CN106434990B - A kind of clover phytophthora nested PCR detection method - Google Patents
A kind of clover phytophthora nested PCR detection method Download PDFInfo
- Publication number
- CN106434990B CN106434990B CN201611077021.9A CN201611077021A CN106434990B CN 106434990 B CN106434990 B CN 106434990B CN 201611077021 A CN201611077021 A CN 201611077021A CN 106434990 B CN106434990 B CN 106434990B
- Authority
- CN
- China
- Prior art keywords
- phytophthora
- clover
- primer
- pcr
- amplification
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6848—Nucleic acid amplification reactions characterised by the means for preventing contamination or increasing the specificity or sensitivity of an amplification reaction
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Botany (AREA)
- Mycology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention provides a kind of nested PCR detection methods of clover phytophthora, devise the specific primer PMF/PMR of 1 pair of clover phytophthora, its sequence are as follows: PMF:5'-GTCTACA-GTGGATTTGGATCTCTTG-3', PMR:5'-CAAAATATAACAGTAAAGTTGAG-TTCG-3'；The nested PCR detection method of clover phytophthora is established using the primer, this detection method high sensitivity, sensitivity is up to 10fg/ μ l DNA, 10000 times are improved than Standard PCR, the method for the present invention is easy to operate, and time-consuming is few, reproducible, high specificity, flux is big, can be applied to quick, the accurate detection of clover phytophthora in Alfalfa plant tissue and soil, to prevent clover phytophthora invasion, pathogen monitoring and Alfalfa international trade contact etc. all have significance.
Description
Technical field
The invention belongs to crop disease early warning detection and Prevention Technique field, be related to a kind of method that molecule quickly detects with
Using, and in particular to clover phytophthora nested PCR detection method and its application.
Background technique
Clover is pulse family, clover category herbaceos perennial, is China or even plants most herbage varieties in the world, by
In its wide adaptability, yield is high, quality is good the advantages that, be known as the laudatory title of " King of Pasture ".By clover phytophthora
(Phytophthora medicaginis) infect caused by causing root rot disease of Medicago sativa be cause alfalfa output lose Major Diseases it
One, causing root rot disease of Medicago sativa can lead to the production loss of clover susceptible variety up to 68% or more.Clover phytophthora is classified as by China to be forbidden entering the territory
Quarantine object, currently, there has been no the reports that clover phytophthora root rot occurs for China, but continuous with the animal husbandry of recent years China
Development, China port import clover forage and seed increase and a large amount of allocation and transportation of domestic clover forage and seed, Shi Bizeng
The germ is added to be passed to the danger of Pest- or disease-free area by epidemic-stricken area, which causes harm very serious once being passed to, and quarantining is to prevent the germ
It colonizes in China, propagate most economical, most efficient method.Therefore it is necessary to be furtherd investigate to clover phytophthora, as early as possible
Establish its quickly accurate detection method.
The identification of phytophthora traditional classification is mainly based upon morphological feature, and (colonial morphology, hypha form, chlamydospore have
Nothing, sporangium feature, sporangiophore layer go out mode, the deciduous of sporangium and type of spermary etc.), Pathogenicity, physiology it is raw
Change feature etc..Pathogen need to be separated when carrying out Morphological Identification, however on same selective medium, other growths
The microbes of fast speed inhibit phytophthora growth, and causing separation, there are certain difficulties.In addition, the form of Phytophthora inter-species
It learns character and overlapping phenomenon often occurs, each strain morphology character has differences in phytophthora kind, and vulnerable to environmental influence (place
Master, culture medium, temperature etc.) and there is unstable character.Although conventional method has played important function in phytophthora detection,
It is time-consuming and laborious, and operator is required to have professional phytophthora separation, Morphological Identification knowledge and experience abundant；Simultaneously
Time-consuming for traditional classification identification method, sensitivity is low, vulnerable to the interference of the factors such as artificial and environment, cannot be latent in disease
Phase and early stage make diagnosis, are difficult that disease occurs to carry out timely monitoring and effectively control.
With the development of molecular biology technology, in recent years, utilizing a certain special molecular piece of PCR amplification pathogen ribosomes
Section (internal transcribed spacer ITS transcribed spacer) carries out pathogen identification, detection and disease screening
It is widely used in the world, it can be directly to samples such as plant tissue, soil and water bodys by PCR amplification using pathogen special primer
In pathogen detected.Due to this method high specificity, high sensitivity, simplicity, quickly, "dead" pollution, easily push away
It is wide to wait outstanding advantages, the increasingly great attention by various countries virologist.However the molecular detection technology of Phytophthora oomycetes is ground
Study carefully the result shows that, rDNA/ITS is varied less between Phytophthora sibling species, and design primer is difficult two phases from ITS sequence
It is distinguished like high kind.Therefore high sensitivity and specific detection are carried out to Phytophthora pathogen, it should be from the other bases of phytophthora
Because of upper design primer.Existing research shows in PhytophthoraYpt1Gene contains multiple exons and introne, and exon has
Conservative, and these intrones have variability between not of the same race, and it is close to be very suitable for design primer progress Phytophthora oomycetes
Specific molecular detection, the identification of edge kind.
