CN104450939A - Double PCR (Polymerase Chain Reaction) molecular rapid detection method of plantain foxysporum - Google Patents
Double PCR (Polymerase Chain Reaction) molecular rapid detection method of plantain foxysporum Download PDFInfo
- Publication number
- CN104450939A CN104450939A CN201410828054.7A CN201410828054A CN104450939A CN 104450939 A CN104450939 A CN 104450939A CN 201410828054 A CN201410828054 A CN 201410828054A CN 104450939 A CN104450939 A CN 104450939A
- Authority
- CN
- China
- Prior art keywords
- plantain
- wilt
- dna
- banana
- sample
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Agricultural Chemicals And Associated Chemicals (AREA)
Abstract
The invention discloses a double PCR (Polymerase Chain Reaction) molecular rapid detection method of plantain (dwarf banana and plantain) foxysporum. Two pairs of molecular specific primers aiming at the plantain foxysporum are designed from the specific gene sequence of the plantain foxysporum, so that a rapid reliable molecular detection technology is established. PCR is performed on DNA (Deoxyribonucleic Acid) included in a sample by using the two pairs of specific primers simultaneously; when the product shows an amplified band of 755 bp, the pathogenic bacteria of the plantain foxysporum is included in the sample; when the product shows an amplified band of 590 bp, the pathogenic bacteria of the dwarf banana and the plantain foxysporum is included in the sample. The method has the advantages of easiness in operation, less time consumption and high sensitivity, and the sensitivity of detection of the plantain foxysporum hypha can reach 0.4 mug. The method can be meanwhile applied to detection of directly separated pathogenic bacteria, banana diseased tissues, seedlings or soil and irrigation water, the diffusion and the spread of the plantain foxysporum are prevented, and safe production of the banana is guaranteed.
Description
Technical field
The invention belongs to crop disease control and technical field of plant quarantine, particularly, relate to a kind of duplex PCR molecule method for quick of powder plantain wilt.
Background technology
Banana blight is the destructive disease of banana, is also important quarantine disease.Banana blight occurs in China's banana main producing region, constitutes crushing threat, also have impact on the income of banana producing region peasant, hinder the process of building Socialist New China's banana industry.Banana blight bacteria is propagated to be with soil bacteria and seedling, and quick, the accurate detection of germ is significant to pre-disease prevention diffusion.The seed borne fungi of banana plant and soil is the early diagnosis of banana blight and the key index of disease monitoring.
In recent years, the generation of withering along with banana, spread and pathogenic bacteria variation develop, the plantain of China also starts blight occurs, and serious plot sickness rate reaches more than 30%.Correlative study shows, cause the pathogenic bacteria of plantain blight mainly No. 1 physiological strain or the phylogenetic ancestry new with nearer one of No. 1 physiological strain sibship, this pedigree may be that No. 1 Race evolution comes (Lv Shun etc., 2014).Current China has utilized randomly amplified polymorphic DNA (RAPD) technology, or No. 1, banana blight bacteria and No. 4 distinctive pathogenic related gene primers of physiological strain (Li Minhui etc., 2012), invent the report of the PCR Fast Detection Technique for detecting banana blight No. 4 microspecies (race 4) or No. 1 microspecies (race 4), but there is larger genetic variation and genetic differentiation in banana blight No. 4 microspecies or No. 1 microspecies, the molecule method for quick of current foundation is mainly set up for the physiological strain in domestic somewhere, only utilize set up indivedual primer carry out rapid detection may in microspecies some differentiation monoid cannot detect.This may cause false negative phenomenon, causes the false judgment to experimental result.In addition, China does not also have the molecule method for quick for plantain blight at present.
Summary of the invention
In order to overcome the shortcoming of prior art with not enough, primary and foremost purpose of the present invention is the duplex PCR molecule method for quick providing a kind of powder plantain (dwarf banana and plantain) Pathogen of Fusarium Wilt, the molecule rapid detection primer that the method provides not only can detect plantain wilt, also can detect the dwarf banana blight dominant microflora of In Guangdong Province, have easy and simple to handle, consuming time few, sensitivity advantages of higher; In addition, by this technology, powder plantain seedling, growing area soil extraction, irrigation water etc. are detected, prevent the diffusion of plantain blight with spread, for guarantee China's banana disease-free seedlings production base construction, guarantee banana safety in production significant.
The duplex PCR molecule method for quick of powder plantain Pathogen of Fusarium Wilt of the present invention is started with from the distinctive gene order of plantain wilt, devise two pairs of special primers for the differentiation monoid that plantain wilt two is different, this primer can detect plantain wilt 2 difference differentiation monoid simultaneously; Meanwhile, because the monoid 2 of plantain wilt is identical with advantage No. 1 microspecies (dwarf banana wilt) the monoid gene of In Guangdong Province, therefore, this detection method also can detect the dwarf banana blight dominant microflora of In Guangdong Province.The method is easy to operation, production practice can be directly applied to the form of test kit, for the highly sensitive rapid detection of the plant tissue that carries disease germs or soil, production is ensured to provide healthy aseptic seedling, be of great significance nosophyte numerator early warning tool.
Technical scheme of the present invention is as follows: the duplex PCR molecule method for quick of a kind of powder plantain (dwarf banana and plantain) wilt, is characterized in that, comprise the following steps:
(1) design powder plantain wilt monoid 1 and monoid 2 special primer, primer sequence is as follows:
(2) sample is processed, extracting sample DNA;
(3) take sample DNA as template, use powder plantain wilt monoid 1 and monoid 2 special primer to carry out duplex PCR amplified reaction;
(4) amplified production is detected with 1.2%-1.5% agarose gel electrophoresis, when PCR primer presents the amplified band of 755bp, namely show containing plantain wilt in sample, when PCR primer presents the amplified band of 590bp, show in sample containing dwarf banana or plantain wilt.
Sample described in step (2) is powder plantain pathogenic bacteria, and described extracting sample DNA is the DNA of the hypha,hyphae utilizing the SDS method improved to extract.
Sample described in step (2) is banana plant tissue, and described extracting sample DNA is utilize the DNA in CTAB method extracting banana plant tissue, and selected Banana Tissue position is Banana Root, bulb or false stem tissue.
When sample described in step (2) is soil, described extracting sample DNA is preferably and uses soil genomic dna rapid extraction test kit to extract the soil DNA of doubting and infecting.
The reaction conditions of the duplex PCR amplified reaction described in step (3) is preferably 94 DEG C of denaturation 5min; 94 DEG C of sex change 1min, 65 DEG C of annealing 1min, 72 DEG C extend 1min, 35 circulations; 72 DEG C extend 10min;
The system (50 μ L) of the duplex PCR amplified reaction described in step (3) is as follows:
Detecting with agarose gel electrophoresis detection preferred 1.2%-1.5% (w/v) agarose gel electrophoresis described in step (4).
