CN104031991B - Fluorescent quantitative PCR detection method and the kit thereof of Bemisia tabaci to Diacloden resistance - Google Patents
Fluorescent quantitative PCR detection method and the kit thereof of Bemisia tabaci to Diacloden resistance Download PDFInfo
- Publication number
- CN104031991B CN104031991B CN201410215726.7A CN201410215726A CN104031991B CN 104031991 B CN104031991 B CN 104031991B CN 201410215726 A CN201410215726 A CN 201410215726A CN 104031991 B CN104031991 B CN 104031991B
- Authority
- CN
- China
- Prior art keywords
- bemisia tabaci
- diacloden
- resistance
- pcr
- detection
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
Abstract
The invention discloses a kind of for detection of Bemisia tabaci (<i>Bemisia</i><i>Tabaci</i>) specific PCR primer pair to Diacloden resistance, kit and detection method, is primer pair forward primer nucleotide sequence as SEQ? ID? is reverse primer nucleotide sequence as SEQ shown in No.1? ID? shown in No.2. The fluorescent quantitative PCR detection method of Bemisia tabaci provided by the present invention to Diacloden, need manpower and sample size few, the feature that amount detection is large, highly sensitive, high specificity, fast and convenient and accurately and reliably, thereby can effectively detect the resistance of Bemisia tabaci to Diacloden, be suitable for the Rapid&Early diagnosis of Bemisia tabaci to Diacloden resistance, can be used for real-time monitoring and the early-warning and predicting of field Bemisia tabaci Diacloden resistance simultaneously, application prospect is extensive.
Description
Technical field
The invention belongs to biological field, relate to fluorescent quantitative PCR detection method and the kit thereof of Bemisia tabaci to Diacloden resistance.
Background technology
Bemisia tabaciBemisiatabaci(Gennadius), be global agricultural pests, be with great harm to production. After the eighties in 20th century, be distributed in successively more than 90 countries and regions of the whole world except Wai Ge continent, the Antarctic Continent, and post nearly 74 sections kind more than 500 of plant. In China, this insect becomes the important industrial crops insect of China in the latter stage nineties, and the kind that mainly causes harm is B bion, because the strong harmfulness of its invasion property is greatly again by titled with " super insect "; Q bion Bemisia tabaci was found in flowers market, Yunnan Province by this laboratory first in 2003, was diffused rapidly to afterwards all parts of the country, and these two kinds of bion Bemisia tabaci are to endanger maximum bion on the crops such as China's vegetables and flowers at present. Bemisia tabaci is not only directly stung and is inhaled water, causes plant weak, withered, but also propagates the viroses of plant. The harm being caused as passing malicious medium by Bemisia tabaci even makes the whole canopy tomato in some areas have no harvest, and has brought extremely serious harm to existence. In view of Bemisia tabaci directly endangers and the seriousness of indirect hazard, in agricultural production, instant stage has been arrived in the preventing and controlling of Bemisia tabaci.
Bemisia tabaci is mainly taking chemical prevention as main, and the excessive use of pesticide, causes Bemisia tabaci various control medications to be produced to resistance in various degree, especially uses the anabasine insecticide resistance to the action of a drug the longest, that range of application is the widest the strongest to preventing and treating Bemisia tabaci. Diacloden is the anabasine insecticide of second generation brand new, entered after Chinese market from 2000, and be the first-selection of preventing and treating Bemisia tabaci always. Find that first it is the horticultural production district at southern Spain that Bemisia tabaci produces resistance to anabasine insecticide, after in succession find to approach the Bemisia tabaci Diacloden resistant population of 1000 times in Israel and Spain again soon, and there is remarkable cross resistance to other nicotinoids medicament in high resistance population. In recent years, national most of provinces such as Beijing of China, Jiangsu, Zhejiang, Xinjiang, Hubei also have Bemisia tabaci anabasine medicament to be produced to the report of resistance successively, and China north to Heilungkiang, reach in the south Hainan, to Qinghai, east all have to the most areas in Shanghai Bemisia tabaci distribute and endanger, harm bion is mainly Q type and Type B, and the resistance to the action of a drug is generally very high. Therefore the resistance to the action of a drug is to cause Bemisia tabaci great outburst and be difficult to the one of the main reasons of administering.
Hence one can see that, and the resistance problem of Bemisia tabaci is very outstanding, therefore for more effective use anabasine insecticide, develops effective Bemisia tabaci Diacloden resistance early stage rapid molecular diagnostic techniques and just seem particularly important. Pest resistance to insecticide is administered and is depended on illustrating of pest resistance mechanism, but people still " know little about it " to the resistance mechanism of the anti-anabasine insecticide of Bemisia tabaci at present. About the mechanism of action of anabasine insecticide, people generally believe, it is mainly as the activator of post-synapse nAChR (nAChRs), act on the central nervous system of insect and make the insect paralysis of twitching dead. Therefore, concentrate on nAChRs about anabasine insecticide resistance mechanism study general, as relevant with anabasine insecticide resistance in all found nAChRs sudden change in the insects such as black peach aphid, fruit bat, planthopper, malarial mosquito and honeybee. Except target site insensitivity, insect is also relevant with metabolic mechanism to the resistance mechanism of anabasine insecticide, as relevant with Diacloden resistance in all found recently the metabolic detoxification of Cytochrome P450 oxidase gene mediation in black peach aphid, housefly, brown paddy plant hopper. And in Bemisia tabaci, do not find so far the sudden change report relevant with anabasine insecticide resistance of nAChRs, but by biochemical and molecular biology method find a kind of cytochrome P450 gene (CYP6CM1) relevant with Imidacloprid resistance. This laboratory utilizes transcribes group technology and obtains a large amount of P450 gene fragment orders, and carries out quantitative fluorescent PCR taking Diacloden resistance and sensitive strain as experiment material and carry out expression checking, found that P450 gene in resistant strainCYP4C64Expression significantly raise, and find that by field sample detection this gene is extremely relevant to Diacloden resistance, domestic not yet have about the conventional medicament related gene inspecting reagent kit such as field the nicotinic insecticide resistance to the action of a drug, especially Diacloden use.
At present, although the molecular marking technique of some PCR-based methods is as RAPD (RandomAmplifidePolymorphicDNA, randomly amplified polymorphic DNA), AFLP (AmplifideFragmentLengthPolymorphism, AFLP) for the searching of Bemisia tabaci resistance related gene, but these marks are not directly used in Bemisia tabaci resistance and detect, Bemisia tabaci Diacloden resistance detects and is still confined to bioassay method. But traditional bioassay method has some shortcomings: (1) sensitivity is low: biologicall test is difficult to detect early stage resistance or low frequency resistance; (2) cycle is long: Bemisia tabaci Diacloden bioassay results generally needs 2 days (48 hours); (3) very large to examination worm quantitative requirement: measures a calibration curve and complete a secondary survey and at least need approximately 800 examination worms, and also very high to the requirement of insect raising. (4) troublesome poeration and standard are not strong: method is more loaded down with trivial details, and the more complicated that operates from worm source, raise and be difficult to accomplish real standardization to mensuration, not only cause the raw workload of surveying to strengthen, and many human factors also can affect the raw result of surveying; (6) LC that the calibration curve that traditional method is drawn from software is obtained50And LC90Repeatability and the accuracy of value are lower; (7) traditional bioassay method often has hysteresis quality to the resistance level recording for examination insect.
Along with the further develop rapidly of Protocols in Molecular Biology, people are by fluorescent quantitative PCR technique (RealTime-quantitativePolymeraseChainReaction, RT-qPCR) resistance to the action of a drug that is widely used in multiple virus, bacterium detects, and starts to be applied to the expression detection of insect resistance detoxifying gene on transcriptional level. Quantitative fluorescent PCR is exactly in pcr amplification process, by fluorescence signal, PCR process is detected in real time. Due to the exponential time base at pcr amplification, there is linear relationship in the Ct value of template (period that the fluorescence signal in each reaction tube experiences while reaching the threshold value of setting) and the initial copy number of this template, so become quantitative foundation. With respect to conventional resistance detection means such as raw surveys, the advantages such as quantitative fluorescent PCR has simple to operate, highly sensitive, reproducible, because starting to become the prefered method that insect resistance target gene transcriptional level expression detects, on detecting, the resistance to the action of a drug day by day demonstrates powerful advantage. The evaluation for its resistance management measure and resistance risk early warning are provided technological means by the exploitation of the early stage resistance to the action of a drug Molecular Detection of Bemisia tabaci and diagnostic techniques, has great importance at aspects such as reducing pest damage loss, minimizing agricultural chemicals pollution, the quality that ensures victual and the guarantee people's health to environment. Therefore, a kind of accurate, easy, quick, reliable Bemisia tabaci Diacloden resistance detection means of foundation is particularly urgent. So in order better to detect Bemisia tabaci Diacloden resistance, develop more effectively Bemisia tabaci Diacloden resistance detection means, we have carried out this research contents.
Summary of the invention
The present invention is directed to that the sensitivity existing in existing Bemisia tabaci Diacloden resistance detection technique is low, the problem such as the cycle is long, poor repeatability and material requirements height, screen and the step such as the optimization of reaction system by specificity fluorescent quantification PCR primer, set up a kind of molecular detecting method of quantitative fluorescent PCR fast and accurately and detection kit quick, easy, that detect accurately and efficiently Bemisia tabaci Diacloden resistance, for Bemisia tabaci Diacloden resistance effectively detects effective tool is provided.
Technical scheme provided by the invention is: a kind of for detection of Bemisia tabaci (Bemisiatabaci) specific PCR primer pair to Diacloden resistance, its forward primer nucleotide sequence is as shown in SEQIDNo.1, and reverse primer nucleotide sequence is as shown in SEQIDNo.2.
The present invention carry also supply a kind of for detection of Bemisia tabaci (Bemisiatabaci) PCR detection kit to Diacloden resistance, described kit comprises described specific PCR primer pair.
Further, in kit of the present invention, also comprise reverse transcriptase, DNase, RNase inhibitor, dNTP mixture, Auele Specific Primer, MgCl2Solution, thermal starting TaqDNA polymerase, fluorescent quantitation reactant liquor, Buffer buffer solution, RNase-free water etc. In addition, also should comprise the positive control and the negative control sample that meet this kit requirement.
The present invention also provide a kind of detect Bemisia tabaci (Bemisiatabaci) PCR detection method to Diacloden resistance, the method, comprises the following steps:
(1) extract the RNA sample of Bemisia tabaci to be measured, and reverse transcription is cDNA template;
(2) described cDNA template is joined in the PCR reactant liquor that contains above-mentioned specific PCR primer pair and obtains PCR reaction system;
(3) carry out fluorescence quantitative PCR detection;
Specific PCR primer pair of the present invention is with in Bemisia tabaci bodyCYP4C64The conservative fragments district of gene is that target sequences Design obtains, and this primer has very high specificity, by the field sample detection of different space-times, finds that this has very high amplification efficiency to primer, and it is splendid that qRT-PCR detects effect.
In described Bemisia tabaci bodyCYP4C64The nucleotide sequence in conservative fragments district as shown in SEQ ID No .3.
The amplification program of described fluorescence quantitative PCR detection is: 94 DEG C of denaturation 5min, and 94 DEG C of sex change 30sec, 60 DEG C of annealing 40sec, 72 DEG C are extended 45sec, 40 circulations.
After PCR process completes, by 0.l DEG C of s-1Heating rate rise to 95 DEG C of analysis verifications that carry out melt curve analysis from 72 DEG C, detailed process is: 95 DEG C are carried out 15s, then 60 DEG C are carried out 1min, then 95 DEG C are carried out 15s, finally carry out 15s at 60 DEG C again.
The present invention uses ABIPrism7500 quantitative real time PCR Instrument to detect.
When ABIPrism7500 quantitative real time PCR Instrument carries out interpretation of result, the fluorescence signal of 3-15 circulation is got in baseline setting. For ease of comparing, the threshold value of all amplification curves of sample, feminine gender and positive control is all set as 0.50 (be positioned at amplification curve logarithmic phase centre position, Other Instruments baseline and Threshold can be adjusted accordingly according to instrument).
Quantitative fluorescent PCR product in above-mentioned steps is carried out to fluorescent quantitation detection, under specific wavelength condition, according to the anti-quick sample room Ct value judged result of fluoroscopic examination, if described Bemisia tabaci sample to be measured produces typical " S " type amplification curve and unimodal melt curve analysis, and Ct value≤24, illustrate that described Bemisia tabaci testing sample produces resistance to Diacloden; If Ct >=27 value, illustrates that Bemisia tabaci sample to be measured does not produce resistance to Diacloden. If Ct value is positioned in the middle of both, suggestion is reformed, and whether sample produces apparent weight to Diacloden resistance and do result and determine.
The RNA sample that the RNA sample of described Bemisia tabaci to be measured is Bemisia tabaci adults.
The present invention is selection Bemisia tabaciCYP4C64The conservative fragments district of gene is target sequence, according to the design principle of this gene feature and fluorescence quantification PCR primer, has designed a pair of Auele Specific Primer, has set up a kind of PCR kit for fluorescence quantitative and detection method thereof detecting for Bemisia tabaci Diacloden resistance. Than existing biometric techniques, fluorescent quantificationally PCR detecting kit and using method thereof that Bemisia tabaci Diacloden resistance provided by the present invention detects, have following effect and advantage:
(1) specificity is stronger. The present invention utilizes Bemisia tabaciCYP4C64The conservative fragments district of gene is target sequence, 5 pairs of primers are designed, verify that by regular-PCR whether single fragment is, then carry out amplification efficiency by quantitative fluorescent PCR and calculate an Auele Specific Primer, thereby can carry out specific amplification to target sequence in PCR process, and pass through different time, the field sample detection of different location, find that this is single to primer amplification band, the Bemisia tabaci cDNA sample that variable concentrations is set carries out amplification efficiency detection, result shows that this reaches 99%(90-110% to primer amplification efficiency and can be used for qRT-PCR detection), show that the Auele Specific Primer that obtains can be forCYP4C64Gene qRT-PCR detects.
(2) sensitivity and the degree of accuracy are higher. The Bemisia tabaci Diacloden resistance detection method relating in the present invention is mainly applied qRT-PCR technology, detects Bemisia tabaci Diacloden resistance level by the difference of Ct value. This technology great advantage is to detect micro-masterplate DNA, and sensitivity reaches 10-8μ g, both, with respect to traditional False Rate and the poor raw survey method of repeatability, sensitivity and the degree of accuracy of detection improved greatly; And the sensitivity reaching than common primer is high.
(3) sense cycle is short. Raw survey process at least needs the time of 48 hours, and the inventive method only needs can complete for 3 hours judgement, once can detect multiple samples simultaneously, is particularly suitable for the fast detecting of batch samples.
(4) material requirements is few. In Bemisia tabaci virulence bioassay, measuring a calibration curve at least needs the accurate examination of approximately 800 leaders worm, and raising and the picking of these examination worms need to spend certain human and material resources and financial resources. And the present invention only needs the Bemisia tabaci adults of tens left and right to the detection of a population.
(5) detect uniqueness. By the Fields detection of multiple fields sample, findCYP4C64The resistance of gene overexpression and Diacloden is closely related, at home and abroad there is no field resistance Bemisia tabaci gene expression detection kit and uses, and has very strong uniqueness.
In sum, the alternative traditional bioassay method of method of the present invention, it can detect accurate, quick, special, easily for examination Bemisia tabaci whether have Diacloden resistance, significant to the monitoring of field Bemisia tabaci Diacloden resistance. The PCR detection method of Bemisia tabaci provided by the present invention to Diacloden resistance, need manpower and sample size few, the feature that amount detection is large, and highly sensitive, high specificity, fast and convenient and accurately and reliably, thereby can effectively detect the resistance of Bemisia tabaci to Diacloden, be suitable for the Rapid&Early diagnosis of Bemisia tabaci to Diacloden resistance, can be used for real-time monitoring and the early-warning and predicting of field Bemisia tabaci Diacloden resistance simultaneously, application prospect is extensive.
Brief description of the drawings
Fig. 1 be in the present invention Auele Specific Primer used to amplification Bemisia tabaciCYP4C64Gene cDNA fragment sequence.
Fig. 2 is this gene cDNA amplified fragments 2% agarose gel electrophoresis figure in Fig. 1. Wherein, 1: to the Bemisia tabaci adults cDNA sample of Diacloden sensitivity; 2: the adult cDNA sample that Diacloden is produced to resistance; M:Marker I.
Fig. 3 carries out the standard amplification curve that quantitative fluorescent PCR obtains for standard items gradient dilution. Wherein, abscissa represents period, and ordinate represents the fluorescence signal intensity of the n time PCR circulation time, parallel and represent fluorescence threshold away from the straight line of abscissa, 5 diluted concentrations of alphabetical representative sample cDNA in figure.
Fig. 4 is the calibration curve obtaining according to the quantitative fluorescent PCR of the data drafting drawing in Fig. 3. Wherein, abscissa represents the logarithm value of standard sample cDNA concentration, and ordinate represents that cycle threshold is Ct value.
Fig. 5 is the fluorescence quantitative PCR detection result of the detection Bemisia tabaci Diacloden resistance of embodiment 1. Wherein, A: to the responsive Bemisia tabaci cDNA of Diacloden sample; B: to the sample of Diacloden resistance Bemisia tabaci cDNA.
Fig. 6 is the fluorescence quantitative PCR detection result of the detection Bemisia tabaci Diacloden resistance of embodiment 2. Wherein, the Bemisia tabaci cDNA negative control sample to Diacloden sensitivity in A: embodiment 1; In B: embodiment 1, Diacloden is produced the Bemisia tabaci cDNA positive control sample of resistance; C: the Bemisia tabaci cDNA testing sample that Diacloden is produced to resistance; D: the Bemisia tabaci cDNA testing sample that Diacloden is produced to resistance; E: the Bemisia tabaci cDNA testing sample that Diacloden is produced to resistance. .
Detailed description of the invention
Below in conjunction with embodiment, the invention will be further described and explanation, but protection scope of the present invention is not limited in this.
Before experiment, material sample is prepared:
(1) Bemisia tabaci Diacloden sensitive population TH-S: this Bemisia tabaci is to be collected in for 2000 between the cabbage field in Haidian, Beijing by laboratory member. In insect group insectarium of Vegetable & Flower Inst., Chinese Academy of Agriculture Science, use without worm cabbage seedling and carry out subculture raising, do not contact during this time any poison insecticide, to Diacloden sensitivity (LC50 is 19.10mg/L);
(2) Bemisia tabaci Diacloden resistant population TH-R: this population is eliminates with Diacloden the population that selects TH-S always, and Diacloden resistance LC50 reaches 1426.22mg/L, and resistant multiple reaches the high resistance level of 75 times, on wild cabbage, raises so far continuously;
(3) field Diacloden resistant population ZJ: this population is the Bemisia tabaci gathering in field, Zhejiang Province in 2011, and Diacloden resistance LC50 reaches 2471.95mg/L, and resistant multiple reaches the high resistance level of 129 times;
(4) field Diacloden resistant population TJ: this population is the Bemisia tabaci gathering in field, Tianjin in 2012, and Diacloden resistance LC50 reaches 2119.15mg/L, reaches the high resistance level of 111 times;
(5) field Diacloden resistant population BJ: this population is the Bemisia tabaci gathering in field, Beijing in 2012, and Diacloden resistance LC50 reaches 1483.24mg/L, reaches the high resistance level of 78 times;
Above-mentioned five Bemisia tabacis all carry out isolated rearing indoor, and raising temperature is 25 ± 1 DEG C, and relative humidity is 60%-70%, and the photoperiod is illumination: dark=16h:8h.
Embodiment 1
Utilize the detection of fluorescent quantitative PCR technique to TH-S and TH-R adult cDNA sample and the foundation of this detection kit and its using method.
1. with Bemisia tabaciCYP4C64The conservative fragments district of gene is target sequence (sequence 3 in sequence table), and according to fluorescence quantification PCR primer design principle, the quantitative primer sequence of design specificity fluorescent is as follows:
Forward primer (qC64-F): 5 '-GCACACACCATGACCGTAGCAG-3 ' (sequence 1 in sequence table);
Reverse primer (qC64-R): 5 '-GGCTCTTCGTGACATCG-3 ' (sequence 2 in sequence table);
As shown in Figure 1, its specific amplification is as Fig. 2 (wherein, 1: to the cDNA sample of Diacloden sensitivity for this primer amplified fragment sequence; 2: the cDNA sample that Diacloden is produced to resistance; M:Marker I) shown in, this primer amplification specificity is high as can be seen from Figure, and amplified band is single, and size is 138bp, meets quantitative fluorescent PCR reaction requirement.
2. extract two population adult RNA samples, then reverse transcription is cDNA template, in the quantitative fluorescent PCR reaction system of Auele Specific Primer described in comprising step 1, reacts;
(1) extraction step of Bemisia tabaci adults RNA is as follows:
1. get each 30 of sensitivity, resistant population Bemisia tabaci adults, freezing for subsequent use in liquid nitrogen;
2. adult is put into glass homogenizer, and to the abundant homogenate of Trizol reagent that adds lml in homogenizer, after homogenate, liquid is poured in 1.5ml centrifuge tube, room temperature is placed 5min;
3. to the chloroform that adds 0.2ml in centrifuge tube, thermal agitation 15s, then room temperature is placed 3min;
4. under 4 DEG C of conditions 12, the centrifugal 15min of 000rpm;
5. draw supernatant and be transferred in a new centrifuge tube, add 0.5ml isopropyl alcohol, liquid in pipe is mixed gently, room temperature leaves standstill 10min;
6. under 4 DEG C of conditions 12, the centrifugal 10min of 000rpm;
7. abandon supernatant, then add the ethanol of lml75%, washing precipitation gently, 4 DEG C, the centrifugal 5min of 7500rpm, abandons supernatant;
8. RNA precipitation natural drying after, add the water-soluble solution of approximately 30 μ lDEPC, preserve on ice, survey OD260/OD280Value, electrophoresis detection band, selects qualified RNA sample to carry out following reverse transcription experiment or-80 DEG C and saves backup.
(2) the synthetic cDNA template of reverse transcription:
Remove genomic PrimeScript with Japanese TaKaRa company below?RT kit is example, and experimentation is as follows:
1. before using, each kit component is thawed and centrifugal mixing;
2. the removal of genomic DNA reaction:
3. reverse transcription reaction (carrying out on ice):
(3) foundation of quantitative fluorescent PCR calibration curve:
To sample cDNA carry out 5 gradient dilutions (extension rate is respectively 1 ×, 2 ×, 4 ×, 8 ×, 16 ×), then adopt the chimeric fluorescence method of SYBRGreen I to carry out quantitative fluorescent PCR:
1. quantitative fluorescent PCR reaction system 25 μ l are composed as follows:
＊ This product is the RealMasterMix of Tian Gen bio tech ltd, Beijing (SYBRGreen) reagent kit product.
2. quantitative fluorescent PCR reaction condition is:
94 DEG C of denaturation 6min, 94 DEG C of sex change 30sec, 60 DEG C of annealing 30sec, 72 DEG C are extended 35sec, 40 circulations. After PCR process completes, by 0.l DEG C of s-1Heating rate rise to 95 DEG C of analysis verifications that carry out melt curve analysis from 72 DEG C, detailed process is: 95 DEG C are carried out 15s, then 60 DEG C are carried out 1min, then 95 DEG C are carried out 15s, finally carry out 15s at 60 DEG C again.
The standard amplification curve finally obtaining as shown in Figure 3; Wherein, abscissa represents period, and ordinate represents the fluorescence signal intensity of the n time PCR circulation time, parallel and represent fluorescence threshold away from the straight line of abscissa in figure, 5 diluted concentrations of A, B, C, D, E letter representative sample cDNA.
The calibration curve finally obtaining as shown in Figure 4; Wherein, abscissa represents the logarithm value of standard sample cDNA concentration, and ordinate represents that cycle threshold is Ct value.
(4) quantitative fluorescent PCR course of reaction:
The system of quantitative fluorescent PCR course of reaction and condition are as described in step (3) above.
3. detect:
The present invention uses ABIPrism7500 quantitative real time PCR Instrument to detect.
4. interpretation of result:
When ABIPrism7500 quantitative real time PCR Instrument carries out interpretation of result, the fluorescence signal of 3-15 circulation is got in baseline setting. For ease of comparing, the threshold value of all amplification curves of sample (for examination Bemisia tabaci adults cDNA sample), negative control (to the negative control sample of Bemisia tabaci adults cDNA of Diacloden sensitivity) and positive control (Diacloden being produced to the positive control sample of Bemisia tabaci adults cDNA of resistance) is all set as 0.50 (be positioned at amplification curve logarithmic phase centre position, Other Instruments baseline and Threshold can be adjusted accordingly according to instrument).
Quantitative fluorescent PCR product in above-mentioned steps is carried out to fluorescent quantitation detection, as shown in Figure 5, under specific wavelength condition, according to the anti-quick sample room Ct value judged result of fluoroscopic examination, known two samples have produced typical amplification curve, and the Ct value of the sample of TH-S is 27.27 ± 0.18 (SE), the Ct value of the sample of TH-R is 23.08 ± 0.21 (SE), by analyzing, expression difference has between the two reached the utmost point level of signifiance, thus, resist the expression difference of quick this gene of sample room known by Diacloden, can clearly distinguish both, distinguishing so standard can initial setting be: Ct value≤24, illustrate that testing sample produces resistance to Diacloden, if Ct >=27 value, illustrates that testing sample is sensitive population, not yet Diacloden is produced to resistance, if Ct value is positioned in the middle of both, suggestion is reformed, and whether sample produces apparent weight to Diacloden resistance and do result and determine.
Embodiment 2
By the kit in other three Diacloden resistance Bemisia tabaci ZJ, TJ and BJ checking embodiment 1 and the availability of detection method, specific experiment process as described in Example 1.
Final quantitative fluorescent PCR reaction detection result as shown in Figure 6, wherein, A (TH-R): in embodiment 1, Diacloden is produced to the Bemisia tabaci TH-R adult cDNA positive control sample of resistance; B (TH-S): the Bemisia tabaci TH-S adult cDNA negative control sample to Diacloden sensitivity in embodiment 1; C (ZJ): be collected in the Bemisia tabaci field populations ZJ adult cDNA testing sample of Zhejiang area to Diacloden generation resistance; D (TJ): be collected in the Bemisia tabaci TJ adult cDNA testing sample of Efficiency in Buildings in Tianjin Area to Diacloden generation resistance; E (BJ): be collected in the Bemisia tabaci BJ adult cDNA testing sample of Beijing area to Diacloden generation resistance.
Under specific wavelength condition, according to the anti-quick sample room Ct value judged result of fluoroscopic examination, known two samples have produced typical amplification curve, and the Ct value of the sample of ZJ is 23.51 ± 0.19 (SE), the Ct value of the sample of TJ is 23.62 ± 0.24 (SE), the Ct value of the sample of BJ is 23.96 ± 0.14 (SE), by analyzing, with respect to TH-S negative control, both expressions are all to have reached the utmost point level of signifiance, be on close level with TH-R positive control, hence one can see that, this differentiation standard setting is reasonable, by this fluorescent quantificationally PCR detecting kit, can clearly distinguish Diacloden resistance and responsive Bemisia tabaci.
<110>Vegetable & Flower Inst., Chinese Academy of Agriculture Science
<120>fluorescent quantitative PCR detection method and the kit thereof of Bemisia tabaci to Diacloden resistance
<160>3
<210>1
<211>22
<212>DNA
<213>Bemisia tabaci (Diacloden)
<400>1
GCACACACCATGACCGTAGCAG22
<210>2
<211>17
<212>DNA
<213>Bemisia tabaci (Diacloden)
<400>2
GGCTCTTCGTGACATCG17
<210>3
<211>138
<212>DNA
<213>Bemisia tabaci (Diacloden)
<400>3
TCGGATTACGTCAGAGCTATTTACGATATCAGTGAGCTCACCCTCAAACGGTCCTTCCAACCATGGTTTTGGCCTGATTTAGTTTTCAATATGACTGACTACGGTAAACGTTATAGTGAATGTCTAAGCGTGCTCCAC
Claims (6)
- One kind for detection of Bemisia tabaci (Bemisiatabaci) specific PCR primer pair to Diacloden resistance, it is characterized in that: forward primer nucleotide sequence is as shown in SEQIDNo.1, and reverse primer nucleotide sequence is as shown in SEQIDNo.2.
- One kind for detection of Bemisia tabaci (Bemisiatabaci) PCR detection kit to Diacloden resistance, it is characterized in that: described kit comprises PCR primer pair claimed in claim 1.
- One kind for detection of Bemisia tabaci (Bemisiatabaci) PCR detection method to Diacloden resistance, comprise the following steps:(1) extract the RNA sample of Bemisia tabaci to be measured, and reverse transcription is cDNA template;(2) described cDNA template is joined contain in the right PCR reactant liquor of Auele Specific Primer claimed in claim 1 and obtain PCR reaction system;(3) carry out fluorescence quantitative PCR detection.
- 4. method according to claim 3, is characterized in that: the amplification program of described fluorescence quantitative PCR detection is: 94 DEG C of denaturation 5min, and 94 DEG C of sex change 30sec, 61 DEG C of annealing 40sec, 72 DEG C are extended 45sec, 40 circulations.
- 5. method according to claim 4, is characterized in that: if the sample of described Bemisia tabaci to be measured produces typical " S " type amplification curve and unimodal melt curve analysis, and Ct value≤24, illustrate that described Bemisia tabaci sample to be measured produces resistance to Diacloden; If Ct >=27 value, illustrates that the sample of Bemisia tabaci to be measured does not produce resistance to Diacloden.
- 6. according to the method described in claim 3-5 any one, it is characterized in that: the RNA sample that the RNA sample of described Bemisia tabaci to be measured is Bemisia tabaci adults.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410215726.7A CN104031991B (en) | 2014-05-21 | 2014-05-21 | Fluorescent quantitative PCR detection method and the kit thereof of Bemisia tabaci to Diacloden resistance |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410215726.7A CN104031991B (en) | 2014-05-21 | 2014-05-21 | Fluorescent quantitative PCR detection method and the kit thereof of Bemisia tabaci to Diacloden resistance |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104031991A CN104031991A (en) | 2014-09-10 |
| CN104031991B true CN104031991B (en) | 2016-05-25 |
Family
ID=51462985
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410215726.7A Expired - Fee Related CN104031991B (en) | 2014-05-21 | 2014-05-21 | Fluorescent quantitative PCR detection method and the kit thereof of Bemisia tabaci to Diacloden resistance |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104031991B (en) |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107043753B (en) * | 2017-02-27 | 2020-06-12 | 中国农业科学院蔬菜花卉研究所 | Bemisia tabaci thiamethoxam resistance gene CYP6DZ7 and promoter thereof |
| CN106867976A (en) * | 2017-02-27 | 2017-06-20 | 中国农业科学院蔬菜花卉研究所 | Bemisia tabaci Diacloden resistant gene CYP4C64 and its promoter |
| CN111206033B (en) * | 2018-11-22 | 2022-08-02 | 中国科学院苏州纳米技术与纳米仿生研究所 | Thiamethoxam aptamer and application thereof |
| CN110031623B (en) * | 2019-05-10 | 2021-10-15 | 南京农业大学 | Method for detecting drug resistance of bemisia tabaci by using BA-ELISA (BA-enzyme linked immunosorbent assay) |
| CN110564860B (en) * | 2019-06-18 | 2022-10-04 | 中国农业科学院蔬菜花卉研究所 | Mutant site of tobacco whitefly resistant gene to thiamethoxam |
-
2014
- 2014-05-21 CN CN201410215726.7A patent/CN104031991B/en not_active Expired - Fee Related
Non-Patent Citations (2)
| Title |
|---|
| 外来入侵生物B型烟粉虱对噻虫嗪的代谢抗性分子机制研究;刁永朝;《中国优秀硕士学位论文全文库》;20091215;第41页第3.1.2.3 * |
| 菜田几种昆虫细胞色素P450含量变化的研究;李如美;《中国优秀硕士学位论文全文数据库》;20091215;全文 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104031991A (en) | 2014-09-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104031991B (en) | Fluorescent quantitative PCR detection method and the kit thereof of Bemisia tabaci to Diacloden resistance | |
| Gayoso et al. | Assessment of real-time PCR as a method for determining the presence of Verticillium dahliae in different Solanaceae cultivars | |
| Wu et al. | Identification and characterization of Colletotrichum species associated with mango anthracnose in Taiwan | |
| CN101475995B (en) | Method for detecting areca-nut yellow leaf disease phytoplasma pathogen and special reagent kit therefor | |
| CN101643788B (en) | Detection primer of potato late blight bacterium molecules and use method thereof | |
| CN100427927C (en) | Green smut bug real-time fluorescent quantitative PCR test kit and its use | |
| CN104232782B (en) | A kind of detect tobacco soil-borne fungus pathogen PCR primer and application and method | |
| Amaradasa et al. | DNA fingerprinting and anastomosis grouping reveal similar genetic diversity in Rhizoctonia species infecting turfgrasses in the transition zone of USA | |
| CN104195253B (en) | Based on the diamondback moth of ABCC1 gene to the detection method of Bt Cry1Ac protein resistance and test kit thereof | |
| CN104962639A (en) | LAMP primer group and detection method for rapidly detecting corynespora cassiicola | |
| CN104232785B (en) | Oriental fruit moth fluorescent light PCR (Polymerase Chain Reaction) detection method and application | |
| Zhu et al. | Detection and quantification of Fusarium commune in host tissue and infested soil using real‐time PCR | |
| CN106755339A (en) | Cucumber anthracnose LAMP detection primer and its application | |
| CN106350598B (en) | For the PCR primer pair of Citrus Huanglongbing pathogen early warning, kit and method | |
| Hodson et al. | Real time PCR assays to detect and quantify the nematodes Pratylenchus vulnus and Mesocriconema xenoplax | |
| CN104178577A (en) | Method and kit for detecting resistance of plutella xylostella (L.) to insecticidal protein Cry1Ac generated by Bt (bacillus thuringiensis) based on ABCC2 (ATP-binding cassette C2) gene | |
| CN111850155A (en) | Application of specific target primer in simultaneous and rapid identification of two pathogenic bacteria of strawberry infection | |
| CN103088147A (en) | PCR (polymerase chain reaction) method and kit for simultaneously identifying specificities of Q-type bemisia tabaci and B-type bemisia tabaci | |
| Zhang et al. | Identification of a specific SCAR marker for detection of Tilletia foetida (Wall) Liro pathogen of wheat | |
| CN105200122A (en) | Quantitative detection kit for wheat stripe rust and application thereof | |
| CN113136442B (en) | Method and kit for detecting erwinia amylovora based on LFD-RPA technology and application of method and kit | |
| CN104388577A (en) | Loop-mediated isothermal amplification primer for detecting erwinia amylovory and kit | |
| CN103911457B (en) | The composition of qualification or assistant identification fall webworms and detection method thereof | |
| Amaradasa et al. | Development of SCAR markers and UP-PCR cross-hybridization method for specific detection of four major subgroups of Rhizoctonia from infected turfgrasses | |
| CN104531904B (en) | A kind of apple chlorotic leaf spot virus real-time fluorescence quantitative PCR detection method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB03 | Change of inventor or designer information |
Inventor after: Zhang Youjun Inventor after: Liu Yating Inventor after: Yang Xin Inventor after: Xie Wen Inventor after: Wang Bolin Inventor after: Wang Shaoli Inventor after: Wu Qingjun Inventor after: Li Rumei Inventor after: Yang Nina Inventor after: Guo Litao Inventor before: Zhang Youjun Inventor before: Yang Xin Inventor before: Xie Wen Inventor before: Wang Shaoli Inventor before: Wu Qingjun Inventor before: Li Rumei Inventor before: Yang Nina Inventor before: Guo Litao Inventor before: Liu Yating |
|
| COR | Change of bibliographic data | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20160525 Termination date: 20200521 |