The present invention withYpt1Gene is that clover phytophthora detects target spot, designs specific primer and combines with round pcr,
Establish high specificity, high sensitivity, time-consuming short detection method.Identification, monitoring, Defect inspection of the present invention in clover phytophthora
There is certain application prospect with prevent and treat etc..
Summary of the invention
The object of the present invention is to provide a kind of specific primer for detecting clover phytophthora, PCR detection method and its answer
With present invention can apply to carry the Alfalfa plant tissue of clover phytophthora and Soil K+adsorption.Clover is detected using the present invention
Phytophthora accuracy height, high specificity, high sensitivity, easily operated, detection time is short and result is reliable.
It achieves the object of the present invention and includes the following steps (technical solution):
1. the design of clover phytophthora specific primer: by measurement clover phytophthora (Phytophthora medicaginis) and other phytophthoras (Phytophthora spp)Ypt1Gene order, to Phytophthora difference inter-speciesYpt1
Gene order is compared, and designs 1 pair of primer for having specific amplification effect to clover phytophthora, i.e. specific PCR
The sequence of detection primer are as follows:
Upstream primer PMF:5'- GTCTACAGTGGATTTGGATCTCTTG -3',
Downstream primer PMR:5'- CAAAATATAACAGTAAAGTTGAGTTCG -3'；
Go out the product of 225bp to clover phytophthora specific amplification.
PhytophthoraYpt1Gene universal primer ph1F/Yph2R, sequence are as follows:
Ph1F:5'-CGACCATTGGCGTGGACTTT-3',
Yph2R:5'-ACGTTCTCGCAGGCGTATC- T-3'.
2. the foundation of clover phytophthora nested PCR detection method, comprising the following steps:
(1) sample to be tested genomic DNA is extracted.
When for detecting pathogen pure culture, genomic DNA is extracted using CTAB method, the specific method is as follows: taking
A small amount of hypha powder (hypha powder, which had just covered semicircular base, to be advisable) in 1.5mL centrifuge tube, is added 900 μ L 2%CTAB(16
Alkyl trimethyl ammonium bromide) extracting solution (2% CTAB；100 mmol/L Tris-HCl, pH 8.0；20 mmol/L EDTA,
pH8.0；1.4 mol/L NaCl) and 90 μ L SDS(neopelexes) [note: CTAB, SDS need 60 DEG C of preheatings], make
Vibrated and mixed with oscillator, 60 DEG C of water-bath 1h(DNA are discharged into buffer), 12000 rmin-1It is centrifuged 15 min；Take supernatant
700 μ L of liquid adds isometric phenol, chloroform, isoamyl alcohol (25:24:1), and gently oscillation mixes, 12000 rmin-1It is centrifuged 9 min；
500 μ L of supernatant is taken, isometric chloroform is added and extracts again once, 12000 rmin-1It is centrifuged 5 min；Take 350 μ of supernatant
1/10 volume, 3 molL is added in L-1NaAc and 2 times of volume dehydrated alcohol, -20 DEG C of precipitatings 30 min, 12000 rmin-1
It is centrifuged 5 min；Liquid is discarded supernatant, addition 700 μ L ice, 70% ethyl alcohol, which is washed, (to be slightly centrifuged；Incline and fall supernatant), in ultra-clean work
Make to dry alcohol-free taste on platform, 30 ~ 60 μ L TE(10 mmol/L Tris-HCl, 0.1 mmol/L EDTA, pH 8.0 are added)
Solution is dissolved, and DNA solution is obtained, and with UV spectrophotometer measuring DNA concentration and to be diluted to 25 ng/ μ L stand-by.
For detecting in Alfalfa plant tissue there are when clover phytophthora, DNA, tool are extracted using NaOH rapid cleavage method
Body process is as follows: 10 μ L, 0.5 mol/L NaOH being added into every milligram of plant tissue, is sufficiently milled to tissue in mortar
It is transferred to after paste in 1.5mL centrifuge tube, 12,000 rpm are centrifuged 6 min, take 5 μ l of supernatant that 495 μ L, 0.1 mol/L is added
Tris-HCl(pH=8.0) it is uniformly mixed, take 1.0 μ L to be expanded as pcr template；
For detecting in pedotheque there are when clover phytophthora, using soil DNA extracts kit, DNA is extracted.
(2) wheel of nest-type PRC the 1st amplification: the DNA extracted using step (1) is utilized as templateYpt1Gene universal primer
Ph1F/Yph2R(ph1F:5'-CGACCATTGGCGTGGACTTT-3' and Yph2R:5'-ACGTTCTCGCAGGCGTATCT-3')
The 1st wheel PCR amplification is carried out, amplification reaction system and response procedures are as follows: 25 μ L of PCR reaction system, including 2 ×Taq PCR
Master Mix 12.5 μ L, each 1.0 μ L of ph1F/Yph2R primer of 10 μm of ol/L, 1.0 μ L of DNA profiling, with sterile ultrapure water
Complement to 25 μ L；Amplified reaction program are as follows: 94 DEG C of initial denaturation 5min；94 DEG C of 1 min of denaturation, 58 DEG C of 30 S of annealing, 72 DEG C of extensions
1 min, 35 circulations, 10 min of last 72 DEG C of extensions.
(3) wheel of nest-type PRC the 2nd amplification: after to step (2) first round PCR amplification, 1.0 μ l first round PCR is taken to expand
The dilution for increasing production object or amplified production is template and primer PMF/PMR(PMF:5'- GTCTACAGTGGATTTGGATCTCTTG
- 3', PMR:5'- CAAAATATAACAGTAAAG- TTGAGTTCG -3') the 2nd wheel PCR amplification of progress is combined, PCR amplification
Condition are as follows: 25 μ L of PCR reaction system, including 2 ×TaqPCR Master Mix 12.5 μ L, the PMF/PMR of 10 μm of ol/L
Each 1.0 μ L, DNA template of primer (the 1st wheel pcr amplification product) 1.0 μ L, complement to 25 μ L with sterile ultrapure water；Amplification
For 95 DEG C of initial denaturations 5 min, 94 DEG C of denaturation 30 s, 57 DEG C of annealing 45 s, 72 DEG C of 30 s of extension, totally 35 are recycled, finally
72 DEG C of 10 min of extension；
(4) detected through gel electrophoresis: 5.0 μ L steps (3) the 2nd wheel pcr amplification product is taken to carry out electricity with 1.5% Ago-Gel
Swimming separates, and observes under ultraviolet lamp after voltage 4-5V/cm, 40 min of electrophoresis through ethidium bromide staining, according to amplified production
Whether there is or not and its clip size result is judged, if the product of about 225bp size can be amplified specifically, that is, can determine whether
There are clover phytophthoras in the test sample, otherwise not there is no the bacterium in the test sample.
Compared with prior art, the present invention have technical advantage below and the utility model has the advantages that
1. high specificity, accuracy are high: the present invention has obtained clover epidemic disease by being sequenced and inquiring the data in GenBank
Mould (Phytophthora medicaginis) and other phytophthoras (Phytophthora spp)Ypt1Gene order, and
It is not of the same race to PhytophthoraYpt1Sequence is analyzed, and clover phytophthora a pair of specific primer PMF/PMR is devised, right using this
Primer pair phytophthora and other fungies carry out PCR amplification, and discovery can only amplify size from the DNA of clover phytophthora and be about
The band of 225bp, and other bacterial strains expand not shaping band, illustrate that primer of the invention has very strong specificity；
2. reproducible, high sensitivity: repeatability and sensitivity are an important indicators of detection of pathogens, it is related to
PCR Fast Detection Technique can be directly applied in the inspection and quarantine of entry and exit plant and plant product.Test of many times confirms
The present invention has good repeatability, and object DNA only needs 10 pg/ μ L, so that it may detect, identify clover phytophthora；
3. easy to operate, quick: apply the method for the present invention, sample to be tested genomic DNA is extracted, PCR amplification and
It is can determine that after conventional agarose electrophoresis as a result, entire detection process is using DNA rapid extracting method, it is easy to operate, it is not necessarily to
Pathogen is separately cultured, detection time is substantially reduced, general entire detection process can be completed in 6 hours；
4. application is good: directly having important practical application valence from diseased tissues or with clover phytophthora is detected in soil bacteria
Value, clover phytophthora are with the soil or invalid body (such as root, stem) biography in clover with the most probable route of transmission of trade contacts
It broadcasts, in trading port, quarantine departments are mainly the separation for passing through pathogen in soil and invalid body, identification to determine whether taking
Band clover phytophthora.But to the interference in the isolating and purifying of pathogen vulnerable to some saprophytic bacterias, it is unable to satisfy customs quarantine control
It needs.Plant tissue and soil can be effectively detected by devising a pair of of specific primer, in conjunction with PCR detection method in the present invention
Clover phytophthora in earth can refer to the inspection and quarantine and field investigation for being applied to entry and exit plant and plant product, to control
Clover phytophthora is passed to China and is of great significance, meanwhile, detection of the foundation of system of the present invention also for other pathogens provides
Technological guidance and theoretical foundation.
Detailed description of the invention
Fig. 1 is the PCR amplification electropherogram of specific primer of the present invention, in figure: swimming lane M is 2000bp Marker, swimming
Road 1-3 is clover phytophthora, and swimming lane 4-7 is respectively phytophthora blight of pepper, late disease bacteria, soyabean phytophthora and cowpea phytophthora, swimming
Road 8 is negative control.
Fig. 2 is the sensitivity detection amplification electrophoretogram of specific primer of the present invention, and Fig. 2-a is substance PCR to clover phytophthora
The sensitivity testing result of bacterium, Fig. 2-b are sensitivity testing result of the nest-type PRC to clover phytophthora, and swimming lane M is in figure
2000bp Marker, swimming lane 1 are 100 ng, and swimming lane 2 is 10 ng, and swimming lane 3 is 1 ng, and swimming lane 4 is 100 pg, and swimming lane 5 is 10
Pg, swimming lane 6 are 1 pg, and swimming lane 7 is 100 fg, and swimming lane 8 is 10 fg, and swimming lane 9 is 1 fg, and swimming lane 10-11 is negative control, swimming
Road 12 is positive control.
Fig. 3 is detection method to clover phytophthora testing result in Alfalfa stem tissue and pedotheque
Electrophoretogram, swimming lane M is 2000bp Marker in figure, and swimming lane 1 is positive control, and swimming lane 2 is negative control, and swimming lane 3 is manually to connect
The Alfalfa stem tissue of kind morbidity, swimming lane 4 are that healthy Alfalfa stem organizes, and swimming lane 5 is the soil for carrying clover phytophthora,
Swimming lane 6 is high pressure sterilization soil, and swimming lane 7 is the soil for carrying clover phytophthora, and swimming lane 8 is high pressure sterilization soil.
Specific embodiment
Below in conjunction with specific embodiment, the present invention is further elaborated, but is not intended to limit the scope of the invention.Below
Embodiment is according to conventional laboratory conditions, or has delivered operating technology regulation described in pertinent literature, or built according to manufacturer
The experiment condition of view.
Embodiment 1: clover phytophthora PCR detects the design of specific primer and the specificity verification of primer
1. the extraction of clover phytophthora genomic DNA
The clover phytophthora genomic DNA in different regions source is extracted using CTAB method, the specific method is as follows: taking a small amount of
900 μ L 2%CTAB(cetyls are added in hypha powder (hypha powder, which had just covered semicircular base, to be advisable) in 1.5 mL centrifuge tubes
Trimethylammonium bromide) extracting solution (2% CTAB；100 mmol/L Tris-HCl, pH 8.0；20 mmol/L EDTA, pH8.0；
1.4 mol/L NaCl) and 90 μ L SDS(neopelexes) [note: CTAB, SDS need 60 DEG C of preheatings], use oscillation
Device oscillation mixes, and 60 DEG C of water-bath 1h(DNA are discharged into buffer), 12000 rmin-1It is centrifuged 15 min；Take supernatant 700
μ L adds isometric phenol, chloroform, isoamyl alcohol (25:24:1), and gently oscillation mixes, 12000 rmin-1It is centrifuged 9 min；Take supernatant
500 μ L of liquid is added isometric chloroform and extracts again once, 12000 rmin-1It is centrifuged 5 min；350 μ L of supernatant is taken, is added
1/10 volume, 3 molL-1NaAc and 2 times of volume dehydrated alcohol, -20 DEG C of precipitatings 30 min, 12000 rmin-1Centrifugation 5
min；Liquid is discarded supernatant, addition 700 μ L ice, 70% ethyl alcohol, which is washed, (to be slightly centrifuged；Incline and fall supernatant), on superclean bench
Alcohol-free taste is dried, 30 ~ 60 μ L TE(10 mmol/L Tris-HCl, 0.1 mmol/L EDTA, pH 8.0 are added) solution
It is dissolved, obtains DNA solution, with UV spectrophotometer measuring DNA concentration and to be diluted to 100 ng/ μ L stand-by.
2. clover phytophthora detects targetYpt1Gene magnification and sequencing
WithYpt1Gene universal primer (ph1F:5'-CGACCATTGGCGTGGACTTT-3' and Yph2R:5'-
ACGTTCTCGCAGGCGTATCT-3') to for examination clover phytophthora (Phytophthora medicaginis)Ypt1Gene
It is expanded, 25 μ L of PCR reaction system, including 2 ×TaqPCR Master Mix(Beijing Tiangeng biochemical technology Co., Ltd)
12.5 μ L, each 1.0 μ L of 1.0 μ L, DNA template of ph1F/Yph2R primer of 10 μm of ol/L, complement to 25 with sterile ultrapure water
µL.Amplified reaction program are as follows: 94 DEG C of initial denaturation 5min；94 DEG C of 1 min of denaturation, 58 DEG C of 30 S of annealing, 72 DEG C of extension 1 min, 35
A circulation, 10 min of last 72 DEG C of extensions.Pcr amplification product is sent to Shanghai Sheng Gong bioengineering Co., Ltd and is sequenced.
3. the design of clover phytophthora detection specific primer
By sequencing obtain clover phytophthora (P.medicaginis)Ypt1Gene order and Phytophthora in GenBank
18 not of the same raceYpt1Gene order carries out tetraploid rice analysis, according to the difference site of clover phytophthora and other inter-species
(being compared in BioEdit), with Primer Primer5 software design clover phytophthora (P.medicaginis) specificity
Primer, upstream primer PMF:5'- GTCTACAGTGGATTT- GGATCTCTTG -3', downstream primer PMR:5'-
CAAAATATAACAGTAAAGTTGAGTTCG -3', primer are synthesized by Shanghai Sheng Gong bioengineering Co., Ltd.
4. the foundation of clover phytophthora specific PCR detection method and primer specificity PCR verifying
On the basis of having designed specific primer, by the optimization of PCR reaction system and Amplification, clover is established
Phytophthora PCR detection method, 25 μ L of PCR reaction system, including 2 ×TaqPCR Master Mix 12.5 μ L, 10 μm of ol/L
Each 1.0 μ L of 1.0 μ L, DNA template of PMF/PMR primer, complement to 25 μ L with sterile ultrapure water.Amplified reaction program are as follows: 94
DEG C initial denaturation 5min；94 DEG C of 1 min of denaturation, 57 DEG C of annealing 45S, 72 DEG C of 30 s of extension, 35 circulations, last 72 DEG C extend 10
min.So that the clover phytophthora of examination and the genomic DNA of other pathogens are template, using well-established clover phytophthora
PCR detects amplification system and amplification program to clover phytophthora special primer (upstream primer PMF:5'- GTCT-
ACAGTGGATTTGGATCTCTTG -3', downstream primer PMR:5'- CAAAATATAACAG- TAAAGTTGAGTTCG -3')
Specificity verified.5 μ L PCR products are taken to carry out 1.5% agarose electrophoresis detection, in ultraviolet after ethidium bromide staining
It observes under lamp, the specificity of clover phytophthora special primer is verified according to the presence or absence of DNA band and size.
