyzed and detected according to the intensity of fluorescence signals after PCR amplification.
7. The detection method of the triple fluorescent quantitative PCR detection kit based on rhizoctonia solani of brassicaceae vegetables according to claim 6, wherein the detection method comprises the following steps:
(1) preparing a PCR reaction system: taking 1 mu L of each of the positive control, the negative control and the blank control, and respectively adding 19 mu L of triple fluorescent quantitative PCR detection premixed solution to obtain PCR reaction systems of the positive control, the negative control and the blank control;
(2) PCR amplification reaction: the reaction condition is 98 ℃ for 1 min; alternately cycling 40 times at 98 ℃ for 5sec and 62 ℃ for 32 sec;
(3) fluorescence detection: after the PCR reaction is finished, detecting a fluorescence signal value of a PCR reaction system;
(4) and analyzing and judging the result.
8. The detection method of the triple fluorescence quantitative PCR detection kit based on the rhizoctonia solani of cruciferous vegetables according to claim 7, wherein in a 20 μ L PCR reaction system, each substance comprises:
the upstream primer AG-2-1-F: 0.2. mu.L, downstream primer AG-2-1-R: 0.2. mu.L, fluorescent probe AG-2-1-P: 1 mu L of the solution;
the upstream primer AG-1-IB-F: 0.3. mu.L, downstream primer AG-1-IB-R: 0.3. mu.L, fluorescent probe AG-1-IB-P: 1 mu L of the solution;
upstream primer AG-4 HGII-F: 0.2. mu.L, downstream primer AG-4 HGII-R: 0.2. mu.L, fluorescent probe AG-4 HGII-P: 1 mu L of the solution;
qPCR MIX: 10.4 mu L; double water distillation: 4.2. mu.L.
9. The detection method of the triple fluorescence quantitative PCR detection kit based on Rhizoctonia solani of cruciferous vegetables according to claim 7, wherein in the fluorescence detection in the step (3), FAM, VIC and CY5 channels are selected as fluorescence channels.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910717500.XA CN110669858B (en) | 2019-08-05 | 2019-08-05 | Triple fluorescence quantitative PCR detection method and kit for cruciferous vegetable rhizoctonia solani |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910717500.XA CN110669858B (en) | 2019-08-05 | 2019-08-05 | Triple fluorescence quantitative PCR detection method and kit for cruciferous vegetable rhizoctonia solani |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110669858A CN110669858A (en) | 2020-01-10 |
| CN110669858B true CN110669858B (en) | 2022-06-24 |
Family
ID=69068672
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910717500.XA Active CN110669858B (en) | 2019-08-05 | 2019-08-05 | Triple fluorescence quantitative PCR detection method and kit for cruciferous vegetable rhizoctonia solani |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110669858B (en) |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101792795A (en) * | 2009-12-29 | 2010-08-04 | 中国水稻研究所 | Identification method for determining anastomosis groups of rhizoctonia solani |
| CN101899506A (en) * | 2010-05-18 | 2010-12-01 | 华南农业大学 | Detection primer for No.1 and No.4 physiological strains of fusarium oxysporum f. sp cubense and rapid detection method |
| CN103966307A (en) * | 2013-02-05 | 2014-08-06 | 中国农业科学院蔬菜花卉研究所 | Fluorescent quantitative PCR detection technology of brassicaceous vegetable plasmodiophoromycetes, and its application |
| WO2016040595A1 (en) * | 2014-09-11 | 2016-03-17 | Agrofresh Inc. | Methods for pathogen detection and disease management on meats, plants, or plant parts |
| CN107557445A (en) * | 2017-10-31 | 2018-01-09 | 青岛农业大学 | Detection causes the nucleic acid, kit and method of begonia damping-off, spot disease and powdery mildew pathogen simultaneously |
-
2019
- 2019-08-05 CN CN201910717500.XA patent/CN110669858B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101792795A (en) * | 2009-12-29 | 2010-08-04 | 中国水稻研究所 | Identification method for determining anastomosis groups of rhizoctonia solani |
| CN101899506A (en) * | 2010-05-18 | 2010-12-01 | 华南农业大学 | Detection primer for No.1 and No.4 physiological strains of fusarium oxysporum f. sp cubense and rapid detection method |
