CN111471793A

CN111471793A - Primer, probe, kit and method for RT-QPCR (reverse transcription-quantitative polymerase chain reaction) detection of fusarium sporotrichioides

Info

Publication number: CN111471793A
Application number: CN202010370262.2A
Authority: CN
Inventors: 朱建宁; 沈颂东; 车团结; 张镭; 石勇; 孙宗科; 高恺; 李潇玲; 郑晓玲
Original assignee: Lanzhou Baiyuan Gene Technology Co ltd
Current assignee: Lanzhou Baiyuan Gene Technology Co ltd
Priority date: 2020-05-06
Filing date: 2020-05-06
Publication date: 2020-07-31

Abstract

The invention discloses a primer, a probe, a kit and a method for RT-QPCR detection of fusarium sporotrichioides, belonging to the technical field of biology. The nucleotide sequences of the upstream primer and the downstream primer are respectively shown as SEQ ID NO. 1 and SEQ ID NO. 2, and the nucleotide sequence of the probe is shown as SEQ ID NO. 3; the kit comprises the primer and the probe. The fluorescent quantitative PCR detection method comprises the following steps: extracting total DNA of a sample to be detected; preparing a reaction system; diluting the template in a gradient manner to prepare a standard curve sample and a positive control sample; performing fluorescent quantitative PCR amplification on a sample to be detected, a standard curve sample, a positive control sample and a negative control sample by using a primer and a probe; and drawing a standard curve and calculating a result. The primer, the probe and the kit have high specificity and good sensitivity, and can be used for quickly and accurately detecting the fusarium sporotrichioides.

Description

Primer, probe, kit and method for RT-QPCR (reverse transcription-quantitative polymerase chain reaction) detection of fusarium sporotrichioides

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a primer, a probe, a kit and a method for real-time fluorescent quantitative PCR detection of fusarium sporotrichioides.

Background

Fusarium sporotrichioides (Fusarium sporotrichioides) is one of important pathogenic bacteria of gramineous crops, can cause gibberellic disease of wheat, oat, barley and the like, and the pathogenic bacteria mainly damage ears of grain crops, so that damaged ears are discolored, shrunken, the grain weight is reduced, and further the yield is reduced. Poses serious threat to agricultural production. Is a main pathogenic bacterium of plant root rot, and can cause damage to pseudo-ginseng, gastrodia elata, radix pseudostellariae, cotton and the like. Fusarium sporotrichioides can invade roots of plants to cause root rot or invade a plant vascular bundle system to cause plant wilting and withering, and can occur in the whole growth process of plants, and other strains can invade roots but cannot invade the plant vascular bundle system to cause diseases. The disease causes root rot, which gradually weakens the function of water and nutrient absorption of plants, and finally the whole plant dies, mainly manifested as yellowing and withering of the whole plant leaves. Fusarium sporotrichum has the characteristics of easy variation and polymorphism, the endogenetic differentiation is very obvious, and the Fusarium sporotrichum can be divided into a plurality of specialization and physiological races under the seeds, so the genetic diversity of the Fusarium sporotrichum is always a research hotspot. For many years, the polymorphism of the strain is researched according to tests such as morphological characteristics, pathogenicity and nutrient fusion groups, and the methods are time-consuming and labor-consuming and cannot accurately reveal the evolutionary relationship of the species.

In the prior art, the multiplex PCR detection of Fusarium sporotrichioides has good specificity and high accuracy, but the PCR result needs to be analyzed by agarose electrophoresis, and the influence factors are more. With the continuous development of molecular biology technology, RT-QPCR (real-time fluorescence quantitative PCR) is widely applied to the detection of strains at present. Compared with the conventional isolated culture method, the method has the characteristics of short time consumption, simple and convenient operation and good specificity, the result can be directly observed, and the pollution caused in the operation process can be effectively avoided. However, Fusarium sporotrichioides has high homology with other Fusarium species, such as Fusarium solani, Fusarium trilorum and Fusarium oxysporum. Therefore, the PCR detection method for Fusarium sporotrichioides has high specificity and high accuracy, and is a problem to be solved by the technical personnel in the field.

Disclosure of Invention

One of the purposes of the invention is to provide a primer for RT-QPCR detection of fusarium sporotrichioides, which has good specificity and high accuracy.

Another object of the present invention is to provide a probe for RT-QPCR detection of Fusarium sporotrichioides.

The invention also aims to provide a kit for RT-QPCR detection of Fusarium sporotrichioides.

The fourth object of the present invention is to provide a method for RT-QPCR detection of Fusarium sporotrichioides.

In order to achieve the purpose, the technical scheme adopted by the invention is as follows:

the invention carries out bioinformatics comparison analysis on complete sequences of Fusarium sporotrichum 18SrRNA genes in an NCBI database, selects a conservative fragment sequence suitable for designing primers and probes as a target, further applies Primexpress 3 software, Primer Premier 5 software and Oligo 7 software, designs a plurality of groups of real-time fluorescent quantitative PCR primers and probes, and finally determines a group of fluorescent quantitative PCR primers and probes for detecting the Fusarium sporotrichum through preliminary screening of tests.

The primer for RT-QPCR detection of fusarium sporotrichioides comprises an upstream primer and a downstream primer, the nucleotide sequences of the upstream primer and the downstream primer are respectively shown as SEQ ID NO. 1 and SEQ ID NO. 2,

an upstream primer: 5'-CGAGGACCCCTAAACTCTG-3', respectively;

a downstream primer: 5'-ATGTGCGTTCAAAGATTCGAT-3' are provided.

The nucleotide sequence of the probe for detecting the RT-QPCR of the fusarium sporotrichum is shown as SEQ ID NO. 3: 5'-AACGGATCTCTTGGTTCTGG-3', respectively; preferably, the fluorescent reporter group marked at the 5 'end of the probe is VIC, and the fluorescent quencher group marked at the 3' end of the probe is BHQ.

The 18SrRNA gene is widely present in Fusarium sporotrichioides and has high conservation. The invention adopts Fusarium sporotrichioides 18SrRNA gene as a target sequence to synthesize a primer and a probe.

The invention relates to a primer and probe combination for real-time fluorescent quantitative PCR detection of fusarium sporotrichum, which comprises the following components in percentage by weight:

an upstream primer: 5'-CGAGGACCCCTAAACTCTG-3', respectively;

a downstream primer: 5'-ATGTGCGTTCAAAGATTCGAT-3', respectively;

and (3) probe: 5'-AACGGATCTCTTGGTTCTGG-3' are provided.

The kit for RT-QPCR detection of fusarium sporotrichioides comprises the primer and the probe.

In the technical scheme of the invention, the kit also comprises a QPCR template, wherein the QPCR template is shown as SEQ ID NO. 4; preferably, the template is in the form of a plasmid.

The nucleotide sequence synthesized by the corresponding plasmid of the primer and probe amplification fragment is shown as SEQ ID NO. 5, and specifically comprises the following steps:

5’-CGGGACGGCCCGCCCGAGGACCCCTAAACTCTGTTTTTAGTGGAACTTCTGAGTA AAACAAACAAATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATG AAGAACGCACCAAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGA ATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCG-3’。

in embodiments of the invention, the kit further comprises a negative sample; preferablyThe negative control sample is ddH₂O。

In the embodiment of the invention, the premix is also included, and preferably, the premix is 2 × Probe Mix.

The invention relates to a reaction system for RT-QPCR detection of fusarium sporotrichum, which comprises the following components:

an upstream primer: 5'-CGAGGACCCCTAAACTCTG-3', respectively;

a downstream primer: 5'-ATGTGCGTTCAAAGATTCGAT-3', respectively;

and (3) probe: 5'-AACGGATCTCTTGGTTCTGG-3', respectively;

template: as shown in SEQ ID NO. 4;

preferably, the kit further comprises a negative control sample, and further preferably, the negative control sample is ddH₂O。

The RT-QPCR detection method for detecting the fusarium sporotrichioides comprises the following steps:

step 1, extracting total DNA of a sample to be detected;

step 2, preparing a reaction system, wherein the reaction system is as described above;

step 3, diluting the template in a gradient manner to prepare a standard curve sample and a positive control sample;

step 4, performing fluorescent quantitative PCR amplification on a sample to be detected, a standard curve sample, a positive control sample and a negative control sample by using the primer and the probe;

step 5, drawing a standard curve, and calculating a result through the standard curve and the Ct value of the sample to be detected;

preferably, in the step 3, the concentration of the standard curve sample prepared by the gradient dilution is 3.1 × 10 respectively⁹copies/μL、 3.1×10⁸copies/μL、3.1×10⁷copies/μL、3.1×10⁶copies/μL、3.1×10⁵copies/μL、3.1×10⁴copies/μL、 3.1×10³copies/μL、3.1×10²copies/μL、3.1×10¹copies/μL；

Preferably, the concentration of the positive control sample is 3.1 × 10¹⁰copies/μL。

In the examples of the present invention, the reaction conditions of PCR were: digestion of the contamination at 37 ℃ for 2min, pre-denaturation at 95 ℃ for 10min, at 95 ℃ for 15s and 60 ℃ for 1min and collection of the fluorescence signal for 40 cycles.

As an embodiment of the present invention, the PCR reaction system is:

in the technical scheme, the Fusarium sporotrichioides 18SrRNA gene is amplified by adopting a PCR technology, and is connected into a plasmid vector PUC57 by utilizing a gene recombination technology to construct a recombinant plasmid PUC57-18SrRNA, and the recombinant plasmid PUC57-18SrRNA is subjected to corresponding PCR identification and sequencing identification and finally is quantitatively used as an 18SrRNA gene standard product of the method.

The preparation method of the 18SrRNA gene standard substance comprises the following steps:

s1, extracting genome DNA of fusarium sporotrichum (a standard strain) to obtain a DNA sample, and using the DNA sample as a template for PCR amplification of 18SrRNA genes;

PCR amplification of S2.18SrRNA Gene fragment: selecting an amplification sequence, designing a PCR primer and a probe,

s3, carrying out PCR amplification by taking the DNA sample obtained in the step S1 as a template; then purifying the obtained PCR amplification product;

s4, connecting the purified PCR amplification product obtained in the step S3 with a plasmid vector PUC 57; then transforming the ligation product to obtain a colony transformed with the plasmid;

s5, selecting a monoclonal colony, inoculating the colony in a culture solution, and culturing; the plasmid preparation kit is used for extracting positive recombinant plasmid PUC57-18SrRNA for PCR identification and sequencing analysis of bacterial liquid.

Compared with the prior art, the invention has the following beneficial effects:

the invention selects Fusarium sporotrichioides 18SrRNA gene containing highly conserved and specific sequence to construct recombinant plasmid PUC57-18SrRNA as standard substance; and further screening fluorescent quantitative PCR primers and probes for detecting fusarium sporotrichioides. The primer, the probe and the kit for real-time fluorescent quantitative PCR detection of the fusarium sporotrichum have high specificity and good sensitivity, and can quickly and accurately detect the fusarium sporotrichum.

Drawings

FIG. 1 is a diagram showing the results of blast alignment in NCBI database of 18SrRNA gene amplification sequences.

FIG. 2 is a diagram showing the results of Primer-Blast comparison of upstream and downstream Primer sequences in NCBI.

FIG. 3 is a graph showing a standard curve of the standard.

FIG. 4 is a graph showing the results of the sensitivity test of the present invention, wherein a, b, c, d, e, f, g, h, i, j, and k are relative fluorescence curves of different plasmid concentrations, wherein a represents the plasmid concentration of 3.1 × 10⁹copies/. mu. L, b represents plasmid concentration of 3.1 × 10⁸copies/. mu. L, c represents plasmid concentration 3.1 × 10⁷copies/. mu. L, d represents plasmid concentration of 3.1 × 10⁶copies/. mu. L, e represents a plasmid concentration of 3.1 × 10⁵copies/. mu. L, f represents plasmid concentration of 3.1 × 10⁴copies/. mu. L, g represents a plasmid concentration of 3.1 × 10³copies/. mu. L, h represents a plasmid concentration of 3.1 × 10²copies/. mu. L, i represents a plasmid concentration of 3.1 × 10¹copies/. mu. L and negative control.

FIG. 5 is a diagram showing the results of the specificity test of the present invention.

FIG. 6 is a gel image verification chart of the specificity experiment of the present invention.

Detailed Description

The present invention is further illustrated by the following examples. It should be noted that the following examples are only for illustrating the present invention and should not be construed as limiting the scope of the present invention, and those skilled in the art can make certain insubstantial modifications and adaptations of the present invention based on the above disclosure and still fall within the scope of the present invention.

Example 1

This example discloses a method for preparing the 18s rrna gene standard of the present invention.

To establish a real-time fluorescent quantitative PCR method, an external standard substance required by the method must be prepared, and the standard substance should contain a highly conserved and specific sequence to ensure high specificity of the reaction. The 18SrRNA gene is widely present in Fusarium sporotrichioides and has high conservation. The invention adopts Fusarium sporotrichioides 18SrRNA gene as a target sequence. In the embodiment, the PCR technology is mainly adopted to amplify the Fusarium bacteroides 18SrRNA gene, the Fusarium bacteroides 18SrRNA gene is connected to a plasmid vector PUC57 by utilizing the gene recombination technology to construct a recombinant plasmid PUC57-18SrRNA, and corresponding PCR identification and sequencing identification are carried out, and finally, the recombinant plasmid PUC57-18SrRNA is quantitatively used as a standard substance of a method to be established, so that a foundation is laid for the next method and evaluation.

First, preparation of template DNA

Genomic DNA of Fusarium sporotrichioides (standard strain) was extracted and used as a template for PCR amplification of the 18SrRNA gene. The fungus genome extraction kit produced by Beijing Baitach company is adopted for extraction, and the specific extraction method is as follows:

① adding 1ml of the bacterial suspension into a 1.5ml centrifuge tube, centrifuging at 8000r/min for 2 minutes, and removing the supernatant;

② adding preheated Buffer FP1 at 550 mu L65 ℃ and RNaseA at 4 mu L ℃, mixing the mixed bacterial liquid precipitates by violent vortex oscillation, putting the mixed bacterial liquid precipitates into a water bath at 65 ℃ for 1h after mixing, and performing violent vortex oscillation for 5-6 times in the period;

③ adding 130 mu L Buffer P2, mixing well, centrifuging at 12000rmp for 3 min;

④ carefully pipette the supernatant onto a column A, carefully avoid pipetting the interfacial material, centrifuge at 12000rmp for 1min, and collect the supernatant;

⑤ adding 1.5 times volume of Buffer P3, immediately and gently vortexing, and mixing well;

⑥ adding the mixture obtained in the previous step into an adsorption column AC, centrifuging at 12000rmp for 1min, and removing waste liquid in the collection tube;

⑦ adding 700 μ L rinsing liquid WB, centrifuging at 12000rmp for 1min, and discarding the waste liquid;

⑧ adding 500 μ L of rinsing liquid WB, centrifuging at 12000rmp for 1min, and discarding the waste liquid;

⑨ placing the adsorption column AC back into the empty collection tube, centrifuging at 12000rmp for 3-5 min;

⑩ the adsorption column AC is taken out and put into a clean centrifuge tube, 50 μ L elution buffer EB (preheated in 65-70 deg.C water bath) is added in the middle of the adsorption film, and the mixture is placed at room temperature for 3-5min and then centrifuged at 12000rmp for 1min to collect DNA.

PCR amplification of 18S rRNA gene fragment

1. Design and Synthesis of primers

The 18SrRNA identification is to identify the species of the fungi by utilizing a method for sequencing the 18SrRNA sequence of the fungi. Is a method for rapidly obtaining the fungal species information. The invention utilizes real-time fluorescent quantitative PCR to detect the expression level of the 18SrRNA gene of the fusarium sporotrichum, and the significance and specificity of the 18SrRNA in the detection of the fusarium sporotrichum are determined.

The invention relates to a method for detecting the molecular weight of Fusarium sporotrichioides 18SrRNA gene in NCBI database, which comprises the steps of comparing and analyzing bioinformatics of the complete sequence of the Fusarium sporotrichioides 18SrRNA gene in NCBI database, selecting a conservative fragment sequence suitable for designing a Primer and a probe as a target, and designing a group of real-time fluorescent quantitative PCR primers and probes and a group of peripheral primers of related sequences by applying Primer express 3 software, Primer Premier 5 software and Beacon Designer 7 software.

The amplification sequence SEQ ID NO. 4 selected by the invention is shown as follows:

>FR750924.1Fusarium sporotrichioides genomic DNA containing 18S rRNAgene,ITS1,5.8S rRNAgene,ITS2,28S rRNAgene,culture collection MTCC:7375

5’-TCCCAACCCCTGTGACATACCTATACGTTGCCTCGGCGGATCAGCCCGCGCCCCG TAAAACGGGACGGCCCGCCCGAGGACCCCTAAACTCTGTTTTTAGTGGAACTTCTG AGTAAAACAAACAAATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCAT CGATGAAGAACGCACCAAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAAT CATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTC GAGCGTCATTTCAACCCTCAAGCTCAGCTTGGTGTTGGGACTCGCGGTAACCCGCGT TCCCCAAATCGATTGGCGGTCACGTCGAGCTTCCATAGCGTAGTAATCATACACCTC GTTACTGGTAATCGTCGCGGCCACGCCGTTAAACCCCAACTTCTGAATGTTGACCTC GGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAA-3’。

this sequence is shown in FIG. 1 by blast results against the NCBI database.

FIG. 1 shows the results of the blast alignment in the NCBI database.

As can be seen from fig. 1: this sequence is specific for Fusarium bactridioides.

The peripheral primer sequences are shown as SEQ ID NO. 6 and SEQ ID NO. 7, and specifically comprise:

an upstream primer: fusarium sporotrichioides-11F 5'-TGTGACATACCTATACGTTGCCT-3';

a downstream primer: fusarium sporotrichioides-411R 5'-CGACGATTACCAGTAACGAGG-3'.

The amplified fragment size was: 401 bp.

2. PCR reaction system and reaction conditions

PCR amplification was carried out using DNA as a template and the above-mentioned peripheral primer Fusarium sporotrichioides-11F/Fusarium sporotrichioides-411R as an amplification primer, using the following system and reaction conditions.

And (3) PCR system:

wherein the primer adopts Fusarium sporotrichioides-11F/Fusarium sporotrichioides-411R, the Taq enzyme adopts Beijing Baitak Power Taq Plus DNA polymerase, and the PCR amplification instrument is an ASA-4800PCR instrument of Suzhou Baiyuan Gene technology Limited.

Amplification procedure/reaction conditions:

pre-denaturation at 94 deg.C for 5min, pre-denaturation at 94 deg.C for 30s, denaturation at 50 deg.C for 30s, and denaturation at 72 deg.C for 1min for 30 cycles, and electrophoresis of 5 μ L amplification product at 72 deg.C for 10min to detect PCR product size, and purifying and recovering residual PCR amplification product with DNA gel recovery kit from Shanghai's chemical company.

Construction and transformation of recombinant plasmid PUC57-18SrRNA

1. And (3) connection reaction: the PCR amplification product obtained by the above purification was ligated with PUC57 (Biotechnology Co., Ltd., Wuhan King Kerui), and prepared using the following ligation system:

after the preparation was completed, the ligation reaction was carried out overnight at 16 ℃.

2. Transformation and PCR identification of PUC57-18SrRNA plasmid

① taking out the frozen DH5 α competent cells from an ultra-low temperature refrigerator at-70 ℃, and placing the cells on an ice box to naturally thaw the cells;

② adding the ligation product 10 μ L into DH5 α competent cells 100 μ L;

performing heat shock in water bath at ③ 42 deg.C for 90s, immediately cooling on ice for 30 min;

④ A1.5 ml EP tube was mixed with a pre-cooled liquid medium L B (containing no ampicillin) of 800. mu. L, and incubated at 37 ℃ with gentle shaking at 140rpm for 1 hour;

⑤ centrifuging the above culture solution at 8000rpm for 1min, discarding supernatant, coating the cell suspension absorption residue on L B plate containing 0.1ngAmp, standing with front side upward for 30min, and inverting the culture dish to culture in 37 deg.C incubator overnight after the bacteria solution is completely absorbed by the culture medium;

⑥ the next day, picking single colony from the plate, culturing in 100 μ L L B liquid medium (containing ampicillin) PCR tube under shaking at 37 deg.C for 2-3 hr, absorbing 2 μ L as template for PCR identification, adding the residual bacterial liquid into 20ml L B liquid medium for amplification;

⑦ the diluted bacterial solution was amplified with Fusarium sporotrichioides specific primer Fusarium sporotrichioides1F/Fusarium sporotrichioides1R, the PCR product was electrophoresed on 1% agarose gel, and positive transformants were identified by detecting the size of the PCR product.

The sequence of primer Fusarium sporotrichioides1F/Fusarium sporotrichioides1R is as follows:

an upstream primer; fusarium sporotrichioides1F 5'-CGAGGACCCCTAAACTCTG-3';

a downstream primer; fusarium sporotrichioides1R 5'-ATGTGCGTTCAAAGATTCGAT-3'.

The amplified fragment size was: 171 bp.

The results of Primer-Blast comparison of the upstream and downstream Primer sequences in NCBI are shown in FIG. 2

FIG. 2 shows the results of Primer-Blast alignment of upstream and downstream Primer sequences in NCBI.

As can be seen from fig. 2: the pair of primers has specificity to fusarium sporotrichioides.

The PCR reaction system is as follows:

amplification procedure/reaction conditions: pre-denaturation at 94 ℃ for 5 min; 30 cycles of 94 ℃ for 30s, 60 ℃ for 30s and 72 ℃ for 20 s; 5min at 72 ℃.

A plasmid preparation kit produced by Baitach company is adopted to extract positive recombinant plasmid PUC57-18SrRNA, the concentration and the purity are determined, meanwhile, a part of purified plasmid is sucked and sent to Shanghai bioengineering limited company for sequencing, and the gene sequence of the insert fragment is determined to be consistent with the target sequence.

Fourth, obtaining and quantifying standard substance

1. E.coli DH5 α 100 mu L containing the recombinant PUC57-18SrRNA obtained in the step three is taken to be transferred into L B liquid culture medium with the thickness of 5m L and is shaken overnight at the temperature of 37 ℃ and the rpm of 200;

2. transferring 1ml of overnight-cultured bacterial liquid into 10ml of L B liquid culture medium, performing enrichment culture at 200rpm for 2-3 hours, and extracting plasmids by using a plasmid preparation kit produced by Beijing Baitaike company;

3. the extracted plasmid was measured by an ultramicro UV-visible spectrophotometer (ND5000) of Baitach Biotechnology Ltd, Beijing, and measurement A was carried out₂₆₀、A₂₈₀According to A₂₆₀/A₂₈₀Judging the purity of the plasmid;

4. calculation of the concentration (copy number) of the plasmid PUC57-18SrRNA

(1) Molecular weight of plasmid 2917bp × 660 (average molecular weight per base pair)

(2) The plasmid concentration was found to be 100 ng/. mu. L, plasmid purity A₂₆₀/A₂₈₀When real-time fluorescence quantitative PCR is performed, it is necessary to convert the unit to copies/. mu. L because the unit must be "copy number".

Plasmid copies/. mu. L ═ avogalois constant × moles of plasmid

Wherein the Avogastron constant is 6.02 × 10²³copies/mol。

The plasmid thus extracted had a concentration copies/. mu. L ═ 100 × 10^-9ng/μL×6.02×10²³copies/mol÷(2917bp×660g/bp·mol)＝3.1×10¹⁰copies/μL

10 u L plasmid and 90 u L sterile water to get the concentration of 3.1 × 10⁹Plasmid copies/. mu. L, which were diluted 10-fold to obtain a range of concentrations of plasmid, and stored at-20 ℃ until use.

Example 2

The embodiment discloses a fluorescent quantitative PCR kit, which comprises the following components:

premix 2 × Probe Mix (manufactured by Nanjing Novozam Biotech Co., Ltd., known as AceQ U⁺Probe Master Mix)。

The upstream primer with the final concentration of 10 mu M and the downstream primer with the final concentration of 10 mu M;

probe at a final concentration of 10. mu.M;

the recombinant plasmid PUC57-18SrRNA gene series concentration standard prepared in example 1 (series concentration of the series concentration standard: 3.1 × 10)⁹copies/μL、3.1×10⁸copies/μL、3.1×10⁷copies/μL、3.1×10⁶copies/μL、 3.1×10⁵copies/μL、3.1×10⁴copies/μL、3.1×10³copies/μL、3.1×10²copies/μL、3.1×10¹copies/μL)；

Positive control, concentration 3.1 × 10¹⁰copies/. mu. L of the recombinant plasmid pUC57-18SrRNA prepared in example 1;

ddH₂O，ddH₂o was used as a reagent and negative control.

An upstream primer; fusarium sporotrichioides1F 5'-CGAGGACCCCTAAACTCTG-3';

a downstream primer; fusarium sporotrichioides1R 5'-ATGTGCGTTCAAAGATTCGAT-3';

and (3) probe: 18SrRNA 1-15 '-AACGGATCTCTTGGTTCTGG-3'.

The fluorescent reporter group marked at the 5 'end of the probe is VIC, and the fluorescent quencher group marked at the 3' end of the probe is BHQ.

the use method of the kit comprises the following steps:

1) extracting total DNA of a sample to be detected;

2) performing fluorescent quantitative PCR amplification on a sample to be detected, a standard sample with a series of concentrations, a positive control sample and a negative control sample by using the primers and the probes;

3) and drawing a standard curve, and calculating a result through the standard curve and the Ct value of the sample to be detected.

Example 3

This example discloses the use of the kit of example 2 to plot a standard curve for a standard.

Using 18SrRNA gene series concentration standard substance (series concentration of series concentration standard substance is 3.1 × 10)⁹copies/μL、 3.1×10⁸copies/μL、3.1×10⁷copies/μL、3.1×10⁶copies/μL、3.1×10⁵copies/μL、3.1×10⁴copies/μL、 3.1×10³copies/μL、3.1×10²copies/μL、3.1×10¹copies/μ L) as a template, and performing fluorescent quantitative PCR amplification using primers and probes in the kit, while setting a positive control and a negative control.

negative control: ddH₂O。

The PCR reaction system is as follows:

reaction conditions are as follows: digestion of the contamination at 37 ℃ for 2min, pre-denaturation at 95 ℃ for 10min, at 95 ℃ for 15s and 60 ℃ for 1min and collection of the fluorescence signal for 40 cycles.

Method for obtaining standard curve: and taking the logarithm of the plasmid concentration of the standard substance as an abscissa and the ct value as an ordinate to obtain a standard curve. The original equation of the standard curve is Y ═ ax + b, the equation of the standard curve at this time is Y ═ -3.385x +42.81, and the standard curve graph is shown in the attached figure 3.

As can be seen from FIG. 3, the standard curve of the standard sample is smooth, and the correlation coefficient is high, specifically R²0.997, meets the requirement of real-time fluorescent quantitative PCR detection.

Example 4

This example discloses the performance test of the real-time fluorescent quantitative PCR kit of the invention

1. Sensitivity test

The plasmids prepared in example 1 were diluted 10-fold to obtain a series of concentrations of plasmids, and the concentration was 3.1 × 10⁹copies/μL、3.1×10⁸copies/μL、3.1×10⁷copies/μL、3.1×10⁶copies/μL、3.1×10⁵copies/μL、 3.1×10⁴copies/μL、3.1×10³copies/μL、3.1×10²copies/μL、3.1×10¹copies/. mu. L and negative control as templates the reaction system is as follows:

The fluorescence curve obtained by processing the fluorescence signal detected by the instrument with software, and observing the signal of the fluorescence curve, the data show that when the plasmid concentration reaches 3.1 × 10²Fluorescence signal is still obtained when copies/mu L reaches the plasmid concentration of 3.1 × 10¹No fluorescence signal at copies/μ LThe sensitivity of the method of the invention is therefore 3.1 × 10²copies/μL。

FIG. 4 shows the results of the sensitivity test of the present invention, wherein a represents the plasmid concentrations of 3.1 × 10⁹copies/. mu. L, b represents plasmid concentration of 3.1 × 10⁸copies/. mu. L, c represents plasmid concentration 3.1 × 10⁷copies/. mu. L, d represents plasmid concentration of 3.1 × 10⁶copies/. mu. L, e represents a plasmid concentration of 3.1 × 10⁵copies/. mu. L, f represents plasmid concentration of 3.1 × 10⁴copies/. mu. L, g represents a plasmid concentration of 3.1 × 10³copies/. mu. L, h represents a plasmid concentration of 3.1 × 10²copies/. mu. L, i represents a plasmid concentration of 3.1 × 10¹copies/. mu. L and negative control.

2. Experiment of specificity

To confirm the specificity of the invention for detecting fusarium sporotrichioides, we selected other common clinical infection microorganism specificity experiments, and the selected microorganisms include: fusarium oxysporum, Alternaria alternata, Fusarium avenae, Fusarium graminearum, Botrytis cinerea and Fusarium solani.

The specificity test includes a test using the genomic DNA of the above-mentioned sample as a template. The DNA extraction of the microorganisms adopts a DNA rapid extraction kit of Beijing Baitach biotechnology limited and adopts an AceQ U + Probe Master Mix real-time fluorescent quantitative PCR kit produced by Nanjing NuoZan biotechnology limited to carry out experiments, and the reaction system is as follows:

the primer and the probe are the primer and the probe in the embodiment 2 of the invention.

And processing the fluorescence signal detected by the instrument by software to obtain a fluorescence curve, observing the signal of the fluorescence curve, and analyzing the specificity. The results refer to fig. 5: the genome DNA is used as a template, only the fusarium sporotrichioides is detected to be positive, and the other microorganisms are negative, so that the invention has good specificity. The results are shown in Table 1 and FIG. 5.

TABLE 1

FIG. 5 is a diagram showing the results of the specificity test of the present invention. Wherein a standard amplification curve is Fusarium sporotrichioides genome, and b represents that no standard amplification curve is generated and is Fusarium oxysporum, Alternaria alternata, Fusarium avenaceum, Fusarium graminearum, Botrytis cinerea and Fusarium solani respectively

3. Gel imaging verification chart for specificity experiment

In order to confirm that the method has specificity to the detection of fusarium sporotrichioides, other common plant-infected microorganisms are selected for a specificity experiment. The selected microorganisms include: fusarium oxysporum, Alternaria alternata, Fusarium avenae, Fusarium graminearum, Botrytis cinerea and Fusarium solani.

Preparing 1% agarose gel to detect fusarium sporotrichioides specific primer probe fluorescence quantitative result. And taking an amplification product of a specificity experiment as a template.

The results are shown in FIG. 6, in which lanes 1-9 are sequentially marked with 1: blank control (water), 2-3: positive control (Fusarium sporotrichioides), negative control (4: Alternaria, 5: Fusarium solani, 6: Fusarium graminearum, 7: Fusarium sporotrichioides, 8: Fusarium avenae, 9: Botrytis cinerea) and D L2000.

The result shows that the method has specificity for detecting the fusarium sporotrichioides.

Example 5

This example discloses the method of RT-QPCR detection of Fusarium oxysporum of the invention,

the DNA of the sample to be tested and the 18SrRNA gene series concentration standard substance prepared in the example 1 are respectively used(the series concentration of the series concentration standard substance is 3.1 × 10⁹copies/μL、3.1×10⁸copies/μL、3.1×10⁷copies/μL、 3.1×10⁶copies/μL、3.1×10⁵copies/μL、3.1×10⁴copies/μL、3.1×10³copies/μL、3.1×10²copies/μL、 3.1×10¹copies/. mu. L) as a template, and performing fluorescent quantitative PCR amplification using the primers and probes in the kit of example 2, while setting positive and negative controls.

The PCR reaction system is as follows:

reaction conditions are as follows: reaction conditions are as follows: digestion of the contamination at 37 ℃ for 2min, pre-denaturation at 95 ℃ for 10min, at 95 ℃ for 15s and 60 ℃ for 1min and collection of the fluorescence signal for 40 cycles.

Drawing a standard curve, and carrying out rapid quantitative detection through the standard curve and the Ct value of the sample to be detected.

The above-mentioned embodiment is only one of the preferred embodiments of the present invention, and should not be used to limit the scope of the present invention, but all the insubstantial modifications or changes made within the spirit and scope of the main design of the present invention, which still solve the technical problems consistent with the present invention, should be included in the scope of the present invention.

SEQUENCE LISTING

<110> Baiyuan Gene technology of Lanzhou Ltd

<120> primer, probe, kit and method for RT-QPCR detection of fusarium sporotrichum

<130>20200421

<160>7

<170>PatentIn version 3.3

<210>1

<211>19

<212>DNA

<213> Artificial sequence

<400>1

cgaggacccc taaactctg 19

<210>2

<211>21

<212>DNA

<213> Artificial sequence

<400>2

atgtgcgttc aaagattcga t 21

<210>3

<211>20

<212>DNA

<213> Artificial sequence

<400>3

aacggatctc ttggttctgg 20

<210>4

<211>503

<212>DNA

<213> Artificial sequence

<400>4

tcccaacccc tgtgacatac ctatacgttg cctcggcgga tcagcccgcg ccccgtaaaa 60

cgggacggcc cgcccgagga cccctaaact ctgtttttag tggaacttct gagtaaaaca 120

aacaaataaa tcaaaacttt caacaacgga tctcttggtt ctggcatcga tgaagaacgc 180

accaaaatgc gataagtaat gtgaattgca gaattcagtg aatcatcgaa tctttgaacg 240

cacattgcgc ccgccagtat tctggcgggc atgcctgttc gagcgtcatt tcaaccctca 300

agctcagctt ggtgttggga ctcgcggtaa cccgcgttcc ccaaatcgat tggcggtcac 360

gtcgagcttc catagcgtag taatcataca cctcgttact ggtaatcgtc gcggccacgc 420

cgttaaaccc caacttctga atgttgacct cggatcaggt aggaataccc gctgaactta 480

agcatatcaa taagcggagg aaa 503

<210>5

<211>207

<212>DNA

<213> Artificial sequence

<400>5

cgggacggcc cgcccgagga cccctaaact ctgtttttag tggaacttct gagtaaaaca 60

aacaaataaa tcaaaacttt caacaacgga tctcttggtt ctggcatcga tgaagaacgc 120

accaaaatgc gataagtaat gtgaattgca gaattcagtg aatcatcgaa tctttgaacg 180

cacattgcgc ccgccagtat tctggcg 207

<210>6

<211>23

<212>DNA

<213> Artificial sequence

<400>6

tgtgacatac ctatacgttg cct 23

<210>7

<211>21

<212>DNA

<213> Artificial sequence

<400>7

cgacgattac cagtaacgag g 21

Claims

1. The primer for RT-QPCR detection of Fusarium sporotrichioides is characterized in that the primer comprises an upstream primer and a downstream primer, the nucleotide sequences of the upstream primer and the downstream primer are respectively shown as SEQ ID NO. 1 and SEQ ID NO. 2,

an upstream primer: 5'-CGAGGACCCCTAAACTCTG-3', respectively;

a downstream primer: 5'-ATGTGCGTTCAAAGATTCGAT-3' are provided.

2. The probe for RT-QPCR detection of Fusarium sporotrichioides is characterized in that the nucleotide sequence of the probe is shown as SEQ ID NO: 3: 5'-AACGGATCTCTTGGTTCTGG-3', respectively; preferably, the fluorescent reporter group marked at the 5 'end of the probe is VIC, and the fluorescent quencher group marked at the 3' end of the probe is BHQ.

3. A primer and probe combination for RT-QPCR detection of Fusarium sporotrichioides is characterized by comprising the following components:

an upstream primer: 5'-CGAGGACCCCTAAACTCTG-3', respectively;

a downstream primer: 5'-ATGTGCGTTCAAAGATTCGAT-3', respectively;

and (3) probe: 5'-AACGGATCTCTTGGTTCTGG-3' are provided.

4. A kit for RT-QPCR detection of Fusarium bactridioides comprising the primer of claim 1 and the probe of claim 2.

5. The kit according to claim 4, further comprising a QPCR template as shown in SEQ ID NO 4; preferably, the template is in the form of a plasmid.

6. The kit of claim 4 or 5, further comprising a negative sample; preferably, the negative control sample is ddH₂O。

7. The kit according to claim 4 or 5, further comprising a premix, preferably the premix is 2 × Probe Mix.

8. A reaction system for RT-QPCR detection of Fusarium sporotrichioides, comprising:

an upstream primer: 5'-CGAGGACCCCTAAACTCTG-3', respectively;

a downstream primer: 5'-ATGTGCGTTCAAAGATTCGAT-3', respectively;

and (3) probe: 5'-AACGGATCTCTTGGTTCTGG-3', respectively;

template: as shown in SEQ ID NO. 4;

9. An RT-QPCR detection method for detecting fusarium sporotrichioides is characterized by comprising the following steps of:

step 1, extracting total DNA of a sample to be detected;

step 2. preparing a reaction system, wherein the reaction system is as described in claim 8;

preferably, in the step 3, the concentration of the standard curve sample prepared by the gradient dilution is 3.1 × 10 respectively⁹copies/μL、3.1×10⁸copies/μL、3.1×10⁷copies/μL、3.1×10⁶copies/μL、3.1×10⁵copies/μL、3.1×10⁴copies/μL、3.1×10³copies/μL、3.1×10²copies/μL、3.1×10¹copies/μL；

10. The method of claim 9, wherein the reaction conditions of the PCR are: digestion of the contamination at 37 ℃ for 2min, pre-denaturation at 95 ℃ for 10min, at 95 ℃ for 15s and 60 ℃ for 1min and collection of the fluorescence signal for 40 cycles.