5. primer specificity verification result
PCR amplification the result shows that, primer PMF/PMR can only be specifically from the clover phytophthora genomic DNA for examination
The band (Fig. 1) that size is about 225bp is amplified, and other pathogens and negative control are without amplified band.Illustrate this to drawing
Object can distinguish clover phytophthora and other pathogens, have the specificity of kind, can be used for clover phytophthora and quickly may be used
The detection and identification leaned on.
Embodiment 2: the sensitivity determination of clover phytophthora nest-type PRC detection
1. Standard PCR detects
Clover phytophthora genomic DNA is diluted with sterile ultrapure water, is configured to the series of concentrations of 10 times of orders of magnitude
It is spare.PCR amplification is carried out using genomic DNA of the primer PMF/PMR of the present invention to different series concentration, assesses the primer
To the sensitivity of clover phytophthora genomic DNA detection, amplification reaction system and response procedures are as follows: 25 μ of PCR reaction system
L, including 2 ×TaqPCR Master Mix(Beijing Tiangeng biochemical technology Co., Ltd) 12.5 μ L, the PMF/ of 10 μm of ol/L
Each 1.0 μ L of 1.0 μ L, DNA template of PMR primer, complements to 25 μ L with sterile ultrapure water.Amplified reaction program are as follows: 94 DEG C of pre- changes
Property 5min；94 DEG C of 1 min of denaturation, 57 DEG C of 45 S of annealing, 72 DEG C of 1 min of extension, 35 circulations, 10 min of last 72 DEG C of extensions.
2. nest-type PRC detects
(1) dilution of DNA profiling: clover phytophthora genomic DNA is diluted with sterile ultrapure water, is configured to 10 times
The series of concentrations of the order of magnitude is spare.
(2) it the wheel of nest-type PRC the 1st amplification: using the DNA of different diluted concentrations as template, utilizesYpt1Gene universal primer
Ph1F/ph2R(ph1F:5'-CGACCATTGGCGTGGACTTT-3' and Yph2R:5'-ACGTTCTCGCAGGCGTATCT-3')
The wheel amplification of nest-type PRC the 1st is carried out, amplification reaction system and response procedures are as follows: 25 μ L of PCR reaction system, including 2 ×Taq
PCR Master Mix(Beijing Tiangeng biochemical technology Co., Ltd) 12.5 μ L, ph1F/Yph2R primer of 10 μm of ol/L is each
1.0 μ L, 1.0 μ L of DNA profiling complement to 25 μ L with sterile ultrapure water.Amplified reaction program are as follows: 94 DEG C of initial denaturation 5min；94℃
It is denaturalized 1 min, 58 DEG C of 30 S of annealing, 72 DEG C of 1 min of extension, 35 circulations, 10 min of last 72 DEG C of extensions.
(3) nest-type PRC the 2nd wheel amplification: after to first round PCR amplification, take 1.0 μ l first round pcr amplification products or
The dilution of amplified production is that template combines the progress wheel amplification of nest-type PRC the 2nd with clover phytophthora specific primer PMF/PMR.
25 μ L of PCR reaction system, including 2 ×TaqPCR Master Mix(Beijing Tiangeng biochemical technology Co., Ltd) 12.5 μ L, 10
Each 1.0 μ L of PMF/PMR primer of μm ol/L, 1.0 μ L of first round PCR product complement to 25 μ L with sterile ultrapure water.Amplification is anti-
Answer program are as follows: 94 DEG C of initial denaturation 5min；94 DEG C of 1 min of denaturation, 57 DEG C of 45 S of annealing, 72 DEG C of 1 min of extension, 35 circulations, most
72 DEG C of 10 min of extension afterwards.
3. Standard PCR and nest-type PRC remolding sensitivity compared with: when carrying out standard PCR amplification with specific primer PMF/PMR,
Reaction sensitivity can achieve 25 μ l of 100pg DNA-1Reaction system (a in Fig. 2).Further withYpt1Gene universal primer
Ph1F/Yph2R carries out the PCR product that expands of the first round as template, using PMF/PMR as second take turns amplimer into
Row nested PCR amplification can make from electrophoretogram it can be seen that the specific amplification band of nest-type PRC is more much brighter than Standard PCR
The sample (10pg, 1 pg, 100fg, 10fg/25 μ l reaction system) that originally can't see band generates bands visible (in Fig. 2
B), sensitivity reaches 25 μ l of 10fg DNA-1Reaction system improves 10000 times or so than Standard PCR.
Embodiment 3: the detection of clover phytophthora in incidence tissue, Alfalfa stem
The acquisition of artificial infection incidence tissue: it will be gone on rye culture medium flat plate for the clover phytophthora of examination, 25 DEG C black
The mycelia block wound inoculation of the mm of 2 mm × 2 is cut after 5 d of dark culture from colony edge in Alfalfa (kind: middle lucerne 1)
On stem, it is spare to cut incidence tissue after the onset for 25 DEG C of dark moisturizing cultures.
The extraction of incidence tissue's genomic DNA: DNA is extracted using NaOH rapid cleavage method, detailed process is as follows: to every milli
10 μ L, 0.5 mol/L NaOH is added in gram plant tissue, is sufficiently milled in mortar by tissue to be transferred to 1.5mL after paste and is centrifuged
Guan Zhong, 12,000 rpm are centrifuged 6 min, take 5 μ l of supernatant that 0.1 Tris-HCl(pH=8.0 mol/L 495 μ L are added) mixing
Uniformly, 1.0 μ L is taken to be expanded as pcr template.
Nested PCR amplification detection: it using the DNA mentioned as template, utilizesYpt1Gene universal primer ph1F/ph2R(ph1F:
5'-CGACCATTGGCGTGGACTTT-3', Yph2R:5'-ACGTTC- TCGCAGGCGTATCT-3') carry out nest-type PRC the 1st
Wheel amplification, amplification reaction system and response procedures are as follows: 25 μ L of PCR reaction system, including 2 ×Taq PCR Master Mix
(Beijing Tiangeng biochemical technology Co., Ltd) 12.5 μ L, each 1.0 μ L of ph1F/Yph2R primer of 10 μm of ol/L, DNA profiling 1.0
μ L complements to 25 μ L with sterile ultrapure water.Amplified reaction program are as follows: 94 DEG C of initial denaturation 5min；94 DEG C of 1 min of denaturation, 58 DEG C move back
30 S of fire, 72 DEG C of 1 min of extension, 35 circulations, 10 min of last 72 DEG C of extensions.After to first round PCR amplification, 1.0 μ are taken
The dilution of l first round pcr amplification product or amplified production is that template is combined with clover phytophthora specific primer PMF/PMR
Carry out the wheel amplification of nest-type PRC the 2nd.25 μ L of PCR reaction system, including 2 ×TaqThe Beijing PCR Master Mix(Tiangeng is biochemical
Science and Technology Ltd.) 12.5 μ L, each 1.0 μ L of the PMF/PMR primer of 10 μm of ol/L, 1.0 μ L of first round PCR product, surpassed with sterile
Pure water complements to 25 μ L.Amplified reaction program are as follows: 94 DEG C of initial denaturation 5min；94 DEG C of 1 min of denaturation, 57 DEG C of annealing 45 S, 72 DEG C
Extend 1 min, 35 circulations, 10 min of last 72 DEG C of extensions.
Testing result: taking nest-type PRC the 2nd to take turns 5.0 μ L of amplified production and separated with 1.5% agarose electrophoresis, voltage 4-5V/
Cm, electrophoresis terminates to observe under ultraviolet lamp after ethidium bromide staining, according to the presence or absence of amplified production and its clip size to knot
Fruit is judged, if the product of about 225bp can be amplified specifically, that is, can determine whether in incidence tissue with clover phytophthora
Bacterium.Testing result (Fig. 3) shows to can detect that clover phytophthora in morbidity root, and health tissues and negative control are then without spy
Anisotropic band occurs, and illustrates that the set technology can be used for the rapid molecular detection of clover phytophthora in plant tissue.
Embodiment 4: the detection of clover phytophthora in soil
Preparation with soil bacteria: will go on rye culture medium flat plate, 25 DEG C of dark culturings for the clover phytophthora of examination, to
After mycelia covers with plate, the mycelium in plate is washed down with suitable sterile water and obtains mycelium suspended liquid, uses plant tissue
Crusher smashes the mycelia in hyphal suspension, then mixes with appropriate soil, and mixed soil air-dries at room temperature, obtains
To carrying clover phytophthora soil bacteria.
Extraction with soil bacteria genomic DNA: using Sigma company soil DNA extracts kit (Sigma,
DNB100, Soil DNA Isolation Kit) extract soil in total DNA, take 1.0 μ L to be expanded as pcr template.
Nested PCR amplification detection: it using the DNA mentioned as template, utilizesYpt1Gene universal primer ph1F/ph2R(ph1F:
5'-CGACCATTGGCGTGGACTTT-3', Yph2R:5'-ACGTTC- TCGCAGGCGTATCT-3') carry out nest-type PRC the 1st
Wheel amplification, amplification reaction system and response procedures are as follows: 25 μ L of PCR reaction system, including 2 ×Taq PCR Master Mix
(Beijing Tiangeng biochemical technology Co., Ltd) 12.5 μ L, each 1.0 μ L of ph1F/Yph2R primer of 10 μm of ol/L, DNA profiling 1.0
μ L complements to 25 μ L with sterile ultrapure water.Amplified reaction program are as follows: 94 DEG C of initial denaturation 5min；94 DEG C of 1 min of denaturation, 58 DEG C move back
30 S of fire, 72 DEG C of 1 min of extension, 35 circulations, 10 min of last 72 DEG C of extensions.After to first round PCR amplification, 1.0 μ are taken
The dilution of l first round pcr amplification product or amplified production is that template is combined with clover phytophthora specific primer PMF/PMR
Carry out the wheel amplification of nest-type PRC the 2nd.25 μ L of PCR reaction system, including 2 ×TaqThe Beijing PCR Master Mix(Tiangeng is biochemical
Science and Technology Ltd.) 12.5 μ L, each 1.0 μ L of the PMF/PMR primer of 10 μm of ol/L, 1.0 μ L of first round PCR product, surpassed with sterile
Pure water complements to 25 μ L.Amplified reaction program are as follows: 94 DEG C of initial denaturation 5min；94 DEG C of 1 min of denaturation, 57 DEG C of annealing 45 S, 72 DEG C
Extend 1 min, 35 circulations, 10 min of last 72 DEG C of extensions.