| CN103966307A (en) * | 2013-02-05 | 2014-08-06 | 中国农业科学院蔬菜花卉研究所 | Fluorescent quantitative PCR detection technology of brassicaceous vegetable plasmodiophoromycetes, and its application |
| WO2016040595A1 (en) * | 2014-09-11 | 2016-03-17 | Agrofresh Inc. | Methods for pathogen detection and disease management on meats, plants, or plant parts |
| CN107557445A (en) * | 2017-10-31 | 2018-01-09 | 青岛农业大学 | Detection causes the nucleic acid, kit and method of begonia damping-off, spot disease and powdery mildew pathogen simultaneously |
Non-Patent Citations (3)
| Title |
|---|
| Anastomosis group and subgroup identification of Rhizoctonia solani strains deposited in NARO Genebank, Japan;Tomoo Misawa等;《Journal of General Plant Pathology》;20190308;第85卷(第4期);第282-294页 * |
| 华北地区十字花科芸薹属蔬菜上立枯丝核菌的病原生物学研究;王朵等;《植物病理学报》;20181211;第49卷(第5期);第590-601页 * |
| 马铃薯黑痣病菌系统发育分析及融合群快速鉴定;张春艳;《万方学位论文数据库》;20150415;第1-47页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110669858A (en) | 2020-01-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108060263B (en) | Primer probe combination and fluorescent quantitative PCR kit for simultaneously detecting three cryptococci | |
| Dhib et al. | Evaluation of Chitine synthase (CHS1) polymerase chain reaction assay in diagnosis of dermatophyte onychomycosis | |
| CN107083446B (en) | Diarrhea pathogenic bacteria multiple gene detection system and kit and application thereof | |
| CN116064906A (en) | Primer group for synchronously detecting multiple soybean quarantine pathogens and detection method thereof | |
| CN109266764B (en) | Kit for detecting abundance of common probiotics | |
| CN110904253A (en) | Encephalitis meningitis nucleic acid typing detection kit and detection method | |
| CN104946760B (en) | A kind of method and dedicated kit for detecting Pythium inflatum | |
| CN108676851B (en) | Loop-mediated isothermal amplification primer composition for detecting phytophthora infestans and application thereof | |
| CN110157837B (en) | Primer and method for detecting peste des petits ruminants virus and bluetongue virus | |
| CN113897422A (en) | Multiplex PCR primer probe set and kit for detecting pathogenic mucor | |
| CN109811073B (en) | Primer for rapidly detecting streptococcus agalactiae and streptococcus iniae at early stage by double PCR (polymerase chain reaction) and application of primer | |
| CN110669858B (en) | Triple fluorescence quantitative PCR detection method and kit for cruciferous vegetable rhizoctonia solani | |
| CN112280876A (en) | Primer, probe, kit and application for recombinase-mediated isothermal amplification detection | |
| CN109735645B (en) | Real-time fluorescent PCR (polymerase chain reaction) primer, probe and kit for detecting Sporothrix globosum | |
| CN108950043B (en) | Drowning-related plankton composite amplification detection system and kit | |
| CN110735003A (en) | Universal primer, kit and detection method for detecting fungal contamination in cell product | |
| CN114574609B (en) | Kit and method for detecting mucormycosis pathogens | |
| CN110106242B (en) | Detection primer and detection method for chemical type of pathogenic toxin of fusarium graminearum root rot | |
| CN115418394A (en) | Composition, kit and method for detecting CHO cell genome DNA | |
| CN110724757B (en) | Primer for mulberry fruit fat large sclerotinia sclerotiorum detection and application thereof | |
| Zou et al. | Rapid detection of strawberry mottle virus using reverse transcription recombinase polymerase amplification with lateral flow strip | |
| CN114350846B (en) | Primer group and kit for combined detection of multiple pulmonary infection fungi | |
| CN109207623B (en) | Fluorescent PCR (polymerase chain reaction) primer, probe and detection kit for identifying three sporothrix bacteria | |
| Wu et al. | Early and simultaneous detection of Nosema bombycis (Microsporidia: Nosematidae), nucleopolyhedrovirus (Baculoviridae), and densovirus (Parvoviridae) by multiplex real-time polymerase chain reaction in Bombyx mori (Lepidoptera: Bombycidae) | |
| CN106676163B (en) | Primer and method for detecting pichia pastoris cell DNA |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |