CN110106242B

CN110106242B - Detection primer and detection method for chemical type of pathogenic toxin of fusarium graminearum root rot

Info

Publication number: CN110106242B
Application number: CN201910455771.2A
Authority: CN
Inventors: 王海光; 琚慧慧; 刘志龙; 阮柳; 孔前前
Original assignee: China Agricultural University
Current assignee: China Agricultural University
Priority date: 2019-05-29
Filing date: 2019-05-29
Publication date: 2020-10-02
Anticipated expiration: 2039-05-29
Also published as: CN110106242A

Abstract

The invention relates to the technical field of plant inspection and quarantine, in particular to a primer and a method for detecting the chemical type of pathogenic toxin of fusarium graminearum mycorrhizal rot of alfalfa. The invention provides a specific primer for detecting the chemical type of pathogenic toxin of fusarium graminearum mycorrhizal rot, and the sequence of the specific primer is shown in SEQ ID No. 1-6. The three pairs of specific primers can be used for accurately, quickly and conveniently detecting whether the fusarium graminearum root rot pathogen has the potential of generating trichothecene toxins, zearalenone and fumonisins, so that the accurate, specific and sensitive detection of the chemical type of the fusarium graminearum root rot pathogen toxin by using the conventional PCR technology is realized, the detection time and cost are effectively saved, and a simple, quick and accurate method is provided for the toxin-generating potential evaluation of fusarium separated from alfalfa or alfalfa products.

Description

Detection primer and detection method for chemical type of pathogenic toxin of fusarium graminearum root rot

Technical Field

The invention relates to the technical field of plant inspection and quarantine, in particular to a specific primer for detecting the chemical type of pathogenic toxin of fusarium graminearum mycorrhizal rot and a method for detecting the chemical type of pathogenic toxin of fusarium graminearum mycorrhizal rot by using the specific primer.

Background

Alfalfa (Medicago sativa) is the leguminous forage with the largest planting area in the world, is known as the king of forage, and has important economic and ecological values. In recent years, the growing area of Chinese alfalfa is gradually increased. With the increase of the planting area and the planting years of alfalfa, the alfalfa root rot becomes more and more serious. Alfalfa root rot can occur in each growing period of alfalfa, the symptoms of alfalfa root rot are mostly manifested as wilting and drooping of plant tissues, the whole plant is withered and yellow in severe cases and is easy to extract from soil, and the root system of alfalfa root rot plants is seriously atrophied compared with the normal root system. Alfalfa root rot can seriously reduce the yield and quality of alfalfa once running in a large area, and even needs to be planted again.

Fusarium is one of main pathogens causing alfalfa root rot, the Fusarium can generate toxins such as trichothecene toxins, zearalenone, fumonisin and the like, the generated toxins are one of causes of diseases, and meanwhile, the toxins can cause harm to nervous systems, digestive systems, reproductive systems and the like of people and livestock, can cause acute poisoning of people and livestock, and cause serious harm to the health of people and livestock. The types of toxins that can be produced by different Fusarium species vary, and Fusarium species can be classified into different toxin chemotypes. The detection of the chemical type of the fusarium toxin is carried out, which has important significance for understanding the toxin-producing potential of fusarium, further understanding the pathogenic mechanism of fusarium and taking precautionary measures in advance to prevent harm to human and livestock health.

Currently, the detection of the chemical type of fusarium toxin includes Thin Layer Chromatography (TLC), enzyme-linked immunosorbent assay (ELISA), High Performance Liquid Chromatography (HPLC), nuclear magnetic resonance spectroscopy (NMR), and the like. The TLC method is simple to operate and low in cost, but is harmful to human bodies, can only be used for qualitative detection under normal conditions, and cannot detect a large number of samples simultaneously; the ELISA detection does not need pretreatment, has high specificity and strong sensitivity, can quickly detect a large number of samples, needs simple equipment and is easy to popularize, but the method has the defects of false positive, single detection object, need of preparation and storage of antibodies and the like; the NMR method has the advantages of high efficiency, accuracy, quantification, capability of detecting a target compound without pretreatment and the like, but the resolution ratio is relatively low, and an instrument is expensive; HPLC has the advantages of high sensitivity, rapidness, accuracy, suitability for detection of trace samples and the like, can be used together with mass spectrometry to realize quantitative detection, is a detection method which is applied more at present, but the method mainly utilizes instruments which are only equipped in large laboratories such as a high performance liquid chromatograph, a mass spectrometer, a liquid-mass spectrometer and the like, the instruments are expensive and have higher requirements on operation of personnel, and the method also relates to complex processes such as fermentation, purification, pretreatment of samples and the like of toxins. Therefore, it is urgently needed to develop a method which depends on conventional laboratory instruments, is simple and convenient to operate, and has high detection speed and high sensitivity.

In recent years, research on pathways and regulation mechanisms related to production of fusarium toxin has been rapidly advanced, and Polymerase Chain Reaction (PCR) detection methods based on related toxin-producing genes are gradually used for detection of the chemical type of fusarium toxin. The method for detecting the toxin-producing gene by utilizing the PCR technology is relatively simple, and is fast in detection speed and relatively simple in operation, and only common instruments in laboratories such as a PCR instrument and an electrophoresis instrument are needed.

Previous studies on the analysis of the toxin-producing type of fusarium have focused on fusarium causing grain diseases, but few studies have been made on the chemical type of fusarium toxin causing alfalfa root rot, and fusarium can be classified into different specialization types, varieties and the like under the classification unit of species, thereby complicating the toxin-producing types of different fusarium. Therefore, the development of an accurate and sensitive PCR detection method for identifying the chemical type of pathogenic toxin of fusarium alfalfa root rot has important significance for analyzing the toxin-producing potential of fusarium and preventing and controlling the alfalfa root rot.

Disclosure of Invention

In order to solve the technical problems in the prior art, the invention aims to provide three pairs of specific primers for detecting the chemical type of the pathogenic toxin of fusarium graminearum, the three pairs of specific primers have high specificity, sensitivity and amplification efficiency, and the PCR detection method for identifying the chemical type of the pathogenic toxin of fusarium graminearum is further developed by utilizing the three pairs of specific primers.

In order to achieve the purpose, the technical scheme of the invention is as follows: the present invention determines that the synthesis of Trichothecene (TND) by cyclization of Tri5gene (encoding trichothecene synthetase, catalytic Farnesyl pyrophosphate) is the first step of synthesis of trichothecene (TCTs), Pks13 gene (essential gene for zearalenone (zenalonone, ZEN) synthesis) and Fum8 gene (encoding alpha-aminotransferase, essential gene for Fumonisin (FUM) synthesis) are detection targets by performing a great deal of analysis, comparison and screening on sequences and functions of toxin-producing metabolic pathways and toxin-producing related genes of fusarium in the prior art. Specific primers for detecting the chemical types of the pathogenic toxins of fusarium graminearum are respectively designed aiming at the Tri5gene, the Pks13 gene and the Fum8 gene, and three pairs of specific primers which have excellent amplification efficiency, high specificity and sensitivity and are respectively aiming at the three genes are obtained through screening. Based on the three pairs of specific primers, a PCR method for detecting the chemical type of pathogenic toxin of fusarium graminearum mycorrhizal rot of alfalfa is developed.

Specifically, the invention provides specific primers for detecting the chemical type of pathogenic toxin of fusarium graminearum, which comprise the following three pairs of specific primers:

SEQ ID NO.1：Tri5H1-F：AGTTGGGCCAAGGTTTCCAA；

SEQ ID NO.2：Tri5H1-R：AAGGAACTGCTTGCGCTCAT；

SEQ ID NO.3：ZEA13H1-F：AGTTGGAATACCCCGCTTGG；

SEQ ID NO.4：ZEA13H1-R：CCACGATCCAAGACCGTTGA；

SEQ ID NO.5：FUM8H1-F：TTGCATAGGGGTTGGTGCAA；

SEQ ID NO.6：FUM8H1-R：GGAACAATCCAGCAAGCGTC。

the kit comprises specific primers shown in SEQ ID NO. 1-6 and used for detecting the chemical type of pathogenic toxins of fusarium graminearum.

For ease of detection, the kit may also contain other reagents required for PCR detection.

Preferably, the kit comprises dNTP and Mg²⁺DNA polymerase, PCR reaction buffer solution, positive template, ddH₂One or more of O.

The dNTP and Mg²⁺The DNA polymerase, PCR reaction buffer can be packaged separately or mixed as a premix.

The invention also provides a specific primer for detecting the chemical type of the pathogenic toxin of fusarium graminearum mycorrhizal rot or any one of the following applications of a kit containing the specific primer, which is shown in SEQ ID No. 1-6:

(1) the application in detecting the chemical type of pathogenic toxin of fusarium graminearum root rot;

(2) the application of the strain in detecting the toxin-producing potential of fusarium medicaginosum;

(3) the application in plant pathogen inspection and quarantine or prevention and control of fusarium graminearum mycorrhizal rot.

The invention provides a method for detecting the chemical type of pathogenic toxins of fusarium graminearum mycorrhizal rot, which is to detect by using specific primers for detecting the chemical type of pathogenic toxins of fusarium graminearum mycorrhizal rot or a kit containing the specific primers, wherein the specific primers are shown in SEQ ID Nos. 1-6.

Specifically, the method for detecting the chemical type of the pathogenic toxin of fusarium graminearum root rot comprises the following steps:

(1) extracting the genome DNA of fusarium graminearum root rot pathogen to be detected;

(2) carrying out PCR amplification by using the genomic DNA as a template and using specific primers shown as SEQ ID NO. 1-6 or a kit containing the primers;

(3) judging the type of toxin-producing genes contained in the fusarium graminearum root rot pathogen according to the PCR amplification product, and determining the chemical type of the toxin of the fusarium graminearum root rot pathogen.

Preferably, in the step (2), the reaction procedure for PCR amplification includes: pre-denaturation at 95 ℃ for 2-5 min; denaturation at 94 ℃ for 20-30 s, annealing at 52-54 ℃ for 30s, extension at 72 ℃ for 30-60 s, and 30-35 cycles; extension at 72 ℃ for 10 min.

Further preferably, when a Tri5H1-F/Tri5H1-R primer pair is used, the reaction program of the PCR amplification comprises the following steps: pre-denaturation at 95 ℃ for 2 min; denaturation at 94 ℃ for 30s, annealing at 54 ℃ for 30s, and extension at 72 ℃ for 40s for 35 cycles; extension at 72 ℃ for 10 min.

When the primer pair ZEA13H1-F/ZEA13H1-R is adopted, the reaction program of the PCR amplification comprises the following steps: pre-denaturation at 95 ℃ for 2 min; denaturation at 94 ℃ for 30s, annealing at 54 ℃ for 30s, and extension at 72 ℃ for 30s for 35 cycles; extension at 72 ℃ for 10 min.

When the primer pair FUM8H1-F/FUM8H1-R is adopted, the reaction program of the PCR amplification comprises the following steps: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30s, annealing at 52 ℃ for 30s, extension at 72 ℃ for 1min, and 35 cycles; extension at 72 ℃ for 10 min.

preferably, in the step (2), the 25. mu.L reaction system for PCR amplification comprises 1. mu.L of each of the upstream and downstream primers at 10. mu. mol/L, 12.5. mu.L of the 2 XPCR reaction premix, and 100ng of the PCR amplification reaction systemmu.L genomic DNA 1. mu.L supplemented with ddH₂O to 25. mu.L.

Preferably, in the step (3), the determining the type of the toxin gene contained in the fusarium graminearum root rot pathogen according to the type of the PCR amplification product is determining whether the fusarium graminearum root rot pathogen contains a trichothecene Tri5gene, a zearalenone Pks13 gene, and a fumonisin Fum8 gene according to the band type of the electrophoresis band.

As a preferred technical scheme of the invention, the target fragments obtained by amplification by using a Tri5H1-F/Tri5H1-R, ZEA13H1-F/ZEA13H1-R, FUM8H1-F/FUM8H1-R primer pair are 448bp, 273bp and 742bp respectively, and whether the fusarium graminearum root rot pathogen has the potential of producing trichothecene toxins, zearalenone and fumonisin is determined according to the existence and the size of the target fragments by using an agarose gel electrophoresis technology.

The invention has the beneficial effects that:

the invention provides specific primers for detecting the chemical type of pathogenic toxins of fusarium graminearum root rot, in particular to three pairs of high-efficiency specific primers taking synthetic genes Tri5gene, Pks13 gene and Fum8 gene of trichothecene, zearalenone and fumonisin as targets, and the three pairs of specific primers can be used for accurately, quickly and conveniently detecting whether the pathogens of fusarium graminearum root rot have the potential of generating trichothecene toxins, zearalenone and fumonisin, so that the accurate (the PCR detection result is verified by using a high-efficiency liquid chromatograph and a liquid-mass spectrometer, and the detection results of the two are consistent), specific and sensitive (the sensitivity of the three pairs of primers to DNA detection respectively reaches 10 pg/mu L, 100 pg/mu L), 1 ng/. mu.L).

On the basis of the specific primers, the invention develops a PCR method for detecting the chemical type of pathogenic toxin of fusarium graminearum root rot, the method only needs common laboratory instruments such as a PCR instrument, an electrophoresis instrument and the like, has high detection speed and relatively simple operation, the method can be used for quickly and conveniently detecting the potential of trichothecene toxins, zearalenone and fumonisins generated by fusarium root rot pathogens of alfalfa, determining the chemical types of corresponding pathogenic toxins, greatly simplifying the detection method of the potential of the corresponding pathogens to generate the toxins, saving the detection time and cost, providing a simple, quick and accurate method for evaluating the toxin generating potential of fusarium separated from alfalfa or alfalfa products, providing technical support for guaranteeing the safety of alfalfa feeds, the health of human and livestock and the healthy development of the alfalfa industry, and having great economic and social benefits.

Drawings

FIG. 1 is an electrophoresis diagram of PCR amplification products obtained by using Tri5-F/R, ZEA13-F/R, FUM8-rp679/rp680 primers in example 1, wherein A is a PCR product electrophoresis diagram of a strain D27-1 as a template and a primer Tri5-F/R, M is a DNA marker, and lane 1 is a PCR product of a primer Tri 5-F/R; b is a PCR product electrophoretogram of a strain N6-1 as a template and a primer ZEA13-F/R, M is a DNA marker, and a lane 1 is a PCR product of a primer ZEA 13-F/R; c is the electrophoresis picture of the PCR product of the primer FUM8-rp679/rp680 with strain KLX2 as the template, M is DNAmarker, and lane 1 is the PCR product of the primers FUM8-rp679/rp 680.

FIG. 2 is an electrophoresis diagram of PCR products amplified by using Tri5H1-F/R primer pair in example 4 of the present invention, wherein M is DL2000marker, and lanes 1-10 are PCR products of strains S49-1, D1, D14-1, D16, D18, D21-1, N5-2, KL2, KL2-1, and N1-3, respectively.

FIG. 3 is an electrophoresis diagram of PCR products amplified by using a ZEA13H1-F/R primer pair in example 4 of the present invention, wherein M is DL2000marker, and lanes 1-10 are PCR products of strains N6-1, D25, D38, D23, N1-3, N4-1, N9-1, N11-1, N15-2, and QD11-1, respectively.

FIG. 4 is an electrophoresis diagram of PCR products amplified by FUM8H1-F/R primer pair in example 4 of the present invention, wherein M is DL2000marker, and lanes 1-10 are PCR products of strains KLX1, KLX2, S16, S33-1, S45, S47-1, S47-2, D26, S39-1, and KL5-3, respectively.

FIG. 5 is an electrophoresis diagram of PCR products amplified by different concentrations of the template Tri5H1-F/R primer pair in example 5 of the present invention, wherein M is DL2000marker, and lanes 1-8 are template concentrations of 100ng/μ L, 10ng/μ L, 1ng/μ L, 100pg/μ L, 10pg/μ L, 1pg/μ L, 0.1pg/μ L, and 0pg/μ L, respectively.

FIG. 6 is an electrophoresis diagram of PCR products amplified by different concentrations of the template ZEA13H1-F/R primer pair in example 5 of the present invention, wherein M is DL2000marker, and lanes 1-8 are template concentrations of 100ng/μ L, 10ng/μ L, 1ng/μ L, 100pg/μ L, 10pg/μ L, 1pg/μ L, 0.1pg/μ L, and 0pg/μ L, respectively.

FIG. 7 is an electrophoresis diagram of PCR products amplified by different concentrations of the FUM8H1-F/R primer pair as the template in example 5, wherein M is DL2000marker, and lanes 1-8 are respectively template concentrations of 100ng/μ L, 10ng/μ L, 1ng/μ L, 100pg/μ L, 10pg/μ L, 1pg/μ L, 0.1pg/μ L, and 0pg/μ L.

Detailed Description

Preferred embodiments of the present invention will be described in detail with reference to the following examples. It is to be understood that the following examples are given for illustrative purposes only and are not intended to limit the scope of the present invention. Various modifications and alterations of this invention will become apparent to those skilled in the art without departing from the spirit and scope of this invention.

The experimental procedures used in the following examples are all conventional procedures unless otherwise specified.

Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

EXAMPLE 1 screening of specific primers for detecting the chemical type of pathogenic toxin of Fusarium graminearum

1. Selection of strains for primer selection

At present, most of report genes for toxin production of fusarium are from fusarium of cereal crops in databases such as NCBI and the like, reports of Tri5, Pks13 and Fum8 of fusarium graminearum root rot pathogen are not seen, in order to ensure that finally obtained specific primers for detecting the chemical type of the fusarium graminearum root rot pathogen toxin have better universality, the invention firstly tries to screen primers suitable for detecting the toxin production genes of the fusarium graminearum root rot pathogen from primers for detecting the toxin production situation of the fusarium separated from cereals aiming at various fusarium graminearum root rot pathogens of different sources, but the screening result shows that the primers for detecting the toxin production situation of the fusarium separated from the cereals have no universality for detecting the toxin production situation of the fusarium graminearum root rot pathogen toxin.

224 fusarium graminearum separated and purified from collected alfalfa root rot plants in 2013-2018 (as shown in table 1, reference documents: ruan willow, mazhanhong, liu zhengyu, qin feng, wang haiguang, pathogen separation, identification and bactericide toxicity determination of alfalfa root rot in China university school newspaper, 2016,21(6): 56-67; before hole, qin feng, zhang, mahong, liu shilong, wang haiguang, pathogen pathogenicity and toxin chemical type determination of alfalfa root rot in China university of fusarium graminearum in China agriculture school newspaper, 2018,23(5): 74-85.); the last 38 fusarium is a pathogen separated and purified in 2018), 11 strains are selected for primer screening according to strains, collection places, collection years, disease indexes and the like, and the strain information is shown in table 2.

TABLE 1224 isolation and purification of Fusarium graminearum mycorrhizal rot pathogen strains

TABLE 2 information on Fusarium strains tested for primer screening

Strain numbering	Collection site	Year of collection	Species of the Strain
				KD3	Hebei province yellow Ye city south hong Kong three-division six-division factory	2015	Fusarium oxysporum
N19	Southern school district of the institute of North Hebei, China, Zhang Jiakou City, Hebei province	2015	Fusarium solani
				N1-2	Southern school district of the institute of North Hebei, China, Zhang Jiakou City, Hebei province	2015	Fusarium redolens
N6-1	Southern school district of the institute of North Hebei, China, Zhang Jiakou City, Hebei province	2015	Fusarium equiseti
				KLX1	Hebei province yellow Ye city south hong Kong three-division six-division factory	2015	Fusarium commune
KLX2	Hebei province yellow Ye city south hong Kong three-division six-division factory	2015	Fusarium proliferatum
				S49-1	Radix Anisodi Acutanguli of Hebei province, yellow Ye City, south Dagang	2014	Fusarium incarnatum
QD3-2	Radix Anisodi Acutanguli of Hebei province, yellow Ye City, south Dagang	2015	Fusarium oxysporum
				N9-2	Southern school district of the institute of North Hebei, China, Zhang Jiakou City, Hebei province	2015	Fusarium acuminatum
B3-5-1	Southern school district of the institute of North Hebei, China, Zhang Jiakou City, Hebei province	2016	Fusarium tricinctum
				D27-1	Yangrong Zhendong village of Yangduang, Shang Ye, Huang, Hebei province	2014	Fusarium equiseti

2. Extraction of genome DNA of fusarium alfalfa mycorrhizal rot pathogen

The 11 isolated and purified strains in Table 2 were subjected to activation culture, fresh hyphae at the edges of the colonies were punched out with a 6 mm-diameter sterile punch, inoculated on Potato Dextrose Agar (PDA) plates (90 mm in diameter), and cultured in a 25 ℃ mold incubator for 5 days. A modified CTAB method (Guo L.D., Hyde K.D., LiewE.C.Y.identification of endo-fungal from Livistona chinensis based on immobilized affinity and rDNA sequences. New Phytologist,2000,147(3): 617-630) is adopted to extract genome DNA of fusarium graminearum root rot pathogen, and the specific steps are as follows:

(1) scraping fresh mycelium at the edge of the strain cultured for 5 days by using a sterilized toothpick, putting the fresh mycelium into a 2.0mL shaking tube filled with 0.4g of quartz sand, adding 1mL of CTAB extracting solution at 65 ℃, and shaking for 2 times on a vortex shaking instrument, wherein each time is 6m/s and 40 s.

(2) Water bath at 65 deg.C for 30min, and mixing by gently inverting for 2-3 times to ensure full lysis.

(3) Centrifuging at 12000rpm for 10min, collecting supernatant, adding equal volume of chloroform/isoamyl alcohol (24:1) into a new 2.0mL sterile centrifuge tube, turning upside down, mixing, and centrifuging at 12000rpm for 10 min.

(4) The supernatant was pipetted into a fresh 2.0mL sterile centrifuge tube, an equal volume of chloroform/isoamyl alcohol (24:1) was added, and after mixing by inversion, centrifugation was carried out at 12000rpm for 10min (this step was repeated until no protein appeared between the aqueous and organic phases).

(5) And (3) sucking the supernatant into a new 1.5mL sterile centrifuge tube, adding isopropanol with the volume of 2/3 of that of the supernatant, slightly inverting and uniformly mixing, and allowing white fibrous precipitates to appear, and standing at-20 ℃ for 4 hours.

(6) Centrifuging at 12000rpm for 10min, discarding supernatant, washing precipitate with 70% ethanol and anhydrous ethanol, and centrifuging at 10000rpm for 5 min.

(7) And (4) performing instantaneous centrifugation, sucking away excess liquid by using a gun head, opening a cover of a centrifuge tube, and drying in an oven at 37 ℃ for 10min until DNA precipitates are semitransparent.

(8) Adding 50-100 μ L ddH₂O dissolves the DNA precipitate, and the DNA1h is dissolved by digestion in a water bath at 37 ℃.

3. Obtaining of toxin related gene Tri5, Pks13 and Fum8 gene fragment

By consulting domestic and foreign related documents, primers for detecting fusarium toxigenic related genes are searched and obtained, PCR amplification is carried out by taking 11 strain genome DNAs extracted from the step 2 as templates, and primers capable of amplifying Tri5, Pks13 and Fum8 gene fragments are screened. The PCR amplification is carried out by using a method reported in a literature, an amplification product is subjected to agarose gel electrophoresis detection, if a target band does not exist, a PCR system and a program are improved, the PCR amplification is carried out again and the agarose gel electrophoresis detection is carried out, and when the target band does not exist after the multiple improvements, the primer is considered not to be capable of amplifying the target band. The product of the single clear target strip is sent to Beijing Optimus Hippocrate Biotechnology Limited for sequencing. After many attempts, 1 pair of primers of the Tri5, Pks13 and Fum8 genes which can relatively stably amplify target bands are finally obtained, and the sequences of the primers are shown in table 3.

Table 3 shows that the primers obtained by screening can amplify target bands of toxin-associated genes Tri5, Pks13 and Fum8

The references are respectively:

Nicholson,P.,Simpson,D.R.,Wilson,A.H.,Chandler,E.,Thomsett,M.Detection and differentiation of trichothecene and enniatin-producingFusarium species on small-grain cereals.European Journal of Plant Pathology,2004,110(5-6):503～514.

Priyanka,S.R.,Venkataramana,M.,Balakrishna,K.,Murali,H.S.,Batra,H.V.Development and evaluation of a multiplex PCR assay for simultaneousdetection of major mycotoxigenic fungi from cereals.Journal of Food Scienceand Technology,2015,52(1):486～492.

Zhang,L.P.,Wang,J.S.,Zhang,C.L.,Wang,Q.M.Analysis of potentialfumonisin-producing Fusarium species in corn products from three main maize-producing areas in eastern China.Journal of the Science of Food andAgriculture,2013,93(3):693～701.

BLAST alignment analysis was performed on the sequencing result (shown as SEQ ID NO. 13) with the existing sequence in the NCBI's nucleic acid sequence database using the genomic DNA of the strain D27-1 as a template and Tri5-F/R as a primer, and the results showed that the sequence homology of the strain D27-1 with the sequence annotated as Fusarium sp.FIESC _29Tri5gene for trichodiene synthase, strain ITEM10392(GenBank accession number: LN995586.1) was the highest, and the Ident value was 99%. The genomic DNA of the strain N6-1 is taken as a template, ZEA13-F/R is taken as a primer, and the sequencing result (shown as SEQ ID NO. 14) is subjected to BLAST comparison analysis with the existing sequence in a nucleic acid sequence database of NCBI, so that the result shows that the sequencing result of the strain N6-1 is compared with the sequence annotated as Gibberellazeae PKS gene cluster, complete sequence; the sequence homology of the and polyketide synthsase (PKS13) (GenBank accession number: DQ019316.1) is the highest, and the Ident value is 90 percent; n6-1 has higher sequence homology with Fusarium pseudoramium CS3096 PKS13(PKS13) (GenBank accession number: XM _009259982.1), and Ident value is 89%; BLAST alignment analysis was performed on the sequencing result (shown in SEQ ID NO. 15) and the existing sequence in the NCBI's nucleic acid sequence database using the genomic DNA of strain KLX2 as a template and FUM8-rp679/rp680 as primers, and the results showed that the sequence homology of strain KLX2 was the highest with the gene (GenBank accession No.: KF415157.1) annotated as Fusarium fujikukukukukukuroi strain HKM 41 fumonisin biosynthetic alpha-oxyamine synthase (FUM8), and the Ident value was 100%.

4. Design and screening of specific primers for detecting chemical type of pathogenic toxin of fusarium graminearum

A large number of amplification experiments show that the Tri5-F/R, ZEA13-F/R, FUM8-rp679/rp680 primer has poor stability, a target band cannot be amplified every time under the same conditions, namely, the repeatability is poor, the definition of the band is poor, and the requirements of chemical type detection of the pathogenic toxin of fusarium graminearum root rot on the primer and PCR amplification cannot be met, and the electrophoresis chart of the Tri5-F/R, ZEA13-F/R, FUM8-rp679/rp680 primer used for PCR amplification of the strains D27-1, N6-1 and KLX2 is shown in FIG. 1.

In order to enable the detection of the chemical type of the pathogenic toxin of fusarium graminearum root rot of alfalfa to have higher specificity, sensitivity and accuracy, the invention designs specific primers for amplifying and detecting the Tri5gene, Pks13 gene and Fum8 gene respectively according to the sequences of the trichothecene trie 5gene fragment, the zearalenone Pks13 gene fragment and the fumonisin Fum8 gene fragment amplified by the primers in the table 3.

According to the invention, a large number of screening and comparison experiments show that good Tri5, Pks13 and Fum8 gene detection effects can be realized as long as the primers meet the common primer design principle or are designed by adopting primer design software. On the basis of meeting the general design principle, the invention carries out a large amount of artificial optimization design and screening aiming at the binding force between primers and a target sequence, the structure between the primers or between the primers and the target sequence, GC content, Tm value, primer length, amplified fragment length and the like, and finally obtains three pairs of specific primers with excellent performances in all aspects as shown in Table 4.

TABLE 4 specific primers for detecting the chemical type of pathogenic toxins of Fusarium graminearum

Example 2 determination of PCR amplification reaction conditions for detection of the chemical type of pathogenic toxin of Fusarium graminearum

In order to realize rapid and efficient target band amplification and detection, PCR amplification reaction conditions of a specific primer pair Tri5H1-F/R, ZEA13H1-F/R, FUM8H1-F/R are optimized and screened respectively, and the optimal annealing temperature and the shortest extension time are found out for three pairs of specific primers obtained by screening in the embodiment 1 through a large amount of search and practice, so that the amplification process is quicker, and the bands of the amplification result are clearer.

The PCR reaction conditions finally determined by the screening were as follows:

the PCR amplification system of trichothecene Tri5H1-F/R adopts a 25 muL Mix reaction system, and comprises the following specific steps: mu.L of each primer (10. mu. mol/L), Mix 12.5. mu.L, 1. mu.L of DNA template (100 ng/. mu.L), complement ddH₂O to a final volume of 25. mu.L.

The PCR amplification program of trichothecene Tri5H1-F/R is as follows: pre-denaturation at 95 ℃ for 2 min; denaturation at 94 ℃ for 30s, annealing at 54 ℃ for 30s, and extension at 72 ℃ for 40s for 35 cycles; extending for 10min at 72 ℃; storing at 4 ℃.

The PCR amplification system of zearalenone ZEA13H1-F/R adopts a 25 mu L Mix reaction system, and comprises the following specific steps: mu.L of each primer (10. mu. mol/L), Mix 12.5. mu.L, 1. mu.L of DNA template (100 ng/. mu.L), complement ddH₂O to a final volume of 25. mu.L.

The PCR amplification program of zearalenone ZEA13H1-F/R is as follows: pre-denaturation at 95 ℃ for 2 min; denaturation at 94 ℃ for 30s, annealing at 54 ℃ for 30s, and extension at 72 ℃ for 30s for 35 cycles; extending for 10min at 72 ℃; storing at 4 ℃.

The PCR amplification system of fumonisin FUM8H1-F/R adopts a 25 mu L Mix reaction system, and comprises the following specific steps: mu.L of each primer (10. mu. mol/L), Mix 12.5. mu.L, 1. mu.L of DNA template (100 ng/. mu.L), complement ddH₂O to a final volume of 25. mu.L.

The PCR amplification program of fumonisin FUM8H1-F/R is as follows: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30s, annealing at 52 ℃ for 30s, extension at 72 ℃ for 1min, and 35 cycles; extending for 10min at 72 ℃; storing at 4 ℃.

Example 3 establishment of PCR detection method for chemical type of pathogenic toxin of Fusarium graminearum

This example provides a method for PCR detection of the chemical type of pathogenic toxin of Fusarium graminearum according to the specific primers determined by the screening in example 1 and the PCR reaction conditions determined by the screening in example 2, as follows:

(1) extracting the genome DNA of fusarium to be detected;

(2) PCR amplification is carried out by taking the extracted fusarium genome DNA as a template and Tri5H1-F/R (SEQ ID NO.1-2), ZEA13-H1F/R (SEQ ID NO.3-4) and FUM8H1-F/R (SEQ ID NO.5-6) as primers respectively:

the PCR amplification system of trichothecene Tri5H1-F/R adopts a 25 muL Mix reaction system, and comprises the following specific steps: mu.L of each primer (10. mu. mol/L), Mix 12.5. mu.L, 1. mu.L of DNA template (100 ng/. mu.L), complement ddH₂O to a final volume of 25. mu.L. The PCR amplification procedure was as follows: pre-denaturation at 95 ℃ for 2 min; denaturation at 94 ℃ for 30s, annealing at 54 ℃ for 30s, and extension at 72 ℃ for 40s for 35 cycles; extending for 10min at 72 ℃; storing at 4 ℃.

The PCR amplification system of zearalenone ZEA13H1-F/R adopts a 25 mu L Mix reaction system, and comprises the following specific steps: mu.L of each primer (10. mu. mol/L), Mix 12.5. mu.L, 1. mu.L of DNA template (100 ng/. mu.L), complement ddH₂O to a final volume of 25. mu.L. The PCR amplification procedure was: pre-denaturation at 95 ℃ for 2 min; denaturation at 94 ℃ for 30s, annealing at 54 ℃ for 30s, and extension at 72 ℃ for 30s for 35 cycles; extending for 10min at 72 ℃; storing at 4 ℃.

The PCR amplification system of fumonisin FUM8H1-F/R adopts a 25 mu L Mix reaction system, and comprises the following specific steps: mu.L of each primer (10. mu. mol/L), Mix 12.5. mu.L, 1. mu.L of DNA template (100 ng/. mu.L), complement ddH₂O to a final volume of 25. mu.L. The PCR amplification procedure was: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30s, annealing at 52 ℃ for 30s, extension at 72 ℃ for 1min, and 35 cycles; extending for 10min at 72 ℃; storing at 4 ℃.

(3) And (3) sampling 5 mu L of PCR products for electrophoresis, putting the gel into EB solution for dyeing for 9min after the electrophoresis is finished, taking a picture under an ultraviolet gel imaging system after the gel is washed by distilled water, and checking whether a DNA strip which conforms to the size of a target strip exists or not so as to determine whether the gel has the related genes and the capability of producing related toxins.

Example 4 application of PCR detection method for chemical type of pathogenic toxin of Fusarium graminearum

The 224 fusarium graminearum (table 1) separated and purified from the collected alfalfa root rot plants in 2013-2018 of the laboratory are extracted with genome DNA, and the detection method provided in example 3 is adopted to detect the chemical type of the pathogenic toxin of the alfalfa root rot.

As a result, 102 of 224 Fusarium strains contained the target band of the toxigenic gene Tri5, and the fragment size was 448bp (partial detection results are shown in FIG. 2). Among the strains containing the target band, Fusarium equiseti (F.equiseti)93, Fusarium oxysporum (F.oxysporum)4, Fusarium solani (F.solani)2, Fusarium tricinctum (F.tricinctum)1, Fusarium solani (F.proliferum) 1, and Fusarium erythropolis (F.incarnatum)1 were selected.

Among the 224 Fusarium strains, 33 strains contained the target band of the toxigenic gene Pks13, and the fragment size was 273bp (partial detection results are shown in FIG. 3). Among the strains containing the band of interest, Fusarium equiseti (F.equiseti)29 strain, Fusarium oxysporum (F.oxysporum)2 strain, Fusarium solani (F.solani)1 strain, and Fusarium tricinctum (F.tricinctum)1 strain were selected.

11 of the 224 Fusarium strains contained the target band of the toxigenic gene Fum8, with a fragment size of 742bp (partial detection results are shown in FIG. 4). Among the strains containing the band of interest, Fusarium equiseti (F.equiseti)1 strain, Fusarium oxysporum (F.oxysporum)1 strain, Fusarium stratiforme (F.proliferum) 6 strain, Fusarium rubrum (F.incarnatum)1 strain, Fusarium aromaticum (F.redox) 1 strain, and F.commune1 strain were selected.

The sequence of a Tri5gene fragment obtained by amplification of a Tri5H1-F/R primer is shown as SEQ ID NO.16 by taking a D27-1 strain as a template, the sequence of a Pks13 gene fragment obtained by amplification of a ZEA13H1-F/R primer is shown as SEQ ID NO.17 by taking an N6-1 strain as a template, and the sequence of the Fum8 gene fragment obtained by amplification of a FUM8H1-F/R primer is shown as SEQ ID NO.18 by taking an KLX1 strain as a template.

Example 5 analysis of the accuracy of the PCR detection method for the chemical type of pathogenic toxins from Fusarium graminearum

According to the detection result of the PCR method in the

embodiment

4, 3 Fusarium strains with positive trichothecene toxins, zearalenone and fumonisin genes and large disease indexes are respectively selected, and the detection accuracy of the PCR method is verified by a liquid phase-mass spectrometry detection method. Strain information is shown in table 5:

TABLE 5 Fusarium used to verify the accuracy of the PCR detection method

1. Detection of trichothecene toxin produced by strain QZ3(F. oxysporum)

The formula of the trichothecene toxin seed culture medium is as follows: per 1000mL of solution: 10g of cane sugar, 2g of ammonium nitrate, 0.5g of magnesium sulfate, 0.2g of ferric sulfate, 2g of monopotassium phosphate, 4g of peptone, 2g of yeast extract and distilled water, wherein the volume is determined to be 1000mL, and the mixture is sterilized at 121 ℃ for 30min under high pressure for later use.

The formula of the trichothecene toxin fermentation culture solution is as follows: per 1000mL of solution: 1g of ammonium nitrate, 3g of monopotassium phosphate, 0.5g of magnesium sulfate, 4g of sodium chloride, 20g of cane sugar, 10mL of glycerin and 0.02g of zinc sulfate, adding distilled water to a constant volume of 1000mL, and carrying out autoclaving at 121 ℃ for 30min for later use.

Inoculating strain QZ3 to PDA culture medium for activation, after the strain grows for 5d, inoculating 2 fungus cakes with diameter of 6mm to a triangular flask containing 250mL trichothecene toxin seed culture solution, and culturing the culture solution on a shaker at the rotation speed of 140rpm and the temperature of 28 ℃. And 3d, inoculating the trichothecene toxin seed culture solution to the trichothecene toxin fermentation culture solution on a superclean bench, inoculating 50mL of trichothecene toxin seed culture solution to each 1000mL of triangular flask, putting the trichothecene toxin fermentation culture solution into a shaking table with the rotating speed of 140rpm and the temperature of 28 ℃ for fermentation culture, and extracting the toxin after 15-20 d. And (3) uniformly shaking the fermented culture medium, and performing suction filtration by using a Buchner funnel to obtain the liquid crude toxin. Adding ethyl acetate and liquid crude toxin into a separating funnel respectively, shaking up and down uniformly, and discharging the lower-layer water phase after the crude toxin is completely extracted. And (3) carrying out rotary evaporation on the ethyl acetate part to obtain a crude extract of the trichothecene toxin.

Preparing a standard substance: dissolving standard substance (1mg) in 1mL of chromatographic grade methanol, collecting 500 μ L of organic filter membrane with pore diameter of 0.22 μm, and subjecting to ultrasonic treatment in ultrasonic cleaner for 10min to remove bubbles and promote dissolution. Sample preparation was performed in the same manner as the standard, and QZ3 crude toxin was dissolved in 0.22 μm organic filter membrane in chromatographic grade methanol, and the membrane was sonicated in a sonicator for 10min to expel air bubbles and facilitate dissolution. Preparation of a mobile phase: passing the chromatographic grade methanol and water through a filter membrane with the diameter of 50mm and the pore diameter of 0.2 mu m, and removing bubbles by ultrasonic treatment for 30 min. Chromatographic conditions are as follows: the chromatographic column is Agilent ZORBAX SB-C184.6X 150mm 5-Micron, the detection wavelength is 218nm, the mobile phase methanol-water (20:80, v/v), the column temperature: 40 ℃, flow rate: 1.0mL/min, and the sample size is 20. mu.L.

Through optimization, when the mobile phase is mobile phase methanol-water (20:80, v/v), the toxin peak-emergence time and peak type are better, under the condition, the peak-emergence retention time of the trichothecene toxin standard product is 5.020min, and the sample has obvious peak emergence at 5.396min, which indicates that the crude toxin of the strain QZ3 contains trichothecene toxin.

2. Detection of zearalenone produced by strain B1-12-3(F.equiseti)

The formula of the zearalenone fermentation culture solution is as follows: 60g of glucose, 20g of peptone, 1.0g of yeast extract, 6.0g of sodium nitrate, 1.0g of dipotassium phosphate, 1.5g of potassium nitrate, 0.5g of potassium chloride, 0.5g of magnesium sulfate and 0.025g of ferric sulfate, adding distilled water to a constant volume of 1000mL, and carrying out autoclaving at 121 ℃ for 30min for later use.

Inoculating the strain B1-12-3 to a PDA culture medium for activation, inoculating 4 bacterial cakes with the diameter of 6mm after the strains grow for 5 days, inoculating the bacterial cakes to a 1000mL triangular flask, performing shake culture in a shaking table at the rotating speed of 92rpm and the temperature of 22.9 ℃, and extracting toxins after 15-20 days. And (3) uniformly shaking the fermented culture medium, and performing suction filtration by using a Buchner funnel to obtain the liquid crude toxin. Adding ethyl acetate and liquid crude toxin into a separating funnel respectively, shaking up and down uniformly, and discharging the lower-layer water phase after the crude toxin is completely extracted. And (3) carrying out rotary evaporation on the ethyl acetate part to obtain a crude extract of the zearalenone.

Preparing a standard substance: dissolving all zearalenone standard (1mg) completely in 1mL chromatographic grade methanol, collecting 500 μ L organic filter membrane with pore diameter of 0.22 μm, placing in ultrasonic cleaner, and subjecting to ultrasonic treatment for 10min to remove air bubbles and promote dissolution. Sample preparation the same standard, dissolving B1-12-3 crude toxin in 0.22 μm organic filter membrane in chromatographic grade methanol, placing in ultrasonic cleaner for 10min, discharging bubbles, and promoting dissolution. Preparation of a mobile phase: passing the chromatographic grade methanol and water through a filter membrane with the diameter of 50mm and the pore diameter of 0.2 mu m, and removing bubbles by ultrasonic treatment for 30 min. Chromatographic conditions are as follows: the chromatographic column is Agilent ZORBAX SB-C184.6 multiplied by 150mm 5-Micron, the detection wavelength is 236nm, and the mobile phase is methanol-water (60:40, v/v); the column temperature was 40 ℃, the flow rate was 1.0mL/min, and the sample size was 20. mu.L. Through optimization, when the mobile phase is methanol-water (60:40, v/v), the toxin peak-emergence time and the peak type are better, under the condition, the peak-emergence retention time of the zearalenone standard product is 5.020min, and the sample B1-12-3 has an obvious peak-emergence time at 5.396min, which shows that the crude toxin of the strain B1-12-3 contains zearalenone toxin.

3. Fumonisin B produced by strain KLX2(F. proliferatum)₁Detection of (2)

The formula of the fumonisin fermentation medium is as follows: 160g of corn is taken and added into a 1000mL triangular flask, equal volume of distilled water is added, and the mixture is autoclaved at 121 ℃ for 30min for standby.

Inoculating KLX2 strain to PDA culture medium for activation, and preparing into 10 strain after the strain grows over the whole culture dish⁷Spore suspension per mL. The spore suspension was inoculated into fumonisin fermentation medium, 8mL each flask. Culturing at 25 deg.C for 2 weeks, and culturing at 15 deg.C for 2 weeks to extract toxin. Stirring the culture medium uniformly by using a glass rod, adding ethyl acetate to a constant volume of 1000mL, putting the mixture into an ultrasonic cleaner for ultrasonic treatment for 30min, filtering the mixture by using four layers of gauze, evaporating the filtrate by using a rotary evaporator, and dissolving the filtrate by using ethyl acetate for later use to obtain crude toxin A. The filter residue is put into a basin for airing, and then is extracted three times by methanol-water (3:1, v/v) according to the method to obtain crude toxin B.

Preparing a standard substance: dissolving fumonisin standard (1mg) in 1mL chromatographic grade methanol, collecting 500 μ L organic filter membrane with pore diameter of 0.22 μm, placing in ultrasonic cleaner, and ultrasonic treating for 10min to remove air bubbles and promote growthsample preparation same standard, dissolving KLX2 crude toxin B in chromatographic grade methanol with 0.22 μm organic filter membrane, placing in ultrasonic cleaner for 10min, discharging air bubble, promoting dissolution, preparing mobile phase, passing chromatographic grade methanol and water through filter membrane with diameter of 50mm and aperture of 0.2 μm, ultrasonic removing air bubble for 30min, chromatographic condition, column is Zorbax Eclipse XDB-C18 column 150mm × 2.1mm, 3.5mm, mobile phase is methanol-water-formic acid (55:45:2, V/V/V), column temperature is 30 ℃, flow rate is 0.2mL/min, sample feeding is 10 μ L, mass spectrum condition, quadrupole time of flight mass spectrometer (Q-TOF) is equipped with electrospray ion source, positive ion mode detection, voltage is 150V, collision energy is 40, peak time is 52, peak time of methanol-water-acetic acid is 45: 55V/V, and peak time of horse water-acetic acid is 52, when the peak time of flow is equal to that of horse acetic acid, the sample is dissolved in chromatographic grade methanol, the sample is dissolved in the same standard, sample preparation, and the sample preparation is dissolved in chromatographic grade methanol with flow of 0.5 μm, and the sample preparation, and the sample is prepared by electrospray ionization ion ionization (ionization ion ionization, and the sample preparation, and the₁The peak retention time of the standard is 3.589min, while the sample KLX2 has obvious peak at 3.835min, and the mass spectrogram shows that the peak retention time is M-H]^–The M/z of the ion peak is 722.3922, [ M-H ] of the standard]^–The ion peak was 722.3957, both of which were substantially identical and were substantially identical to those reported in the literature (Li, C., Wu, Y.L., Yang, T., Huang-Fu, W.G. Rapid determination of fumonisins B)₁andB₂in corn by liquid chromatography-chromatography mass spectrometry with ultrasoundness in journal of chromatography Science,2012,50(1): 57-63), indicating that the crude toxin of strain KLX2 contains fumonisin B₁。

Example 6 determination of sensitivity of the chemical type of toxin of Fusarium graminearum root rot pathogen

After DNA concentrations were measured by extracting DNAs of strains QZ3, B1-12-3, KLX2 by the modified CTAB method in example 1, the template DNAs were diluted with ultrapure water to 100ng/μ L, 10ng/μ L, 1ng/μ L, 100pg/μ L, 10pg/μ L, 1pg/μ L, and 0.1pg/μ L by a 10-fold dilution method, and three pairs of primers Tri5H1-F/R (SEQ ID NO: 1-2), ZEA13-H1F/R (SEQ ID NO: 3-4), and FUM8H1-F/R (SEQ ID NO: 5-6) were tested for sensitivity using the above-concentrated DNAs as templates, respectively, while setting negative controls. The PCR reaction system and the reaction procedure were the same as in example 3. The above experiment was performed in triplicate. And sampling 6 mu L of PCR product for electrophoresis detection, carrying out voltage 120V and current 150mA, carrying out electrophoresis time for 30min, after electrophoresis is finished, putting the gel into EB solution for dyeing for 9min, washing with distilled water, and taking a picture under an ultraviolet gel imaging system to observe whether each lane has a strip.

The results showed that the sensitivity of the primer pair Tri5H1-F/R was 10 pg/. mu.L (as shown in FIG. 5), and fragments of the Tri5gene in Fusarium equiseti (F.equiseti), Fusarium oxysporum (F.oxysporum), Fusarium solani (F.solani), Fusarium tricinctum (F.tricinctum), Fusarium exserosum (F.proliferatum), and Fusarium erythraeum (F.incarnatum) could be detected; the sensitivity of the primer pair ZEA13-H1F/R is 100 pg/mu L (shown in figure 6), and the primer pair ZEA13-H1F/R can detect the Pks13 gene fragment in fusarium equiseti (F.equiseti), fusarium oxysporum (F.oxysporum), fusarium solani (F.solani) and fusarium tricuspidatum (F.tricinctum); the sensitivity of the primer pair FUM8H1-F/R is 1 ng/. mu.L (shown in FIG. 7), and the primer pair FUM8H1-F/R can detect a fragment of Fum8 genes in Fusarium equiseti (F.equiseti), Fusarium oxysporum (F.oxysporum), Fusarium straticola (F.proliferatum), Fusarium rubrum (F.incarnatum), Fusarium aromaticum (F.redox) and F.commune.

Although the invention has been described in detail hereinabove with respect to a general description and specific embodiments thereof, it will be apparent to those skilled in the art that modifications or improvements may be made thereto based on the invention. Accordingly, such modifications and improvements are intended to be within the scope of the invention as claimed.

Sequence listing

<110> university of agriculture in China

<120> detection primer and detection method for chemical type of pathogenic toxin of fusarium graminearum mycorrhizal rot of alfalfa

<130>KHP191112623.6

<160>18

<170>SIPOSequenceListing 1.0

<210>1

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>1

agttgggcca aggtttccaa 20

<210>2

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>2

aaggaactgc ttgcgctcat 20

<210>3

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

agttggaata ccccgcttgg 20

<210>4

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>4

ccacgatcca agaccgttga 20

<210>5

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>5

ttgcataggg gttggtgcaa 20

<210>6

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>6

ggaacaatcc agcaagcgtc 20

<210>7

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>7

agcgactaca ggcttccctc 20

<210>8

<211>22

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>8

aaaccatcca gttctccatc tg 22

<210>9

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>9

cattcttggt cttgtgagga 20

<210>10

<211>19

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>10

ccttatgctc atcgacatg 19

<210>11

<211>22

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>11

cgtagtagga atgagaagga tg 22

<210>12

<211>22

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>12

gcaagctttg tggctgattg tc22

<210>13

<211>545

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>13

ttagcgacta acaggcttcc ctccagacaa tcgtaggcat ggttgtktac agttgggcca 60

aggtttccaa agagctcatg gcagatctat caatccacta cacctatacc ctcgttctgg 120

acgatagcaa ggacgatcct catcccacta tggagaacta cttcaatgat ctgcatgctg 180

gaagggagca agctcatcct tggtggagac tcgtcaacga acacttccca aatgttctcc 240

gacatttcgg tcctttttgt tcgttgaatt tgatccgcag cacccttgac tgtgagtatt 300

tgatccatgc tatttatata aacaagctaa acctaatttt gtagtttttg agggatgctg 360

gattgaacag tacaactttg ggggataccc cggatctcat gattaccccg gcttccttcg 420

gcgcatgaat ggtcttggcc attgcgttgg tgcttcgttg tggcccaagg ctcagtttga 480

tgagcgcaag cagttccttg agatcacatc atccattgcc cagatggaga atgggaatgg 540

tttaa 545

<210>14

<211>381

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>14

ttctcattct tggtcttgtg aggaagaccc caagcaactg gaccaagttc ggaatcttcc 60

ataaacttgg ggtaaggctc agttggaata ccccgcttgg ccagcatttg cataagttca 120

gaatccccag cacatcgatc aatcataccc ttttcagccc agataatggc ggtccgtttc 180

ggtcgctggc tggccttcaa agatggtgga tggtacgtag caacggcagc aaatatagct 240

tggagatgtt gtcgagtcat atctgttgat ctccaaaagc cattttgacg agatatgctc 300

tcaaagatag cccagccaat atcattctta tcctcaacgg tcttggatcg tggcgagcac 360

atgtcgatga gcataaggat c 381

<210>15

<211>922

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>15

tccgtagttc cgtagtagga aattggaagg atgttcatga tgccacttgc ataggggttg 60

gtgcaagcac taagtagtga gagcatcata gtatgagcat cagtcccgat cattgcttta 120

tagttcaagc cgtatgttag catcatatca gtcttggcta gagccacgct tcatgtagta 180

actgacctcg gcatcgtccc gaatgatgct ctagcgatgg atatagattg gccaaccgtc 240

tctcaagcgc aatgaaaaca tcaaaggtcc cgtagaacca ccttgcagaa ctaggaccaa 300

ggccatattt gtagaaagcc ttgacgcttg cttctacagc ctcttggctt tgtggcaagc 360

tcaaaggtgc tattccttcg aggtcacccc cagggtactt cttggacagt ccttcgacat 420

aggaacaaag tgaggcatcc gatttgatac tttgttcaac aatagcggga tcgtcggggt 480

gttgctttgg gagtatatca ggggtaaaga tagtagaagt cacgcctttg atctggagct 540

tgcagctcac ttttgtaatc atgttgatca agtcaagggt gtctttccaa gatgtagtcg 600

caaagatgca aactcgaact cgacaggacc tatggtccaa ggtcagtgcg tatccaggtc 660

tctgttgagc ccataacaga aagaaaggat ccttaccata atggcgtggc tggaggcaca720

ccacaggcga ctgcaaaacc tcgctgcatt gcctcctcat ggaatctaga cgcttgctgg 780

attgttcctg tggcagatta gattccgcgt tcctagagca caacgccatt atgacctaga 840

gcaacttacc tactggaaag cagacaacag gagagccgcg cgaagagagt atacaacagc 900

cagcttgtgc aagacaatca gc 922

<210>16

<211>436

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>16

ttgggcccag gtttccaaag agctcatggc agatctatca atccactaca cctataccct 60

cgttctggac gatagcaagg acgatcctca tcccactatg gagaactact tcaatgatct 120

gcatgctgga agggagcaag ctcatccttg gtggagactc gtcaacgaac acttcccaaa 180

tgttctccga catttcggtc ctttttgttc gttgaatttg atccgcagca cccttgactg 240

tgagtatttg atccatgcta tttatataaa caagctaaac ctaattttgt agtttttgag 300

ggatgctgga ttgaacagta caactttggg ggataccccg gatctcatga ttaccccggc 360

ttccttcggc gcatgaatgg tcttggccat tgcgttggtg cttcgttgtg gcccaaggct 420

cagtttgatg agcgca 436

<210>17

<211>235

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>17

gatcccagca catcgatcaa tcataccctt ttcagcccag ataatggcgg tccgtttcgg 60

tcgctggctg gccttcaaag atggtggatg gtacgtagca acggcagcaa atatagcttg 120

gagatgttgt cgagtcatat ctgttgatct ccaaaagcca ttttgacgag atatgctctc 180

aaagatagcc cagccaatat cattcttatc ctcaacggtc tttggatcgt ggaag 235

<210>18

<211>720

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>18

gttttgcata gggggttggt gcaagcacta agtagtgaga gcatcttagt atgagcatca 60

gtcccgatca ttgctttata gttcaagccg tatgttagca tcatatcagt cttggctaga 120

gccacgcttc atgtagtaac tgacctcggc atcgtcccga atgatgctct agcgatggat 180

atagattggc caaccgtctc tcaagcgcaa tgaaaacatc aaaggtcccg tagaaccacc 240

ttgcagaact aggaccaagg ccatatttgt agaaagcctt gacgcttgct tctacagcct 300

cttggctttg tggcaagctc aaaggtgcta ttccttcgag gtcaccccca gggtacttct 360

tggacagtcc ttcgacatag gaacaaagtg aggcatccga tttgatactt tgttcaacaa 420

tagcgggatc gtcggggtgt tgctttggga gtatatcagg ggtaaagata gtagaagtca 480

cgcctaggat ctggagctgg cagttcactt tggtaatcat gttgatcaag tcaagggagt 540

ctttccaaga agtagtcgca aagatgcaaa ctcgaactgg acaggaccta tggtccaagg 600

tcagtgcgta tccaggtctc tgttgagccc ataacagaaa gaaaggatcc ttaccataat 660

ggcgtggctg gaggcacacc acaggcgact gcaaaacctc gctgcattgc ctcctcatgg 720

Claims

1. Specific primers for detecting the chemical type of pathogenic toxins of fusarium graminearum root rot, which are characterized by comprising the following components:

SEQ ID NO.1：Tri5H1-F：AGTTGGGCCAAGGTTTCCAA；

SEQ ID NO.2：Tri5H1-R：AAGGAACTGCTTGCGCTCAT；

SEQ ID NO.3：ZEA13H1-F：AGTTGGAATACCCCGCTTGG；

SEQ ID NO.4：ZEA13H1-R：CCACGATCCAAGACCGTTGA；

SEQ ID NO.5：FUM8H1-F：TTGCATAGGGGTTGGTGCAA；

SEQ ID NO.6：FUM8H1-R：GGAACAATCCAGCAAGCGTC。

2. a kit comprising the specific primers of claim 1 for detecting the chemical type of a pathogenic toxin of fusarium graminearum.

3. Use of the specific primers of claim 1 or the kit of claim 2 for detecting the chemical type of a toxin causative of fusarium graminearum mycorrhizal rot.

4. Use of the specific primers of claim 1 or the kit of claim 2 for detecting the toxin-producing potential of fusarium alfalfa.

5. The use of the specific primers of claim 1 or the kit of claim 2 in alfalfa pathogen quarantine inspection or prevention and control of alfalfa fusarium root rot.

6. A method for detecting the chemical type of pathogenic toxin of fusarium graminearum rhizoctonia, which is characterized in that the specific primer of claim 1 or the kit of claim 2 is used for detection.

7. The detection method according to claim 6, characterized by comprising the steps of:

(2) performing PCR amplification by using the genomic DNA as a template and the specific primer of claim 1 or the kit of claim 2;

(3) judging the type of toxin genes contained in the fusarium graminearum root rot pathogen according to the PCR amplification product, and determining the chemical type of the toxin of the fusarium graminearum root rot pathogen.

8. The detection method according to claim 7, wherein the reaction procedure of PCR amplification comprises: pre-denaturation at 95 ℃ for 2-5 min; denaturation at 94 ℃ for 20-30 s, annealing at 52-54 ℃ for 30s, extension at 72 ℃ for 30-60 s, and 30-35 cycles; extension at 72 ℃ for 10 min.

9. The detection method according to claim 8, wherein when the Tri5H1-F/Tri5H1-R primer pair is used, the reaction procedure of the PCR amplification comprises: pre-denaturation at 95 ℃ for 2 min; denaturation at 94 ℃ for 30s, annealing at 54 ℃ for 30s, and extension at 72 ℃ for 40s for 35 cycles; extending for 10min at 72 ℃;

when the primer pair ZEA13H1-F/ZEA13H1-R is adopted, the reaction program of the PCR amplification comprises the following steps: pre-denaturation at 95 ℃ for 2 min; denaturation at 94 ℃ for 30s, annealing at 54 ℃ for 30s, and extension at 72 ℃ for 30s for 35 cycles; extending for 10min at 72 ℃;

10. the detection method according to any one of claims 7 to 9, wherein the 25. mu.L reaction system for PCR amplification comprises 1. mu.L of each of 10. mu. mol/L upstream and downstream primers, 12.5. mu.L of 2 × PCR reaction premix, 1. mu.L of 100 ng/. mu.L genomic DNA, and ddH complement₂O to 25. mu.L.

11. The detection method according to any one of claims 7 to 9, wherein the determination of the type of the toxin gene contained in the fusarium graminearum root rot pathogen according to the PCR amplification product is a determination of whether the fusarium graminearum root rot pathogen contains a trichothecene toxin according to the presence or absence and size of the electrophoretic bandTri5Gene zearalenonePks13Gene fumonisinFum8A gene.

12. The method according to claim 10, wherein the determination of the type of the toxin gene contained in the Fusarium graminearum root rot pathogen from the PCR amplification product is performed by determining whether the Fusarium graminearum root rot pathogen contains a trichothecene toxin according to the presence or absence and size of the electrophoretic bandTri5Gene zearalenonePks13Gene fumonisinFum8A gene.