Described powder plantain wilt duplex PCR molecule method for quick is detecting the application of dwarf banana and plantain wilt.
The duplex PCR molecule method for quick of described powder plantain wilt is by being applied to the detection of fragrant plantain illing tissue DNA, the detection of the pathogenic fungi that illing tissue is directly separated, the detection of the Different groups of dwarf banana and plantain wilt physiological strain in soil, helps the quarantine of fragrant plantain seedling, soil surface characters detection, the fragrant early diagnosis of plantain disease in field and the monitoring of germ and qualification.
The mechanism of the duplex PCR molecule method for quick of plantain Pathogen of Fusarium Wilt of the present invention is:
With the universal primer of the Fusariumsp reported (Fusarium) IGS, its sequence is as follows:
iNL11：5’-AGGCTTCGGCTTAGCGTCTTAG-3；’
iCNS1：5’-TTTCGCAGTGAGGTCGGCAG-3’)。
With the universal primer amplification plantain Pathogen of Fusarium Wilt genome DNA of above-mentioned Fusariumsp (Fusarium) IGS and the pathogenic bacteria gene group DNA of other physiological strain.Order-checking obtains the rrna rDNA intergenic region IGS sequence of plantain Pathogen of Fusarium Wilt and other physiological strain of banana blight.From NCBI and Fusarium database, download the IGS sequence of other specialized form of Fusarium oxysporum, and belong to the IGS sequence of other kind of Fusariumsp together, compared by Mega 6.0 software.Analyze the sequence difference of plantain Pathogen of Fusarium Wilt and other physiological strain bacterial strain of banana blight, find out the gene that plantain Pathogen of Fusarium Wilt characteristic has, i.e. mononucleotide site.Belong to the sequence gap of other kind of bacterial strain according to plantain pathogenic bacteria and other physiological strain of Pathogen Causing Banana Fusarium Wilt and Fusariumsp together, obtain the specific gene site of plantain Pathogen of Fusarium Wilt as shown in Figures 1 and 2.Application Premier 5.0 software, in conjunction with design of primers principle, carries out the design of plantain wilt specific detection primer.Utilize the primer of design to be screened by Standard PCR, obtain the Auele Specific Primer 2 detecting plantain wilt two different differentiation monoid right.
Because the monoid 2 of plantain wilt is identical with advantage No. 1 microspecies monoid gene of In Guangdong Province, therefore, these two pairs of Auele Specific Primers also may be used for the detection of the dwarf banana wilt of In Guangdong Province.
The present invention, relative to prior art, has following advantage and effect:
(1) the present invention starts with from the distinctive gene order of plantain wilt, two pairs of special primers are devised for the differentiation monoid that plantain wilt two is different, this primer can detect plantain wilt 2 difference differentiation monoid simultaneously, and identification level reaches below physiological strain and breaks up monoid rank.
(2) because the monoid 2 of plantain wilt is identical with the IGS gene fragment of the advantage No. 1 microspecies monoid of In Guangdong Province, therefore, detection method of the present invention also can detect the dwarf banana blight dominant microflora of In Guangdong Province.
(3) detection method of the present invention is easy to operation, production practice can be directly applied to the form of test kit, for the highly sensitive rapid detection of the plant tissue that carries disease germs or soil, production is ensured to provide healthy aseptic seedling, be of great significance nosophyte numerator early warning tool.
(4) the duplex PCR detection technique PCR reaction that the present invention sets up directly can detect the dwarf banana wilt dominant microflora of plantain wilt two monoids and In Guangdong Province simultaneously; Meanwhile, the sensitivity detecting the powder plantain wilt mycelia be separated to can reach 0.4 μ g, and the sensitivity of detection zone soil bacteria can reach the spore concentration of every gram of soil 40 pathogenic bacterias.
Accompanying drawing explanation
Fig. 1 plantain withered pathogenic bacteria (monoid 1) specific gene site.
Fig. 2 plantain withered pathogenic bacteria (monoid 1) specific gene site.
Fig. 3 is that specific detection primer DJTY8F/DJTY8R is to fragrant plantain wilt and other Fusariumsp pcr amplification result.
Fig. 4 is that specific detection primers F DJ6-F/FDJ6-R is to fragrant plantain wilt and other Fusariumsp pcr amplification result.
Fig. 5 is to fragrant plantain wilt and other Fusariumsp pcr amplification result based on duplex PCR technology.
Fig. 6 is duplex PCR detection system sensitivity technique electrophorogram.
Fig. 7 is the amplification electrophorogram of duplex PCR detection system to fall ill powder plantain tissue DNA and upper bacterial isolate bacterium DNA thereof.
Fig. 8 is that duplex PCR detection system mixes the amplification electrophorogram of soil bacteria DNA to the different spore content positive.
Embodiment
Below in conjunction with embodiment and accompanying drawing, the present invention is described in further detail, but embodiments of the present invention are not limited thereto.
Indicate: powder plantain of the present invention refers to dwarf banana or plantain.
Embodiment 1: the design of plantain wilt Auele Specific Primer and screening
1, strains tested
The strains tested numbering of banana blight bacteria No. 4 microspecies (Race4) and banana blight bacteria No. 1 microspecies (Race 1), source and little type, in table 1, existing are all stored in this laboratory.In table 1,23 bacterial strains are except FOB-5, F-6-1 and DG-2-1, other 20 bacterial strains are in document (" qualification of plantain Pathogen of Fusarium Wilt and TEF-1 α sequential analysis ", Plant Pathology, 2014,44 (4): 337-348), and document (" 9 based on the qualification of polygene sequential analysis to Fusarium oxysporum Cuba specialized form (banana blight bacteria) physiological strain ", fungus journal, 2014,33 (4): 867-882) open in.
Table 1 is for examination banana blight bacteria strain Table 1 Isolates of Fusarium oxysporum used in this study
Note:
arace 2, Race 3, BW4, from Australia, for south China university week and merit professor is so kind as to give (professor Jiang Zide represents), are respectively No. 2, No. 3 and No. 4, subtropics physiological strain (ST4).
bhN 1 and HN 4 is so kind as to give for Chinese Academy of Tropical Agricultural Sciences Xie Yixian researcher, is respectively No. 1 and No. 4 (TR4) physiological strains in the torrid zone;
cfOB-5 and DG-2-1 is that Guangdong Academy of Agricultural Sciences Xie great Sen researcher gives.
dthe qualification of microspecies is mainly by determining the Pathogenicity of Brazilian any of several broadleaf plants (AAA) and dwarf banana (ABB).All the other are the present inventor and are separated, all Pathogenicity.
2, the extraction of fungal DNA: with the DNA of the SDS method extracting banana blight bacteria improved; Concrete steps are as follows:
(1) liquid transfer gun head of bacterial strain sterilizing that single spore separation is cultivated is scraped off mycelium lightly from substratum, then choose that to be placed in-20 DEG C of refrigerators in sterilized 2mL centrifuge tube for subsequent use.(2) choose the 2mL centrifuge tube of mycelia to a sterilizing of soybean grain size, often pipe adds 2 steel balls with dehydrated alcohol calcination, adds 400 μ LSDS damping fluids; Grinding is smashed mycelia and is about 20min, 12000rpm, 4 DEG C of centrifugal 10min, gets supernatant 400 μ L; (3) add 200 μ L spores and phenol, 200 μ L chloroforms, 12000rpm, 4 DEG C of centrifugal 15min, get supernatant; (4) 2 μ L RNase are added, 37 DEG C of water bath with thermostatic control 1h; (5) add 200 μ L spores and phenol, 200 μ L chloroforms, 12000rpm, 4 DEG C of centrifugal 15min, get honest and upright and thrifty 350 μ L; (6) add 2 times of volume dehydrated alcohols of supernatant, 1/2 volume NaOAC, gently overturn mixing ,-20 DEG C freeze 30min; (7) 12000rpm, 4 DEG C of centrifugal 10min, abandon supernatant; (8) add 100 μ L 70% alcohol and wash DNA two or three time, dry; (9) add 50 μ L deionized waters, mixing, preserves in-20 DEG C of refrigerators.
3, rrna rDNA intergenic region (IGS) sequence of amplification plantain wilt: Fusariumsp (Fusarium) the IGS universal primer sequence reported is as follows:
iNL11：5’-AGGCTTCGGCTTAGCGTCTTAG-3’；
iCNS1：5’-TTTCGCAGTGAGGTCGGCAG-3’。
Increase with above-mentioned primer iNL11 and iCNS1 the pathogenic bacteria gene group DNA of plantain Pathogen of Fusarium Wilt genome DNA cited by table 1 and other physiological strain.
PCR reaction conditions is: 94 DEG C of denaturation 2min, 94 DEG C of sex change 1min, 55 DEG C of annealing 1min, and 72 DEG C extend 1min, 35 circulations; 72 DEG C of total elongation 5min.
Amplified production is separated through 1.2% agarose gel electrophoresis, obtain about 2100bp amplified band, object fragment reclaims test kit through DNA glue and reclaims purifying rear clone in pMD18-T carrier, and positive colony is checked order by Invitrogen biotechnology company limited Guangzhou Branch.
Sequencing primer comprises iNL11 and iCNS1, and primer NLa and CNSa (" A moleculardiagnostic for tropical race 4 of the banana Fusarium wilt pathogen " .Plant Pathology, 59:348 ?357, Dita MA, Waalwijk C, Buddenhagen IW, Souza Jr MT, Kema GHJ, 2010), the two sequence is as follows:
NLa：5’-TCTAGGGTAGGCKRGTTTGTC-3’；
CNSa：5‘-TCTCATRTACCCTCCGAGACC-3’。
Order-checking obtains plantain Pathogen of Fusarium Wilt and comprises two different differentiation monoids, and its IGS sequence is as follows:
The IGS sequence of monoid 1:
CCGGCGCTCGAGCGCGTCGTGGTATTTCGCGTATTGTAATTTCAACACGAGCGGGGTCAAATCCTTTGCAGACGACTTAGCTGTGCGAAACGGTCCTGTAAGCAGTAGAGTAGCCTTGTTGTTACGATCTGCTGAGGGTAAGCCGTCCTTCGCCTCGATTTCCCCAATGGGTTCTCCGGATTTCTGGAGACTTGTAGGGGTTGTGGGTTTTTTCGATGTGTCGTCTCCGGACGGGCGGTGCAGGGTAGTCGAGTTAGACTTGGTGGAATTCCGTCGAGTCTGGTCGGCTGTGTGTTGGACGGTGCAGGGTAGGCTGCTTGGACATGGTCGGTTCGAGGATCGATTCGAGGGCCGGCCTGTCGATGATGTGTGATGTATGCGGTCTAGGGTAGGCTGGTTTGTCTTGGTTCAATTTGATGTCGGCTCCCGTGCAGGCCAGAGTGAGGGGGGTCCAGGGTAGGTACAGGGTAGGCAGCTTAGATTTGGTCGATCTGGAGGTCGATTCTCCGGCTGGCGGATCTGACACTGTCGAAACGAGGTGCGAGCGGTGTAGGGTAGGCTAGTTTCGTCCTCGCCAGGTTGCGATTTGGACGATATATGTGGTCTAGGGTATGCTCTAGGGTAAGTAGAATTCGAGTTTCGTCGCCGACAGTTTTCTGTGGGTGTATGGTAGGTACAGGGTAGGCAAATCTCTCTCCGGCCAGTACTTGTCTGGTGGTCGTGAGTCGATTTTTTTGTTTTGCCATACTATTGAATTTTGCGGAAATTCAAAAGTGGCTCGGGAGTCCCGCCTGGCGTGCGTCCGACTTGAACATCGTCGGTGTACATATGAGAGGGAGTAATCCGGCCCGGCCGGGGCCCATCACGAGCTGCCGGGTAGGTAAAAGTAAAAAAGTTGTTAAGAGGCGCGGTGTCGGCGTGCTTGTATTTGCGGGAGAGAATTATCTGGAGGTGCTGGGTAGCCGGGAAGACTTGGACGGATCTGGCCCGGGAATGGGTCTGGGCCTGGATTCTGGTGTGGTGTAGGGTAGGCGTAGATAGATGAGTGGTCTAGGGTAGATACAGGGTAGCCAGAAGTCTGGTATATAGTATGGGGGTGTAGGGTAGGTCTGGACACCGTTTTCCACTTCGCCCTTCCCTTTAGTCGAGGGAGGACGATCTTGGCTGGGACGGAGGTGTAGGGTAGGCTTAATTTACGATTACATGATCTGTGTCACTCTAGGGTAGGTGAAAATCCCATATATATATGATCACATTTGGTGAAGAGGTGGTTTGGCTGGTGAGATGGACAAAAGTGCAATATAGAATTATATGTGATTTTGCAAAAGTGGGTGTGAAATTGGGAAATCGGTTTTCCCGCACAGATGAGAGCACGTTTGAGGTGCCATGAGATGCACCTCTCCGAGACGACCTCAACGGTACCGCCGATGTGTTGGTCGGGCTCCTGTGCGGCCGTCCAGGGCGGGATAAGTAAAAGATGTGGTGGTGTAGGGTAGGTAGATAGGTCCAGGGTAGGTTCACTAGATCCGTCAATTCGGCTTTAATCGAAGGACAGGTCTAGGGTAGGCCAGAGTCGGGTCTAGGGTAGGCAGCTCTCACCCTCGAAGTGGTCTACCCGGTAGCCAACTTCAATCGCCTCTCACGGCCGCCACGGACCTCGCATGACGACGGGACTACCACCATCGGATTTGCCTTGGTCGAAATAGTTGGTATATGCACTTTTGAAAAAATGCGTGCAAAATGGTTTTGTGGTTTGGTGGCCGTGAGTCGATTTTTTTGTTTTCCCATACAAATGAATTTTGCGGAAAATAAAAAGTGGCCCACGAGGCAGCTCTGGCGTGCGGCCCACTAAAACGGTCTCGGAGGGTATATGAGAAGGGAGCAAATCCGGCCGAGCCTGAAAGGGTGAGGACAAACCGGGCGAGCAACCTCTCAGTATCAGATCTTGCAGACTTCCACTGCGTGTCCCTCTGTACAGCTTTGCAGGCTCCGGCCTCGGCAGCGGGGGGTTCATAGTGGTCGTCGACCTCCACGAAACTGCACGCTCCGGCGTGACAGCGTACTGGGGATGCCTGTGTAGATGCAGTCCGGGCTTGCCTGGACCGCTAGCAGATGGGCTCTGTGGATGACTGGCCGCTGGCTAGACCTGAAACCTGAGCAACGGGAGGTAACCTCTCGCCGCGGACACCGGAATGGTAGAAGCGGCGTGCTGCGTCCTCCTCTTGGGGCCCCTAAGCCACACCTCCCACAGCGGGTTCGGTGCGGCGGACGGACGCCCTGGGGAATTAGAGGGGAAAGCGGATGCCC
The IGS sequence of monoid 2:
GCGCGTCGTGGTATTTCGCGTATTGTAATTTCAACACGAGCGGGGTCAAATCCTTTGCAGACGACTTAGCTGTGCGAAACGGTCCTGTAAGCAGTAGAGTAGCCTTGTTGTTACGATCTGCTGAGGGTAAGCCGTCCTTCGCCTCGATTTCCCCAATGGGTTCTCCGGATTTCTGGAGACTTGTAGGGGTTGTGGGTTTTTTTTCGATGTGTCGTCTCCGGACGGGCGGTGCAGGGTAGTCGAGTTAGACTTGGTGGAATTCCGTCGATAGGAGTTCCGTCGAGTCTGGTCGGCTGTGTGTTGGACGGTGCAGGGTAGGCTGCTTGGACATGGTCGGTTCGAGGATCGATTCGAGGGCCGGCCTGTCGATGATGTGTGATGTATGCGGTCTAGGGTAGGCTGGTTTGTCTTGGTTCAATTTGATGTCGGCTCCCGTGCAGGCCAGAGTGAGGGGGGTCCAGGGTAGGTACAGGGTAGGCAGCTTAGATTTGGTCGATCTGGAGGTCGATTCTCCGGCTGGCGGATCTGATCAGCACTGTCGAAACGAGATGCGAGCGGTGTAGGGTAGGCTAGTTTCGTCCTCGCCAGGTTGCGATTCGGACGAGATATGTGGTCTAGGGTAGGCTCTAGGGTAAGTAGAATTCGAGTTTCGTCGCCGACAGTTTTCTGTGGGTGTATGGTAGGTACAGGGTAGGCAGATCTCTCTCCGGCCAGTACTTGTCTGGTGGTCGTGAGTCGATTTTTTTGTTTTGCCATACTATTGAATTTTGCGGAAATTCAAAAGTGGCTCGGGAGTCCCGCCTGGCGTGCGTCCGGCTCGAACATCGTCGGTGTACATATGAGAGGGAGTAATCCGGCCCGGCCGGGGCCCATCGCGAGCTGCCGGGTAGGTAAAAGTAAAAAAGTTGTTAAGAGGCGCGGTGTCGGCGTGCTTGTATTTGCGGGAGAGAATTATCTGGAGGTGCTGGGTAGCCGGGAAGACTTGGACGGATCTGGCCCGGGAATGGGTCTGGGCCTAGATTCTGGTGTGGTGTAGGGTAGGCGTAGATAGATGAGTGGTCTAGGGTAGATACAGGGTAGCCAGAAGTCTGGTATATAGTATGGGAGGTGTAGGGTAGGTCTGGACACTGTTTTCCGCTTTGCCCTTCCCTTTACTCGAGGGGAGGACGATCTTGGCTGGGACGGAGGTGTAGGGTAGGCTTAATTTACGATTACATGATCTGTGTAACTCTAGGGTAGGTGAAAATCCCATATATATCTGATCACATTTGGTGAAGAGGTGGTTTGGCTCGTGAGATGGACAAAAGTGCAATGTAGAATTATATGTGATTTTGCAAAAGTGGGTGTGAAATTGGGAAATCGGGTTTCCCGCACAGATGAGAGCACGTTTGAGGTGCCATGAGATGCACCTCTCCGAGACGACCTCAACGGTACCACCCATGTGTTGGTCGGGCTCCTGTGCGCCGTCCAGGGCGGGATAAGTAGAGAATGTGGTGGTGTAGGGTAGGTGACCAGGTCCAGGGTAGGTTCGCCAAATCCGTCAATCCGGCTTGAATCGAAGGACAGGTCTAGGGTAGGCCAGAGTCGGGTCTAGGGTAGGCAACCCTCACCCTCGAAGTGGTCTACCCGGTAGCCAACTTCAATCGCCTCTCACGGCCGCCACGGACCTCGAATGACGATGGGACTACCACCATCGGACTCGCCTTGGTCGAAATAGCTGGTATATGCACTTTTGAAAAAATGCGTGCAAAATGGTTTTGTGGTTTGGTGGCCGTGAGTCGATTTTTTTGTTTTCCCATACAAATGAATTTTGCGGAAAATAAAAAGTGGCCCACGAGGCAGTCCTGGCGTGCGGCCCACTAAAACGGTCTCGGAGGGTATATGAGAAGGGAGCAAATCCGGCCGAGCCTGAAAGGGTGAGGACAAACCGGGCGAGCAACCTCTCAGTATCAGATCTTGCAGACTTCCACTGCGTGTCCCTCTGTACAGCTTTGCAGGCTCCGGCCTCGGCAGCGGGGGGTTCATAGTGGTCGTCGACCTCCACGAAACTGCACGCTCCGGCGTGACAGCGTACTGGGGATGCCTGTGTAGATGCAGTCCGGGCTTGCCTGGACCGCTAGCAGATGGGCTCTGTGGATGACTGGCCGCTGGCTAGACCTGAAACCTGAGCAACGGGAGGTAACCTCTCGCCGCGGACACCGGAATGGTAGAAGCGGCGTGCTGCGTCCTCCTCTTGGGGCCCCTAAGCCACACCTCCCACAGCGGGTTCGGTGCGGCGGACGGACGCCCTGGGGAATTAGAGGGGGAAAGCGGATGCCC
4, PCR special primer design
Amplification obtains the rrna rDNA intergenic region IGS sequence of plantain Pathogen of Fusarium Wilt and other physiological strains of banana blight, the IGS sequence of other specialized form of Fusarium oxysporum is downloaded from NCBI and Fusarium database, and belong to the IGS sequence of other kind of Fusariumsp together, compared by Mega 6.0 software, analyze the sequence difference that plantain Pathogen of Fusarium Wilt and other physiological strain of banana blight and Fusariumsp belong to other kind of bacterial strain together, gene (mononucleotide) site that finding out plantain Pathogen of Fusarium Wilt characteristic has obtains the specific gene site of plantain Pathogen of Fusarium Wilt as shown in Figures 1 and 2.
Application Premier 5.0 software, in conjunction with design of primers principle, carries out the design of plantain wilt specific detection primer.Design obtains multipair PCR primer, is screened by Standard PCR, obtains the Auele Specific Primer 2 detecting plantain wilt two Different groups right, its Primer and sequence as follows:
DJTY8F：5′GCCTGGCGTGCGTCCGACTT3′
DJTY8R：5′AAGCCGAATTGACGGATCTA3′；
FDJ6-F：5'TTTCGTCCTCGCCAGGTTGCGATTC 3'
FDJ6-R：5'CCCCTCGAGTAAAGGGAAGGGCA 3'。
Embodiment 2:
Duplex PCR detection system is to powder plantain wilt DNA and contrast and the detection of peripheral bacterial strain DNA
The plantain region of disease different from Guangdong Province gathers fragrant plantain blight sample, cut the strong little block organization of intersection of diseased plant bulb disease, conventional organization partition method is adopted to carry out being separated (see " planting disease research method ", Beijing: Chinese agriculture press, Fang Zhongda, 1998), dark culturing 2-3d in potato dextrose agar (PDA), at 25 DEG C, after growing bacterium colony, choose the pure culture of colony edge Tip Splitting, carry out single spore separation after producing conidium, and Pathogenicity is carried out to single-ascospore strain, preserve pathogenic single-ascospore strain for subsequent use.Bacterium source and numbering are in table 1.The bacterial strain of preservation is activated on PDA flat board, dark culturing 3-4d at 25 DEG C, picking inoculated by hypha block in yeast powder peptone dextrose nutrient solution (YPD), 25 DEG C, shaking culture 3d under 200rpm.Leach mycelia with Büchner funnel, it is for subsequent use that the water through sterilizing fully washs final vacuum lyophilize collection mycelia.
Wherein, component and the concentration of described YPD nutrient solution are: 2% glucose, 1% yeast extract powder, 2% peptone.
Extraction (SDS method) step of hypha,hyphae DNA is with embodiment 1.
With the genomic dna of the plantain wilt through identifying, No. 1, banana blight bacteria and No. 4 physiological strains and control strain totally 23 bacterial strains for template, the Auele Specific Primer of 2 pairs of powder plantain wilts of the present invention is utilized to carry out PCR detection, amplification system with reference to table 4, and establishes clear water to contrast.The amplified production agarose gel electrophoresis of 1.2% detects.As shown in figures 3-5, in accompanying drawing 3, accompanying drawing 4 and accompanying drawing 5: M is DL2000, band 1 is DBDJ to result; 2 is DJ-6-12; 3 is DJ-7-13; 4 is DJ-13-13; 5 is DJ-8-13; 6 is DJ-11-1; 7 is DJ-9-2; 8 is DJ-12-1; 9 is FJ-9-3; 10 is FJ-2-1; 11 is FJZ1; 12 is BobaiFJ; 13 is HN 1; 14 is Race 2; 15 is Race 3; 16 is Bw4; 17 is XJ-1-7; 18 is HN 4; 19 is AB-2-8; 20 is FOB-5; 21 is FJ-22-2; 22 is F-6-1; 23 is DG-2-1; 24 is clear water contrast.
Result shows, in 23 bacterial strains for examination, the differentiation monoid different except plantain wilt two and the Guangdong dwarf banana wilt bacterial strain identical with plantain wilt monoid 2 gene can amplify except the amplified band that size is 755bp and 590bp by duplex PCR respectively, other Pathogen Causing Banana Fusarium Wilt strain (1,2,3, No. 4 physiological strain), the bacterial strains such as sugarcane Fusariumsp, Fusarium oxysporum wax gourd specialized form and wax gourd epidemic disease are mould all can not amplify band (see table 1).The PCR primer obtained increasing is after DNA glue reclaims test kit recovery and purifying checks order, and the specific amplified sequence obtaining the different differentiation monoid of plantain wilt 2 and Guangdong dwarf banana wilt is as follows:
The specific DNA sequence (755bp) of plantain wilt monoid 1:
GCCTGGCGTGCGTCCGACTTGAACATCGTCGGTGTACATATGAGAGGGAGTAATCCGGCCCGGCCGGGGCCCATCACGAGCTGCCGGGTAGGTAAAAGTAAAAAAGTTGTTAAGAGGCGCGGTGTCGGCGTGCTTGTATTTGCGGGAGAGAATTATCTGGAGGTGCTGGGTAGCCGGGAAGACTTGGACGGATCTGGCCCGGGAATGGGTCTGGGCCTGGATTCTGGTGTGGTGTAGGGTAGGCGTAGATAGATGAGTGGTCTAGGGTAGATACAGGGTAGCCAGAAGTCTGGTATATAGTATGGG-GG-TGTAGGGTAGGTCTGGACACCGTTTTCCACTTCGCCCTTCCCTTTAGTCGAGGG-AGGACGATCTTGGCTGGGACGGAGGTGTAGGGTAGGCTTAATTTACGATTACATGATCTGTGTCACTCTAGGGTAGGTGAAAATCCCATATATATATGATCACATTTGGTGAAGAGGTGGTTTGGCTGGTGAGATGGACAAAAGTGCAATATAGAATTATATGTGATTTTGCAAAAGTGGGTGTGAAATTGGGAAATCGGTTTTCCCGCACAGATGAGAGCACGTTTGAGGTGCCATGAGATGCACCTCTCCGAGACGACCTCAACGGTACCGCCGATGTGTTGGTCGGGCTCCTGTGCGGCCGTCCAGGGCGGGATAAGTAAAAGATGTGGTGGTGTAGGGTAGGTAGATAGGTCCAGGGTAGGTTCACTAGATCCGTCAATTCGGCTT
The specific DNA sequence (590bp) of plantain wilt monoid 2 and Guangdong dwarf banana wilt:
TTTCGTCCTCGCCAGGTTGCGATTCGGACGAGATATGTGGTCTAGGGTAGGCTCTAGGGTAAGTAGAATTCGAGTTTCGTCGCCGACAGTTTTCTGTGGGTGTATGGTAGGTACAGGGTAGGCAGATCTCTCTCCGGCCAGTACTTGTCTGGTGGTCGTGAGTCGATTTTTTTGTTTTGCCATACTATTGAATTTTGCGGAAATTCAAAAGTGGCTCGGGAGTCCCGCCTGGCGTGCGTCCGGCTCGAACATCGTCGGTGTACATATGAGAGGGAGTAATCCGGCCCGGCCGGGGCCCATCGCGAGCTGCCGGGTAGGTAAAAGTAAAAAAGTTGTTAAGAGGCGCGGTGTCGGCGTGCTTGTATTTGCGGGAGAGAATTATCTGGAGGTGCTGGGTAGCCGGGAAGACTTGGACGGATCTGGCCCGGGAATGGGTCTGGGCCTAGATTCTGGTGTGGTGTAGGGTAGGCGTAGATAGATGAGTGGTCTAGGGTAGATACAGGGTAGCCAGAAGTCTGGTATATAGTATGGGAGGTGTAGGGTAGGTCTGGACACTGTTTTCCGCTTTGCCCTTCCCTTTACTCGAGGGG
Above result shows: 2 pairs of primer pair plantain wilts designed by the present invention and the dwarf banana wilt of In Guangdong Province have specificity, utilizes the accurate rapid detection that duplex PCR detection system provided by the present invention can realize powder plantain wilt.
The reaction system (50 μ L) that table 4 Auele Specific Primer PCR detects
Example 3: the detection of duplex PCR system sensitivity
Be dissolved in the water of 50 μ L after getting the fresh mycelia 100mg extracting DNA of plantain blight bacterial strain DJ-6-12, carry out duplex PCR detection with after 10 times of concentration gradient doubling dilutions as template, and establish clear water to contrast, with 2 μ L template DNAs during each amplification.The amplified production agarose gel electrophoresis of 1.2% detects.Duplex PCR detection system sensitivity technique the results are shown in Figure 6, DNA extract in dilution 10
4doubly still can amplify specific band, show that this system can detect the minimum existence being equivalent to the fresh mycelia of 0.4 μ g.In accompanying drawing 6, M is DL2000; 1-5 genomic dnas being followed successively by template bacterial strain DJ-6-12 dilute 10
0, 10
1, 10
2, 10
3, 10
4after PCR result; 6 is clear water contrast.
Example 4: detect powder plantain wilt from disease plant based on duplex PCR technology:
Dwarf banana and plantain disease sample is gathered from Guangdong powder-saving plantain blight region of disease, adopt the DNA of CTAB method extracting morbidity powder plantain bulb diseased tissues, and with for template, simultaneously with powder plantain pathogenic bacteria (FJ-9-3 and the DJ-6-12) DNA that diseased tissues is separated to for positive control, do negative control with healthy plantain tissue DNA, clear water and No. 4 physiological strain bacterial strain DNA, carry out duplex PCR detection.Result as shown in Figure 7,2 dwarf bananas of falling ill and plantain tissue DNA and 2 positive controls obtain being 755 and 590bp amplified band respectively, other healthy plantain tissue, clear water and No. 4 physiological strain bacterial strain DNA do not detect amplified band, and this result shows that the powder plantain tissue that set up duplex PCR detection system is applicable to falling ill detects.In accompanying drawing 7, M is DL2000; The pcr template of 1 is Ma Yong town, Dongguan plantain diseased plant DNA; The pcr template of 2 is Dongguan Wan Jiangqu dwarf banana diseased plant DNA; The pcr template of 3 is plantain wilt (DJ-6-12) DNA; The pcr template of 4 is dwarf banana wilt (FJ-9-3) DNA; The pcr template of 5 is banana blight bacteria (XJ-1-7) DNA; The pcr template of 6 is Ma Yong town, Dongguan healthy plantain plant DNA; 7 is clear water contrast.
Example 5: duplex PCR detection system is to the Testing and appraisal mixing soil bacteria
For determining the minimum bacteria containing amount of the banana blight bacteria that can detect in soil, that has first prepared different spore content mixes soil bacteria, and the preparation method mixing soil bacteria is as follows: first prepare different concns, and namely 1 × 10
5, 1 × 10
4, 1 × 10
3, 1 × 10
2individual/mL, the spore suspension of plantain wilt DJ-6-12 and DJ-9-2, be then mixed into the spore suspension that concentration is joined by 2mL institute in every 50g sterile soil, mix the positive control making different concns native.
Get 1g and mix soil bacteria, according to the method extracting soil STb gene of test kit, step is as follows: the genomic dna extracting each bacterium in soil with E.Z.N.ASoil DNA kit (OMEGA) test kit, and concrete steps are as follows:
(1) in 15mL centrifuge tube, add the sample of mixing, add the SLX solution of 1 milliliter again, under top speed, vortex 3 minutes is until sample is broken up, add the DS damping fluid of 100 μ L again, vortex mixes, then be placed in 70 DEG C of water-bath temperature bath 10min, in the process of hatching, shake sample 2 times fully to mix sample; (2) add the SP2 solution of 200 μ L, vibrate and fully mix sample in 2 minutes, leave standstill after 5min on ice, at 4 DEG C 13,000g, centrifugal 5min; (3) careful transfer is got in supernatant liquor to new 2mL centrifuge tube, notes not being drawn onto precipitation or cell debris, adds Virahol isopyknic with got supernatant liquor, and overturns centrifuge tube 5-10 time to mix sample, under room temperature 13,000g, centrifugal 10min; (4) carefully outwell supernatant liquor and guarantee that DNA precipitation is not poured out, centrifuge tube being upside down in air-dry DNA sample on thieving paper; (5) ddH of 200 μ L is added
2o vortex 10 seconds, 65 DEG C of temperature bath 10-20min precipitate with complete dissolving DNA, of short duration centrifugal to collect the liquid be bonded on centrifugal tube wall.(6) 100 μ L are added by evenly resuspended HTR solution and after shaking 10 seconds, left at room temperature 2min, 13,000g, centrifugal 2min; (7) shift in supernatant liquor to new centrifuge tube.Attention: if supernatant still presents the color of comparatively attaching most importance to, repeats HTR extraction steps 6; (8) add 2 μ L RNase A (25mg/ml) and shake 10s, at 37 DEG C, temperature bath 10min is to eliminate the DNA in sample; (9) add 300 μ L XP2 solution, vibration mixing sample, move to one and be equipped with in the HiBind DNA column of 2ml collection tube, under room temperature 13,000g, centrifugal 1min, discards filtrate; (10) HiBind DNA column is placed in original collection tube, adds the XP2 solution of 300 μ L, under room temperature 13,000g, centrifugal 1min, discards filtrate; (11) moved on another collection tube by DNA column, to add under 700 μ L SPW washing lotion (diluting with dehydrated alcohol) room temperatures 13,000g, centrifugal 1min, discards filtrate, repeats this step once; (12), under room temperature 13,000g, centrifugal empty DNA column 2min is to abandon to the greatest extent SPW washing lotion; (13) DNA column is moved on a new 1.5ml centrifuge tube, add TE (or the ddH of 50 μ L
2o) to the central authorities of pillar, 65 DEG C of temperature are bathed at least after 5min, and room temperature 13,000g is centrifugal with eluted dna.(14) DNA getting 1-2 μ L extracting utilizes purity and the concentration of UV spectrophotometer measuring DNA sample, and with the ratio of OD260/OD280 for best during 1.8-2.0, the concentration of adjustment DNA is that 10ng/ μ L ~ 50ng/ μ L is advisable; Then be placed in-20 DEG C of refrigerators to save backup.
What obtain required detection mixes soil bacteria DNA, and carries out duplex PCR detection as template.The amplified production agarose gel electrophoresis of 1.2% detects.Based on duplex PCR detection system, the amplification of soil bacteria DNA is mixed as shown in Figure 8 to the different spore content positive: in accompanying drawing 8, M is DL2000; 1-4 for inoculum density be 1 × 10
5, 1 × 10
4, 1 × 10
3, 1 × 10
2the plantain wilt (DJ-6-12) of individual/mL mixes soil bacteria; 5 is DJ-6-12 (plantain wilt monoid 1 positive control); 6-9 for inoculum density be 1 × 10
5, 1 × 10
4, 1 × 10
3, 1 × 10
2the plantain wilt (DJ-9-2) of individual/mL mixes soil bacteria; 10 is DJ-9-2 (plantain wilt monoid 2 positive control); 11 is sterilized soil; 12 is clear water contrast.
Result display is except 1 × 10
2the soil bacteria of mixing of individual/mL concentration does not have outside PCR primer, and other spore concentration mixes soil bacteria all can detect specific PCR primer (Fig. 8), shows that detecting minimum bacteria containing amount is the spore that every gram of soil mixes 40 plantain wilts.Carry out the extracting of soil STb gene in conjunction with the soil of 1g, be dissolved in the ddH of 20 μ L
2in O, only use 2 μ L template DNAs during each detection, the minimum pcr template amount therefore detected from soil is equivalent to the DNA amount of 4 spores.Embodiment 7 shows that duplex PCR detection system of the present invention can be applicable to the detection of DNA in powder plantain blight lesion soil, to identify whether this growing area has the existence of cause of disease, for production plantation provides convenient and technical guarantee.
Above content is in conjunction with concrete preferred implementation further description made for the present invention, can not assert that specific embodiment of the invention is confined to these explanations.For general technical staff of the technical field of the invention, without departing from the inventive concept of the premise, its framework form can be flexible and changeable, can subseries product.Just make some simple deduction or replace, all should be considered as belonging to the scope of patent protection that the present invention is determined by submitted to claims.
Claims (6)
1. a duplex PCR molecule method for quick for powder plantain wilt, is characterized in that, comprise the following steps:
(1) design powder plantain wilt monoid 1 and monoid 2 special primer, primer sequence is as follows:
(2) sample is processed, extracting sample DNA;
(3) take sample DNA as template, use powder plantain wilt monoid 1 and monoid 2 special primer to carry out duplex PCR amplified reaction;
(4) amplified production is detected with 1.2%-1.5% agarose gel electrophoresis, when PCR primer presents the amplified band of 755bp, namely show containing plantain wilt in sample, when PCR primer presents the amplified band of 590bp, show in sample containing dwarf banana or plantain wilt.
2. the duplex PCR molecule method for quick of powder plantain wilt according to claim 1, it is characterized in that: the sample described in step (2) is dwarf banana or plantain germ, the method for described extracting sample DNA is the DNA utilizing SDS method extracting dwarf banana or the plantain wilt mycelia of improving.
3. the duplex PCR molecule method for quick of powder plantain wilt according to claim 1, it is characterized in that: the sample described in step (2) is banana plant tissue, the method of described extracting sample DNA is utilize the DNA in CTAB method extracting banana plant tissue, and selected Banana Tissue position is Banana Root, bulb or false stem tissue.
4. the duplex PCR molecule method for quick of powder plantain wilt according to claim 1, it is characterized in that: the sample described in step (2) is soil, the method for described extracting sample DNA is use soil genomic dna rapid extraction test kit to extract the soil DNA of doubting and infecting.
5. the duplex PCR molecule method for quick of powder plantain wilt according to claim 1, is characterized in that: the reaction conditions of the duplex PCR amplified reaction described in step (3) is 94 DEG C of denaturation 5min; 94 DEG C of sex change 1min, 65 DEG C of annealing 1min, 72 DEG C extend 1min, 35 circulations; 72 DEG C extend 10min.
6. the duplex PCR molecule method for quick of powder plantain wilt according to claim 1, is characterized in that: the system 50 μ L of the duplex PCR amplified reaction described in step (3) is as follows:
DNA profiling 2 μ L, containing Mg
2+10 × PCR buffer 5 μ L, the dNTP 5 μ L of 2.5mM, the DJTY8-F 1 μ L of 10 μMs, the DJTY8-R 1 μ L of 10 μMs, the FDJ6-F 1 μ L of 10 μMs, the Taq enzyme 0.5 μ L of the FDJ6-R1 μ L of 10 μMs, 5U/ μ L, ddH
2o 33.5 μ L, totally 50 μ L.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410828054.7A CN104450939B (en) | 2014-12-25 | 2014-12-25 | The duplex PCR molecule method for quick of powder plantain wilt |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410828054.7A CN104450939B (en) | 2014-12-25 | 2014-12-25 | The duplex PCR molecule method for quick of powder plantain wilt |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104450939A true CN104450939A (en) | 2015-03-25 |
| CN104450939B CN104450939B (en) | 2016-07-06 |
Family
ID=52897684
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410828054.7A Active CN104450939B (en) | 2014-12-25 | 2014-12-25 | The duplex PCR molecule method for quick of powder plantain wilt |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104450939B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106119360A (en) * | 2016-06-29 | 2016-11-16 | 东莞市香蕉蔬菜研究所 | A kind of SCAR molecular marker identifying banana blight resistance and authentication method thereof |
| CN109609492A (en) * | 2018-12-19 | 2019-04-12 | 上海派森诺生物科技股份有限公司 | A kind of extracting method of microbial diversity |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101205558A (en) * | 2006-12-22 | 2008-06-25 | 福建省农业科学院植物保护研究所 | Banana wilt bacterium molecule detecting genes and detecting method thereof |
| CN101899506A (en) * | 2010-05-18 | 2010-12-01 | 华南农业大学 | Detection primer for No.1 and No.4 physiological strains of fusarium oxysporum f. sp cubense and rapid detection method |
| CN103789443A (en) * | 2014-02-25 | 2014-05-14 | 广东省农业科学院植物保护研究所 | Multiple intermolecular rapid detection method for banana wilt bacteria and bacterial Erwinia carotovora |
-
2014
- 2014-12-25 CN CN201410828054.7A patent/CN104450939B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101205558A (en) * | 2006-12-22 | 2008-06-25 | 福建省农业科学院植物保护研究所 | Banana wilt bacterium molecule detecting genes and detecting method thereof |
| CN101899506A (en) * | 2010-05-18 | 2010-12-01 | 华南农业大学 | Detection primer for No.1 and No.4 physiological strains of fusarium oxysporum f. sp cubense and rapid detection method |
| CN103789443A (en) * | 2014-02-25 | 2014-05-14 | 广东省农业科学院植物保护研究所 | Multiple intermolecular rapid detection method for banana wilt bacteria and bacterial Erwinia carotovora |
Non-Patent Citations (2)
| Title |
|---|
| 曾莉莎等: "基于多基因序列分析对尖孢镰孢菌古巴专化型（香蕉枯萎病菌）生理小种的鉴定", 《菌物学报》, vol. 33, no. 4, 15 July 2014 (2014-07-15) * |
| 郭立佳等: "大蕉枯萎病病原菌的分离、鉴定和致病性测定", 《热带作物学报》, vol. 34, no. 1, 25 January 2013 (2013-01-25) * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106119360A (en) * | 2016-06-29 | 2016-11-16 | 东莞市香蕉蔬菜研究所 | A kind of SCAR molecular marker identifying banana blight resistance and authentication method thereof |
| CN106119360B (en) * | 2016-06-29 | 2019-09-10 | 东莞市香蕉蔬菜研究所 | A kind of SCAR molecular labeling and its identification method for identifying banana blight resistance |
| CN109609492A (en) * | 2018-12-19 | 2019-04-12 | 上海派森诺生物科技股份有限公司 | A kind of extracting method of microbial diversity |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104450939B (en) | 2016-07-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101899506B (en) | Detection primer for No.1 and No.4 physiological strains of fusarium oxysporum f. sp cubense and rapid detection method | |
| Zheng et al. | Identification of a novel Alternaria alternata strain able to hyperparasitize Puccinia striiformis f. sp. tritici, the causal agent of wheat stripe rust | |
| CN101974650B (en) | Polymerase chain reaction (PCR) method for detecting fusarium oxysporum and kit | |
| Singh et al. | Smut disease assessment by PCR and microscopy in inoculated tissue cultured sugarcane cultivars | |
| CN101974651B (en) | Fluorescence quantitative polymerase chain reaction (PCR) detection method and detection kit for phytophthora capsici leonian | |
| Poletto et al. | Characterization and pathogenicity of Fusarium oxysporum associated with Carya illinoinensis seedlings | |
| CN104232782B (en) | A kind of detect tobacco soil-borne fungus pathogen PCR primer and application and method | |
| CN104830698A (en) | Pokkah boeng disease pathogen separating and identifying method | |
| Yin et al. | Identification of two Monilia species from apricot in China | |
| CN100588716C (en) | Detection primer for banana wilt germina number-four biological strain and method for detecting same | |
| CN104946760B (en) | A kind of method and dedicated kit for detecting Pythium inflatum | |
| CN1312475C (en) | Molecular detection method for fusarium toxin | |
| CN104232748B (en) | Whether a kind of red bayberry nursery stock carries the rapid molecular detection method of wilting germ | |
| CN104450939A (en) | Double PCR (Polymerase Chain Reaction) molecular rapid detection method of plantain foxysporum | |
| CN112029665A (en) | Rubber tree colletotrichum resistant strain HcgHNQZ1736 and application thereof in drug resistance research | |
| Moparthi et al. | Identification and prevalence of seedborne botrytis spp. in dry pea, lentil, and chickpea in Montana | |
| CN106967612A (en) | Produce the green pyrenomycetes of rice and its acquisition methods of five kinds of ustilaginoidea virens toxin | |
| CN105907872A (en) | Specific primers for detecting endogenousness of metarrhizium anisopliae in plant roots | |
| Al-Enezi et al. | Phenotypic and molecular diagnosis of Fusarium oxysporum and Macrophomina phaseolina isolated from cucumis melon roots | |
| Das et al. | Detection of Phytophthora nicotianae in water used for irrigating citrus trees by Ypt1 gene based nested PCR | |
| Motlagh et al. | Endophytic Fungi as Potential Biocontrol Agents against Sclerotium rolfsii Sacc.—The Causal Agent of Peanut White Stem Rot Disease | |
| Li et al. | Fusarium redolens causes black rot disease in Gastrodia elata grown in China | |
| CN104328205A (en) | Establishment of rapid detection method for grain sclerospora graminicola by LAMP | |
| Kutawa et al. | Identification and characterization of pathogen responsible for causing southern corn leaf blight (SCLB) disease in Malaysia. | |
| CN103882108B (en) | Method for detecting temperature sensitive microspecies gx2 of F.moniliforme |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| C53 | Correction of patent of invention or patent application | ||
| CB03 | Change of inventor or designer information |
Inventor after: Zeng Lisha Inventor after: Liu Jianping Inventor after: Xia Ling Inventor after: Lv Shun Inventor after: Liu Wenqing Inventor after: Wang Fang Inventor after: Du Caixian Inventor after: Zhou Jiankun Inventor after: Zhuang Huacai Inventor after: Tao Jin Inventor before: Lv Shun Inventor before: Zeng Lisha Inventor before: Zhou Jiankun Inventor before: Wang Fang Inventor before: Xia Ling Inventor before: Du Caixian |
|
| COR | Change of bibliographic data |
Free format text: CORRECT: INVENTOR; FROM: LV SHUN CENG LISHA ZHOU JIANKUN WANG FANG XIA LING DU CAIXIAN TO: CENG LISHA XIA LING LV SHUN LIU WENQING WANG FANG DU CAIXIAN ZHOU JIANKUN ZHUANG HUACAI TAO JIN LIU JIANPING |
|
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |