CN112646912B - Method for identifying and detecting pathogens of pythium aphanidermatum - Google Patents

Abstract

The invention discloses a method for identifying and detecting pathogens of pythium aphanidermatum, belonging to the technical field of detection, identification and prevention of algae cultivation diseases. The method is based on the design of a specific primer designed on the basis of genome differential sequences of pathogens of red rot of laver, P.pora and P.chondricola, and the establishment of a single PCR (polymerase chain reaction) and double PCR (polymerase chain reaction) detection method for two pathogens of pythium. The method can specifically identify and detect P.porarpyrae and P.chondricola and the possibility of coexistence. The lower limit of detection of the single PCR primer P-for/P-rev is 10 ³ Copy number, the lower limit of detection of the C-for/C-rev primer is 10 ² The number of copies. The lower limit of the double PCR detection is 10 ⁴ The number of copies. The method establishes a specific and sensitive method for identifying the pathogen of the red rot of the laver, can identify P.porae and P.chondricola without sequencing comparison, and provides technical support for the prevention and control of the red rot in the laver cultivation in China.

Description

Method for identifying and detecting Pythium erythrosepticum pathogen

Technical Field

The invention belongs to the technical field of detection, identification and prevention of algae cultivation diseases, and particularly relates to an identification and detection method of pythium pathogen, namely red rot pathogen in laver cultivation.

Background

Red rot is a major disease in the laver cultivation period and is often found in sea areas with high water temperature, low salinity, poor water flow exchange and insufficient dry-out time. The disease course of red rot is rapid, the laver net curtain can be changed into an empty curtain within one week after the red rot is outbreak, the yield is reduced by 30-50%, and the yield of certain sea areas can reach more than 60%. At the early stage of disease, red round disease spots with the diameter of about 2mm can be seen on the leaves, the diameter of the disease spots within 2d can be enlarged to 4-5mm, the disease spots are red at the edges and yellow-green in the middle, the disease spots are gradually enlarged along with the development of the disease course, a plurality of disease spots at close distances are mutually connected, and the whole leaves are completely necrotic within one week. The observation under a microscope shows that the cytopathic effect is obvious, the laver cells at the scab are withered and are connected in series by pythium hyphae, and the phycoerythrin of the cells at the boundary of the scab is dissolved out.

Various pathogens have been identified to cause red rot in laver, including pythium purpurea, p.chondricola, and Alternaria alternata sp. Pythium is the main cause of red rot of laver. Arasaki determines the pathogen as one of Pythium (Pythium) in Oomycotes (Oomycotes) according to hyphal morphological characteristics, reproduction mode, life history and the like. After more than 30 years of classification until the 70's of the 20 th century, takahashi named the pathogen Pythium purpurea (Pythium pora). It was later found that Pythium species P.chondrickola also causes red rot of laver.

At present, there is no cure method for the red rot of laver, and the spread of the disease can be effectively inhibited only by measures of acid washing, cold storage, prolonging the drying time and the like at the early stage of the disease. Therefore, the establishment of a pathogen detection method of red rot is necessary, and valuable time can be provided for controlling the spread of the disease. Amano et al establish a detection method of P.porarpyrae hypha and zoospores by using monoclonal antibodies, but the method has regional differences on pathogen detection. Addepalla et al established a method combining polyclonal antibodies with indirect fluorescence technology that could detect zoospores and cysts of P.pora, but had weak response to other Pythium species. Park and the like design specific primers PP-1 and PP-2 according to the ITS sequence of P.porarpyrae to establish a competitive PCR method, can detect hypha and water zoospores, and can be applied to pathogen detection and pathogen early warning of commercialized laver products. In 2016, a fluorescence quantitative PCR detection method is established by hucho taimen aiming at the ITS sequence of P.poracryrae, so that the detection time can be shortened, the sensitivity is high, and the error of an actually measured sample is large.

In two pythium pathogens of the laver, the pathogenicity of the P.pora and the P.chondricola is different; however, they are completely identical in hyphal morphology, reproductive mode, infection characteristics and transcribed spacer (ITS) sequence, cannot be distinguished by these characteristics, and can be distinguished only by the difference of 4 bases in cytochrome c oxidase subunit 1 and 2 (cox 1 and cox 2) gene sequences. At present, neither the P.porarpyrae nor the P.chondricola can be identified by a detection method of pathogens of red rot of laver.

Disclosure of Invention

In order to solve the technical problems, the invention provides a detection method for identifying single PCR and double PCR by utilizing P.pora and P.chondricola genome differential sequences to design specific primers, establishes single PCR and double PCR of the P.pora and the P.chondricola, performs specific detection, and provides technical support for determining pathogens of red rot of laver.

The technical scheme of the invention is as follows:

(1) Specific primers were designed based on the p.porarpyrae and p.chondricola genomic differential sequence information. The whole genome sequence information of P.porarpyrae NBRC NO.30800 and P.chondricola NBRC NO.33253 in NCBI database are downloaded and compared to obtain the sequence segments (GenBank accession numbers ON158128 and ON 158129) with difference between the two moulds. Primers were designed to ensure as much as possible that both pairs of primers had similar annealing temperatures.

(2) Designing a Pythium porphyrae identification primer of Pythium pathogenic bacteria. According to the obtained differential sequence segment, a specific primer is designed and obtained aiming at the pathogenic bacteria P.poraphyrae NBRC NO.30800 of the laver saprophytic mold, and the specific primer comprises the following components: p-for: cctacagcaatccacgactc; p-rev: TGCCGTAGAGAAGAACACAGAGAGAGA.

(3) Design of primers for identifying Pythium chondricola as a pathogen of Pythium. According to the obtained differential sequence segment, a special primer is designed and obtained aiming at the pathogenic bacteria P.chondricola NBRC NO.33253 of the laver saprophytic mold, and the special primer comprises the following components: c-for: cggacacgaagacgacgacgctat; c-rev: CGACTACGACTACGACTACGACTAT.

(4) The single PCR technology identifies the Pythium pathogens. Genomic DNA extraction is carried out on different strains of Pythium by using a CTAB method, and then the accuracy and sensitivity verification are respectively carried out on the designed and synthesized primers by using the DNA of different strains as templates. The specific PCR reaction conditions are as follows: pre-denaturation at 95 ℃ for 5min; denaturation at 95 ℃ for 30s, annealing at 55 ℃ for 40s, and elongation at 72 ℃ for 1min for 35 cycles.

(5) And (5) constructing a standard plasmid. The synthetic ligation primer PC-merge-for was designed according to the methods reported in the literature: TCTCTGTTCTTCTCTACGGCAAGCACCGGACGACGCTAT, wherein the PCR fragments PCm are amplified by PC-merge-for and C-rev respectively, the P-for and P-rev amplified fragments P are merged into a template after glue recovery, and then the P-for/C-rev is used as a primer for carrying out overlapped PCR amplification, and the PCR reaction system and the procedure are the same as before. After recovery of the electrophoretic fragment gel, IE-Vector background-free rapid cloning kit (Ensaite, qingdao) was used for ligation transformation. And (4) selecting positive clones, and taking the positive clones as standard plasmids for later use after the sequencing comparison is correct.

(6) And (3) identifying and detecting pathogens of the red rot and pythium of the laver by adopting a double PCR technology. Taking the two Pythium genome mixed DNAs obtained by extraction as templates, and simultaneously adding two pairs of synthesized specific primers to perform double PCR detection, wherein the PCR reaction system is 25 mu L, and the two pairs of positive and negative primers are 0.4 mu M respectively. The positive control template was the copy number 10 described above ⁵ The negative control contained no template.

(7) The optimization of the proportion of the specific primers in the process of identifying and detecting the pathogens of the red rot and pythium of the laver by the double PCR technology. Setting the content ratio of the P-for/P-rev primers to the C-for/C-rev primers to be 1 ⁵ Copy, amplification system and procedure were as above, and the product was detected by 1% agarose gel electrophoresis and screened for optimal primer ratios based on band brightness.

(8) And the double PCR detection is used for detecting the pathogenic bacteria of the laver saprophytic mold. The specificity of the method is tested by respectively taking bacterial sample DNA from different sources as templates and using the optimized primer proportion and PCR reaction conditions. The results show that the fragments obtained are in agreement with expectations, indicating that the specificity of the double detection is good. The sensitivity of the double PCR detection is 10 when the standard plasmid is used as the template for the sensitivity detection ⁴ Number of copies.

The invention has the beneficial effects that:

1. the two primers involved in the method have good specificity, can efficiently and conveniently realize the differential identification of the P.porarpyrae and the P.chondricola, have no cross detection phenomenon, and provide technical support for the pathogen detection of the red rot disease of the laver and the disease control;

2. establishing a detection method of the pathogens of the porphyra erythroderma, and particularly, the early disease detection has important significance for preventing and controlling the spread of diseases and reducing loss;

3. the established single PCR and double PCR detection method does not need sequencing and sequence comparison, can accurately and sensitively identify and detect the existence of the P.porphyrae and the P.chondricola only through PCR and agarose gel electrophoresis, and can greatly shorten the detection time.

Drawings

FIG. 1 shows the amplification results of Pythium species 8 with specific primers designed for P.porarpyrae and P.chondricola.

M: DL2000Marker; 1: NBRC No.30800;2: NBRC No.33126;3-8: PYTHT201801-1, JS151205, RZ201902, LS201903, NBRC NO.100633 and NBRC NO.33253;9: blank control.

FIG. 2 is an electrophoresis diagram of PCR amplification products using the recombinant fragment and the recombinant plasmid as templates.

a: recombinant fragment electrophoretogram (M: DL2000Marker; P: fragment P; PCm: fragment PCm; PCm-L: recombinant fragment). b: electrophorogram of the extracted plasmid (M: DL5000Marker;1-4: recombinant plasmid DNA).

FIG. 3 designed primer specific detection.

a: p-for/rev specific assay results (1 dl2000marker 2; b: c-for/rev specific assay results (1 DL2000Marker 2-7.

FIG. 4 detection of sensitivity of designed primers.

Different concentration gradient templates were prepared using standard plasmids and separately subjected to single PCR amplification. a: P-for/P-rev sensitivity detection (1 DL2000marker 2-9: copy number 10 ⁷ -10 ⁰ The standard plasmid of (4); 10: blank control); b: C-for/C-rev sensitivity detection (1 DL2000marker 2-9: copy number 10 ⁷ -10 ⁰ The standard plasmid of (4); 10: blank control).

FIG. 5 is an electrophoretogram showing the results of the double PCR amplification.

a: the standard plasmid was the amplification product of the template (1 DL2000Marker, 2-7: standard plasmid as template; 8: blank control); b: the amplification product with bacterial DNA as template (1 DL2000marker 2-9.

FIG. 6 shows the optimized ratio of primers in the duplex PCR assay.

1: DL2000Marker; 2-12: the P-for/P-rev and C-for/C-rev primer ratios are 1;13: blank control.

FIG. 7 detection of the designed primers specifically in duplex PCR.

1: DL2000Marker;2: taking a standard plasmid as a positive control of a template; 3: P-for/P-rev is used as a positive control of the primer; 4: C-for/C-rev is used as a positive control of the primer; 5: NBRC No.30800;6: NBRC NO.33126;7-12: PYTHT201801-1, JS151205, RZ201902, LS201903, NBRC NO.100633, NBRC NO.33253;13: ul time um;14-16: p.recalcirans, p.inflatum, p.oopapillum;17: oplidiopsis.sp.;18-20: carrageenovora, alternaria sp, b. Hwajinpoensis;21: blank control.

FIG. 8 detection of sensitivity of designed primers in duplex PCR. Different concentration gradient templates were prepared using standard plasmids and double PCR amplifications were performed separately. 1: DL2000Marker;2-9: copy number of 10 ⁷ -10 ⁰ Standard of (2)A plasmid; 10: blank control.

Detailed Description

The present invention will be described in detail with reference to the accompanying drawings and examples.

1. Bacterial strains

The strains used in this example were obtained from the Japan biological resource Bank (NITE), china General Microbiological Culture Collection Center (CGMCC), and isolated strains in this laboratory, as shown in Table 1. Wherein p.poracryae and p.chondricola were grown in half-seawater corn agar medium at 25 ℃; other strains of the Pythium genus and Alternaria alternata were grown in PDA medium (Haibo organism, qingdao) at 25 ℃; the oleaginous fungi can not be separated and cultured, and the diseased laver is frozen and stored at the temperature of minus 20 ℃; pseudoalteromonas cervicalis and bacillus tsunekii were grown in Zobell 2216 medium at 20 ℃.

TABLE 1 strains used in this example

2. Primer design and optimization of single PCR conditions

1. Primer design

Extracting pure cultured genome DNA of P.porarpyrae NBRC NO.30800 and P.chondricola NBRC NO.33253 hyphae for second-generation sequencing, obtaining genome information of two strains after splicing, then obtaining difference sequences of the two strains through whole genome comparison, designing specificity primers on the basis of the difference sequences, and respectively designing specific primers P-for/P-rev aiming at the P.porarpyrae NBRC NO.30800; and a specific primer C-for/C-rev for P.chondricola NBRC NO.33253, and a ligation primer PC-merge-for was designed, the first half of which is reverse complementary to P-rev and the second half of which is C-for. The primers are as follows:

P-for：CCTACAGCAATCCACGAGACTC；

P-rev：TGCCGTAGAGAAGAACACAGAGA；

C-for：CGGACACGAAGACGACGCTAT；

C-rev：CGACTACGACTACGACTACGACTAT；

PC-merge-for：

TCTCTGTGTTCTTCTCTACGGCAAGTCACCGGACACGAAGACGACGCTAT。

2. genomic DNA extraction

Genomic DNA of a Pythium strain and Alternaria alternata was extracted by the CTAB method. The extraction method of the genome DNA of the oleander bacteria comprises the steps of washing laver pathological material containing the oleander bacteria with sterile seawater for 3-5 times, removing surface impurities, and extracting the genome DNA of the oleander bacteria by using a fungus DNA extraction kit (Centatra, qingdao). Bacterial strain genomic DNA was extracted using a bacterial genomic DNA extraction kit (OMEGA, usa). The extracted genomic DNA was concentrated by NanoDrop-2000 (Thermo, USA) and frozen at-20 deg.C for further use.

3. Establishment of single PCR reaction system

A25. Mu.L PCR reaction system was used, each fraction was 12.5. Mu.L of 2 XEx Taq Mix (TaKaRa, japan), each fraction was 1. Mu.L (0.4. Mu.M) of forward and reverse primers, 1. Mu.L of template, and ddH ₂ O9.5 μ L, while setting a set with ddH ₂ O as template blank control. The PCR reaction program is pre-denaturation at 95 ℃ for 5min; denaturation at 95 ℃ for 30s, annealing at 55-61 ℃ for 40s, extension at 72 ℃ for 1min, and 35 cycles; keeping the temperature at 72 ℃ for 10min. The PCR amplification products were detected by 1% agarose gel electrophoresis, the electrophoresis fragment (OMEGA, USA) was recovered, and the PCR amplification products were transformed into DH 10. Beta. E.coli competent cells after connecting with T vector using pCloneEZ-TA-AMP (Zhongmeitai and Beijing) vector ligation kit, and the positive clones were selected and sequenced by Pacinon corporation, qingdao.

Amplification results of specific primers P-for/P-rev designed for P.pora on 8 strains of Pythium in a laboratory are shown in FIG. 1a, a specific target band appears in P.pora, the sequence similarity of the fragment and the P.pora is 100% after sequencing comparison, and no corresponding band is seen in P.chondricola; the amplification result of 8 strains of Pythium ultimum in the laboratory by the specific primer C-for/C-rev designed according to P.chondra is shown in FIG. 1b, the P.chondra has a specific target band, the sequence of the fragment is 100% similar to that of the P.chondra after alignment, and no corresponding band is seen in the P.poraphyrae. This result indicates that P.porarphine can be specifically amplified by P-for/P-rev, and P.chondricola can be specifically amplified by C-for/C-rev.

3. Standard plasmid construction and establishment of double PCR detection method

1. Standard plasmid construction

And performing overlapped PCR amplification by using a gel cutting recovery product of the P-for and P-rev amplified fragment P and the PC-merge-for and C-rev amplified fragment PCm as a template and using the P-for/C-rev as a primer, wherein the PCR reaction system and the procedure are the same as the above. The PCR amplification products were detected by electrophoresis in 1% agarose gel, and the electrophoresis fragments were recovered by gel recovery kit (OMEGA, USA). And (3) carrying out ligation and transformation on the recombinant fragment after gel cutting and recovery by using an IE-Vector background-free rapid cloning kit (Insait, qingdao). Positive clonal colonies are picked in an aseptic workbench, are cultured in LB liquid medium (containing ampicillin 100 mu g/mL) at 37 ℃ for 12-16h under the condition of shaking at 200rpm, and then are extracted by a common plasmid extraction kit (Islands, ensait). The extracted plasmid DNA was stored at-20 ℃ for future use after concentration measurement using NanoDrop-2000 (Thermo, USA), and its copy number was calculated according to the following equation:

and performing PCR amplification by using the fragment P and the fragment PCm as templates and using P-for and C-rev as primers to obtain a recombinant fragment PCm-L (shown in figure 2 a) with the same size as the expected size. The recombinant fragment is connected to an IE-vec tor vector, and a positive plasmid obtained by connection transformation is identified by sequencing and has 100 percent similarity with an expected sequence (figure 2 b).

4. PCR specificity and sensitivity detection

When the specificity detection is performed, the genomic DNA of all the strains in Table 1 is used as a template for PCR amplification, and the product is verified by 1% agarose gel electrophoresis. P-for/P-rev was found to be able to amplify only P.pora; C-for/C-rev amplified only P.chondricola, indicating that the two primer pairs are well specific (FIG. 3).

For sensitivity detection, ddH was used as a standard plasmid ₂ Dilution of O to 10 ⁷ 、10 ⁶ 、10 ⁵ 、10 ⁴ 、10 ³ 、10 ² 、10 ¹ 、10 ⁰ Copies/. Mu.L of 8 gradients were used as templates for PCR amplification and the products were verified by electrophoresis on a 1% agarose gel. The sensitivity of the detection to determine the singleplex PCR detection was 10 respectively ³ (P-for/rev)、10 ² (C-for/rev) number of copies (FIG. 4).

Optimization of duplex PCR amplification conditions

The double PCR reaction system contains two pairs of primers P-for/P-rev and C-for/C-rev, and the copy number of the template for construction is 10 ⁵ Standard plasmid or mixed DNA of P.chondricola NBRC NO.33253 and P.poraphyrae NBRC NO. 30800. The 25 μ L PCR reaction system was: 2 XEx Taq Mix (TaKaRa, japan) 12.5. Mu.L, two pairs of forward and reverse primers each 1. Mu.L (0.4. Mu.M), template 1. Mu.L, ddH ₂ O7.5. Mu.L, while setting a set with ddH ₂ O as a negative control group for the template. The PCR reaction procedure was as above. The product was detected by electrophoresis on a 1% agarose gel. As a result, as shown in FIG. 5, both the target fragments were amplified and the detection effect was good.

When the double PCR reaction system is optimized, the content ratio of the P-for/P-rev primers to the C-for/C-rev primers is set as 1 ⁵ Copy, amplification system and procedure are as above, products were detected by 1% agarose gel electrophoresis (fig. 6), both bands were obtained at 1. 6. Test and sensitivity detection for dual PCR technology detection

The application test of detecting the pythium purpureum by using the double PCR technology is carried out by taking the strain DNA in the table 1 as a template. As a result, the positive control group was found to have two target bands consistent with the expected bands (FIG. 7), which indicates that the specificity of the Pythium porphyri specific primer and the dual PCR detection technology designed by the invention is good.

By standard ofThe sensitivity of the double PCR detection is 10 when the plasmid is used as a template for carrying out the sensitivity detection ⁴ Number of copies (FIG. 8).

Claims (6)

1. A method for identifying and detecting pathogens of Pythium erythrosepticum is characterized in that the design of two specific and high-sensitivity primer sequences and the establishment of a detection method are as follows:

wherein the identification primer sequence of the Pythium porphyrae of the Pythium scab and Pythium saprophytae is P-for: cctacagcaatccacgactc; p-rev: tgccgtagaaagaacacaga;

another identification primer sequence of the Pythium chondricola which is a pathogenic bacterium of Pythium erythrosepticum is C-for: cggacacgaagaccgacgctat; c-rev: CGACTACGACTACGACTACGACTAT.

2. The method for identifying and detecting a Pythium erythrosepticum pathogen according to claim 1, wherein said primer sequence is designed based on the P.porarpyrae and P.chondricola genome differential sequences.

3. The method for identifying and detecting the Pythium erythrosepticum pathogen of the laver as claimed in claim 1 or 2, wherein the Pythium erythrosepticum pathogen identification method adopts single PCR detection, and the reaction conditions are as follows: pre-denaturation at 95 ℃ for 5min; denaturation at 95 ℃ for 30s, annealing at 55-61 ℃ for 40s, and extension at 72 ℃ for 1min for 35 cycles.

4. The method for identifying and detecting Pythium erythrosepticum pathogens according to claim 1, wherein the method for detecting Pythium erythrosepticum pathogens is a double PCR detection.

5. The method for identifying and detecting the pathogen of pythium aphanidermatum according to claim 4, wherein the double PCR detection reaction conditions are as follows: 25 mu.L PCR reaction system, 2 XEx Taq Mix 12.5 mu.L, two pairs of forward and reverse primers each 0.4 mu.M, template copy number 10 ⁵ A standard plasmid.

6. The method for identifying and detecting Pythium erythrosepticum pathogens according to claim 4 or 5, wherein in the double PCR detection, two pairs of specific primers are used in the following ratio of 1.

Images