CN107557445A - Detection causes the nucleic acid, kit and method of begonia damping-off, spot disease and powdery mildew pathogen simultaneously - Google Patents

Abstract

The present invention relates to one group of nucleic acid, kit and detection method for being used to detect three kinds of pathogen for causing begonia damping-off, spot disease and powdery mildew simultaneously, wherein, the upstream and downstream primer that the nucleic acid of three kinds of pathogen includes causing three kinds of pathogen of begonia damping-off, spot disease and powdery mildew is detected simultaneously for multiplex PCR；The nucleic acid for detecting three kinds of pathogen simultaneously for quantitative fluorescent PCR also includes probe corresponding to each pathogen.The present invention also set up it is a kind of than more efficient, it is sensitive, the detection method for causing these three cause of diseases of the pathogen of begonia damping-off, spot disease and powdery mildew can be detected simultaneously.This method can effectively improve the sensitivity of detection, avoid the generation of false negative result, and damping-off, spot disease and powdery mildew, which can occur, effectively to prevent begonia provides a kind of technological means.

Description

Simultaneously detection cause begonia damping-off, spot disease and powdery mildew pathogen nucleic acid, Kit and method

Technical field

The invention belongs to Measurement for Biotechnique, and in particular to one kind, which is used to detect simultaneously, causes begonia damping-off, spot Nucleic acid, kit and the method for the pathogen of disease and powdery mildew.

Background technology

Begonia is one of traditional famous flower of China, and the bright-coloured beauty of such group of plant flowers, figure is colourful, and the florescence is longer, It is easy to cultivate, makees gardening and the ornamental plant to beautify the yard for a long time.A few species can hyoscine, begonia is in China gardens Played an important role in greening, the incidence of disease of Malus spectabilis damping-off, spot disease and powdery mildew constantly rises in recent years, and three is compound Situation about infecting is more and more, and the peasant household to the plantation of China begonia brings about great losses every year.Still lack begonia at present to stand The efficient germicide and disease-resistant variety of rot, spot disease and powdery mildew, these three diseases are infected, it is necessary to clear in time once finding to have Except disease is set, prevent disease from spreading in addition, also to strengthen the management of Pest- or disease-free area, the intrusion of these three diseases is prevented, therefore, for the autumn Malus spectabilis damping-off, spot disease and powdery mildew are established early stage quick determination method and are just particularly important.

The symptom of begonia damping-off is that the basal part of stem in just nearly native face is caught an illness raw dark spots, is changed into sepia corruption after extension Rotten shape；Blade is caught an illness the water stain shape circle scab of raw dirty-green, and existing brown is rotted when infecting petiole；The morning visible scab of high humidity Director has white to light brown mattress filiform；The diseased plant lodging or death of rotting of morbidity weight；Its pathogen is Rhizoctonia solani Kuhn.

The symptom of begonia spot disease is that fleck is eliminated in nascent water logging on leaf, gradually expands, turns into large-scale irregular type Brown scab.Leaf spot lesion is in black water soaking mode along vein extension, and then is developed to stem.Stem's scab is longitudinally elongated dry rot Shape, scab made more than aggrieved place to wither, later aggrieved portion dries up, contracting of hanging around stem one week.Its disease-producing pathogens is that sarson is yellow single Born of the same parents bacterium begonia pathological form bacterium.

The symptom of begonia powdery mildew is that leaf two is looked unfamiliar leukasmus piece, and edge is amorphous, later mutually healing without obvious disease Spot, leaf is cried extremely when serious, and plant early ageing, bulb diminishes, and influences next year production；Its main pathogens is begonia powdery mildew.Its Mycelium is looked unfamiliar in leaf two, flower and petiole life, is survived the winter with mycelium and ascocarp on invalid body, next year air-flow is propagated, mitogenetic After spore or ascospore are sprouted, germ tube directly invades, and repeatedly infects again.

For the detection method for three kinds of pathogen for causing begonia damping-off, spot disease and powdery mildew, energy is there is no at present Method that is enough quick while detecting these three pathogen.

The content of the invention

(1) technical problems to be solved

In order to solve the above-mentioned technical problem, the present invention provides a kind of multiplex PCR that is used for and detects that to cause begonia to stand withered simultaneously The nucleic acid of the pathogen of disease, spot disease and powdery mildew, additionally provide causes begonia using multiple real time fluorescence quantifying PCR detection Nucleic acid, kit and its detection method of the pathogen of damping-off, spot disease and powdery mildew.

(2) technical scheme

In order to achieve the above object, the main technical schemes that the present invention uses include：

One group is used for the nucleic acid that multiplex PCR detects three kinds of pathogen simultaneously, and it includes being used to detect causing begonia respectively The upstream and downstream primer of three kinds of pathogen of damping-off, spot disease and powdery mildew, wherein, the upstream of the damping-off pathogen is drawn Thing sequence is as shown in SEQ ID No.1, and downstream primer sequence is as shown in SEQ ID No.2；

The upstream primer sequence of the spot encephalapthy agent is as shown in SEQ ID No.4, downstream primer sequence such as SEQ ID Shown in No.5；

The upstream primer sequence of the powdery mildew pathogen is as shown in SEQ ID No.7, downstream primer sequence such as SEQ ID Shown in No.8.

One group is used for the nucleic acid that quantitative fluorescent PCR detects three kinds of pathogen simultaneously, and it includes respectively causing as described above Probe corresponding to the upstream and downstream primer of three kinds of pathogen of begonia damping-off, spot disease and powdery mildew and each pathogen, its In,

The probe sequence of the damping-off pathogen is as shown in SEQ ID No.3；

The probe sequence of the spot encephalapthy agent is as shown in SEQ ID No.6；

The probe sequence of the powdery mildew pathogen is as shown in SEQ ID No.9.

Nucleic acid as described above, it is preferable that this group of nucleic acid also include comprising detection cause begonia damping-off, spot disease and The positive amplification Product Sequence of three kinds of pathogen of powdery mildew, wherein,

The positive amplification Product Sequence of the detection damping-off pathogen, includes 28- in such as SEQ ID No.10 Sequence shown between 155bp；

The positive amplification Product Sequence of the detection spot encephalapthy agent, includes 14- in such as SEQ ID No.11 Sequence shown between 121bp；

The positive amplification Product Sequence of the detection powdery mildew pathogen, includes 3-82bp in such as SEQ ID No.12 Between shown in sequence.

A kind of kit for detecting three kinds of pathogen simultaneously for quantitative fluorescent PCR, the kit include：Such as claim The upstream and downstream primer and corresponding probe of three kinds of pathogen for causing begonia damping-off, spot disease and powdery mildew described in 2, The 5' ends of each bar probe and 3' ends difference correspondence markings TEXRED-BHQ1, FAM-TAMRA and CY5-BHQ3.

Kit as described above, it is preferable that also including detection causes the three of begonia damping-off, spot disease and powdery mildew The positive amplification product of kind pathogen, wherein,

The positive amplification product of the detection damping-off pathogen, containing between 28-155bp in such as SEQ ID No.10 Shown sequence；

The positive amplification product of the detection spot encephalapthy agent, containing between 14-121bp in such as SEQ ID No.11 Shown sequence；

The positive amplification product of the detection powdery mildew pathogen, containing institute between 3-82bp in such as SEQ ID No.12 The sequence shown.

Kit as described above, it is preferable that also including Premix EX TaqTM × 2.

A kind of detection method for detecting three kinds of pathogen simultaneously for quantitative fluorescent PCR, this method, which is used for detection, causes the autumn Three kinds of pathogen of Malus spectabilis damping-off, spot disease and powdery mildew, specifically include following steps：

(1) DNA is extracted from sample；

(2) fluorescent quantitative PCR is carried out to the DNA of extraction；Wherein, during fluorescent quantitative PCR, in reactant In system, using nucleotide sequence such as SEQ ID No.1, the SEQ ID of the upstream and downstream primer and probe of the damping-off pathogen Shown in No.2 and SEQ ID No.3, its probe 5' ends and 3' ends difference correspondence markings TEXRED and BHQ1；The spot disease cause of disease The nucleotide sequence of the upstream and downstream primer and probe of body as shown in SEQ ID No.4, SEQ ID No.5 and SEQ ID No.6, Its probe 5' ends and 3' ends difference correspondence markings FAM and TAMRA；The upstream and downstream primer and probe of the powdery mildew pathogen As shown in SEQ ID No.7, SEQ ID No.8 and SEQ ID No.9, its probe 5' ends and 3' ends correspond to nucleotide sequence respectively Mark CY5 and BHQ3；

(3) fluorescence signal is collected, selects the fluoroscopic examination pattern of the fluorophor in step (2), baseline adjustment takes 3~15 The fluorescence signal of individual circulation, the peak given threshold line of normal negative control is just above with threshold line；

(4) result judgement：Testing sample fluorescence growth curve exceedes threshold line, and good logarithm is presented and increases, then sentences Break as the positive, such as without typical amplification curve, be judged as feminine gender.

Detection method as described above, it is preferable that the reaction system of fluorescent quantitative PCR is specific in the step (2) It is as follows：

1 × Premix EX TaqTM,

Final concentration of 0.24 μm of ol/L of the damping-off pathogen sense primer, anti-sense primer, probe it is final concentration of 0.4μmol/L；Final concentration of 0.24 μm of ol/L of the spot encephalapthy agent sense primer, anti-sense primer, the final concentration of probe For 0.4 μm of ol/L；The final concentration of 0.4 μm of ol/L of the powdery mildew pathogen sense primer, anti-sense primer, probe it is final concentration of 0.64μmol/L；

The DNA of the sample is 1 μ L；

It is negative control to set nuclease-free water simultaneously；

Set respectively comprising the sequence as shown in SEQ ID No.10, the sequence shown in SEQ ID No.11, SEQ simultaneously The gene of sequence shown in ID No.12 is as positive control.

Detection method as described above, it is preferable that the response procedures of fluorescent quantitative PCR are in the step (2)：In advance 95 DEG C of denaturation stage, 5min；95 DEG C of amplification stage, 15sec；60 DEG C, 40sec；72 DEG C, 40sec, 45 circulations；72 DEG C, 7min；4 DEG C of insulations.

Detection method as described above, it is preferable that in step (4) result judgement, the threshold value be 35, when Ct values≤ When 35, it is positive findings to have obvious amplification curve；It is negative findings without obvious amplification curve during Ct value ＞ 40.

(3) beneficial effect

The beneficial effects of the invention are as follows：

The invention provides a kind of three kinds for being used for regular-PCR detection and causing begonia damping-off, spot disease and powdery mildew The nucleic acid group of pathogen, this group of nucleic acid can be used for the detection of single pathogen, it can also be used to what these three pathogen synchronously detected Multiplex amplification uses.During for synchronously detecting these three pathogen, by checking, cross reaction does not occur between each other, it is examined Survey high sensitivity, high specificity.

It is used to quantitative fluorescent PCR present invention also offers one kind and detects simultaneously cause begonia damping-off, spot disease and white The nucleic acid and kit of three kinds of pathogen of powder disease, while one kind is established than more efficient, sensitive, high specificity, and can be same When detect the detection methods of these three cause of diseases.This method can effectively improve the sensitivity of detection, avoid the generation of false negative result, Damping-off, spot disease and powdery mildew can occur effectively to prevent begonia a kind of technological means is provided.The detection reagent of offer Box is easy to use, easy to operate, and automaticity is high, effectively substitutes traditional pathogen and is separately cultured to obtain testing result, and Reagent used in kit is few, and cost is low, enormously simplify operating process, reduces the process repeated, also just reduces In the pollution of operating process, avoid repeating and consume excessive labour, save the time, effectively save cost, realize Rapid screening, the Detection results of used kit are good, high specificity, high sensitivity.Nucleic acid provided by the invention, kit and its Detection method, to solve prior art without the pathogen for causing begonia damping-off, spot disease and powdery mildew can be detected simultaneously Technical problem.

The detection method of offer is operated using complete stopped pipe, it is simple, convenient it is quick, pass through direct detection PCR processes Middle fluorescence signal changes to obtain quantitative result it is not necessary to which regular-PCR post processing or electrophoresis detection, overcome Standard PCR The easy pollution of technology, there is false positive, can effectively avoid non-specific amplification problem, and be adapted to the examination inspection of high-volume sample Survey.

Brief description of the drawings

Fig. 1 is the PCR electrophoresis results for detecting three kinds of pathogen simultaneously.

Fig. 2 is that quantitative fluorescent PCR of the present invention is used to detect three kinds of pathogen simultaneously when, the sensitive of damping-off pathogen is detected Spend test result figure；

Fig. 3 is that quantitative fluorescent PCR of the present invention is used to detect three kinds of pathogen simultaneously when, the sensitive of spot encephalapthy agent is detected Spend test result figure；

Fig. 4 is that quantitative fluorescent PCR of the present invention is used to detect three kinds of pathogen simultaneously when, the sensitive of powdery mildew pathogen is detected Spend test result figure.

Embodiment

In order to preferably explain the present invention, in order to understand, below in conjunction with the accompanying drawings, by embodiment, to this hair It is bright to be described in detail.Embodiments of the present invention are not limited to this, and the complementary series of nucleotide sequence provided by the invention also may be used The present invention is realized, unless otherwise specified, agents useful for same is conventional reagent, therefore all according to present disclosure, made ability The equivalent substitution in domain, belongs to protection scope of the present invention.

The design of embodiment 1 primer, probe

Fluorescence quantitative PCR detection is on the basis of regular-PCR detection, further by specific fluorescence probe, is somebody's turn to do Probe is an oligonucleotides, both ends one reporter fluorescence group of mark and a quenching fluorescence group respectively.When probe is complete, report The fluorescence signal for accusing group transmitting is quenched group absorptions；When PCR is expanded, the 5'-3' 5 prime excision enzyme activities of Taq enzyme are by probe enzyme Degraded is cut, separates reporter fluorescence group and quenching fluorescence group, it is so as to which fluorescence monitoring system can receive fluorescence signal, i.e., every A DNA is expanded, just has a fluorescence molecule to be formed, the accumulation and PCR primer for realizing fluorescence signal form Complete Synchronization. So the premise of fluorescence quantitative PCR detection is performing PCR amplified reaction to be entered, the primer and product between amplified reaction need to try one's best Cross reaction is avoided, further ensures that specific probe and each amplified production, primer should not have cross reaction.And due to The present invention is multiple fluorescence quantitative, so the selection of probe mark is also more crucial, the probe that not only come out to Software for Design To pass through screening, the probe signals of three genes can't interfere.

Screening causes the specific target gene of the pathogen of begonia damping-off, spot disease and powdery mildew, root respectively first According to testing goal, a plurality of pathogen gene sequence is downloaded from GenBank to every kind of pathogen, is compared, is chosen conservative Area, then amplimer and the hybridization probe of suitable quantitative fluorescent PCR reaction system are designed in conserved region.

Because the present invention is multiple fluorescence quantitative, the selection of probe mark first is more crucial, and secondly Software for Design comes out Probe to pass through screening, the probe signals of three genes can not interfere, and this just needs three pairs of the consideration when design probe It can not all be interfered between primer and three probes.

Separately design out a plurality of primer sequence for causing three kinds of pathogen of begonia damping-off, spot disease and powdery mildew special Row and hybridization probe sequence, and sequence homology and suitability analysis and evaluation are carried out to the probe to intending selecting and primer combination, And verified by largely detecting experiment, finally these three selected pathogen are special, and are adapted to multiple fluorescence quantitative reaction The primer and probe combinations of system.

It should be noted that during design, the design principle of common PCR primers does not simultaneously apply to setting for fluorescence quantification PCR primer Meter, the design of fluorescence quantification PCR primer is harsher than the design requirement of common PCR primers, but fluorescence quantification PCR primer is affirmative Available for regular-PCR amplified reaction.

First have to carry out the augmentation detection of single pathogen for the amplimer of every kind of pathogen design, confirm single disease After substance augmentation detection does not have non-specific amplification, then the amplification of multiple pathogen is carried out, design primer just needs to avoid as far as possible Generation cross reaction, it is also contemplated that amplification condition is as far as possible consistent, cross reaction is excluded eventually through hybridization reaction；According to above-mentioned Experience Design and many experiments detection the experiment sieving result of design, bioinformatic analysis and inventor determine following sequence：

Damping-off pathogen special amplimer pair and probe：Spy as shown in SEQ ID No.1, SEQ ID No.2 Different amplimer pair, and the hybridization probe sequence as shown in SEQ ID No.3, it is specific as follows：

SEQ IDNo.1：5′-TCGGTCTCTTGCTTTGGTATTGG-3′

SEQ IDNo.2：5′-CGGTGTCCTCAGCGATAGATAAC-3′

SEQ IDNo.3：5′-ACGCCGAGTGGAACCAAGCATAACA-3′

Spot encephalapthy agent special amplimer pair and probe：Spy as shown in SEQ ID No.4, SEQ ID No.5 Different amplimer pair, and the specific probe sequence as shown in SEQ ID No.6, it is specific as follows：

SEQ IDNo.4：5′-GTCGTAACAAGGTCTCCGTAGG-3′

SEQ IDNo.5：5′-ACAAGGGTGAATAATTCAGCAAGG-3′

SEQ IDNo.6：5′-CCCGAGAGGTTCCAGCCCGCC-3′；

Powdery mildew pathogen special amplimer pair and hybridization probe：As shown in SEQ ID No.7, SEQ ID No.8 Specific amplified upstream and downstream primer, and the hybridization probe sequence as shown in SEQ ID No.9 is specific as follows：

SEQ IDNo.7：5′-ATCGAGTCTTTGAACGCATCTTG-3′

SEQ IDNo.8：5′-GGATGTGGGTTGTTGTTGATACTG-3′

SEQ IDNo.9：5′-TGGTATTCCATTGAGCACGCCTGTT-3′.

In the present invention, the design of probe is particularly critical, and probe can be selected between the fragment that primer expands, first First, probe itself can not form primer dimer, otherwise can cause false negative testing result, secondly, enter for multiple pathogen Row detection when, carry out Multiple detection fragment and primer between can not have cross reaction, otherwise can cause false positive or false negative As a result.The fluorescent emission maximum wavelength of the reporter group of every kind of pathogen probe is set to be in different spectrum models when designing probe Enclose, to ensure that the sense channel of quantitative real time PCR Instrument can distinguish the probe of every kind of pathogen.So design in, except with Primer select softwares are assessed, it is ensured that and it is theoretic to meet as far as possible beyond multiple reaction, should also be according to the expansion of reaction Increase curve and carry out the appropriate adjustment of primer and probe concentration, until amplifying optimal amplification curve.

Tri- kinds of fluorescent dyes of TEXRED, FAM, CY5 that the present invention selects, its wavelength are in different spectral regions, each other It can not disturb, there is obvious differentiation effect and signal intensity.

Through lot of experiment validation, during using above-mentioned primer, probe, can be individually used for detecting it is each corresponding to pathogen inspection Survey, mark TEXRED-BHQ1, FAM-TAMRA and CY5-BHQ3 can be selected in the 5 ' ends and 3 ' ends of its probe respectively.But carry out same When detecting three kinds of pathogen, each probe mark then answers these three syntagmatics of correspondence markings, that is to say, that using TEXRED- BHQ1, FAM-TAMRA and CY5-BHQ3 mark the probe of damping-off pathogen, the probe of spot encephalapthy agent, powdery mildew respectively The fluorophor of the probe of pathogen, each end of probe 5 ' and 3 ' end marks is misaligned, but can be arbitrarily combined, and is detected As a result it is unaffected, when certain independent pathogen is detected, probe also can be selected other fluorophors such as VIC, NED and Texred etc. is used as luminophore, and fluorescent quenching group is used as using such as BHQ, MGB and BHQ2 etc..

The regular-PCR of embodiment 2 detects three kinds of pathogen for causing begonia damping-off, spot disease and powdery mildew

Conservative sequence of the damping-off pathogen screened according to embodiment 1 in GenBank in Serial No. GU270601 Row, its nucleotide sequence design primer and probe as shown in SEQ ID No.10 in this conserved sequence.Designed by final determination Damping-off pathogen primer amplified fragments size be 128bp, extension increasing sequence is the 28-155bp as shown in SEQ ID No.10 Between sequence.

SEQ ID No.10：TTCAAAGCAAACCTTTTGTTAATTCAATCGGTC TCTTGCTTTGGTATTGGAGGTCTTTGCAGCTTCACACCTGCTCCTCTT TGTTTATTAGCTGGATCTCAGTGTTATGCTTGGTTCCACTCGGCGTG ATAAGTTATCTATCGCTGAGGACACCGTAAAAAAGTGGCCAAG。

Spot encephalapthy agent selects Serial No. KF731832 is screened in GenBank conserved sequence its nucleotide sequence such as Shown in SEQ IDNo.11, the primer and probe that is designed in this conserved sequence, its primer amplified fragments size is 108bp, amplification Sequence of the sequence between the 14-121bp as shown in SEQ IDNo.11.

SEQ ID No.11：TGGAAGTAAAAAAGTCGTAACAAGGTCTCCGT AGGTGAACCTGCGGAGGGATCATTACACAAATATGAAGGCGGGCT GGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTT TTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCAC。

Powdery mildew pathogen selects the conserved sequence such as SEQ IDNo.12 that Serial No. JF909350 is screened in GenBank Primer and probe that is shown, being designed in this conserved sequence, primer amplified fragments size primer amplified fragments size are 80bp, core Sequence between nucleotide sequence 3-82bp as shown in SEQ IDNo.12.

SEQ IDNo.12：TCATCGAGTCTTTGAACGCATCTTGCGCTCAATG GTATTCCATTGAGCACGCCTGTTTCAGTATCAACAACAACCCACATC CACAATTTTGCTGTGAATGGAATTGAGAATTTTCGGATTTATTTTTA AGCTGAGTTCTTTAAAAT。

Primer in embodiment 1, probe and above-mentioned amplified fragments are synthesized, primer is obtained and carries just like sequence SEQ ID No.10, SEQ ID No.11, the positive plasmid DNA of sequence shown in SEQ ID No.12.

Using primer and positive plasmid DNA and regular-PCR amplification is carried out, it is public using precious bioengineering (Dalian) Co., Ltd Premix EX TaqTM × 2 of department, 25 μ L reaction systems：Each μ L of upstream and downstream primer (10 μM) 0.5；Premix EX TaqTM ×2 12.5μL；Each μ L of positive plasmid DNA profiling 1, remaining is supplied with nuclease-free water.

Pcr amplification reaction condition is preferably：

Reaction condition：95 DEG C of pre-degeneration stage, 4min；94 DEG C of amplification stage, 25sec；60 DEG C, 40sec；72 DEG C, 45min, 45 circulations；72 DEG C, 7min；4 DEG C of insulations.

Electrophoresis is carried out to amplified production, as shown in figure 1, in figure, B is blank control, 1 is damping-off pathogen, 2 is spot Encephalapthy agent, 3 be powdery mildew pathogen amplification, M is DNA Marker.As a result show, designed primer can be effective Amplify the positive band of the corresponding pathogen for causing begonia damping-off, spot disease and powdery mildew.

3 three kinds of pathogen fluorescent quantificationally PCR detecting kits of embodiment

Cause the quantitative fluorescent PCR detection kit bag of three kinds of pathogen of begonia damping-off, spot disease and powdery mildew Include following component：

Premix EX TaqTM×2；

The upstream primer sequence of damping-off pathogen is as shown in SEQ ID No.1, downstream primer sequence such as SEQ ID Shown in No.2, probe sequence is as shown in SEQ ID No.3, probe SEQ IDNo.3 5 ' mark TEXRED, 3 ' mark BHQ1；

The upstream primer sequence of spot encephalapthy agent is as shown in SEQ ID No.4, downstream primer sequence such as SEQ ID No.5 Shown, as shown in SEQ ID No.6 wherein, probe SEQ IDNo.6 5 ' flag F AM, 3 ' mark TAMRA to probe sequence；

The upstream primer sequence of powdery mildew pathogen is as shown in SEQ ID No.7, downstream primer sequence such as SEQ ID Shown in No.8, probe sequence as shown in SEQ ID No.9, wherein, probe SEQ IDNo.11 5 ' mark CY5,3 ' mark BHQ3。

Further, in order to avoid agents useful for same fails or is contaminated, it is provided with as positive control and negative control examination Agent, negative control use nuclease-free water；

Positive control is using the DNA for carrying amplified production, and the nucleotide sequence of the amplified production is respectively such as SEQ ID No.10, SEQ ID No.11, shown in SEQ ID No.12.

The design of negative control can effectively verify whether agents useful for same is contaminated, and avoid false positive, positive control Design can effectively verify the validity for benefiting from reagent, avoid the generation of false negative.

Wherein, Premix EX TaqTM × 2, nuclease-free water are purchased from precious bioengineering (Dalian) Co., Ltd； Primer, probe, plasmid can entrust Invitrogen (Shanghai) Trading Co., Ltd. to synthesize.

The method that embodiment 4 detects three kinds of pathogen quantitative fluorescent PCRs simultaneously

Cause three kinds of pathogen of begonia damping-off, spot disease and powdery mildew using quantitative fluorescent PCR detection simultaneously Method comprises the following steps：

(1) pathogen DNA is extracted

Reagent used has：Liquid nitrogen, CTAB extraction buffers：2%CTAB (cetyl trimethylammonium bromide), 1% β- Mercaptoethanol 1.4mol/L NaCl, 20mmol/L EDTA, 100mmol/L Tris-HCl pH8.0,3M NaAC, 50mM Tris-HCl pH8.0,20mM EDTA, chloroform：Isoamyl alcohol (24:1), isopropanol, 70% ethanol, TE buffer.

Extraction step DNA method, step are as follows：Vegetable material is cut into 1cm or so fragments, is put into the porcelain mortar of precooling In；Liquid nitrogen quickly cooling is added, is ground into fine powder (more thin better)；Extraction buffer 2.5mL, 60 DEG C of guarantors are added in 5mL centrifuge tubes Temperature 1 hour；15 000rpm, centrifuge 10 minutes；Supernatant is transferred in another new centrifuge tube；Add isometric chloroform：Isoamyl Alcohol (24:1), mix extracting to water emulsion and melt shape；15 000rpm, centrifuge 10 minutes；Supernatant is transferred to another new centrifuge tube In；2/3 times of pre- cold isopropanol of volume is added, -20 DEG C of insulation 40min, DNA is slowly mixed and is folded into cotton-shaped；15 000rpm, from The heart 10 minutes, abandons supernatant；DNA precipitations are washed 2 times with 70% ethanol；Add 400 μ L TE buffer dissolving DNAs.

(2) fluorescent quantitative PCR

The kit prepared using embodiment 3 configures reaction system, using 25 μ L reaction systems：Damping-off pathogen, spot The final concentration of 0.24 μm of ol/L of upstream and downstream primer of point encephalapthy agent, concentration and probe concentration are 0.4 μm of ol/L and powdery mildew pathogen The final concentration of 0.40 μm of ol/L of upstream and downstream primer, probe final concentration of 0.64 μm of ol/L, Premix EX TaqTM × 2 are added 12.5 μ L, the amount of DNA of each sample extraction add 1 μ L.

When setting positive control, the plasmid that the positive amplification sequence containing each pathogen is respectively adopted replaces sample DNA, if When putting negative control, sample DNA is replaced using nuclease-free water.

Amplification condition：It is preferred that following amplification condition：

95 DEG C of pre-degeneration stage, 5min；95 DEG C of amplification stage, 15sec；60 DEG C, 40sec；72 DEG C, 40s, 45 circulations； 72 DEG C, 7min；4 DEG C of insulations.

(3) fluorescence signal is collected, selects TEXRED, FAM, Cy5 fluoroscopic examination pattern respectively, baseline adjustment takes 3~15 The fluorescence signal of individual circulation, the peak given threshold line of normal negative control is just above with threshold line；

(4) result judgement：Testing sample fluorescence growth curve exceedes threshold line, and good logarithm is presented and increases, then sentences Break as the positive, such as without typical amplification curve, be judged as feminine gender, in specific the present embodiment, threshold value 35, when Ct value≤35, have Obvious amplification curve is positive findings；Ct values ＞ 40 is negative findings without obvious amplification curve.

The detection of the kit sensitivity of the present invention of embodiment 5

By the DNA of the pathogen for causing begonia damping-off, spot disease and powdery mildew synthesized in embodiment 2, warp Measure, its concentration is respectively 0.145ng/ μ L, 0.28ng/ μ L, 0.21ng/ μ L, and after being diluted by 10 multiple proportions, that is, what is obtained is vertical Rot pathogen DNA concentration is respectively 1.45 × 10^-2ng/μL、1.45×10^-3ng/μL、1.45×10^-4ng/μL、1.45 ×10^-5ng/μL、 1.45×10^-6ng/μL；Spot encephalapthy agent DNA concentration is respectively 2.8 × 10^-2ng/μL、 2.8× 10^-3ng/μL、2.8×10^-4ng/μL、2.8×10^-5ng/μL、2.8×10^-6Ng/ μ L, powdery mildew pathogen DNA concentration difference For 2.1 × 10^-2ng/μL、2.1×10^-3ng/μL、2.1×10^-4ng/μL、 2.1×10^-5ng/μL、2.1×10^-6ng/μL.Profit The kit prepared with embodiment 3 respectively the DNA profilings of above-mentioned various concentrations cause begonia damping-off, spot disease and The detection of three kinds of pathogen of powdery mildew, wherein,

1)NTC：Nuclease-free water；

Reaction system uses 25 μ L reaction systems, by 12.5 μ L Premix EX TaqTM × 2, damping-off pathogen, spot The upstream and downstream primer (20 μM) of point encephalapthy agent is that the upstream and downstream primer (20 μM) of 0.3 μ L and powdery mildew pathogen is 0.5 μ L；Damping-off pathogen, the probe (20 μM) of spot encephalapthy agent are respectively 0.5 μ L, and the probe (20 μM) of powdery mildew pathogen is 0.8 μ L, the μ L of amount 1 of sample DNA.Sample DNA uses the positive template after above-mentioned dilution to be detected, preferably amplification condition：95 ℃-5min；95 DEG C of -15s, 60 DEG C of -40s；72 DEG C, 40sec, 45 circulations；72 DEG C, 7min；4 DEG C of insulations.Real time fluorescent quantitative PCR detections are carried out on ABI7500PCR instrument.

2) each gradient does three Duplicate Samples.

Result judgement：It is positive findings that, which there is obvious amplification curve Ct value≤35, and Ct values ＞ 40 is the moon without obvious amplification curve Property result.

The fluorescent value figure of testing result, wherein, the sensitivity test result of damping-off pathogen is bent in figure as shown in Fig. 2 Line is respectively 1.45 × 10 by left-to-right shown template concentrations^-2ng/μL、 1.45×10^-3ng/μL、1.45×10^-4ng/μL、 1.45×10^-5ng/μL、1.45×10^-6Ng/ μ L damping-off pathogen DNA, can be seen that from result, the side that the present invention is established Method is 2.3 × 10 to concentration^-6Ng/ μ L damping-off pathogen DNA can be detected.The sensitivity test of spot encephalapthy agent As a result as shown in figure 3, curve by left-to-right shown template concentrations is respectively 2.8 × 10 in figure^-2ng/μL、 2.8×10^-3ng/ μL、2.8×10^-4ng/μL、2.8×10^-5ng/μL、2.8×10^-6Ng/ μ L spot encephalapthy agent DNA, can be seen that from result, The method that the present invention is established is 2.8 × 10 to concentration^-6Ng/ μ L spot encephalapthy agent DNA can be detected.Powdery mildew disease The sensitivity test result of substance is as shown in Figure 4.Curve is respectively 2.1 × 10 by left-to-right shown template concentrations in figure^{- 2}ng/μL、2.1×10^-3 ng/μL、2.1×10^-4ng/μL、2.1×10^-5ng/μL、2.1×10^-6Ng/ μ L powdery mildew cause of disease Body DNA, can be seen that from result, and the method that the present invention is established is 2.1 × 10 to concentration^-6Ng/ μ L powdery mildew pathogen DNA It can detect.It can be seen that the sensitivity point of the inventive method detection damping-off pathogen, spot encephalapthy agent, powdery mildew pathogen Wei 1.45 × 10^-6ng/μL、2.8×10^-6ng/μL、2.1×10^-6ng/μL。

The specificity of 6 kit of the present invention of embodiment

Utilize the kit Rhizoctonia solani (cfcc 7848) of the present invention, aspergillus flavus (cfcc 84919), sharp spore reaping hook Bacterium (cfcc 89008), Alternaria tenuissima (cfcc 84543), Colletotrichum gloeosporiodes (cfcc 82273), Bacillus subtillis (cfcc 14476), aspergillus flavus (CICC 2090), Bacillus cercus (cfcc 2692), green trichoderma (CICC2535), white vacation Silk yeast (cfcc 3529), place powdery mildew (cfcc 83251) are detected.

Above-mentioned strain can take bacterium solution to carry out extraction DNA by commercially available, after above-mentioned strain activation and culture.Will extraction DNA carries out the methods described of embodiment 4 and detected.Testing result shows that Rhizoctonia solani Kuhn, place powdery mildew have expansion in above-mentioned strain Increase curve, other bacterium substances do not have amplification curve, and testing result is feminine gender, i.e., Rhizoctonia solani Kuhn corresponds to damping-off cause of disease Body, place powdery mildew correspond to powdery mildew pathogen, and testing result is the positive, the results showed that primer that the present invention designs, probe tool There is specificity, without non-specific amplification, high specificity.

Embodiment 7：Sample is detected using kit of the present invention

Collection shows as damping-off, spot disease, powdery mildew and healthy begonia leaf sample, with picking up from Qingdao There are 21 samples in area, wherein damping-off symptom, and spot disease symptoms have 15 samples, white powder disease symptoms to have 35 samples.

Extraction DNA is carried out to above-mentioned sample, the method for extracting DNA such as embodiment 4 can be used to carry out, and using the present invention's Kit detects to the DNA of extraction, is detected using fluorescent quantitation method described in embodiment 4, as a result shows, be corresponding with The sample of damping-off, spot disease and powdery mildew, Ct value≤35, have and substantially show amplification curve, be as a result all positive, the healthy autumn The DNA testing results of Malus spectabilis sample do not have amplification curve, and testing result is feminine gender, illustrate the detection method of the present invention to sample Detection has a good applicability, and the detection is in the progress of ABI7500 quantitative fluorescent PCRs instrument, and Detection accuracy is up to 100%.

The above described is only a preferred embodiment of the present invention, being not the limitation that other forms are done to the present invention, appoint What those skilled in the art changed or be modified as possibly also with the technology contents of the disclosure above equivalent variations etc. Imitate embodiment.But it is every without departing from technical solution of the present invention content, the technical spirit according to the present invention is to above example institute Any simple modification, equivalent variations and the remodeling made, still fall within the protection domain of technical solution of the present invention.

Sequence table

<110>Qingdao Agricultural University

<120>Detection causes the nucleic acid, kit and method of begonia damping-off, spot disease and powdery mildew pathogen simultaneously

<160> 12

<170> SIPOSequenceListing 1.0

<210> 1

<211> 23

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 1

tcggtctctt gctttggtat tgg 23

<210> 2

<211> 23

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 2

cggtgtcctc agcgatagat aac 23

<210> 3

<211> 25

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 3

acgccgagtg gaaccaagca taaca 25

<210> 4

<211> 22

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 4

gtcgtaacaa ggtctccgta gg 22

<210> 5

<211> 24

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 5

acaagggtga ataattcagc aagg 24

<210> 6

<211> 21

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 6

cccgagaggt tccagcccgc c 21

<210> 7

<211> 23

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 7

atcgagtctt tgaacgcatc ttg 23

<210> 8

<211> 24

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 8

ggatgtgggt tgttgttgat actg 24

<210> 9

<211> 25

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 9

tggtattcca ttgagcacgc ctgtt 25

<210> 10

<211> 171

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 10

ttcaaagcaa accttttgtt aattcaatcg gtctcttgct ttggtattgg aggtctttgc 60

agcttcacac ctgctcctct ttgtttatta gctggatctc agtgttatgc ttggttccac 120

tcggcgtgat aagttatcta tcgctgagga caccgtaaaa aagtggccaa g 171

<210> 11

<211> 160

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 11

tggaagtaaa aaagtcgtaa caaggtctcc gtaggtgaac ctgcggaggg atcattacac 60

aaatatgaag gcgggctgga acctctcggg gttacagcct tgctgaatta ttcacccttg 120

tcttttgcgt acttcttgtt tccttggtgg gttcgcccac 160

<210> 12

<211> 146

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 12

tcatcgagtc tttgaacgca tcttgcgctc aatggtattc cattgagcac gcctgtttca 60

gtatcaacaa caacccacat ccacaatttt gctgtgaatg gaattgagaa ttttcggatt 120

tatttttaag ctgagttctt taaaat 146

Claims (10)

1. one group is used for the nucleic acid that multiplex PCR detects three kinds of pathogen simultaneously, it is characterised in that including causing respectively for detecting The upstream and downstream primer of three kinds of pathogen of begonia damping-off, spot disease and powdery mildew, wherein, the damping-off pathogen Upstream primer sequence is as shown in SEQ ID No.1, and downstream primer sequence is as shown in SEQ ID No.2；

The upstream primer sequence of the spot encephalapthy agent is as shown in SEQ ID No.4, downstream primer sequence such as SEQ ID No.5 It is shown；

The upstream primer sequence of the powdery mildew pathogen is as shown in SEQ ID No.7, downstream primer sequence such as SEQ ID No.8 It is shown.

2. one group is used for the nucleic acid that quantitative fluorescent PCR detects three kinds of pathogen simultaneously, it is characterised in that including such as claim 1 The upstream and downstream primer of described three kinds of pathogen for causing begonia damping-off, spot disease and powdery mildew respectively and each pathogen Corresponding probe,

The probe sequence of the damping-off pathogen is as shown in SEQ ID No.3；

The probe sequence of the spot encephalapthy agent is as shown in SEQ ID No.6；

The probe sequence of the powdery mildew pathogen is as shown in SEQ ID No.9.

3. nucleic acid as claimed in claim 1 or 2, it is characterised in that this group of nucleic acid also includes causing begonia to stand comprising detection The positive amplification Product Sequence of three kinds of pathogen of rot, spot disease and powdery mildew, wherein,

The positive amplification Product Sequence of the detection damping-off pathogen, comprising between 28-155bp in such as SEQ ID No.10 Shown sequence；

The positive amplification Product Sequence of the detection spot encephalapthy agent, comprising between 14-121bp in such as SEQ ID No.11 Shown sequence；

The positive amplification Product Sequence of the detection powdery mildew pathogen, includes institute between 3-82bp in such as SEQ ID No.12 The sequence shown.

4. a kind of kit for detecting three kinds of pathogen simultaneously for quantitative fluorescent PCR, it is characterised in that the kit includes： Cause the upstream and downstream primer and phase of three kinds of pathogen of begonia damping-off, spot disease and powdery mildew as claimed in claim 2 The probe answered, the 5' ends of each bar probe and 3' ends difference correspondence markings TEXRED-BHQ1, FAM-TAMRA and CY5-BHQ3.

5. kit as claimed in claim 4, it is preferable that also cause begonia damping-off, spot disease and white powder including detection The positive amplification product of three kinds of pathogen of disease, wherein,

The positive amplification product of the detection damping-off pathogen, containing as shown between 28-155bp in SEQ ID No.10 Sequence；

The positive amplification product of the detection spot encephalapthy agent, containing as shown between 14-121bp in SEQ ID No.11 Sequence；

The positive amplification product of the detection powdery mildew pathogen, containing sequence shown between 3-82bp in such as SEQ ID No.12 Row.

6. kit as claimed in claim 4, it is characterised in that also including Premix EX TaqTM × 2.

7. a kind of detection method for detecting three kinds of pathogen simultaneously for quantitative fluorescent PCR, it is characterised in that this method is used to examine Surveying causes three kinds of pathogen of begonia damping-off, spot disease and powdery mildew, specifically includes following steps：

(1) DNA is extracted from sample；

(2) fluorescent quantitative PCR is carried out to the DNA of extraction；Wherein, during fluorescent quantitative PCR, in reaction system In, using nucleotide sequence such as SEQ ID No.1, the SEQ ID of the upstream and downstream primer and probe of the damping-off pathogen Shown in No.2 and SEQ ID No.3, its probe 5' ends and 3' ends difference correspondence markings TEXRED and BHQ1；The spot disease cause of disease The nucleotide sequence of the upstream and downstream primer and probe of body as shown in SEQ ID No.4, SEQ ID No.5 and SEQ ID No.6, Its probe 5' ends and 3' ends difference correspondence markings FAM and TAMRA；The upstream and downstream primer and probe of the powdery mildew pathogen As shown in SEQ ID No.7, SEQ ID No.8 and SEQ ID No.9, its probe 5' ends and 3' ends correspond to nucleotide sequence respectively Mark CY5 and BHQ3；

(3) fluorescence signal is collected, selects the fluoroscopic examination pattern of the fluorophor in step (2), baseline adjustment takes 3~15 to follow The fluorescence signal of ring, the peak given threshold line of normal negative control is just above with threshold line；

(4) result judgement：Testing sample fluorescence growth curve exceedes threshold line, and good logarithm is presented and increases, then is judged as The positive, such as without typical amplification curve, it is judged as feminine gender.

8. detection method as claimed in claim 7, it is characterised in that the reaction of fluorescent quantitative PCR in the step (2) System is specific as follows：

1 × Premix EX TaqTM,

Final concentration of 0.24 μm of ol/L of the damping-off pathogen sense primer, anti-sense primer, final concentration of 0.4 μ of probe mol/L；Final concentration of 0.24 μm of ol/L of the spot encephalapthy agent sense primer, anti-sense primer, final concentration of the 0.4 of probe μmol/L；The powdery mildew pathogen sense primer, anti-sense primer final concentration of 0.4 μm of ol/L, final concentration of 0.64 μ of probe mol/L；

The DNA of the sample is 1 μ L；

It is negative control to set nuclease-free water simultaneously；

Set respectively comprising the sequence as shown in SEQ ID No.10, the sequence shown in SEQ ID No.11, SEQ ID simultaneously Sequence gene shown in No.12 is as positive control.

9. detection method as claimed in claim 7, it is characterised in that the reaction of fluorescent quantitative PCR in the step (2) Program is：95 DEG C of pre-degeneration stage, 5min；95 DEG C of amplification stage, 15sec；60 DEG C, 40sec；72 DEG C, 40sec, 45 circulations； 72 DEG C, 7min；4 DEG C of insulations.

10. detection method as claimed in claim 7, it is characterised in that in step (4) result judgement, the threshold value is 35, when Ct values≤35, it is positive findings to have obvious amplification curve；It is negative findings without obvious amplification curve during Ct value ＞ 40.