Testing result: taking nest-type PRC the 2nd to take turns 5.0 μ L of amplified production and separated with 1.5% agarose electrophoresis, voltage 4-5V/
Cm, electrophoresis terminates to observe under ultraviolet lamp after ethidium bromide staining, according to the presence or absence of amplified production and its clip size to knot
Fruit is judged, if the product of about 225bp can be amplified specifically, that is, can determine whether that there are clover phytophthoras in pedotheque
Bacterium.Testing result (Fig. 3) shows to can detect that the bacterium in band soil bacteria, and autoclaved soil and negative control are then without spy
Anisotropic band occurs, and illustrates that the set technology can be used for the rapid molecular detection of clover phytophthora in soil.
The foregoing is merely presently preferred embodiments of the present invention, all equivalent changes done according to scope of the present invention patent with
Modification, is all covered by the present invention.
SEQUENCE LISTING
<110>Inst. of Plant Protection, fujian Academy of Agricultural Science
<120>a kind of clover phytophthora nested PCR detection method
<130> 4
<160> 4
<170> PatentIn version 3.3
<210> 1
<211> 25
<212> DNA
<213>artificial sequence
<400> 1
gtctacagtg gatttggatc tcttg 25
<210> 2
<211> 27
<212> DNA
<213>artificial sequence
<400> 2
caaaatataa cagtaaagtt gagttcg 27
<210> 3
<211> 20
<212> DNA
<213>artificial sequence
<400> 3
cgaccattgg cgtggacttt 20
<210> 4
<211> 20
<212> DNA
<213>artificial sequence
<400> 4
acgttctcgc aggcgtatct 20
Claims (4)
1. a kind of nest-type PRC detection primer of clover phytophthora, which is characterized in that the primer is clover phytophthora specificity
Primer PMF/PMR, sequence are as follows: PMF:5'- GTCTACAGTGGATTTGGATCTCTTG -3', PMR:5'-
CAAAATATAACAGTAA- AGTTGAGTTCG -3'。
2. carrying out clover phytophthora nested PCR detection method using detection primer described in claim 1, which is characterized in that packet
Include following steps:
(1) genomic DNA is extracted from sample to be tested；
(2) wheel of nest-type PRC the 1st amplification: the DNA extracted using step (1) is utilized as templateYpt1Gene universal primer ph1F/
Yph2R carries out the 1st wheel PCR amplification, and amplification reaction system and response procedures are as follows: 25 μ L of PCR reaction system, including 2 ×Taq
PCR Master Mix 12.5 μ L, each 1.0 μ L of ph1F/Yph2R primer of 10 μm of ol/L, 1.0 μ L of DNA profiling are surpassed with sterile
Pure water complements to 25 μ L；Amplified reaction program are as follows: 94 DEG C of initial denaturation 5min；94 DEG C of 1 min of denaturation, 58 DEG C of annealing 30 S, 72 DEG C
Extend 1 min, 35 circulations, 10 min of last 72 DEG C of extensions；
(3) wheel of nest-type PRC the 2nd amplification: after to step (2) first round PCR amplification, 1.0 μ l first round PCR amplifications is taken to produce
1-100 times of dilution of object or amplified production is that template combines the 2nd wheel PCR of progress with primer PMF/PMR described in claim 1 and expands
Increase, the condition of PCR amplification are as follows: 25 μ L of PCR reaction system, including 2 ×TaqPCR Master Mix 12.5 μ L, 10 μm of ol/
Each 1.0 μ L of the PMF/PMR primer of L complements to 25 with sterile ultrapure water with the 1st wheel pcr amplification product for 1.0 μ L of DNA template
µL；Amplification is 95 DEG C of initial denaturations 5 min, 94 DEG C of denaturation 30 s, 57 DEG C of annealing 45 s, 72 DEG C of 30 s of extension, totally 35
A circulation, 10 min of last 72 DEG C of extensions；
(4) detected through gel electrophoresis: 5.0 μ L steps (3) the 2nd wheel pcr amplification product is taken to carry out electrophoresis point with 1.5% Ago-Gel
From being observed under ultraviolet lamp after voltage 4-5V/cm, 40 min of electrophoresis through ethidium bromide staining, according to the presence or absence of amplified production
And its clip size judges result, if the product of about 225bp size can be amplified specifically, that is, can determine whether described
Test sample in there are clover phytophthoras.
3. PCR detection method according to claim 2, it is characterised in that: describedYpt1Gene universal primer ph1F/
Yph2R, sequence are as follows: ph1F:5'-CGACCATTGGCGTGGACTTT-3', Yph2R:5'-ACGTTCTCGCAGGCGTATC-
T-3'。
4. application of the primer as described in claim 1 in clover phytophthora detection and identification.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611077021.9A CN106434990B (en) | 2016-11-30 | 2016-11-30 | A kind of clover phytophthora nested PCR detection method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611077021.9A CN106434990B (en) | 2016-11-30 | 2016-11-30 | A kind of clover phytophthora nested PCR detection method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106434990A CN106434990A (en) | 2017-02-22 |
| CN106434990B true CN106434990B (en) | 2019-06-25 |
Family
ID=58222939
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201611077021.9A Active CN106434990B (en) | 2016-11-30 | 2016-11-30 | A kind of clover phytophthora nested PCR detection method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106434990B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106702014A (en) * | 2017-03-07 | 2017-05-24 | 福建省农业科学院植物保护研究所 | Peanut focal spot bacterial molecular detection primer and rapid detection method thereof |
| CN108977581B (en) * | 2018-08-14 | 2021-12-31 | 甘肃出入境检验检疫局检验检疫综合技术中心 | Real-time RT-PCR detection kit for alfalfa mosaic virus and detection method thereof |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102051415A (en) * | 2010-11-30 | 2011-05-11 | 天津出入境检验检疫局动植物与食品检测中心 | LAMP primer group for rapidly detecting phytophthora. medicaginis at normal temperature |
| CN103555823A (en) * | 2013-09-07 | 2014-02-05 | 福建省农业科学院植物保护研究所 | Phytophthora nicotianae molecule detection primer and detection method thereof |
| CN104928397A (en) * | 2015-07-15 | 2015-09-23 | 福建省农业科学院植物保护研究所 | Cowpea phytophthora PCR detection primer and method |
| CN205484362U (en) * | 2016-03-09 | 2016-08-17 | 中华人民共和国北京出入境检验检疫局 | Rotten mould root -rot germ specificity detect reagent box of alfalfa |
-
2016
- 2016-11-30 CN CN201611077021.9A patent/CN106434990B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102051415A (en) * | 2010-11-30 | 2011-05-11 | 天津出入境检验检疫局动植物与食品检测中心 | LAMP primer group for rapidly detecting phytophthora. medicaginis at normal temperature |
| CN103555823A (en) * | 2013-09-07 | 2014-02-05 | 福建省农业科学院植物保护研究所 | Phytophthora nicotianae molecule detection primer and detection method thereof |
| CN104928397A (en) * | 2015-07-15 | 2015-09-23 | 福建省农业科学院植物保护研究所 | Cowpea phytophthora PCR detection primer and method |
| CN205484362U (en) * | 2016-03-09 | 2016-08-17 | 中华人民共和国北京出入境检验检疫局 | Rotten mould root -rot germ specificity detect reagent box of alfalfa |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106434990A (en) | 2017-02-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107760795B (en) | LAMP primer for rapidly detecting anthracnose bacteria of tea trees and detection method | |
| CN106434993B (en) | For detecting LAMP primer composition object and its application of cucumber fusarium axysporum | |
| CN101974650B (en) | Polymerase chain reaction (PCR) method for detecting fusarium oxysporum and kit | |
| CN108220474A (en) | A kind of LAMP detection primer of Fusarium graminearum and its application | |
| CN104928397B (en) | Cowpea phytophthora PCR detection primers and its detection method | |
| CN107815505A (en) | A kind of Glorosprium musarum Cookeet Mass LAMP detection primer group and its detection method | |
| CN106868164B (en) | Primer for detecting phytophthora camphorata and nested PCR detection method | |
| CN109868324A (en) | One species-specific primer and its detection method | |
| CN106434990B (en) | A kind of clover phytophthora nested PCR detection method | |
| CN106381341B (en) | Nested PCR (polymerase chain reaction) detection primer for phytophthora taro and application of nested PCR detection primer | |
| CN108893557A (en) | A kind of method of three kinds of wheat rhizome portion diseases of quick detection | |
| CN105039535B (en) | A kind of primer for detecting Pear black spot bacterium and the detection method using its detection Pear black spot bacterium | |
| CN102851362B (en) | Method for quickly identifying Brucella based on mass spectrum technology and application thereof | |
| CN112176080B (en) | Nested PCR primer group, kit and detection method for specifically detecting purple sisal leaf roll disease phytoplasma | |
| CN1312475C (en) | Molecular detection method for fusarium toxin | |
| CN104911262B (en) | A kind of dalbergia odorifera tar spot bacterium molecule detection primer and quick determination method | |
| CN106801103A (en) | A kind of detection primer group of Streptococcusagalactiae, detection kit and multi-PCR detection method | |
| CN101928779A (en) | Real-time fluorescent RCR molecular detection kit for leptosphaeria maculans and detection method thereof | |
| CN114277166B (en) | RPA detection primer, probe and detection method for melon bacterial fruit blotch | |
| CN110878373A (en) | Recombinase polymerase amplification detection kit for phytophthora infestans and application thereof | |
| AU2020103778A4 (en) | Primer Set for Detection of Streptococcus agalactiae, Detection Kit and Multiplex PCR Detection Method | |
| CN105648107B (en) | A kind of southern corn leaf blight molecular detection primer and rapid detection method | |
| CN105063040B (en) | Phytophthora infestans germ PCR detection primers, kit and detection method | |
| CN106244721B (en) | A kind of capsicum stain anthrax bacteria molecular detection primer and detection method | |
| CN110106242A (en) | The detection primer and detection method of clover Fusariumsp Pathogens of Root Rot toxin chemical type |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |