CN107541560A - Nucleic acid, kit and method for the Multiple detection of ulcer bacteria, brown patch germ and withes broom phytoplasma - Google Patents

Abstract

It is used for the present invention relates to one group while detects ulcer bacteria, nucleic acid, kit and the detection method of three kinds of pathogens of brown patch germ and withes broom phytoplasma, wherein, detecting the nucleic acid of three kinds of pathogens simultaneously for multiplex PCR includes being respectively used to the upstream and downstream primer for detecting ulcer bacteria, brown patch germ and withes broom phytoplasma；The nucleic acid for detecting three kinds of pathogens simultaneously for quantitative fluorescent PCR also includes probe corresponding to each pathogen.The present invention also set up it is a kind of than more efficient, it is sensitive, ulcer bacteria, the detection method of brown patch germ and withes broom phytoplasma these three cause of diseases can be detected simultaneously.This method can effectively improve the sensitivity of detection, avoid the generation of false negative result.

Description

Nucleic acid for the Multiple detection of ulcer bacteria, brown patch germ and withes broom phytoplasma, Kit and method

Technical field

The invention belongs to Measurement for Biotechnique, and in particular to one kind is used for ulcer bacteria, brown patch germ and withes broom and plants original Nucleic acid, kit and the method for body Multiple detection.

Background technology

China tree (Melia azedarach) is one of important indigenous tree in China, and the tree kind is raw on the fertile soil of moistening It is long rapid, not tight is required to soil, can be grown in acid soil, neutral soil and In Limestone Area, be Plain and low altitude area hills The good reproducting tree species in area, the seeds are also the commerical tree species of good Landscape Trees, in addition and efficient, low toxicity wide One of botanical pesticide is composed, China tree industry is gradually risen in China.In recent years, the canker of China tree, brown spot and withes broom hair Sick rate is gradually increasing, and the situation of three's Combined Infection is more and more, and the user to plantation China tree causes extreme loss.At present The still efficient germicide and disease-resistant variety of the canker of shortage China tree, brown spot and withes broom, infect these three once finding to have Disease is set, it is necessary to remove disease in time, is prevented disease from spreading in addition, also to strengthen the management of Pest- or disease-free area, is prevented these three diseases Intrusion, therefore, for ulcer cause of disease, brown spot and the withes broom of China tree, establishes early stage fast quantitative measurement method for detecting and just seems outstanding To be important.

China tree canker mainly causes harm blade and branch.Blade is caught an illness, and just produces yellow or darker yellow green oil stain in blade back Shape fleck, rear blade face protuberance, in ecru sponge.Afterwale portion is broken to be recessed in cork shape or sick portion, forms fold. Later stage scab is filbert, central canescence, and forms a circle brown enamel light in the strong portion's intersection of disease, and depressed part often rupture is in radiation Shape.Branch is caught an illness, and circular water stain shape dot of coming into being, dirty-green, is expanded taupe afterwards, suberification, is formed big and deep breach, most Several scabs merge to form the big spot of yellowish-brown irregular shape afterwards, and edge is obvious.

China tree brown spot main harm blade, scab first occur at the tip of top vane, are initially light yellow, gradually become For yellowish-brown or dark brown, circular or ellipse, small scab often pool together, and occur several sections even entirely on blade when serious Portion is covered with scab, occurs larger brown spot, the scab performance rupture of morbidity later stage on leaf sheath and vein, and leaf cell tissue is in Downright bad shape, shed brown powder, and vein and vascular bundle remaining are such as thread.

China tree withes broom mainly caused by mycoplasma and fungi, after branch is aggrieved, is pierced because being suppressed terminal bud growth The sprig that sharp lateral bud is sprouted in advance, it is not only slow-growing, and its terminal bud is also suppressed by pathogen soon, and stimulate its side Bud sprouts into sprig again.So it is repeated, makes branch in shape of growing thickly.Leaf on branch is small and with yellow green, internal palisade tissue With the differentiation unobvious of spongy tissue.Sick branch can bloom at the beginning, result, but flowers and fruits are often lopsided.It is then colored and unreal after gradually, finally Do not bloom.The branch Cong Duoneng survival several years, eventually because tired raw new branches and leaves, nutrient consumption are excessive and withered.Due to shoot tissue compared with Normal person is tender, is subject to freeze injury.

At present, the routine inspection method of ulcer bacteria has classical symptom ocular estimate, tissue pathological slice method and pathogenicbacteria separation Culture and Pathogenicity method.Conventional Pathogenicity method can determine the existing state of germ, thus can correctly evaluate The danger of quarantine harmful organisms Spreading and diffusion.But need to verify by being separately cultured of pathogen, Pathogenicity.But Conventional method detection cycle is grown, easily erroneous judgement.It is separately cultured can take the strong intersection of fritter disease for showing disease sample sick group Knit, smashed to pieces in sterile purified water and bacteria suspension is made.If can't see symptom, hybrid blade sample can be taken, with peptone phosphorus Acid buffer immersion vibration enrichment culture 6-8 hours at room temperature, then by bacteria suspension directly or after centrifugal concentrating in PSA or Rule on YSA culture mediums, 28 DEG C of separation choose full edge, the vivid faint yellow circular petite of protuberance after 2-3 days.It is it can be seen that existing The detection method of ulcer bacteria there are the defects of detection time is long.

China tree canker, brown spot, withes broom the provinces such as Guangdong, Hainan, Fujian Jiangxi, Anhui China tree growing area by Occur, the serious woods section incidence of disease often results in China tree mortality, have become some areas development China tree plantation up to more than 50% And the serious obstruction afforested in flakes.For the detection method of ulcer cause of disease, foxiness cause of disease and withes broom phytoplasma, energy is there is no at present Enough quick methods for detecting these three pathogens simultaneously.

The content of the invention

(1) technical problems to be solved

In order to solve the above-mentioned technical problem, the present invention provides a kind of multiplex PCR that is used for and detects ulcer bacteria, brown spot simultaneously Bacterium and the nucleic acid of withes broom phytoplasma, additionally provide using multiple real time fluorescence quantifying PCR detection ulcer bacteria, brown patch germ and Nucleic acid, kit and its detection method of withes broom phytoplasma.

(2) technical scheme

In order to achieve the above object, the main technical schemes that the present invention uses include：

One group is used for the nucleic acid that multiplex PCR detects three kinds of pathogens simultaneously, and it includes being used to detect ulcer bacteria, brown spot Bacterium and the upstream and downstream primer of withes broom phytoplasma, wherein, the upstream primer sequence such as SEQ ID No.1 institutes of the ulcer bacteria Show, downstream primer sequence is as shown in SEQ ID No.2；

The upstream primer sequence of the brown patch germ is as shown in SEQ ID No.5, downstream primer sequence such as SEQ ID No.6 It is shown；

The upstream primer sequence of the withes broom phytoplasma is as shown in SEQ ID No.9, downstream primer sequence such as SEQ ID Shown in No.10.

One group is used for the nucleic acid that quantitative fluorescent PCR detects three kinds of pathogens simultaneously, and it includes ulcer bacteria as described above, brown Probe corresponding to the upstream and downstream primer and each pathogen of pinta bacterium and withes broom phytoplasma, wherein,

The probe sequence of the ulcer bacteria is as shown in SEQ ID No.3；

The probe sequence of the brown patch germ is as shown in SEQ ID No.7；

The probe sequence of the withes broom phytoplasma is as shown in SEQ ID No.11.

Nucleic acid as described above, it is preferable that this group of nucleic acid is also included comprising detection ulcer bacteria, brown patch germ and withes broom The positive amplification product of phytoplasma, wherein,

The positive amplification product of the detection ulcer bacteria, shown between 29-194bp in such as SEQ ID No.4 Sequence；

The positive amplification product of the detection brown patch germ, shown between 20-213bp in such as SEQ ID No.8 Sequence；

The positive amplification product of the detection withes broom phytoplasma, comprising between 2-134bp in such as SEQ ID No.12 Shown sequence.

A kind of kit for detecting three kinds of pathogens simultaneously for quantitative fluorescent PCR, the kit include：Such as claim Upstream and downstream primer and the corresponding probe of ulcer bacteria, brown patch germ and three kinds of pathogens of withes broom phytoplasma described in 2, respectively The 5' ends of bar probe and 3' ends difference correspondence markings FAM-BHQ1, JOE-TAMRA and CY5-BHQ3.

Kit as described above, it is preferable that also include three kinds of detection ulcer bacteria, brown patch germ and withes broom phytoplasma The positive amplification product of pathogen, wherein,

The positive amplification product of the detection ulcer bacteria, containing as shown between 29-194bp in SEQ ID No.4 Sequence；

The positive amplification product of the detection brown patch germ, containing as shown between 20-213bp in SEQ ID No.8 Sequence；

The positive amplification product of the detection withes broom phytoplasma, containing institute between 2-134bp in such as SEQ ID No.12 The sequence shown.

Kit as described above, it is preferable that also including Premix EX TaqTM × 2.

A kind of detection method for detecting three kinds of pathogens simultaneously for quantitative fluorescent PCR, this method are used to detect canker Three kinds of bacterium, brown patch germ and withes broom phytoplasma pathogens, specifically include following steps：

(1) DNA is extracted from sample；

(2) fluorescent quantitative PCR is carried out to the DNA of extraction；Wherein, during fluorescent quantitative PCR, in reactant In system, using nucleotide sequence such as the SEQ ID No.1, SEQ ID No.2 of the upstream and downstream primer and probe of the ulcer bacteria Shown in SEQ ID No.3, its probe 5' ends and 3' ends difference correspondence markings FAM and BHQ1；The upstream and downstream of the brown patch germ The nucleotide sequence of primer and probe as shown in SEQ ID No.5, SEQ ID No.6 and SEQ ID No.7, its probe 5' ends and 3' ends difference correspondence markings JOE and TAMRA；The nucleotide sequence of the upstream and downstream primer and probe of the withes broom phytoplasma is such as Shown in SEQ ID No.9, SEQ ID No.10 and SEQ ID No.11, its probe 5' ends and 3' ends difference correspondence markings CY5 and BHQ3；

(3) fluorescence signal is collected, selects the fluoroscopic examination pattern of the fluorophor in step (2), baseline adjustment takes 3~15 The fluorescence signal of individual circulation, the peak given threshold line of normal negative control is just above with threshold line；

(4) result judgement：Testing sample fluorescence growth curve exceedes threshold line, and good logarithm is presented and increases, then sentences Break as the positive, such as without typical amplification curve, be judged as feminine gender.

Detection method as described above, it is preferable that the reaction system of fluorescent quantitative PCR is specific in the step (2) It is as follows：

1 × Premix EX TaqTM,

Final concentration of 0.45 μm of ol/L of the ulcer bacteria sense primer, anti-sense primer, final concentration of 0.1 μ of probe mol/L；Final concentration of 0.45 μm of ol/L of the brown patch germ sense primer, anti-sense primer, final concentration of 0.1 μ of probe mol/L；The withes broom phytoplasma sense primer, anti-sense primer final concentration of 0.6 μm of ol/L, final concentration of 0.08 μ of probe mol/L；

The DNA of the sample is 1 μ L；

It is negative control to set nuclease-free water simultaneously；

Set respectively comprising the sequence as shown in SEQ ID No.4, the sequence shown in SEQ ID No.8, SEQ ID simultaneously The gene of sequence shown in No.12 is as positive control.

Detection method as described above, it is preferable that the response procedures of fluorescent quantitative PCR are in the step (2)：In advance 95 DEG C of denaturation stage, 5min；95 DEG C of amplification stage, 15sec；58 DEG C, 30sec；72 DEG C, 40sec, 45 circulations；72 DEG C, 7min；4 DEG C of insulations.

Detection method as described above, it is preferable that in step (4) result judgement, the threshold value be 33, when Ct values≤ When 33, it is positive findings to have obvious amplification curve；It is negative findings without obvious amplification curve during Ct value ＞ 40.

(3) beneficial effect

The beneficial effects of the invention are as follows：

The invention provides one kind to be used for three kinds of regular-PCR detection ulcer bacteria, brown patch germ and withes broom phytoplasma diseases The nucleic acid group of opportunistic pathogen, this group of nucleic acid can be used for the detection of single pathogen, it can also be used to which these three pathogens synchronously detect more Re-spread increase uses.During for synchronously detecting these three pathogens, by checking, cross reaction does not occur between each other, it is detected High sensitivity, high specificity.

It is used for quantitative fluorescent PCR present invention also offers one kind and detects ulcer bacteria, brown patch germ and withes broom plant simultaneously The nucleic acid and kit of three kinds of pathogens of substance, while one kind is established than more efficient, sensitive, high specificity, and can be simultaneously Detect the detection method of these three cause of diseases.This method can effectively improve the sensitivity of detection, avoid the generation of false negative result.Carry The detection kit of confession is easy to use, easy to operate, and automaticity is high, effectively substitutes traditional pathogenicbacteria separation culture to obtain Testing result, and the reagent used in kit is few, cost is low, enormously simplify operating process, reduces the process repeated, Also just reduce the pollution in operating process, avoid repeating and consume excessive labour, save the time, it is effectively save into This, realizes rapid screening, the Detection results of used kit are good, high specificity, high sensitivity.Nucleic acid provided by the invention, Kit and its detection method, plant original to solve prior art without ulcer bacteria, brown patch germ and withes broom can be detected simultaneously The technical problem of body, i.e., the detection to three kinds of cause of diseases can be obtained to same sample progress one-time detection.

The detection method of offer is operated using complete stopped pipe, it is simple, convenient it is quick, pass through direct detection PCR processes Middle fluorescence signal changes to obtain quantitative result it is not necessary to which regular-PCR post processing or electrophoresis detection, overcome Standard PCR The easy pollution of technology, there is false positive, can effectively avoid non-specific amplification problem, and be adapted to the examination inspection of high-volume sample Survey.

Brief description of the drawings

Fig. 1 is the PCR electrophoresis results for detecting three kinds of pathogens simultaneously.

Fig. 2 is that quantitative fluorescent PCR of the present invention detects three kinds of pathogens simultaneously when, the sensitivity test knot of ulcer bacteria is detected Fruit is schemed；

Fig. 3 is that quantitative fluorescent PCR of the present invention detects three kinds of pathogens simultaneously when, the sensitivity test knot of brown patch germ is detected Fruit is schemed；

Fig. 4 is that quantitative fluorescent PCR of the present invention detects three kinds of pathogens simultaneously when, the sensitivity of detection withes broom phytoplasma is surveyed Test result figure.

Embodiment

In order to preferably explain the present invention, in order to understand, below in conjunction with the accompanying drawings, by embodiment, to this hair It is bright to be described in detail.Embodiments of the present invention are not limited to this, and the complementary series of nucleotide sequence provided by the invention also may be used The present invention is realized, unless otherwise specified, agents useful for same is conventional reagent, therefore all according to present disclosure, made ability The equivalent substitution in domain, belongs to protection scope of the present invention.

The design of embodiment 1 primer, probe

Fluorescence quantitative PCR detection is on the basis of regular-PCR detection, further by specific fluorescence probe, is somebody's turn to do Probe is an oligonucleotides, both ends one reporter fluorescence group of mark and a quenching fluorescence group respectively.When probe is complete, report The fluorescence signal for accusing group transmitting is quenched group absorptions；When PCR is expanded, the 5'-3' 5 prime excision enzyme activities of Taq enzyme are by probe enzyme Degraded is cut, separates reporter fluorescence group and quenching fluorescence group, it is so as to which fluorescence monitoring system can receive fluorescence signal, i.e., every A DNA is expanded, just has a fluorescence molecule to be formed, the accumulation and PCR primer for realizing fluorescence signal form Complete Synchronization. So the premise of fluorescence quantitative PCR detection is pcr amplification reaction to be carried out, the primer and product between amplified reaction need to be kept away as far as possible Exempt from cross reaction, further ensure that specific probe and each amplified production, primer should not have cross reaction.Again due to this Invention is using multiple fluorescence quantitative, so the selection of probe is also more crucial, the probe that not only come out to Software for Design To pass through screening, the probe signals of three genes can't interfere.

The specific target gene of ulcer bacteria, brown patch germ and withes broom phytoplasma is screened respectively first, according to detection mesh , a plurality of pathogenic bacteria gene sequence is downloaded from GenBank to every kind of pathogen, is compared, chooses corresponding detection strain Conserved sequence, on conserved sequence designed for amplification primer and suitable quantitative fluorescent PCR reaction system hybridization probe.

Because the present invention is multiple fluorescence quantitative, the selection of probe first is more crucial, the spy that secondly Software for Design comes out Pin will pass through screening, and the probe of three genes can not interfere, and this just needs to consider three pairs of primers and three when designing probe It can not all be interfered between bar probe.

Separately design out the special a plurality of primer sequence of ulcer bacteria, brown patch germ and withes broom phytoplasma these three pathogens Row and hybridization probe sequence, and sequence homology and suitability analysis and evaluation are carried out to the probe to intending selecting and primer combination, And verified by largely detecting experiment, finally these three selected pathogens are special, and are adapted to multiple fluorescence quantitative reaction The primer and probe combinations of system.

It should be noted that during design, the design principle of common PCR primers does not simultaneously apply to setting for fluorescence quantification PCR primer Meter, the design of fluorescence quantification PCR primer is harsher than the design requirement of common PCR primers, but fluorescence quantification PCR primer is affirmative Available for regular-PCR amplified reaction.

First have to carry out the augmentation detection of single pathogen for the amplimer of every kind of pathogen design, confirm single disease After opportunistic pathogen augmentation detection does not have non-specific amplification, then the amplification of multiple pathogen is carried out, the primer of design just needs to keep away as far as possible Exempt from that cross reaction occurs, it is also contemplated that the condition of amplification is as far as possible consistent, cross reaction is excluded eventually through hybridization reaction；According to Above-mentioned design, bioinformatic analysis and the Experience Design of inventor and many experiments detection experiment sieving result determine to be used for together When detect ulcer bacteria, the primer and probe of brown patch germ and withes broom phytoplasma this three pathogen, following sequence：

Ulcer bacteria special amplimer pair and probe：Special expansion as shown in SEQ ID No.1, SEQ ID No.2 Increase primer pair, and the hybridization probe sequence as shown in SEQ ID No.3, it is specific as follows：

SEQ IDNo.1：5′-CCACACGAATTGCTTGATTCATTG-3′

SEQ IDNo.2：5′-TGACCAACTTCACCAGGTAACTG-3′

SEQ IDNo.3：5′-CGAACTGCCGACCTCACCCTTATCA-3′

Brown patch germ special amplimer pair and probe：Special expansion as shown in SEQ ID No.5, SEQ ID No.6 Increase primer pair, and the specific probe sequence as shown in SEQ ID No.7, it is specific as follows：

SEQ IDNo.5：5′-TCGCACTCTCTATCAGCAAAGG-3′

SEQ IDNo.6：5′-CGGACTCTAAAAGAGCCAGATTTC-3′

SEQ IDNo.7：5′-TGTTGCCGCTTCACTCGCCGTTACT-3′；

Withes broom phytoplasma special amplimer pair and hybridization probe：As shown in SEQ ID No.9, SEQ ID No.10 Specific amplified upstream and downstream primer, and the hybridization probe sequence as shown in SEQ ID No.11 is specific as follows：

SEQ IDNo.9：5′-TGGTCTAAGTGCAATGCTCAAC-3′

SEQ IDNo.10：5′-CCGCCTTCGCTACTGGTGTTCC-3′

SEQ IDNo.11：5′-TTGCCTCTATCTTACTCTA-3′.

In the present invention, the design of probe is particularly critical, and probe can be selected between the fragment that primer expands, first First, probe itself can not form primer dimer, otherwise can cause false negative testing result, secondly, enter for multiple pathogen Row detection when, carry out Multiple detection fragment and primer between can not have cross reaction, otherwise can cause false positive or false negative As a result.The fluorescent emission maximum wavelength of the reporter group of every kind of pathogen probe is set to be in different spectrum models when designing probe Enclose, to ensure that the sense channel of quantitative real time PCR Instrument can distinguish the probe of every kind of pathogen.So design in, except with Primer select softwares are assessed, it is ensured that and it is theoretic to meet as far as possible beyond multiple reaction, should also be according to the expansion of reaction Increase curve and carry out the appropriate adjustment of primer and probe concentration, until amplifying optimal amplification curve.

Tri- kinds of fluorescent dyes of FAM, JOE, CY5 that the present invention selects, for label probe, its wavelength is in different spectrum models Enclose, can not disturb each other, there is obvious differentiation effect and signal intensity.

Through lot of experiment validation, during using above-mentioned primer, probe, can be individually used for detecting it is each corresponding to pathogen inspection Survey, flag F AM-BHQ1, JOE-TAMRA and CY5-BHQ3 can be selected in the 5 ' ends and 3 ' ends of its probe respectively.But progress is examined simultaneously When surveying three kinds of pathogens, each probe mark then answers these three syntagmatics of correspondence markings, that is to say, that using FAM-BHQ1, JOE- TAMRA and CY5-BHQ3 marks the probe of ulcer bacteria, the probe of brown patch germ, the probe of withes broom phytoplasma, each spy respectively Pin 5 ' is held and the fluorophor of 3 ' end marks is misaligned, but can be arbitrarily combined, and testing result is unaffected, certainly When an independent pathogen is detected, other fluorophors such as VIC, NED and Texred etc. also can be selected as luminous in probe Group, fluorescent quenching group is used as using such as BHQ, MGB and BHQ2 etc..

Three kinds of regular-PCR of embodiment 2 detection ulcer bacteria, brown patch germ and withes broom phytoplasma pathogens

Conserved sequence of the ulcer bacteria screened according to embodiment 1 in GenBank in Serial No. AY342165, it is sieved The nucleotide sequence of the conserved sequence of choosing is as shown in SEQ IDNo.4, the primer and probe that is designed in this conserved sequence.And really Determining ulcer bacteria primer amplified fragments size is

166bp, sequence of the extension increasing sequence between the 29-194bp as shown in SEQ IDNo.4.

SEQ IDNo.4：ATCGACGACTCAGCTGCACCATAAGCACCCACA CGAATTGCTTGATTCATTGAAGAAGACGATGAGAAGCAGCTTTTGCTTTGCACACCCGATTTTGGGTCTGTAGCTCA GTTGGTTAGAGCGCACCCCTGATAAGGGTGAGGTCGGCAGTTCGAATCTGCCCAGACCCACCAGTTACCTGGTGAAG TTGGTCAGAGCGCGT。

Brown patch germ selects Serial No. AY154712, its nucleotide sequence of the conserved sequence of screening such as SEQ in GenBank Shown in IDNo.8, the primer and probe that designs in this sequence, primer amplified fragments size is 194bp, and extension increasing sequence is such as SEQ The sequence between 20-213bp shown in IDNo.8.

SEQ ID No.8：TTTCGGAGCGCAGCACAAGTCGCACTCTCTATC AGCAAAGGTCTAGCATCCATTAAGCCTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA GCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAAT TTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTT GGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCT。

Withes broom phytoplasma selects Serial No. EF990733, the conserved sequence such as SEQ IDNo.12 of screening in GenBank Primer and probe that is shown, designing in this sequence, primer amplified fragments size are 132bp, its nucleotide sequence such as SEQ The fragment of 2-134bp shown in IDNo.12.

SEQ IDNo.12：TATGGTCTAAGTGCAATGCTCAACATTGTGATG CTATAAAAACTGTTTAGCTAGAGTAAGATAGAGGCAAGTGGAATTCCATGTGTAGTGGTAAAATGCGTAAATATATG GAGGAACACCAGTAGCGAAGGCGGCTTGCTGGGTCTTTACTGACGCTGAGGCACGAAA。

Primer in embodiment 1 and above-mentioned amplified fragments are synthesized, primer is obtained and carries just like sequence SEQ ID No.4, SEQ ID No.8, the positive plasmid DNA of sequence shown in SEQ ID No.12.

Using primer and positive plasmid DNA and regular-PCR amplification is carried out, it is public using precious bioengineering (Dalian) Co., Ltd Premix EX TaqTM × 2 of department, 25 μ L reaction systems：Each μ L of upstream and downstream primer (10 μM) 0.5；Premix EX TaqTM× 2 12.5μL；Each μ L of positive plasmid DNA profiling 1, remaining is supplied with nuclease-free water.

Pcr amplification reaction condition is preferably：

Reaction condition：95 DEG C of pre-degeneration stage, 4min；94 DEG C of amplification stage, 25sec；58 DEG C, 30sec；72 DEG C, 45min, 30 circulations；72 DEG C, 7min；4 DEG C of insulations.

Electrophoresis is carried out to amplified production, as shown in figure 1, in figure, B is blank control, 1 is ulcer bacteria, 2 is brown spot Bacterium, 3 be withes broom phytoplasma amplification, M is DNA Marker.As a result show, designed primer can be amplified effectively The positive band of corresponding ulcer bacteria, brown patch germ and withes broom phytoplasma.

3 three kinds of pathogen fluorescent quantificationally PCR detecting kits of embodiment

Ulcer bacteria, the fluorescent quantificationally PCR detecting kit of three kinds of pathogens of brown patch germ and withes broom phytoplasma include Following component：

Premix EX TaqTM×2；

The upstream primer sequence of ulcer bacteria is as shown in SEQ ID No.1, downstream primer sequence such as SEQ ID No.2 institutes Show, probe sequence is as shown in SEQ ID No.3, probe SEQ IDNo.3 5 ' flag F AM, 3 ' mark BHQ1；

The upstream primer sequence of brown patch germ is as shown in SEQ ID No.5, downstream primer sequence such as SEQ ID No.6 institutes Show, as shown in SEQ ID No.7 wherein, probe SEQ IDNo.7 5 ' mark JOE, 3 ' mark TAMRA to probe sequence；

The upstream primer sequence of withes broom phytoplasma is as shown in SEQ ID No.9, downstream primer sequence such as SEQ ID Shown in No.10, probe sequence as shown in SEQ ID No.11, wherein, probe SEQ IDNo.11 5 ' mark CY5,3 ' mark BHQ3。

Further, in order to avoid agents useful for same fails or is contaminated, it is provided with as positive control and negative control examination Agent, negative control use nuclease-free water；

Positive control is using the DNA for carrying amplified production, and the nucleotide sequence of the amplified production is respectively such as SEQ ID No.4, SEQ ID No.8, shown in SEQ ID No.12.

The design of negative control can effectively verify whether agents useful for same is contaminated, and avoid false positive, positive control Design can effectively verify the validity for benefiting from reagent, avoid the generation of false negative.

Wherein, Premix EX TaqTM × 2, nuclease-free water are purchased from precious bioengineering (Dalian) Co., Ltd； Primer, probe, plasmid can entrust Invitrogen (Shanghai) Trading Co., Ltd. to synthesize.

The method that embodiment 4 detects three kinds of pathogen quantitative fluorescent PCRs simultaneously

Detect ulcer bacteria, the side of three kinds of pathogens of brown patch germ and withes broom phytoplasma simultaneously using quantitative fluorescent PCR Method comprises the following steps：

(1) pathogen DNA is extracted

Reagent used has：Liquid nitrogen, CTAB extraction buffers：2%CTAB (cetyl trimethylammonium bromide), 1% β- Mercaptoethanol 1.4mol/L NaCl, 20mmol/L EDTA, 100mmol/L Tris-HCl pH8.0,3M NaAC, 50mM Tris-HCl pH8.0,20mM EDTA, chloroform：Isoamyl alcohol (24:1), isopropanol, 70% ethanol, TE buffer.

Extraction step DNA method, step are as follows：China tree vegetable material is cut into 1cm or so fragments, the porcelain for being put into precooling is ground In alms bowl；Liquid nitrogen quickly cooling is added, is ground into fine powder (more thin better)；The addition extraction buffer 2.5mL in 5ml centrifuge tubes, 60 DEG C Insulation 1 hour；15 000rpm, centrifuge 10 minutes；Supernatant is transferred in another new centrifuge tube；Add isometric chloroform：Isoamyl Alcohol (24:1), mix extracting to water emulsion and melt shape；15 000rpm, centrifuge 10 minutes；Supernatant is transferred to another new centrifuge tube In；2/3 times of pre- cold isopropanol of volume is added, -20 DEG C of insulation 30min, DNA is slowly mixed and is folded into cotton-shaped；15 000rpm, from The heart 10 minutes, abandons supernatant；DNA precipitations are washed 2 times with 70% ethanol；Add 400 μ l TE buffer dissolving DNAs.

(2) fluorescent quantitative PCR

The kit prepared using embodiment 3 configures reaction system, using 25 μ L reaction systems：Ulcer bacteria, brown spot The final concentration of 0.45 μm of ol/L of upstream and downstream primer of bacterium, concentration and probe concentration is 0.1 μm of ol/L and the upstream and downstream of withes broom phytoplasma is drawn The final concentration of 0.60 μm of ol/L of thing, probe final concentration of 0.08 μm of ol/L, Premix EX TaqTM × 2 add 12.5 μ L, each The amount of DNA of sample extraction adds 1 μ L.

When setting positive control, the plasmid that the positive amplification sequence containing each pathogen is respectively adopted replaces sample DNA, if When putting negative control, sample DNA is replaced using nuclease-free water.

Amplification condition：It is preferred that following amplification condition：

95 DEG C of pre-degeneration stage, 5min；95 DEG C of amplification stage, 15sec；58 DEG C, 30sec；72 DEG C, 40s, 45 circulations； 72 DEG C, 7min；4 DEG C of insulations.

(3) fluorescence signal is collected, selects FAM, JOE, Cy5 fluoroscopic examination pattern respectively, baseline adjustment takes 3~15 to follow The fluorescence signal of ring, the peak given threshold line of normal negative control is just above with threshold line；

(4) result judgement：Testing sample fluorescence growth curve exceedes threshold line, and good logarithm is presented and increases, then sentences Break as the positive, such as without typical amplification curve, be judged as feminine gender, in specific the present embodiment, threshold value 33, when Ct value≤33, have Obvious amplification curve is positive findings；Ct values ＞ 40 is negative findings without obvious amplification curve.

The detection of the kit sensitivity of the present invention of embodiment 5

By the DNA of ulcer bacteria, brown patch germ and withes broom phytoplasma, after measured, its concentration is respectively 0.23ng/ μ L, 0.18ng/ μ L, 0.26ng/ μ L, after being diluted by 10 multiple proportions, that is, the ulcer bacteria DNA obtained concentration is respectively 2.3 ×10^-2ng/μL、2.3×10^-3ng/μL、2.3×10^-4ng/μL、2.3×10^-5ng/μL、2.3×10^-6ng/μL；Brown patch germ DNA concentration is respectively 1.8 × 10^-2ng/μL、1.8×10^-3ng/μL、1.8×10^-4ng/μL、1.8×10^-5ng/μL、1.8× 10^-6Ng/ μ L, withes broom phytoplasma DNA concentration is respectively 2.6 × 10^-2ng/μL、2.6×10^-3ng/μL、2.6×10^-4ng/μ L、2.6×10^-5ng/μL、2.6×10^-6ng/μL.The kit prepared using embodiment 3 is respectively to the DNA of above-mentioned various concentrations Template carries out the detection of ulcer bacteria, brown patch germ and withes broom phytoplasma these three pathogens, wherein,

1)NTC：Nuclease-free water；

Reaction system uses 25 μ L reaction systems, by 12.5 μ L Premix EX TaqTM × 2, ulcer bacteria, brown spot The upstream and downstream primer (20 μM) of bacterium is that the upstream and downstream primer (20 μM) of 0.56 μ L and withes broom phytoplasma is 0.75 μ L；Ulcer Germ, the probe (20 μM) of brown patch germ are respectively 0.125 μ L, and (20 μM) of the probe of withes broom phytoplasma is 0.1 μ L, sample DNA The μ L of amount 1.Sample DNA uses the positive template after above-mentioned dilution to be detected, preferably amplification condition：95℃-5min；95℃- 15s, 58 DEG C of -30s；72 DEG C, 40sec, 45 circulations；72 DEG C, 7min；4 DEG C of insulations.Real-time fluorescence quantitative PCR detection exists Carried out on ABI7500PCR instrument.

2) each gradient does three Duplicate Samples.

Result judgement：It is positive findings that, which there is obvious amplification curve Ct value≤33, and Ct values ＞ 40 is the moon without obvious amplification curve Property result.

The fluorescent value figure of testing result, wherein, the sensitivity test result of ulcer bacteria as shown in Fig. 2 in figure curve by Template concentrations shown in left-to-right are respectively 2.3 × 10^-2ng/μL、2.3×10^-3ng/μL、2.3×10^-4ng/μL、2.3×10^{- 5}ng/μL、2.3×10^-6Ng/ μ L ulcer bacteria DNA, can be seen that from result, and the method that the present invention is established is 2.3 to concentration ×10^-6Ng/ μ L ulcer bacteria DNA can be detected.The sensitivity test result of brown patch germ is as shown in figure 3, curve in figure It is respectively 1.8 × 10 by left-to-right shown template concentrations^-2ng/μL、1.8×10^-3ng/μL、1.8×10^-4ng/μL、1.8× 10^-5ng/μL、1.8×10^-6Ng/ μ L brown patch germ DNA, can be seen that from result, and the method that the present invention is established is to concentration 1.8×10^-6Ng/ μ L brown patch germ DNA can be detected.The sensitivity test result of withes broom phytoplasma is as shown in Figure 4.Figure Middle curve is respectively 2.6 × 10 by left-to-right shown template concentrations^-2ng/μL、2.6×10^-3ng/μL、2.6×10^-4ng/μL、 2.6×10^-5ng/μL、2.6×10^-6Ng/ μ L withes broom phytoplasma DNA, can be seen that from result, the method that the present invention is established It is 2.6 × 10 to concentration^-6Ng/ μ L withes broom phytoplasma DNA can be detected.It can be seen that the inventive method detection ulcer bacteria, The sensitivity of brown patch germ, withes broom phytoplasma is respectively 2.3 × 10^-6ng/μL、1.8×10^-6ng/μL、2.6×10^-6ng/μ L。

The specificity of 6 kit of the present invention of embodiment

Using the kit of the present invention to aspergillus flavus (cfcc 84919), Fusarium oxysporum (cfcc89008), thin pole chain lattice Spore (cfcc 84543), Colletotrichum gloeosporiodes (cfcc 82273), Bacillus subtillis (cfcc 14476), aspergillus flavus (CICC 2090), Bacillus cercus (cfcc2692), green trichoderma (CICC2535), candida albicans (cfcc 3529) are carried out Detection.

Above-mentioned strain can take bacterium solution to carry out extraction DNA by commercially available, after above-mentioned strain activation and culture.Will extraction DNA carries out the methods described of embodiment 4 and detected.Testing result shows that above-mentioned strain does not have amplification curve, and testing result is Feminine gender, that is, show that primer, probe that the present invention designs have specificity, without non-specific amplification, high specificity.

Embodiment 7：Sample is detected using kit of the present invention

Collection shows as canonical bundle branch symptom, canker symptom, foxiness disease symptoms and healthy China tree sample, picks up from Shandong There are 13 samples In The Area of Qingdao, wherein canker symptom, and 9 samples of canker symptom, canonical bundle branch symptom have 15.

Extraction DNA is carried out to above-mentioned sample, the method for extracting DNA such as embodiment 4 can be used to carry out, and using the present invention's Kit detects to the DNA of extraction.Detected, as a result shown, canker with the fluorescent quantitation method described in embodiment 4 The sample of bacterium, brown patch germ and withes broom phytoplasma symptom, which has, substantially shows amplification curve, is as a result all positive, illustrates the detection Detection of the method to sample has good applicability, and the detection is carried out in ABI7500 quantitative real time PCR Instruments, Detection accuracy Up to 100%.

The above described is only a preferred embodiment of the present invention, being not the limitation that other forms are done to the present invention, appoint What those skilled in the art changed or be modified as possibly also with the technology contents of the disclosure above equivalent variations etc. Imitate embodiment.But it is every without departing from technical solution of the present invention content, the technical spirit according to the present invention is to above example institute Any simple modification, equivalent variations and the remodeling made, still fall within the protection domain of technical solution of the present invention.

Sequence table

<110>Qingdao Agricultural University

<120>Nucleic acid, kit and method for the Multiple detection of ulcer bacteria, brown patch germ and withes broom phytoplasma

<130>

<160> 12

<170> SIPOSequenceListing 1.0

<210> 2

<211> 24

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 2

ccacacgaat tgcttgattc attg 24

<210> 3

<211> 23

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 3

tgaccaactt caccaggtaa ctg 23

<210> 3

<211> 25

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 3

cgaactgccg acctcaccct tatca 25

<210> 6

<211> 202

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 6

atcgacgact cagctgcacc ataagcaccc acacgaattg cttgattcat tgaagaagac 60

gatgagaagc agcttttgct ttgcacaccc gattttgggt ctgtagctca gttggttaga 120

gcgcacccct gataagggtg aggtcggcag ttcgaatctg cccagaccca ccagttacct 180

ggtgaagttg gtcagagcgc gt 202

<210> 4

<211> 22

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 4

tcgcactctc tatcagcaaa gg 22

<210> 5

<211> 24

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 5

cggactctaa aagagccaga tttc 24

<210> 7

<211> 25

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 7

tgttgccgct tcactcgccg ttact 25

<210> 8

<211> 312

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 8

tttcggagcg cagcacaagt cgcactctct atcagcaaag gtctagcatc cattaagcct 60

ttttttcaac ttttgacctc ggatcaggta gggatacccg ctgaacttaa gcatatcaat 120

aagcggagga aaagaaacca acagggattg ccctagtaac ggcgagtgaa gcggcaacag 180

ctcaaatttg aaatctggct cttttagagt ccgagttgta atttgcagag ggcgctttgg 240

ctttggcagc ggtccaagtt ccttggaaca ggacgtcaca gagggtgaga atcccgtacg 300

tggtcgctgg ct 312

<210> 9

<211> 22

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 9

tggtctaagt gcaatgctca ac 22

<210> 10

<211> 22

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 10

ccgccttcgc tactggtgtt cc 22

<210> 11

<211> 19

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 11

ttgcctctat cttactcta 19

<210> 12

<211> 168

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 12

tatggtctaa gtgcaatgct caacattgtg atgctataaa aactgtttag ctagagtaag 60

atagaggcaa gtggaattcc atgtgtagtg gtaaaatgcg taaatatatg gaggaacacc 120

agtagcgaag gcggcttgct gggtctttac tgacgctgag gcacgaaa 168

Claims (10)

1. one group is used for the nucleic acid that multiplex PCR detects three kinds of pathogens simultaneously, it is characterised in that including for detecting canker The upstream and downstream primer of bacterium, brown patch germ and withes broom phytoplasma, wherein, the upstream primer sequence such as SEQ of the ulcer bacteria Shown in ID No.1, downstream primer sequence is as shown in SEQ ID No.2；

The upstream primer sequence of the brown patch germ is as shown in SEQ ID No.5, downstream primer sequence such as SEQ ID No.6 institutes Show；

The upstream primer sequence of the withes broom phytoplasma is as shown in SEQ ID No.9, downstream primer sequence such as SEQ ID Shown in No.10.

2. one group is used for the nucleic acid that quantitative fluorescent PCR detects three kinds of pathogens simultaneously, it is characterised in that including such as claim 1 Probe corresponding to the upstream and downstream primer of the ulcer bacteria, brown patch germ and withes broom phytoplasma and each pathogen,

The probe sequence of the ulcer bacteria is as shown in SEQ ID No.3；

The probe sequence of the brown patch germ is as shown in SEQ ID No.7；

The probe sequence of the withes broom phytoplasma is as shown in SEQ ID No.11.

3. nucleic acid as claimed in claim 1 or 2, it is characterised in that this group of nucleic acid is also included comprising detection ulcer bacteria, foxiness Germ and the positive amplification product of withes broom phytoplasma, wherein,

The positive amplification product of the detection ulcer bacteria, includes sequence shown between 29-194bp in such as SEQ ID No.4 Row；

The positive amplification product of the detection brown patch germ, includes sequence shown between 20-213bp in such as SEQ ID No.8 Row；

The positive amplification product of the detection withes broom phytoplasma, shown between 2-134bp in such as SEQ ID No.12 Sequence.

4. a kind of kit for detecting three kinds of pathogens simultaneously for quantitative fluorescent PCR, it is characterised in that the kit includes： The upstream and downstream primer and corresponding probe of ulcer bacteria, brown patch germ and withes broom phytoplasma as claimed in claim 2, respectively The 5' ends of bar probe and 3' ends difference correspondence markings FAM-BHQ1, JOE-TAMRA and CY5-BHQ3.

5. kit as claimed in claim 4, it is preferable that also include detection ulcer bacteria, brown patch germ and withes broom and plant original The positive amplification product of body, wherein,

The positive amplification product of the detection ulcer bacteria, containing sequence shown between 29-194bp in such as SEQ ID No.4；

The positive amplification product of the detection brown patch germ, containing sequence shown between 20-213bp in such as SEQ ID No.8；

The positive amplification product of the detection withes broom phytoplasma, containing as shown between 2-134bp in SEQ ID No.12 Sequence.

6. kit as claimed in claim 4, it is characterised in that also including Premix EX TaqTM × 2.

7. a kind of detection method for detecting three kinds of pathogens simultaneously for quantitative fluorescent PCR, it is characterised in that this method is used to examine Ulcer bacteria, brown patch germ and withes broom phytoplasma these three pathogens are surveyed, specifically include following steps：

(1) DNA is extracted from sample；

(2) fluorescent quantitative PCR is carried out to the DNA of extraction；Wherein, during fluorescent quantitative PCR, in reaction system In, using the upstream and downstream primer and probe of the ulcer bacteria nucleotide sequence such as SEQ ID No.1, SEQ ID No.2 and Shown in SEQ ID No.3, its probe 5' ends and 3' ends difference correspondence markings FAM and BHQ1；Draw the upstream and downstream of the brown patch germ The nucleotide sequence of thing and probe is as shown in SEQ ID No.5, SEQ ID No.6 and SEQ ID No.7, its probe 5' ends and 3' End difference correspondence markings JOE and TAMRA；The nucleotide sequence such as SEQ of the upstream and downstream primer and probe of the withes broom phytoplasma Shown in ID No.9, SEQ ID No.10 and SEQ ID No.11, its probe 5' ends and 3' ends difference correspondence markings CY5 and BHQ3；

(3) fluorescence signal is collected, selects the fluoroscopic examination pattern of the fluorophor in step (2), baseline adjustment takes 3~15 to follow The fluorescence signal of ring, the peak given threshold line of normal negative control is just above with threshold line；

(4) result judgement：Testing sample fluorescence growth curve exceedes threshold line, and good logarithm is presented and increases, then is judged as The positive, such as without typical amplification curve, it is judged as feminine gender.

8. detection method as claimed in claim 7, it is characterised in that the reaction of fluorescent quantitative PCR in the step (2) System is specific as follows：

1 × Premix EX TaqTM,

Final concentration of 0.45 μm of ol/L of the ulcer bacteria sense primer, anti-sense primer, final concentration of 0.1 μm of ol/ of probe L；Final concentration of 0.45 μm of ol/L of the brown patch germ sense primer, anti-sense primer, final concentration of 0.1 μm of ol/L of probe； The final concentration of 0.6 μm of ol/L of the withes broom phytoplasma sense primer, anti-sense primer, final concentration of 0.08 μm of ol/L of probe；

The DNA of the sample is 1 μ L；

It is negative control to set nuclease-free water simultaneously；

Set respectively comprising the sequence as shown in SEQ ID No.4, the sequence shown in SEQ ID No.8, SEQ ID simultaneously The gene of sequence shown in No.12 is as positive control.

9. detection method as claimed in claim 7, it is characterised in that the reaction of fluorescent quantitative PCR in the step (2) Program is：95 DEG C of pre-degeneration stage, 5min；95 DEG C of amplification stage, 15sec；58 DEG C, 30sec；72 DEG C, 40sec, 45 circulations； 72 DEG C, 7min；4 DEG C of insulations.

10. detection method as claimed in claim 7, it is characterised in that in step (4) result judgement, the threshold value is 33, when Ct values≤33, it is positive findings to have obvious amplification curve；It is negative findings without obvious amplification curve during Ct value ＞ 40.