CN107541560B - Nucleic acid, kit and method for multiple detection of ulcer germs, brown spot germs and arbuscular disease phytoplasma - Google Patents
Nucleic acid, kit and method for multiple detection of ulcer germs, brown spot germs and arbuscular disease phytoplasma Download PDFInfo
- Publication number
- CN107541560B CN107541560B CN201711046205.3A CN201711046205A CN107541560B CN 107541560 B CN107541560 B CN 107541560B CN 201711046205 A CN201711046205 A CN 201711046205A CN 107541560 B CN107541560 B CN 107541560B
- Authority
- CN
- China
- Prior art keywords
- seq
- probe
- brown spot
- sequence
- detecting
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a group of nucleic acids, a kit and a detection method for simultaneously detecting three pathogenic bacteria, namely, canker pathogen, brown spot pathogen and arbuscular disease phytoplasma, wherein the nucleic acids for simultaneously detecting the three pathogenic bacteria by multiplex PCR comprise upstream and downstream primers for detecting the canker pathogen, the brown spot pathogen and the arbuscular disease phytoplasma respectively; the nucleic acid for simultaneously detecting the three pathogenic bacteria by the fluorescent quantitative PCR also comprises probes corresponding to all the pathogenic bacteria. The invention also establishes a detection method which is relatively efficient and sensitive and can simultaneously detect three pathogens, namely canker pathogen, brown spot pathogen and arbuscular disease phytoplasma. The method can effectively improve the detection sensitivity and avoid the occurrence of false negative results.
Description
Technical Field
The invention belongs to a biological detection technology, and particularly relates to a nucleic acid, a kit and a method for multiple detection of canker pathogen, brown spot pathogen and arbuscular disease phytoplasma.
Background
The Melia azedarach (Melia azedarach) is one of the important local tree species in China, the tree species grows rapidly on moist fertile soil, has low requirements on soil, can grow in acid soil, neutral soil and limestone areas, is a good afforestation tree species in plains and low-altitude hilly areas, is also a good material tree species for landscaping tree species, is also one of high-efficiency and low-toxicity broad-spectrum botanical pesticides, and the Melia azedarach industry gradually rises in China. In recent years, the incidence of the ulcer disease, the brown spot disease and the arbuscular disease of the melia azedarach gradually rises, and the combined infection of the three is more and more, which causes great loss to users who plant the melia azedarach. At present, high-efficiency bactericides and disease-resistant varieties for the ulcer disease, the brown spot disease and the arbuscular disease of the melia azedarach are lacked, once the three diseases of the melia azedarach are found to be infected, the diseased trees need to be cleared in time to prevent the spread of the diseases, in addition, the management of an non-epidemic area needs to be enhanced to prevent the invasion of the three diseases, and therefore, the establishment of an early-stage rapid quantitative detection method for the ulcer pathogen, the brown spot disease and the arbuscular disease of the melia azedarach is very important.
The melia azedarach canker mainly damages leaves and branches. When the leaves are infected with diseases, yellow or dark yellow green oil stain-like small spots are generated on the leaf back at the beginning, and the rear leaf surface is raised to be a beige spongy substance. The rear bulge is broken into a cork shape or the diseased part is sunken to form a fold. The later stage of scab is light brown, the center is grey white, a circle of brown glaze light is formed at the junction of the scab and the healthy part, and the sunken part is broken to be radial. The branch tips are infected with diseases, the branches grow round water stain-shaped small spots and are dark green, then the branches are enlarged to be grey brown, become cork and form large and deep cracks, and finally a plurality of disease spots are fused to form large yellow brown irregular spots with obvious edges.
The Melia azedarach brown spot mainly damages leaves, disease spots firstly occur at the tips of the top leaves, are light yellow at first and gradually turn to yellow brown or dark brown, are round or oval, small disease spots are often gathered together, a plurality of sections of disease spots or even all the disease spots are distributed on the leaves in serious cases, larger brown spots appear on leaf sheaths and veins, the disease spots are cracked in the later period of disease occurrence, leaf cell tissues are necrotic, brown powder is scattered, and the veins and vascular bundles remain as filaments.
The melia azedarach arbuscular disease is mainly caused by mycoplasma-like organisms and fungi, after branches are damaged, the growth of terminal buds is inhibited to stimulate twigs which lateral buds germinate in advance, the growth is slow, the terminal buds are also inhibited by pathogens in the near future, and the lateral buds are stimulated to germinate into twigs. Repeating the steps to make the branches in a cluster shape. Leaves on branches are small and yellow green, and the differentiation between internal grid tissues and sponge tissues is not obvious. Diseased branches can bloom and bear fruits at the beginning, but flowers and fruits are often deformed. It is not practical to flower after the later stage, and finally it does not flower. The branches and the clumps can survive for a plurality of years, and the branches and the clumps are withered because new branches and leaves are accumulated and the nutrient is excessively consumed. The branches are tender and vulnerable to freezing damage because the tissues of the branches are normal.
At present, the conventional detection methods of the ulcer germs comprise a typical symptom visual inspection method, a histopathological section method, pathogen isolation culture and pathogenicity determination method. Conventional pathogenicity assays can determine the survival status of pathogens and thus can correctly assess the risk of spreading of a pesticidally-detectable pest. However, it is necessary to verify the pathogenicity by isolated culture of pathogenic bacteria and measurement of pathogenicity. However, the conventional method has a long detection period and is easy to misjudge. For the sample with symptom, a small piece of diseased tissue at the junction of diseased health can be taken and smashed in sterilized distilled water to prepare bacterial suspension. If no symptom can be seen, a mixed leaf sample can be taken, soaked in peptone phosphate buffer solution, oscillated and enriched and cultured for 6-8 hours at room temperature, then the bacterial suspension is directly or centrifugally concentrated and streaked on PSA or YSA culture medium, and after separation for 2-3 days at 28 ℃, light yellow round microcolonies with bright whole edges and bulges are selected. Therefore, the defects of long detection time and the like exist in the existing detection method for the ulcer germs.
The ulcer, brown spot and cluster of chinaberry diseases occur in chinaberry growing areas in Guangdong, Hainan, Fujian Jiangxi, Anhui province and other provinces, the incidence of serious forest segment is over 50 percent, and massive death of chinaberry is often caused, which becomes a serious obstacle to development of chinaberry growing and sheet afforestation in partial areas. The method for detecting the ulcer pathogen, the brown spot pathogen and the arbuscular disease phytoplasma has no method for quickly and simultaneously detecting the three pathogens at present.
Disclosure of Invention
Technical problem to be solved
In order to solve the technical problems, the invention provides a nucleic acid for simultaneously detecting the ulcerative bacteria, the brown spot bacteria and the arbuscular disease phytoplasma by multiplex PCR, and also provides a nucleic acid, a kit and a detection method for detecting the ulcerative bacteria, the brown spot bacteria and the arbuscular disease phytoplasma by adopting multiplex real-time fluorescent quantitative PCR.
(II) technical scheme
In order to achieve the purpose, the invention adopts the main technical scheme that:
a group of nucleic acids for simultaneously detecting three pathogenic bacteria by multiplex PCR comprises an upstream primer and a downstream primer for detecting canker pathogen, brown spot pathogen and arbuscular disease phytoplasma, wherein the upstream primer sequence of the canker pathogen is shown as SEQ ID No.1, and the downstream primer sequence is shown as SEQ ID No. 2;
the upstream primer sequence of the brown spot germ is shown as SEQ ID No.5, and the downstream primer sequence is shown as SEQ ID No. 6;
the upstream primer sequence of the arbuscular disease phytoplasma is shown as SEQ ID No.9, and the downstream primer sequence is shown as SEQ ID No. 10.
A group of nucleic acids for simultaneously detecting three pathogenic bacteria by fluorescent quantitative PCR comprises the upstream and downstream primers of the canker pathogen, the brown spot pathogen and the arbuscular disease phytoplasma and probes corresponding to the pathogenic bacteria, wherein,
the probe sequence of the ulcer germs is shown as SEQ ID No. 3;
the probe sequence of the brown spot germ is shown in SEQ ID No. 7;
the probe sequence of the arbuscular pathogen is shown as SEQ ID No. 11.
The nucleic acid as described above, preferably the set of nucleic acids further comprises positive amplification products comprising detection of ulcerative colitis, brown spot colitis and arbuscular mycosis pathogens, wherein,
the positive amplification product for detecting the ulcer germs has a sequence shown between 29 bp and 194bp in SEQ ID No. 4;
the positive amplification product for detecting the brown spot germ has a sequence shown between 20 bp and 213bp in SEQ ID No. 8;
the positive amplification product for detecting the arbuscular disease phytoplasma has a sequence shown as the 2 nd-134 bp in SEQ ID No. 12.
A kit for simultaneously detecting three pathogenic bacteria by fluorescent quantitative PCR, which comprises: the upstream and downstream primers and corresponding probes for three pathogenic bacteria, i.e., ulcerative bacteria, brown spot bacteria and arbuscular disease phytopathogens, according to claim 2, wherein each of the probes has markers FAM-BHQ1, JOE-TAMRA and CY5-BHQ3 at its 5 'end and 3' end, respectively.
The kit as described above, preferably, further comprises a positive amplification product for detecting three pathogenic bacteria of canker pathogen, brown spot pathogen and bush disease phytoplasma, wherein,
the positive amplification product for detecting the ulcer germs has a sequence shown between 29 bp and 194bp in SEQ ID No. 4;
the positive amplification product for detecting the brown spot germ has a sequence shown between 20 bp and 213bp in SEQ ID No. 8;
the positive amplification product for detecting the arbuscular disease phytoplasma has a sequence shown as the 2 nd-134 bp in SEQ ID No. 12.
The kit as described above, preferably, further comprises Premix EX TaqTM x 2.
A detection method for simultaneously detecting three pathogenic bacteria by fluorescent quantitative PCR is used for detecting three pathogenic bacteria, namely canker pathogen, brown spot pathogen and arbuscular disease phytoplasma, and specifically comprises the following steps:
(1) extracting DNA from the sample;
(2) performing fluorescent quantitative PCR amplification on the extracted DNA; wherein, during fluorescent quantitative PCR amplification, in a reaction system, the nucleotide sequences of the upstream primer and the downstream primer of the ulcerative bacteria and the probe are shown as SEQ ID No.1, SEQ ID No.2 and SEQ ID No.3, and the 5 'end and the 3' end of the probe are respectively and correspondingly marked with FAM and BHQ 1; the nucleotide sequences of the upstream primer and the downstream primer of the brown spot pathogen and the probe are shown as SEQ ID No.5, SEQ ID No.6 and SEQ ID No.7, and the 5 'end and the 3' end of the probe are respectively and correspondingly marked with JOE and TAMRA; the nucleotide sequences of the upstream primer, the downstream primer and the probe of the arbuscular disease phytoplasma are shown as SEQ ID No.9, SEQ ID No.10 and SEQ ID No.11, and the 5 'end and the 3' end of the probe are respectively and correspondingly marked with CY5 and BHQ 3;
(3) collecting fluorescence signals, selecting a fluorescence detection mode of the fluorescent group in the step (2), adjusting a base line, taking 3-15 circulating fluorescence signals, and setting a threshold line by the highest point of the threshold line just exceeding the normal negative control;
(4) and (4) judging a result: and if the fluorescence increase curve of the sample to be detected exceeds a threshold value line and shows good logarithmic increase, judging the sample to be detected to be positive, and if no typical amplification curve exists, judging the sample to be detected to be negative.
In the detection method, preferably, the reaction system for the fluorescent quantitative PCR amplification in step (2) is specifically as follows:
1×Premix EX TaqTM，
the final concentration of the ulcer germ upstream primer and downstream primer is 0.45 mu mol/L, and the final concentration of the probe is 0.1 mu mol/L; the final concentration of the forward primer and the downstream primer of the brown spot pathogen is 0.45 mu mol/L, and the final concentration of the probe is 0.1 mu mol/L; the final concentration of the upstream primer and the downstream primer of the arbuscular disease phytoplasma is 0.6 mu mol/L, and the final concentration of the probe is 0.08 mu mol/L;
the DNA of the sample is 1 mu L;
meanwhile, setting water without nuclease as a negative control;
meanwhile, genes comprising a sequence shown as SEQ ID No.4, a sequence shown as SEQ ID No.8 and a sequence shown as SEQ ID No.12 are respectively set as positive controls.
In the detection method as described above, preferably, the reaction procedure of the fluorescent quantitative PCR amplification in step (2) is: pre-denaturation stage at 95 deg.C for 5 min; amplification stage 95 ℃ for 15 sec; 58 ℃ for 30 sec; 72 ℃, 40sec, 45 cycles; 72 ℃ for 7 min; keeping the temperature at 4 ℃.
In the detection method described above, preferably, in the determination of the result in step (4), the threshold is 33, and when the Ct value is less than or equal to 33, a significant amplification curve is a positive result; when the Ct value is more than 40, no obvious amplification curve is a negative result.
(III) advantageous effects
The invention has the beneficial effects that:
the invention provides a nucleic acid group for detecting three pathogenic bacteria of canker pathogen, brown spot pathogen and arbuscular disease phytoplasma by common PCR (polymerase chain reaction), and the nucleic acid group can be used for detecting single pathogenic bacteria and can also be used for multiplex amplification of synchronous detection of the three pathogenic bacteria. When the kit is used for synchronously detecting the three pathogenic bacteria, cross reaction does not occur among the pathogenic bacteria through verification, and the kit has high detection sensitivity and strong specificity.
The invention also provides a nucleic acid and a kit for simultaneously detecting three pathogens, namely, canker pathogen, brown spot pathogen and arbuscular disease phytoplasma by fluorescent quantitative PCR, and simultaneously establishes a detection method which is relatively efficient, sensitive and strong in specificity and can simultaneously detect the three pathogens. The method can effectively improve the detection sensitivity and avoid the occurrence of false negative results. The provided detection kit is convenient to use, simple and convenient to operate, high in automation degree, capable of effectively replacing traditional pathogen isolation culture to obtain a detection result, few in reagent used by the kit, low in cost, capable of greatly simplifying the operation process, reducing the repeated operation process, reducing pollution in the operation process, avoiding excessive labor force consumption caused by repeated operation, saving time, effectively saving cost, and capable of realizing rapid screening, and the used kit is good in detection effect, strong in specificity and high in sensitivity. The nucleic acid, the kit and the detection method thereof provided by the invention solve the technical problem that the prior art can not simultaneously detect the canker pathogen, the brown spot pathogen and the arbuscular disease phytoplasma, namely, the detection of three pathogens can be obtained by carrying out one-time detection on the same sample.
The detection method provided by the invention adopts the operation of completely closing the tube, is simple, convenient and quick to operate, obtains a quantitative result by directly detecting the change of a fluorescent signal in the PCR process, does not need common PCR post-treatment or electrophoresis detection, overcomes the defects of easy pollution and false positive occurrence of the conventional PCR technology, can effectively avoid the difficulty of nonspecific amplification, and is suitable for screening and detecting large-batch samples.
Drawings
FIG. 1 shows the results of PCR electrophoresis for simultaneous detection of three pathogenic bacteria.
FIG. 2 is a diagram showing the results of sensitivity tests for detecting ulcer pathogens when three pathogens are simultaneously detected by fluorescent quantitative PCR according to the present invention;
FIG. 3 is a graph showing the results of the sensitivity test for detecting Limonitum when three pathogenic bacteria are simultaneously detected by the fluorescent quantitative PCR of the present invention;
FIG. 4 is a graph showing the results of the sensitivity test for detecting the arbuscular disease phytoplasma when three pathogenic bacteria are simultaneously detected by the fluorescent quantitative PCR of the present invention.
Detailed Description
For the purpose of better explaining the present invention and to facilitate understanding, the present invention will be described in detail by way of specific embodiments with reference to the accompanying drawings. The embodiments of the present invention are not limited thereto, and the complementary sequences of the nucleotide sequences provided by the present invention can also implement the present invention, and the reagents used are conventional reagents unless otherwise specified, and therefore all equivalent substitutions in the art made in accordance with the present disclosure are within the scope of the present invention.
Example 1 design of primers and probes
The fluorescent quantitative PCR detection is based on the common PCR detection, and further passes through a specific fluorescent probe which is an oligonucleotide, and two ends of the probe are respectively marked with a reporter fluorescent group and a quenching fluorescent group. When the probe is complete, the fluorescent signal emitted by the reporter group is absorbed by the quenching group; during PCR amplification, the 5 '-3' exonuclease activity of Taq enzyme cuts and degrades the probe, so that the reporter fluorescent group and the quenching fluorescent group are separated, a fluorescence monitoring system can receive a fluorescence signal, namely, one fluorescent molecule is formed when one DNA chain is amplified, and the accumulation of the fluorescence signal and the formation of a PCR product are completely synchronous. Therefore, the precondition of the fluorescent quantitative PCR detection is to perform PCR amplification reactions, cross reactions between primers and products of the amplification reactions need to be avoided as much as possible, and cross reactions between the specific probe and each amplification product and each primer are further ensured. In addition, because the invention adopts multiple fluorescence quantification, the selection of the probe is more critical, and not only the probe designed by software needs to be screened, but also the probe signals of the three genes cannot interfere with each other.
Firstly, screening specific target genes of canker pathogen, brown spot pathogen and arbuscular disease phytoplasma respectively, downloading a plurality of pathogen gene sequences from GenBank for each pathogen according to the detection purpose, carrying out comparison analysis, selecting a conserved sequence corresponding to a detected strain, and designing primers for amplification and a hybridization probe suitable for a fluorescent quantitative PCR reaction system on the conserved sequence.
Because the invention is the multiple fluorescence quantification, firstly the selection of the probe is more critical, secondly the probe designed by the software is screened, the probes of the three genes can not interfere with each other, and therefore, the three pairs of primers and the three probes can not interfere with each other when the probe is designed.
Respectively designing a plurality of primer sequences and hybridization probe sequences specific to three pathogenic bacteria, namely, canker pathogen, brown spot pathogen and arbuscular disease phytoplasma, analyzing and evaluating sequence homology and adaptability of the probes and primer combinations to be selected, verifying through a large number of detection tests, and finally selecting the primers and probe combinations specific to the three pathogenic bacteria and suitable for a multiple fluorescence quantitative reaction system.
It should be noted that, in the design, the design principle of the ordinary PCR primer is not suitable for the design of the fluorescent quantitative PCR primer, and the design requirement of the fluorescent quantitative PCR primer is more strict than that of the ordinary PCR primer, but the fluorescent quantitative PCR primer is certainly applicable to the ordinary PCR amplification reaction.
The amplification primers designed for each pathogen firstly carry out amplification detection of single pathogen, and then carry out amplification of multiple pathogens after confirming that the amplification detection of the single pathogen does not carry out non-specific amplification, the designed primers need to avoid cross reaction as much as possible, the amplification conditions need to be considered as consistent as possible, and finally the cross reaction is eliminated through hybridization reaction; according to the design, bioinformatics analysis, empirical design of the inventor and screening results of a large number of experimental detection tests, primers and probes for simultaneously detecting three pathogenic bacteria, namely canker pathogen, brown spot pathogen and arbuscular pathogen, are determined, and the sequences are as follows:
amplification primer pair and probe specific to ulcerative bacteria: the specific amplification primer pair shown as SEQ ID No.1 and SEQ ID No.2 and the hybridization probe sequence shown as SEQ ID No.3 are as follows:
SEQ IDNo.1：5′-CCACACGAATTGCTTGATTCATTG-3′
SEQ IDNo.2：5′-TGACCAACTTCACCAGGTAACTG-3′
SEQ IDNo.3：5′-CGAACTGCCGACCTCACCCTTATCA-3′
amplification primer pair and probe specific to brown spot pathogen: the specific amplification primer pair shown as SEQ ID No.5 and SEQ ID No.6 and the specific probe sequence shown as SEQ ID No.7 are as follows:
SEQ IDNo.5：5′-TCGCACTCTCTATCAGCAAAGG-3′
SEQ IDNo.6：5′-CGGACTCTAAAAGAGCCAGATTTC-3′
SEQ IDNo.7：5′-TGTTGCCGCTTCACTCGCCGTTACT-3′；
an amplimer pair specific for an arbuscular phytoplasma and a hybridization probe: the specific amplification upstream and downstream primers shown as SEQ ID No.9 and SEQ ID No.10 and the hybridization probe sequence shown as SEQ ID No.11 are as follows:
SEQ IDNo.9：5′-TGGTCTAAGTGCAATGCTCAAC-3′
SEQ IDNo.10：5′-CCGCCTTCGCTACTGGTGTTCC-3′
SEQ IDNo.11：5′-TTGCCTCTATCTTACTCTA-3′。
the design of the probe is particularly critical, the probe can be selected among fragments amplified by the primer, firstly, the probe cannot form primer dimer, otherwise, false negative detection results can be caused, secondly, when the probe is used for detecting multiple pathogenic bacteria, cross reaction cannot be caused between the fragments and the primer for multiple detection, and otherwise, false positive or false negative results can be caused. The probes are designed such that the maximum fluorescence emission wavelength of the reporter group of each pathogen probe is in a different spectral range to ensure that the detection channel of the quantitative fluorescence PCR instrument can distinguish the probes of each pathogen. Therefore, in addition to using primer select software to evaluate, and ensure that the multiplex reaction is theoretically matched as much as possible, the design should be made with appropriate adjustment of primer and probe concentrations according to the amplification curve of the reaction until the optimal amplification curve is amplified.
The invention selects three fluorescent dyes of FAM, JOE and CY5 to label the probe, the wavelength is in different spectrum range, and the dyes can not interfere with each other, and has obvious distinguishing effect and signal intensity.
A large number of experiments prove that when the primers and the probes are adopted, the primers and the probes can be independently used for detecting the corresponding pathogenic bacteria, and the 5 'end and the 3' end of the probes can be respectively selected from the markers FAM-BHQ1, JOE-TAMRA and CY5-BHQ 3. However, when three pathogens are detected simultaneously, the labeling of each probe should be used for labeling the three combination relationships, that is, FAM-BHQ1, JOE-TAMRA and CY5-BHQ3 are used for labeling the probe of canker pathogen, the probe of brown spot pathogen and the probe of arbuscular disease pathogen respectively, the fluorescent groups labeled at the 5 'end and the 3' end of each probe are not overlapped, but can be combined randomly, the detection result is not influenced, and when a single pathogen is detected, the probe can also adopt other fluorescent groups such as VIC, NED, Texred and the like as luminescent groups and adopt BHQ, MGB, BHQ2 and the like as fluorescent quenching groups.
EXAMPLE 2 general PCR detection of three pathogenic bacteria, canker, Brown spot and bush disease Phytoplasma
The sequence number of the canker pathogen screened according to the embodiment 1 in GenBank is AY342165 conserved sequence, the nucleotide sequence of the screened conserved sequence is shown in SEQ ID No.4, and primers and probes are designed in the conserved sequence. And determining that the size of the primer amplification fragment of the ulcerative bacteria is 166bp, and the amplification sequence is a sequence between 29 bp and 194bp shown in SEQ ID No. 4.
SEQ IDNo.4：ATCGACGACTCAGCTGCACCATAAGCACCCACACGAATTGCTTGATTCATTGAAGAAGACGATGAGAAGCAGCTTTTGCTTTGCACACCCGATTTTGGGTCTGTAGCTCAGTTGGTTAGAGCGCACCCCTGATAAGGGTGAGGTCGGCAGTTCGAATCTGCCCAGACCCACCAGTTACCTGGTGAAGTTGGTCAGAGCGCGT。
The sequence number of the brown spot germ is AY154712 in GenBank, the nucleotide sequence of the screened conservative sequence is shown as SEQIDNo.8, the size of the primer amplification fragment is 194bp in the designed primer and probe in the sequence, and the amplification sequence is the sequence between 20 bp and 213bp shown as SEQIDNo.8.
SEQ ID No.8：TTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCCTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCT。
The sequence number of the arbuscular disease phytoplasma is EF990733 in GenBank, the screened conserved sequence is shown as SEQ ID No.12, the size of a primer amplified fragment is 132bp, and the nucleotide sequence of the primer amplified fragment is a fragment of 2-134bp shown as SEQ ID No. 12.
SEQ IDNo.12：TATGGTCTAAGTGCAATGCTCAACATTGTGATGCTATAAAAACTGTTTAGCTAGAGTAAGATAGAGGCAAGTGGAATTCCATGTGTAGTGGTAAAATGCGTAAATATATGGAGGAACACCAGTAGCGAAGGCGGCTTGCTGGGTCTTTACTGACGCTGAGGCACGAAA。
The primers in example 1 and the amplified fragments were synthesized to obtain primers and positive plasmid DNA carrying sequences shown in SEQ ID No.4, SEQ ID No.8, and SEQ ID No. 12.
Using primers and positive plasmid DNA and performing general PCR amplification, a Premix EX TaqTM X2, 25. mu.L reaction system from Boehringer Biotech (Dalian) Ltd: 0.5. mu.L of each upstream and downstream primer (10. mu.M); premix EX TaqTM × 212.5 μ L; each positive plasmid DNA template was 1. mu.L, and the remainder was made up with nuclease-free water.
The PCR amplification reaction conditions are preferably:
reaction conditions are as follows: pre-denaturation stage at 95 deg.C for 4 min; amplification stage 94 ℃, 25 sec; 58 ℃ for 30 sec; at 72 ℃, 45min, and 30 cycles; 72 ℃ for 7 min; keeping the temperature at 4 ℃.
And (3) carrying out electrophoresis on the amplification product, wherein B is blank control, 1 is canker pathogen, 2 is brown spot pathogen and 3 is the amplification result of arbuscular disease phytoplasma, and M is DNA Marker, as shown in figure 1. The result shows that the designed primer can effectively amplify the corresponding positive bands of the canker pathogen, the brown spot pathogen and the arbuscular disease phytoplasma.
Example 3 three pathogenic bacteria fluorescent quantitative PCR detection kit
The fluorescent quantitative PCR detection kit for three pathogenic bacteria of canker pathogen, brown spot pathogen and arbuscular disease phytoplasma comprises the following components:
Premix EX TaqTM×2；
the sequence of an upstream primer of the ulcerative bacteria is shown as SEQ ID No.1, the sequence of a downstream primer is shown as SEQ ID No.2, the sequence of a probe is shown as SEQ ID No.3, the 5 'of the probe SEQ ID No.3 is marked with FAM, and the 3' of the probe SEQ ID No.3 is marked with BHQ 1;
the sequence of an upstream primer of the brown spot pathogen is shown as SEQ ID No.5, the sequence of a downstream primer is shown as SEQ ID No.6, the sequence of a probe is shown as SEQ ID No.7, wherein the 5 'of the probe SEQ ID No.7 is marked with JOE, and the 3' of the probe SEQ ID No.7 is marked with TAMRA;
the upstream primer sequence of the arbuscular disease phytoplasma is shown as SEQ ID No.9, the downstream primer sequence is shown as SEQ ID No.10, and the probe sequence is shown as SEQ ID No.11, wherein the probe SEQ ID No.11 is marked with CY5 at the 5 'position and is marked with BHQ3 at the 3' position.
Furthermore, in order to avoid the failure or pollution of the used reagent, a positive control reagent and a negative control reagent are arranged, and the negative control adopts nuclease-free water;
the positive control adopts plasmid DNA carrying amplification products, and the nucleotide sequences of the amplification products are respectively shown as SEQ ID No.4, SEQ ID No.8 and SEQ ID No. 12.
The design of negative control can effectively verify whether the used reagent is polluted or not, so that false positive is avoided, and the design of positive control can effectively verify the effectiveness of the used reagent, so that false negative is avoided.
Wherein the Premix EX TaqTM x 2, nuclease-free water is available from Takara Bio engineering (Dalian) Ltd; the primers, probes and plasmids can be synthesized by Weijie Jie (Shanghai) trade company Limited.
Example 4 fluorescent quantitative PCR method for simultaneously detecting three pathogenic bacteria
The method for simultaneously detecting three pathogenic bacteria of canker pathogen, brown spot pathogen and arbuscular disease phytoplasma by adopting fluorescent quantitative PCR comprises the following steps:
(1) pathogenic bacteria DNA extraction
The reagents used were liquid nitrogen, CTAB extraction buffer 2% CTAB (cetyltrimethylammonium bromide), 1% β -mercaptoethanol 1.4mol/L NaCl, 20mmol/L EDTA, 100mmol/L Tris-HCl pH8.0, 3M NaAC, 50mM Tris-HCl pH8.0, 20mM EDTA, chloroform isoamyl alcohol (24:1), isopropanol, 70% ethanol, TE buffer.
The method for extracting the DNA comprises the following steps: cutting the chinaberry plant material into pieces of about 1cm, and putting the pieces into a precooled porcelain mortar; adding liquid nitrogen for quick cooling, and grinding into fine powder (the finer the powder is the better); adding 2.5mL of extraction buffer solution into a 5mL centrifuge tube, and keeping the temperature at 60 ℃ for 1 hour; 15000 rpm, centrifuge for 10 minutes; transferring the supernatant into another new centrifugal tube; adding equal volume of chloroform: isoamyl alcohol (24:1), mixing uniformly and extracting to be in a water emulsion molten state; 15000 rpm, centrifuge for 10 minutes; transferring the supernatant into another new centrifugal tube; adding 2/3 times volume of precooled isopropanol, keeping the temperature at-20 ℃ for 30min, and slowly mixing the DNA uniformly to form flocculent DNA; centrifuging at 15000 rpm for 10 min, and discarding the supernatant; washing the DNA precipitate with 70% ethanol for 2 times; DNA was dissolved by adding 400. mu.l of TE buffer.
(2) Fluorescent quantitative PCR amplification
The reaction system was prepared using the kit prepared in example 3, and 25. mu.L of the reaction system: the final concentration of the upstream and downstream primers for ulcerative pathogens, brown spot pathogens was 0.45. mu. mol/L, the probe concentration was 0.1. mu. mol/L and the final concentration of the upstream and downstream primers for arbuscular phytoplasma was 0.60. mu. mol/L, the final concentration of the probe was 0.08. mu. mol/L, 12.5. mu.L of Premix EX TaqTM.2 was added, and 1. mu.L of DNA was added for each sample.
When positive control is set, the sample DNA is replaced by plasmid containing positive amplification sequence of each pathogenic bacterium, and when negative control is set, the sample DNA is replaced by nuclease-free water.
Amplification conditions: the following amplification conditions are preferred:
pre-denaturation stage at 95 deg.C for 5 min; amplification stage 95 ℃ for 15 sec; 58 ℃ for 30 sec; 72 ℃, 40s, 45 cycles; 72 ℃ for 7 min; keeping the temperature at 4 ℃.
(3) Collecting fluorescence signals, respectively selecting fluorescence detection modes of FAM, JOE and Cy5, adjusting a base line, taking 3-15 cycles of fluorescence signals, and setting a threshold line with the highest point of the threshold line just exceeding the normal negative control;
(4) and (4) judging a result: the fluorescence increase curve of the sample to be detected exceeds a threshold value line and shows good logarithmic increase, the sample to be detected is judged to be positive, if no typical amplification curve exists, the sample to be detected is judged to be negative, in the specific embodiment, the threshold value is 33, and when the Ct value is less than or equal to 33, an obvious amplification curve is a positive result; ct value > 40, no obvious amplification curve is negative result.
Example 5 detection of sensitivity of the kit of the invention
The concentration of the plasmid DNA of the ulcerative bacteria, the brown spot bacteria and the arbuscular mycosis phytoplasma is respectively 0.23 ng/mu L, 0.18 ng/mu L and 0.26 ng/mu L after being measured and diluted by 10 times, and the concentration of the obtained ulcerative bacteria DNA is respectively 2.3 multiplied by 10-2ng/μL、2.3×10-3ng/μL、2.3×10-4ng/μL、2.3×10-5ng/μL、2.3×10-6ng/mu L; the concentrations of the DNA of the brown spot germs are respectively 1.8 multiplied by 10-2ng/μL、1.8×10-3ng/μL、1.8×10-4ng/μL、1.8×10-5ng/μL、1.8×10-6ng/. mu.L, the concentration of the DNA of the arbuscular phytoplasma is 2.6X 10-2ng/μL、2.6×10-3ng/μL、2.6×10-4ng/μL、2.6×10-5ng/μL、2.6×10-6ng/. mu.L. The kit prepared in example 3 was used to detect the three pathogens canker pathogen, brown spot pathogen and bush disease phytoplasma respectively for the above DNA templates of different concentrations, wherein,
1) NTC: nuclease-free water;
the reaction system adopts 25 muL reaction system, which consists of 12.5 muL Premix EX TaqTM x 2, 0.56 muL upstream and downstream primers (20 muM) for the ulcerative bacteria and the brown spot bacteria and 0.75 muL upstream and downstream primers (20 muM) for the arbuscular phytoplasma; each of probes for ulcer germs and brown spot germs (20. mu.M) was 0.125. mu.L, each of probes for arbuscular disease phytoplasma (20. mu.M) was 0.1. mu.L, and the amount of sample DNA was 1. mu.L. And (3) detecting the sample DNA by adopting the diluted positive template, preferably selecting amplification conditions: 95-5 min; 95-15 s, 58-30 s; 72 ℃, 40sec, 45 cycles; 72 ℃ for 7 min; keeping the temperature at 4 ℃. Real-time fluorescent quantitative PCR detection was performed on an ABI7500 PCR instrument.
2) Three replicates were made for each gradient.
And (4) judging a result: the Ct value is less than or equal to 33, an obvious amplification curve is a positive result, and the Ct value is more than 40, and no obvious amplification curve is a negative result.
Fluorescence value chart of detection results, wherein the sensitivity test results of the ulcer germs are shown in FIG. 2, and the template concentrations of the curves from left to right in the chart are respectively 2.3X 10-2ng/μL、2.3×10-3ng/μL、2.3×10-4ng/μL、2.3×10- 5ng/μL、2.3×10-6ng/mu L of ulcer germ DNA, and as can be seen from the results, the method established by the invention has the concentration of 2.3 multiplied by 10-6ng/. mu.L of DNA of ulcer germs can be detected. The results of the sensitivity test for brown spot pathogen are shown in FIG. 3, in which the concentration of the template from left to right is 1.8X 10-2ng/μL、1.8×10-3ng/μL、1.8×10-4ng/μL、1.8×10-5ng/μL、1.8×10-6ng/mu L of brown spot germ DNA, and as can be seen from the results, the method established by the invention has the concentration of 1.8 multiplied by 10-6The brown spot germ DNA of ng/microliter can be detected. The results of the sensitivity test for the arbuscular phytoplasma are shown in fig. 4. The template concentrations shown in the graph from left to right are 2.6X 10-2ng/μL、2.6×10-3ng/μL、2.6×10-4ng/μL、2.6×10-5ng/μL、2.6×10-6ng/. mu.L of arbuscular disease phytoplasma DNA, it can be seen from the results that the method established by the invention is applied to concentrations of 2.6X 10-6ng/. mu.L of arbuscular disease phytoplasma DNA can be detected. It can be seen that the sensitivity of the method of the invention for detecting the pathogens of ulcer, brown spot and bush diseases is 2.3 multiplied by 10-6ng/μL、1.8×10-6ng/μL、2.6×10-6ng/μL。
EXAMPLE 6 specificity of the kit of the invention
The kit provided by the invention is used for detecting aspergillus flavus (cfcc 84919), fusarium oxysporum (cfcc 89008), alternaria tenuis (cfcc 84543), colletotrichum gloeosporioides (cfcc 82273), bacillus subtilis (cfcc 14476), aspergillus flavus (CICC 2090), bacillus cereus (cfcc2692), trichoderma viride (CICC2535) and candida albicans (cfcc 3529).
The strain can be obtained commercially, and after the strain is activated and cultured, the strain liquid is taken to extract DNA. The extracted DNA was subjected to detection by the method described in example 4. The detection result shows that the strains have no amplification curve and the detection result is negative, namely the primers and the probes designed by the invention have specificity, no non-specific amplification and strong specificity.
Example 7: detection of samples Using the kit of the invention
Samples of healthy neem, which exhibited typical symptoms of arbuscular, ulcerative, brown spotting and were collected from the Qingdao area of Shandong, with 13 samples for ulcerative symptoms, 9 samples for ulcerative symptoms and 15 for typical arbuscular symptoms.
The DNA extraction from the above sample can be carried out by the method of extracting DNA as in example 4, and the extracted DNA is detected by the kit of the present invention. The result of the detection by using the fluorescent quantitative method described in the embodiment 4 shows that the samples with the symptoms of the canker pathogen, the brown spot pathogen and the arbuscular disease phytoplasma have obvious amplification curves and positive results, which indicates that the detection method has good applicability to the detection of the samples, the detection is carried out by using an ABI7500 fluorescent quantitative PCR instrument, and the detection accuracy rate reaches 100%.
While the invention has been described with reference to a preferred embodiment, it will be understood by those skilled in the art that various changes may be made and equivalents may be substituted for elements thereof without departing from the scope of the invention. However, any simple modification, equivalent change and modification of the above embodiments according to the technical essence of the present invention are within the protection scope of the technical solution of the present invention.
Sequence listing
<110> Qingdao agricultural university
<120> nucleic acid, kit and method for multiple detection of ulcerative bacteria, brown spot bacteria and arbuscular phytoplasmas
<130>
<160>12
<170>SIPOSequenceListing 1.0
<210>2
<211>24
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>2
ccacacgaat tgcttgattc attg 24
<210>3
<211>23
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>3
tgaccaactt caccaggtaa ctg 23
<210>3
<211>25
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>3
cgaactgccg acctcaccct tatca 25
<210>6
<211>202
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>6
atcgacgact cagctgcacc ataagcaccc acacgaattg cttgattcat tgaagaagac 60
gatgagaagc agcttttgct ttgcacaccc gattttgggt ctgtagctca gttggttaga 120
gcgcacccct gataagggtg aggtcggcag ttcgaatctg cccagaccca ccagttacct 180
ggtgaagttg gtcagagcgc gt 202
<210>4
<211>22
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>4
tcgcactctc tatcagcaaa gg 22
<210>5
<211>24
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>5
cggactctaa aagagccaga tttc 24
<210>7
<211>25
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>7
tgttgccgct tcactcgccg ttact 25
<210>8
<211>312
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>8
tttcggagcg cagcacaagt cgcactctct atcagcaaag gtctagcatc cattaagcct 60
ttttttcaac ttttgacctc ggatcaggta gggatacccg ctgaacttaa gcatatcaat 120
aagcggagga aaagaaacca acagggattg ccctagtaac ggcgagtgaa gcggcaacag 180
ctcaaatttg aaatctggct cttttagagt ccgagttgta atttgcagag ggcgctttgg 240
ctttggcagc ggtccaagtt ccttggaaca ggacgtcaca gagggtgaga atcccgtacg 300
tggtcgctgg ct 312
<210>9
<211>22
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>9
tggtctaagt gcaatgctca ac 22
<210>10
<211>22
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>10
ccgccttcgc tactggtgtt cc 22
<210>11
<211>19
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>11
ttgcctctat cttactcta 19
<210>12
<211>168
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>12
tatggtctaa gtgcaatgct caacattgtg atgctataaa aactgtttag ctagagtaag 60
atagaggcaa gtggaattcc atgtgtagtg gtaaaatgcg taaatatatg gaggaacacc 120
agtagcgaag gcggcttgct gggtctttac tgacgctgag gcacgaaa 168
Claims (10)
1. A group of nucleic acids for simultaneously detecting three pathogenic bacteria by multiplex PCR is characterized by comprising an upstream primer and a downstream primer for detecting ulcerative bacteria, brown spot bacteria and arbuscular disease phytoplasma, wherein the upstream primer sequence of the ulcerative bacteria is shown as SEQ ID No.1, and the downstream primer sequence is shown as SEQ ID No. 2;
the upstream primer sequence of the brown spot germ is shown as SEQ ID No.5, and the downstream primer sequence is shown as SEQ ID No. 6;
the upstream primer sequence of the arbuscular disease phytoplasma is shown as SEQ ID No.9, and the downstream primer sequence is shown as SEQ ID No. 10.
2. A set of nucleic acids for simultaneous detection of three pathogenic bacteria by fluorescence quantitative PCR, comprising the upstream and downstream primers for detection of ulcerative pathogens, brown spot pathogens, and rosette disease pathogens and probes corresponding to each pathogen,
the probe sequence of the ulcer germs is shown as SEQ ID No. 3;
the probe sequence of the brown spot germ is shown in SEQ ID No. 7;
the probe sequence of the arbuscular pathogen is shown as SEQ ID No. 11.
3. The nucleic acid of claim 1 or 2, wherein the set of nucleic acids further comprises positive amplification products for detection of ulcerative bacteria, brown spot bacteria, and rampant pathogens, wherein,
the positive amplification product for detecting the ulcer germs has a sequence shown between 29 bp and 194bp in SEQ ID No. 4;
the positive amplification product for detecting the brown spot germ has a sequence shown between 20 bp and 213bp in SEQ ID No. 8;
the positive amplification product for detecting the arbuscular disease phytoplasma has a sequence shown as the 2 nd-134 bp in SEQ ID No. 12.
4. A kit for simultaneously detecting three pathogenic bacteria by fluorescence quantitative PCR is characterized by comprising: the upstream and downstream primers and corresponding probes for detecting ulcerative colitis, Limonicola and arbuscular mycosis according to claim 2, each of which corresponds to the markers FAM-BHQ1, JOE-TAMRA and CY5-BHQ3 at the 5 'end and 3' end, respectively.
5. The kit of claim 4, further comprising positive amplification products for detecting ulcerative bacteria, brown spot bacteria, and arbuscular mycosis pathogens, wherein,
the positive amplification product for detecting the ulcer germs has a sequence shown between 29 bp and 194bp in SEQ ID No. 4;
the positive amplification product for detecting the brown spot germ has a sequence shown between 20 bp and 213bp in SEQ ID No. 8;
the positive amplification product for detecting the arbuscular disease phytoplasma has a sequence shown as the 2 nd-134 bp in SEQ ID No. 12.
6. The kit of claim 4, further comprising Premix EX TaqTM x 2.
7. A detection method for simultaneously detecting three pathogenic bacteria by fluorescent quantitative PCR is characterized in that the method is used for detecting the three pathogenic bacteria of canker pathogen, brown spot pathogen and arbuscular disease phytoplasma, and specifically comprises the following steps:
(1) extracting DNA from the sample;
(2) performing fluorescent quantitative PCR amplification on the extracted DNA; wherein, during fluorescent quantitative PCR amplification, in a reaction system, the nucleotide sequences of the upstream primer and the downstream primer of the ulcerative bacteria and the probe are shown as SEQ ID No.1, SEQ ID No.2 and SEQ ID No.3, and the 5 'end and the 3' end of the probe are respectively and correspondingly marked with FAM and BHQ 1; the nucleotide sequences of the upstream primer and the downstream primer of the brown spot pathogen and the probe are shown as SEQ ID No.5, SEQ ID No.6 and SEQ ID No.7, and the 5 'end and the 3' end of the probe are respectively and correspondingly marked with JOE and TAMRA; the nucleotide sequences of the upstream primer, the downstream primer and the probe of the arbuscular disease phytoplasma are shown as SEQ ID No.9, SEQ ID No.10 and SEQ ID No.11, and the 5 'end and the 3' end of the probe are respectively and correspondingly marked with CY5 and BHQ 3;
(3) collecting fluorescence signals, selecting a fluorescence detection mode of the fluorescent group in the step (2), adjusting a base line, taking 3-15 circulating fluorescence signals, and setting a threshold line by the highest point of the threshold line just exceeding the normal negative control;
(4) and (4) judging a result: and if the fluorescence increase curve of the sample to be detected exceeds a threshold value line and shows good logarithmic increase, judging the sample to be detected to be positive, and if no typical amplification curve exists, judging the sample to be detected to be negative.
8. The detection method according to claim 7, wherein the reaction system for the fluorescent quantitative PCR amplification in the step (2) is as follows:
1×Premix EX TaqTM，
the final concentration of the ulcer germ upstream primer and downstream primer is 0.45 mu mol/L, and the final concentration of the probe is 0.1 mu mol/L; the final concentration of the forward primer and the downstream primer of the brown spot pathogen is 0.45 mu mol/L, and the final concentration of the probe is 0.1 mu mol/L; the final concentration of the upstream primer and the downstream primer of the arbuscular disease phytoplasma is 0.6 mu mol/L, and the final concentration of the probe is 0.08 mu mol/L;
the DNA of the sample is 1 mu L;
meanwhile, setting water without nuclease as a negative control;
meanwhile, genes comprising a sequence shown as SEQ ID No.4, a sequence shown as SEQ ID No.8 and a sequence shown as SEQ ID No.12 are respectively set as positive controls.
9. The detection method according to claim 7, wherein the reaction procedure of the fluorescent quantitative PCR amplification in the step (2) is as follows: pre-denaturation stage at 95 deg.C for 5 min; amplification stage 95 ℃ for 15 sec; 58 ℃ for 30 sec; 72 ℃, 40sec, 45 cycles; 72 ℃ for 7 min; keeping the temperature at 4 ℃.
10. The detection method according to claim 7, wherein in the determination of the result in the step (4), the threshold is 33, and when the Ct value is less than or equal to 33, a significant amplification curve is a positive result; when the Ct value is more than 40, no obvious amplification curve is a negative result.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711046205.3A CN107541560B (en) | 2017-10-31 | 2017-10-31 | Nucleic acid, kit and method for multiple detection of ulcer germs, brown spot germs and arbuscular disease phytoplasma |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711046205.3A CN107541560B (en) | 2017-10-31 | 2017-10-31 | Nucleic acid, kit and method for multiple detection of ulcer germs, brown spot germs and arbuscular disease phytoplasma |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107541560A CN107541560A (en) | 2018-01-05 |
| CN107541560B true CN107541560B (en) | 2020-06-16 |
Family
ID=60968290
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711046205.3A Active CN107541560B (en) | 2017-10-31 | 2017-10-31 | Nucleic acid, kit and method for multiple detection of ulcer germs, brown spot germs and arbuscular disease phytoplasma |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107541560B (en) |
Citations (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101457259A (en) * | 2009-01-15 | 2009-06-17 | 中国检验检疫科学研究院 | Primer for detecting orchid bacterial speckle brown spot pathogen and detection method thereof |
| CN101892308A (en) * | 2010-05-13 | 2010-11-24 | 西北农林科技大学 | Specific amplification primer for detecting marssonina coronaria and detection method |
| CN103114135A (en) * | 2013-01-25 | 2013-05-22 | 郑媛 | Fluorescent PCR (polymerase chain reaction) quick detection primer and kit for citrus canker pathogenic bacteria |
| CN104726595A (en) * | 2014-12-28 | 2015-06-24 | 云南农业大学 | Multiple PCR detection kit for three bacterial seed-borne diseases and special primer for kit as well as multiple PCR detection method |
| CN105177148A (en) * | 2015-09-23 | 2015-12-23 | 北京市农林科学院 | Dual PCR primer for detecting two types of pathogens of grape canker at same time and application of dual PCR primer |
| CN106167831A (en) * | 2016-09-04 | 2016-11-30 | 中国林业科学研究院森林生态环境与保护研究所 | Detect jujube witches broom, Sophora japonica L. withes broom or the LAMP primer group of Fructus Pruni pseudocerasi lethal yellow phytoplasma and test kit thereof and application |
| CN106591452A (en) * | 2016-12-08 | 2017-04-26 | 浙江万里学院 | Real-time fluorescence PCR method for quantitatively detecting Pseudomonas syringae pv. Actinidiae |
| CN106701968A (en) * | 2017-01-22 | 2017-05-24 | 北京市农林科学院 | Primer for simultaneously detecting Botryosphaeria dothidea and Cryptosporella viticola and application of primer |
-
2017
- 2017-10-31 CN CN201711046205.3A patent/CN107541560B/en active Active
Patent Citations (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101457259A (en) * | 2009-01-15 | 2009-06-17 | 中国检验检疫科学研究院 | Primer for detecting orchid bacterial speckle brown spot pathogen and detection method thereof |
| CN101892308A (en) * | 2010-05-13 | 2010-11-24 | 西北农林科技大学 | Specific amplification primer for detecting marssonina coronaria and detection method |
| CN103114135A (en) * | 2013-01-25 | 2013-05-22 | 郑媛 | Fluorescent PCR (polymerase chain reaction) quick detection primer and kit for citrus canker pathogenic bacteria |
| CN104726595A (en) * | 2014-12-28 | 2015-06-24 | 云南农业大学 | Multiple PCR detection kit for three bacterial seed-borne diseases and special primer for kit as well as multiple PCR detection method |
| CN105177148A (en) * | 2015-09-23 | 2015-12-23 | 北京市农林科学院 | Dual PCR primer for detecting two types of pathogens of grape canker at same time and application of dual PCR primer |
| CN106167831A (en) * | 2016-09-04 | 2016-11-30 | 中国林业科学研究院森林生态环境与保护研究所 | Detect jujube witches broom, Sophora japonica L. withes broom or the LAMP primer group of Fructus Pruni pseudocerasi lethal yellow phytoplasma and test kit thereof and application |
| CN106591452A (en) * | 2016-12-08 | 2017-04-26 | 浙江万里学院 | Real-time fluorescence PCR method for quantitatively detecting Pseudomonas syringae pv. Actinidiae |
| CN106701968A (en) * | 2017-01-22 | 2017-05-24 | 北京市农林科学院 | Primer for simultaneously detecting Botryosphaeria dothidea and Cryptosporella viticola and application of primer |
Non-Patent Citations (1)
| Title |
|---|
| Development of qPCR systems to quantify shoot infections by canker-causing pathogens in stone fruits and nut crops;Yong Luo et al;《Journal of Applied Microbiology》;20161231;第416-428页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107541560A (en) | 2018-01-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107557446B (en) | Nucleic acid, kit and method for simultaneously detecting pathogenic bacteria of four diseases of blueberries | |
| CN110951838B (en) | Primer, probe and kit for detecting meloidogyne incognita based on RPA-LFD technology and application | |
| CN107022624B (en) | LAMP method and kit for rapidly detecting bakanae disease bacteria of rice from rice seeds | |
| CN101974650B (en) | Polymerase chain reaction (PCR) method for detecting fusarium oxysporum and kit | |
| KR101756997B1 (en) | Xanthomonas campestris pv. campestris resistant brassica plant and preparation thereof | |
| JP4962744B2 (en) | Sugar beet black rot resistant variety selection marker and its selection method | |
| CN106967809B (en) | Method for rapidly identifying haynaldia villosa chromosomes in wheat background | |
| KR101047322B1 (en) | DNA marker for the identification of Anguilla eel species | |
| KR100753676B1 (en) | TRIM-Br1 and TRIM-Br2 DNA marker system using the same and classification method using the same | |
| Grilli et al. | QTL identification for tolerance to fruit set in tomato by fAFLP markers | |
| KR101934548B1 (en) | Method for Multiplex Analysis of Cylindrocarpon destructans and Fusarium solani Using Real-time PCR | |
| CN107541560B (en) | Nucleic acid, kit and method for multiple detection of ulcer germs, brown spot germs and arbuscular disease phytoplasma | |
| US20150292003A1 (en) | Methods and kits for detection of a pathogen in sugarcane | |
| CN111850155A (en) | Application of specific target primer in simultaneous and rapid identification of two pathogenic bacteria of strawberry infection | |
| CN107557445B (en) | Nucleic acid, kit and method for simultaneously detecting pathogen causing blight, spot disease and powdery mildew of begonia | |
| CN104975083B (en) | A kind of primer and its authentication method of two hidden kind of Rapid identification Bemisia tabaci MEAM1, MED | |
| KR101144198B1 (en) | DNA marker for discrimination of Polygonum multiflorum Thunberg, Cynanchum wilfordii Max. Hemsl. and Cynacum auriculatum Royle ex Wight | |
| CN111534626A (en) | LAMP (loop-mediated isothermal amplification) detection primer composition for pythium bellatus, detection kit and visual detection method of LAMP detection primer composition | |
| CN107586863B (en) | Nucleic acid, kit and method for simultaneously detecting etiolation disease phytoplasma, ulcer disease pathogenic bacteria and leaf spot disease pathogenic bacteria | |
| KR101947677B1 (en) | LAMP primer set for detecting Erwinia amylovora and uses thereof | |
| CN111500747A (en) | Primer and probe combination for detecting citrus semi-piercing nematodes and application thereof | |
| CN112280890A (en) | Primer and probe combination for detecting peronophythora litchi based on RPA-lateral flow chromatography technology and detection method thereof | |
| CN104745686B (en) | Primers and method for specific loop-mediated isothermal amplification (LAMP) detection of genetically modified alfalfa strain J163 and application of method | |
| CN116622883B (en) | Specific probe, primer, kit and method for identifying rice H23 transformant | |
| KR102669820B1 (en) | Primer set for determining origin of angelica gigas, and method for determinig origin of angelica gigas using the same |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |