CN108179208A - For detecting the specific primer of Enterobacter sakazakii and probe and real-time fluorescence quantitative PCR kit - Google Patents
For detecting the specific primer of Enterobacter sakazakii and probe and real-time fluorescence quantitative PCR kit Download PDFInfo
- Publication number
- CN108179208A CN108179208A CN201810205116.7A CN201810205116A CN108179208A CN 108179208 A CN108179208 A CN 108179208A CN 201810205116 A CN201810205116 A CN 201810205116A CN 108179208 A CN108179208 A CN 108179208A
- Authority
- CN
- China
- Prior art keywords
- probe
- real
- primer
- enterobacter sakazakii
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention is provided to detect the specific primer of Enterobacter sakazakii and probe, the probe sequence is：5’‑CGTTCAGGAGAGCCACCG‑3’；The specific primer be following sequences or be following sequences complementary strand sequence：Upstream primer sequence is 5 ' GAACTGACCGATGACGTA 3 '；Downstream primer sequence is 5 ' GTCTCATTAAACGGCTCG 3 '.The present invention also provides corresponding real-time fluorescent PCR reagent cases.The present invention provides specific primer and probe, by the genomic DNA for extracting Enterobacter sakazakii, with reference to real-time fluorescence quantitative PCR detection technique, it can reach the purpose of Enterobacter sakazakii content in accurate quantitative analysis sample to be measured, with highly sensitive and high specific, to judging the content of Enterobacter sakazakii active bacteria so that follow-up study urethral infection is of great significance.
Description
Technical field
The invention belongs to molecular biology and external diagnosis reagent technical field, and in particular to for detecting Enterobacter sakazakii
Specific primer and probe and real-time fluorescence quantitative PCR kit.
Background technology
Enterobacter sakazakii (Cronobacter sakazakii) is one kind of enterobacteriaceae, belong to Gram-negative, will not shape
It is grown between 37 DEG C to 43 DEG C in rodlike bacterium, optimum into spore.Enterobacter sakazakii can cause serious newborn
Meningitis, enterocolitis and bacteremia, the death rate are up to more than 50%.At present, the rugged intestines bar of the unclear slope of microbiologist
The pollution source of bacterium, but many case reports show that infant formula is presently found main infection channel.Traditional diagnosis
The method of Enterobacter sakazakii is mainly classified by Bacterial Physiological biochemical characteristic, and a large amount of time is needed to carry out Physiology and biochemistry
The result judgement of reaction is unfavorable for finding cause of disease in time, diagnoses the cause of disease.Round pcr, can be with as a kind of biology tool
Selective amplification in vitro DNA or RNA segments, easy to operate, high specificity, the features such as quick, sensibility is high.Taq Man probes
Method detects high specificity, and high sensitivity facilitates optimization reaction condition, can be used in the quick detection of Enterobacter sakazakii.
Invention content
Present invention aims at design one group of Enterobacter sakazakii specific primer and probe sequence, establish a kind of can answer extensively
For quick, sensitive, the specific good method with fluorescence quantitative PCR detection of Enterobacter sakazakii detection.The present invention uses base
Because of clone technology, Enterobacter sakazakii 16SrDNA genetic fragments are inserted into carrier pMD18-T, obtains and contains 16SrDNA genes
The recombinant plasmid of segment, in this, as standard items.According to the design of Enterobacter sakazakii 16SrDNA genetic fragments coding gene sequence simultaneously
A group-specific primers and probe are synthesized, optimizes PCR reaction conditions, establishes using real-time fluorescence quantitative polymerase chain reaction as platform
Detection method, and the method established is assessed.
There is provided for detecting the specific primer of Enterobacter sakazakii and probe, the spy for first purpose of the present invention
Needle sequence is：5’-CGTTCAGGAGAGCCACCG-3’；
The specific primer be following sequences or be following sequences complementary strand sequence：
Upstream primer sequence is 5 '-GAACTGACCGATGACGTA-3 '；
Downstream primer sequence is 5 '-GTCTCATTAAACGGCTCG-3 '.
Preferably, the fluorescent reporter group of 5 ' end labels is FAM in probe, the fluorescent quenching group of 3 ' end labels is
BHQ。
Preferably, the sense primer and the downstream primer are to 5 ' ends and/or 3 ' extreme directions extension one to several
Base deletes a sequence obtained to several bases.
Second object of the present invention is to provide a kind of real-time fluorescence quantitative PCR reagent for being used to detect Enterobacter sakazakii
Box, the real-time fluorescence quantitative PCR kit include claim 1-3 any one of them specific primer and probe.
Preferably, in 20 μ l PCR reaction systems, the dosage of the sense primer is 0.2 μ l, the downstream primer
Dosage for 0.2 μ l, the dosage of the probe is 0.2 μ l.
Preferably, the real-time fluorescence quantitative PCR kit further includes series concentration standard items and positive control；It is described
Series concentration standard items are to connect Enterobacter sakazakii 16SrDNA genes with carrier, convert into competent cell induced expression,
Recombinant plasmid is extracted, is diluted after recombinant plasmid is quantified, obtains series concentration standard items.
Preferably, the nucleotides sequence of the standard items is classified as sequence 2 in sequence table.
Third object of the present invention is to provide above-mentioned specific primer and probe, real-time fluorescence quantitative PCR kit exist
It is following it is any in application, the application is not for the purpose of the diagnose and treat of disease：
(1) qualitatively or quantitatively detection or auxiliary detect Enterobacter sakazakii；
(2) product of qualitative or quantitative detection or auxiliary detection Enterobacter sakazakii is prepared.
Fourth object of the present invention is to provide in a kind of detection or auxiliary detection measuring samples whether contain the rugged intestines bar of slope
The method of bacterium, this method not for the purpose of the diagnose and treat of disease, respectively using series concentration standard items and sample to be tested DNA as
Template carries out real-time fluorescence quantitative PCR using specific primer and probe, draws standard curve, by standard curve and to be measured
The Ct values judgement result of sample.
Preferably, the reaction condition of the real-time fluorescence quantitative PCR is：94 DEG C of pre-degenerations 2 minutes, 94 DEG C 10 seconds, 60
DEG C 30s simultaneously collects fluorescence signal, 40 cycles.
The present invention is provided to the primer and probe that Enterobacter sakazakii carries out qualitative and quantitative analysis, by extracting the rugged intestines of slope
The genomic DNA of bacillus with reference to real-time fluorescence quantitative PCR detection technique, can reach the rugged intestines bar of slope in accurate quantitative analysis sample to be measured
The purpose of bacterial content, having high sensitivity, (sensitivity is 1.00 × 102Copies/ml) and high specific (is capable of specificity
From Lactobacillus rhamnosus, the primary bacterium of pneumonia gram, escherichia coli, haemophilus influenzae, Enterobacter sakazakii, Neisseria meningitidis,
Staphylococcus aureus, enterobacter cloacae, beta hemolytic streptococcus, clostridium tetani, pseudomonas aeruginosa, cheese breast bar
Bacterium, vibrio parahaemolytious, streptococcus thermophilus, proteus mirabilis, salmonella typhimurium, NEISSERIA GONORRHOEAE, streptococcus pneumonia, good fortune
It is specific in family name's shigella dysenteriae, salmonella, streptococcus pyogenes, helicobacter pylori to detect Enterobacter sakazakii).Institute of the present invention
The primer and probe of offer can carry out qualitative and quantitative analysis to Enterobacter sakazakii content, to judging Enterobacter sakazakii active bacteria
So that follow-up study urethral infection is of great significance, the present invention will play important content in microorganism clinical detection field
Effect.
Below in conjunction with the accompanying drawings and the present invention is described in detail in specific embodiment.
Description of the drawings
Attached drawing is used to provide further understanding of the present invention, and a part for constitution instruction, the reality with the present invention
Example is applied together for explaining the present invention, is not construed as limiting the invention.In the accompanying drawings：
Fig. 1 is ncbi database blast comparison results.
Fig. 2 is upstream and downstream primer sequence through Primer-Blast comparison results in NCBI.
Fig. 3 is the standard curve of standard items of the present invention.
Fig. 4 is sensitivity experiment result of the present invention.
Fig. 5 is specificity experiments result of the present invention.
Fig. 6 is specificity experiments gel imaging proof diagram of the present invention.
Specific embodiment
Following embodiment facilitates a better understanding of the present invention, but does not limit the present invention.Experiment in following embodiments
Method is conventional method unless otherwise specified.The primer, probe and sequencing efforts used are by raw work biology work
Journey (Shanghai) limited company synthesizes and completes.
The preparation of 1 16SrDNA gene standard items of embodiment
Establish real time fluorescence quantifying PCR method it may first have to which the external standards needed for preparation method, standard items should wrap
Containing highly conserved, special sequence, it is ensured that the high specific of reaction.16SrDNA genes are widely present in Enterobacter sakazakii,
With very high conservative.The present invention is using Enterobacter sakazakii 16SrDNA genes as target sequence.The present embodiment mainly uses
Round pcr expands Enterobacter sakazakii 16SrDNA genes, is connected in plasmid vector pMD18-T using gene recombination technology,
Recombinant plasmid pMD18-T-16S is constructed, and carries out corresponding PCR identifications and sequencing identification, most waits to establish through quantitative be used as afterwards
The standard items of method lay the foundation for the method for next step and assessment.
First, the preparation of template DNA
Enterobacter sakazakii (reference culture) genomic DNA is extracted, the template as the amplification of 16SrDNA gene PCRs.Using north
The bacterial genomes extracts kit of capital hundred Imtech production is extracted, and specific extracting method is as follows：
1. taking 1ml bacteria suspensions, 1.5ml centrifuge tubes are added in, 8000r/min is centrifuged 2 minutes, abandons supernatant.
2. adding in 400 μ l Buffer Digestion suspension bacteria liquids precipitation, it is complete to cell to be put into 65 DEG C of water-bath 1h after mixing
It totally cleaves solution；
3. add in -20 DEG C of standing 5min of 200 μ l Buffer PB mixings, centrifuging and taking supernatant；
4. add in -20 DEG C of standing 5min of 600 μ l isopropanols mixing.Supernatant is abandoned in centrifugation；
5. add in -20 DEG C of standing 5min of 75% ethyl alcohol of 1ml.Supernatant is abandoned in centrifugation；
6. precipitation is washed with 75% ethyl alcohol, dry；
7. it is dissolved in 50 μ l TE Buffer, -20 DEG C of preservations.
2nd, the PCR amplification of 16SrDNA genetic fragments
1st, the design and synthesis of primer
16SrDNA identifications are to carry out Species estimation to bacterium using the method for bacterial 16 S rDNA sequences.It is a kind of fast
The method that speed obtains bacterium kind information.The present invention detects Enterobacter sakazakii 16SrDNA gene tables using real-time fluorescence quantitative PCR
Up to level, meanings and specificity of the 16SrDNA in Enterobacter sakazakii detects are specified.
The present invention to Enterobacter sakazakii 16SrDNA genes complete sequence in ncbi database by carrying out bioinformatics comparison
Analysis is chosen and is suitble to the conservative fragments sequence of design primer and probe for target, using 3 softwares of Primer express,
7 software of 5 softwares of Primer Premier and Beacon Designer, devise one group of real-time fluorescence quantitative PCR primer and
The peripheral primer of probe and one group of correlated series.
The extension increasing sequence that the present invention chooses is as follows：
5’-ATGGTTTCCCTGCCCCGCCCTGCCGCGACAGATGTCGCGGCTCAGTGTTTTCTTAACGCGCTGCTG
CGTGAAACCCGGGACTGGCAACTGATCCCCGGCGCATTACCGCAGGAGCCGGCGCAGATCCATTTACCACTCTCTGA
GACGCAGGCAATCCGTATTGCGCTGCGCTACTTCTCTCCGACGCAACATCATCAGTATCTGTTTCCGGCAATGCTGG
TGGCAAGCGATAACGATAGCTGCGAACCCATTAATTTCACAAAGCTTGTCGACCTCATTCTGGCGAAGCCCGCCGTA
AAAGGCGAACTGACCGATGACGTACTGGCCCGTTTTGCGCGCCGCGTTCAGGAGAGCCACCGCCATACCTGGCAGGC
GATTGAACTGCGTCACGACTGGGCCACGCTTCGCGCGCAGCCGCTCAACTTTGCAGAGGCAGAACAGGCGCTGCTGG
TCGGGCATGCGTTTCACCCGGCACCGAAATCGCACGAGCCGTTTAATGAGACCGAAGCCCGCCGCTATCTGCCGGAT
TTCGCGCCGCGCTTTCCGCTGCGCTGGTTTGCGGTGAATAAGGCGTATGTGGCAGGCGAGAGTCTGGCGTTAGATCT
GCGTACGCGTCTGCTGCGTTTCGCGGCCCAGAGCGCGCCTGCGCTGCTTGAGCACTTTACCGATACACGCTGGCTGG
TGCCGATGCACCCGTGGCAGGCCGCGTATCTGCTCGCGCAGCCGTGGTGTCAGGCGCTGGTGGAGAAGGGCGAGCTT
ACCGATCTGGGCGAAGCAGGCGCGCCGTGGCTGCCGACCAGTTCTTCGCGTTCGCTCTACAGCGAAACCAATAACGA
CATGATCAAATTCTCGCTCAGCGTGCGTCTTACTAACTCGGTGCGCACGCTGTCGGTAAAAGAAGTGAAACGCGGCA
TGCGTCTGGCGCGGATGGCGCAGACTCCCCGCTGGCAGGCGTTGCAGGCGCGTTATCCGACCATGCGCGTCATGCAG
GAAGATGGCTGGATGGGCCTTTGCGACACGCAGGGGACTATTCAGGAAGAGAGCCTGATGGCGCTGCGCGTCAATCT
GCTGTTCGACACGCCAGACACCCAGACCAACGTGCTGGTGAGCCTGACTCAGGCCGCGCCGGACGGCGGCGACAGCC
TGCTGGCCTGCGCCGTGCGCCGCCTCAGTGAACGCCTCAGCCTGCCGCTCGCACAGGCGGCGCGCTGCTGGGTGCAG
GCGTACTGCGAACGCATTCTGCTGCCGCTTTTCAGCGCCGAAGCCGATTACGGCCTGGTACTGCTGGCGCATCAGCA
AAATATTCTGGTGGAGATGCAGCAGGATCTGCCGGTCGGCCTGATTTATCGCGACTGTCAGGGCAGCGGCTTTACCG
ATGGCGCGCTGCTGTGGCTTGCGGAGGCCGGCGAGCCGGAAGCGGAAAACCGCTTCAGCGAAGCCCAGCTGCTGCGC
TACTTCCCGTATTACCTGCTGGTGAACTCCACGCTGGCGGTAACCGCCGCGCTGGGTGCCGCCGGGTTTGAGAGCGA
AGAAAAGCTGATGGCGCTGGTGCGTGACGCGCTCGCGCAACTGCGCGCCACCGCGCGCGATACCCGCTGCCTCGATT
ATGTGCTGGAGAGCCGCCACTGGAACTGCAAGGGCAACTTCTTCTGCTATCTGCACGATCACAACGAAAACACCATC
GCCGACCCGGCGGTCATCTACTTTAACTTCGACAATCCGTTTGCAGGGAGCACGCATGATGCCTGA-3’。
This sequence to the display display of ncbi database blast results by being shown in Fig. 1.
Fig. 1 is ncbi database blast comparison results.
As shown in Figure 1：This sequence pair Enterobacter sakazakii has specificity.
The periphery primer sequence is as follows：
Sense primer：16SrDNA-304F 5'-GAACTGACCGATGACGTA-3'
Downstream primer：16SrDNA-503R 5'-GTCTCATTAAACGGCTCG-3'
Amplified fragments size is：200bp.
Upstream and downstream primer sequence is shown in Fig. 2 through Primer-Blast comparison results in NCBI.
Fig. 2 is upstream and downstream primer sequence through Primer-Blast comparison results in NCBI.
As shown in Figure 2：This has specificity to primer pair Enterobacter sakazakii.
2nd, PCR reaction systems and reaction condition
Using the DNA of extraction as template, using above-mentioned periphery primer 16SrDNA-304F/16SrDNA-503R as amplimer,
PCR amplification is carried out using following systems and reaction condition.
PCR system：
Wherein primer uses 16SrDNA-304F/16SrDNA-503R, and Taq enzyme uses hundred Tyke Power Taq of Beijing
Plus DNA Polymerse, PCR amplification instrument are the serial 96 grads PCR instrument of Hangzhou Lang Ji scientific instrument Co., Ltd MG.
Amplification program/reaction condition：
94 DEG C of pre-degeneration 5min；94 DEG C of 30s, 50 DEG C of 30s, 72 DEG C of 1min, 30 cycles；72 DEG C of 10min take 5 μ L to expand
Product carries out 2% agarose electrophoresis, detects PCR product size, then recycles examination using the DNA gel of Shanghai Sangon Biotech Company's production
Remaining pcr amplification product is recycled in the purifying of agent box.
3rd, the structure of recombinant plasmid pMD18-T-16S and conversion
1st, coupled reaction：The pcr amplification product that above-mentioned purifying obtains and pMD18-T (Dalian treasured biotech firm) are connected
It connects, is prepared using following linked system：
Preparation completion is placed on 16 DEG C and carries out staying overnight coupled reaction.
2nd, the conversion of pMD18-T-16S plasmids and PCR identifications
1. taking out the DH5 α competent cells frozen from -70 DEG C of ultra low temperature freezer, being placed on ice chest makes it solve naturally
Freeze；
2. 10 μ L of connection product is taken to add in the DH5 α competent cells of 100 μ L；
3. heat shock 90s in 42 DEG C of water-baths puts cooled on ice 30min after heat shock immediately；
After 4. LB fluid nutrient mediums (without ampicillin) mixing of 800 μ l of precooling is added in into 1.5ml EP pipes,
37 DEG C of 140rpm jog cultures 1h；
5. above-mentioned culture solution 8000rpm is centrifuged 1min, supernatant is abandoned, cell resuspension absorption residue is coated on and is contained
It on the LB tablets of 0.1ngAmp, faces up and places 30min, after bacterium solution is cultured base absorption completely, be inverted 37 DEG C of culture dish
Insulating box overnight incubation；
6. next day is observed, picking monoclonal bacterium colony is in 100 μ L LB fluid nutrient mediums (containing ampicillin) from tablet
In PCR pipe, 37 DEG C of shaken cultivations 2-3 hours.It draws 2 μ L and carries out PCR identifications as template, remaining bacterium solution is added to 20ml's
It carries out expanding in LB fluid nutrient mediums and shake；
7. expand above-mentioned dilution bacterium solution, PCR with Enterobacter sakazakii specific primer 16SrDNA-304F/16SrDNA-503R
Product uses 2% agarose gel electrophoresis, and positive transformant is identified by detecting PCR product size.
Primer 16SrDNA-304F/16SrDNA-503R sequences are as follows：
Sense primer；16SrDNA-304F 5'-GAACTGACCGATGACGTA-3'
Downstream primer；16SrDNA-503R 5'-GTCTCATTAAACGGCTCG-3'
PCR reaction systems are as follows：
Amplification program/reaction condition：94 DEG C of pre-degeneration 5min；94 DEG C of 30s, 50 DEG C of 30s, 72 DEG C of 1min, 30 cycles；72
℃10min。
Positive recombinant plasmid pMD18-T-16SrDNA is extracted using the Plasmid Preparation kit of hundred Imtech production, is surveyed
Determine concentration and purity, while draw a part of plasmid purification and supreme marine growth Engineering Co., Ltd is sent to be sequenced, determine to be inserted into
The gene order of segment is consistent with aim sequence.
4th, the acquisition of standard items and quantitative
1st, the 100 μ L transferred speciess of bacillus coli DH 5 alpha containing recombinant plasmid pMD18-T-16S that step 3 obtains are taken in 5mL's
LB fluid nutrient mediums, 37 DEG C of 200rpm shake training overnight；
2nd, the bacterium solution transferred speciess of 1ml overnight incubations is taken in 10ml LB fluid nutrient mediums, 200rpm Zengjing Granules 2-3 hours, so
Afterwards using the Plasmid Preparation kit extraction plasmid of hundred Imtech of Beijing production；
3rd, using hundred Tyke bio tech ltd ultramicron ultraviolet-uisible spectrophotometer (ND5000) of Beijing to carrying
The plasmid taken is measured, and measures A260、A280, according to A260/A280Judge the purity of plasmid.
4th, plasmid pMD18-T-16S concentration (copy number) calculates
(1) molecular weight=2909bp × 660 (average molecular weight of each pair of base) of plasmid
(2) plasmid concentration is measured as 173.26ng/ μ l, plasmid purity A260/A280=1.82, because determining in progress real-time fluorescence
It when measuring PCR, needs with " copy number " for unit, it is therefore desirable to by Conversion of measurement unit into copies/ml.
Plasmid copies/ml=Avgadro constants × plasmid molal quantity
Wherein Avgadro constant=6.02 × 1023copies/mol。
Therefore plasmid concentration copies/ml=173.26 × 10 of extraction-9g/ml×6.02×1023copies/mol÷
(2909bp × 660g/bpmol)=5.43 × 1010copies/ml
10 μ l plasmids add 44.3 sterile water just to obtain a concentration of 1.00 × 1010The plasmid of copies/ml, then by the plasmid
A series of plasmid that 10 doubling dilutions just can obtain concentration is carried out, and is saved backup in -20 DEG C.
2 real-time fluorescence quantitative PCR kit of embodiment
First, the design and synthesis of specific primer and probe
The present invention to Enterobacter sakazakii 16SrDNA genes complete sequence in ncbi database by carrying out bioinformatics comparison
Analysis, it is target (see embodiment 1), and further apply to choose the conservative fragments sequence for being suitble to design primer and probe
7 software of 3 softwares of Primer express, 5 softwares of Primer Premier and Oligo, devises multigroup real-time fluorescence and determines
PCR primer and probe are measured, is screened by Preliminary Experiment, is finally determined one group for detecting the fluorescent quantitation of Enterobacter sakazakii
PCR primer and probe.
As the core of the present invention, one group of primer and probe nucleotide for being used for Enterobacter sakazakii real-time fluorescence PCR detection
Sequence is as follows：
Sense primer：16SrDNA-304F 5'-GAACTGACCGATGACGTA-3'
Downstream primer：16SrDNA-503R 5'-GTCTCATTAAACGGCTCG-3'
Probe：16SrDNA304-503 5'-CGTTCAGGAGAGCCACCG-3'
The fluorescent reporter group that probe 5 ' is held is FAM, and 3 ' end labels are fluorescent quenching group BHQ.
The primer and probe amplification Target Nucleotide Sequence be：
5’-GAACTGACCGATGACGTACTGGCCCGTTTTGCGCGCCGCGTTCAGGAGAGCCACCGCCATACCTGG
CAGGCGATTGAACTGCGTCACGACTGGGCCACGCTTCGCGCGCAGCCGCTCAACTTTGCAGAGGCAGAACAGGCGCT
GCTGGTCGGGCATGCGTTTCACCCGGCACCGAAATCGCACGAGCCGTTTAATGAGAC-3’。
2nd, the foundation of real-time fluorescence quantitative PCR kit
1st, real-time fluorescence quantitative PCR kit includes following components：
(2 × premix is produced 2 × premix for hundred Tyke Bioisystech Co., Ltd of Beijing, and full name is 2 × real-
Time PCR Premixture (probe)), final concentration of 10 μM of sense primer, final concentration of 10 μM of downstream primer, end
A concentration of 10 μM of probe, the 16SrDNA gene series concentration standards (series of series concentration standard items of the preparation of embodiment 1
It is a concentration of：1.00×1010copies/ml、1.00×109copies/ml、1.00×108copies/ml、1.00×
107copies/ml、1.00×106copies/ml、1.00×105copies/ml、1.00×104copies/ml、1.00×
103copies/ml、1.00×102Copies/ml), positive control (a concentration of 5.43 × 1010The embodiment 1 of copies/ml is made
Standby recombinant plasmid pMD18-T-16S) and ddH2O, ddH2O is used as reagent and negative control.
Sense primer：16SrDNA-304F 5'-GAACTGACCGATGACGTA-3'
Downstream primer：16SrDNA-503R 5'-GTCTCATTAAACGGCTCG-3'
Probe：16SrDNA304-503 5'-CGTTCAGGAGAGCCACCG-3'.
The fluorescent reporter group that probe 5 ' is held is FAM, and 3 ' end labels are fluorescent quenching group BHQ.
2nd, using the standard curve of real-time fluorescence quantitative PCR kit measurement standard items
Using embodiment 1 prepare 16SrDNA gene series concentration standards (series concentration of series concentration standard items as：
1.00×1010copies/ml、1.00×109copies/ml、1.00×108copies/ml、1.00×107copies/ml、
1.00×106copies/ml、1.00×105copies/ml、1.00×104copies/ml、1.00×103copies/ml、
1.00×102Copies/ml it is) template, using the primer and probe in kit, carries out fluorescent quantitative PCR, set simultaneously
Put positive control and negative control.
PCR reaction systems are as follows：
Reaction condition：94 DEG C of pre-degenerations 2 minutes, 94 DEG C 10 seconds, 60 DEG C of 30s and collect fluorescence signal, 40 cycles.
The preparation method of standard curve：Using the logarithm of the plasmid concentration of standard items as abscissa, obtained using ct values as ordinate
To standard curve, as a result with reference to figure 1.Standard curve original equation is y=ax+b, and the equation of this standard curve is Y=-
2.796x+41.74。
Fig. 1 is the standard curve of standard items of the present invention.As shown in Figure 1, standard items standard curve is smooth, and related coefficient is high,
Specially R2=0.993, meet the requirement of real-time fluorescence quantitative PCR detection.
3 real-time fluorescence quantitative PCR kit of embodiment is to the quantitative detecting method of sample to be tested
16SrDNA gene series concentration standards (the series concentration marks prepared respectively with sample to be tested DNA and embodiment 1
The series concentration of quasi- product is：1.00×1010copies/ml、1.00×109copies/ml、1.00×108copies/ml、
1.00×107copies/ml、1.00×106copies/ml、1.00×105copies/ml、1.00×104copies/ml、
1.00×103copies/ml、1.00×102Copies/ml it is) template, using the primer and probe in kit, carries out fluorescence
Quantitative pcr amplification, while positive control and negative control are set.
PCR reaction systems are as follows：
Reaction condition：94 DEG C of pre-degenerations 2 minutes, 94 DEG C 10 seconds, 60 DEG C of 30s and collect fluorescence signal, 40 cycles.It draws
Standard curve carries out Quantitative detection by the Ct values of standard curve and sample to be tested.
The performance test of 4 real-time fluorescence quantitative PCR kit of embodiment
1st, sensitivity experiment
The plasmid pMD18-T-16S that embodiment 1 is prepared is subjected to 10 doubling dilutions and obtains a series of plasmid of concentration,
Choose a concentration of 1.00 × 1010copies/ml、1.00×109copies/ml、1.00×108copies/ml、1.00×
107copies/ml、1.00×106copies/ml、1.00×105copies/ml、1.00×104copies/ml、1.00×
103copies/ml、1.00×102copies/ml、1.00×101Copies/ml and negative control are as template.Reaction system
It is as follows：
Reaction condition：94 DEG C of pre-degenerations 2 minutes, 94 DEG C 10 seconds, 60 DEG C of 30s and collect fluorescence signal, 40 cycles.According to
Fluorescence signal detected by instrument is handled through software obtains fluorescence curve, observes the signal of fluorescence curve, as a result reference Fig. 4,
Data are shown when plasmid concentration reaches 1.00 × 102Still there is fluorescence signal during copies/ml.Therefore the sensitivity of this method is
1.00×102copies/ml。
Fig. 4 is sensitivity experiment result of the present invention.Wherein, it is respectively 1.00 × 10 that a, which represents plasmid concentration,10copies/ml、
B represents plasmid concentration as 1.00 × 109Copies/ml, c represent plasmid concentration as 1.00 × 108Copies/ml, d represent plasmid
A concentration of 1.00 × 107Copies/ml, e represent plasmid concentration as 1.00 × 106Copies/ml, f represent plasmid concentration as 1.00
×105Copies/ml, g represent plasmid concentration as 1.00 × 104Copies/ml, h represent plasmid concentration as 1.00 ×
103Copies/ml, i represent plasmid concentration as 1.00 × 102Copies/ml, j represent plasmid concentration as 1.00 × 101copies/
Ml and negative control.
2nd, specificity experiments
The present invention can be from Lactobacillus rhamnosus, the primary bacterium of pneumonia gram, escherichia coli, haemophilus influenzae, the rugged intestines bar of slope
Bacterium, Neisseria meningitidis, staphylococcus aureus, enterobacter cloacae, beta hemolytic streptococcus, clostridium tetani, verdigris
How are pseudomonad, Lactobacillus casei, vibrio parahaemolytious, streptococcus thermophilus, proteus mirabilis, salmonella typhimurium, gonorrhoea
It is specific in plucked instrument bacterium, streptococcus pneumonia, Shigella flexneri, salmonella, streptococcus pyogenes and helicobacter pylori to detect
Enterobacter sakazakii.
It is experiment that template carries out that specific test, which is included with the genomic DNA of above-mentioned sample,.The DNA of mentioned microorganism is carried
Take using Shanghai life work bacterial genomes DNA rapid extractions kit (C317KA2364), using Bo companies production 2 ×
Real-time PCR Premixture (probe) real-time fluorescence quantitative PCR kit is tested, and reaction system is as follows：
Primer and probe therein is the primer and probe in the embodiment of the present invention 2.
Reaction condition：94 DEG C of pre-degenerations 2 minutes, 94 DEG C 10 seconds, 60 DEG C of 30s and collect fluorescence signal, 40 cycles.According to
Fluorescence signal detected by instrument is handled through software obtains fluorescence curve, observes the signal of fluorescence curve, analysis specificity.Knot
Fruit is with reference to figure 5：Using genomic DNA as template only Enterobacter sakazakii test positive, remaining microorganism is feminine gender, shows this hair
It is bright that there is specificity well.Testing result is as shown in table 1.
Table 1
Fig. 5 is specificity experiments result of the present invention.Wherein, a standard amplification curves are Enterobacter sakazakii genome, b generations
It is respectively Lactobacillus rhamnosus, the primary bacterium of pneumonia gram, escherichia coli, haemophilus influenzae, brain that table, which does not occur standard amplification curve,
Film inflammation Neisseria, staphylococcus aureus, enterobacter cloacae, beta hemolytic streptococcus, clostridium tetani, P. aeruginosa
Bacterium, Lactobacillus casei, vibrio parahaemolytious, streptococcus thermophilus, proteus mirabilis, salmonella typhimurium, NEISSERIA GONORRHOEAE, lung
Scorching streptococcus, Shigella flexneri, salmonella, streptococcus pyogenes, helicobacter pylori, negative control.
3rd, specificity experiments gel imaging proof diagram
In order to confirm the specificity of the invention detected to Enterobacter sakazakii, we have chosen other common clinicals and infect micro- life
Object carries out specificity experiments, and the microorganism of selection includes：The primary bacterium of Lactobacillus rhamnosus, pneumonia gram, escherichia coli, influenza are bloodthirsty
Bacillus, Neisseria meningitidis, staphylococcus aureus, enterobacter cloacae, beta hemolytic streptococcus, clostridium tetani, copper
Green pseudomonad, Lactobacillus casei, vibrio parahaemolytious, streptococcus thermophilus, proteus mirabilis, salmonella typhimurium, gonorrhoea
Neisseria, streptococcus pneumonia, Shigella flexneri, salmonella, streptococcus pyogenes, helicobacter pylori, negative control.
Prepare 2% agarose gel detection Enterobacter sakazakii specific primer probe fluorescent quantitation result.With specific real
The amplified production tested is template.
Fig. 6 is specificity experiments gel imaging proof diagram of the present invention.Wherein, swimming lane 1-24 be followed successively by Lactobacillus rhamnosus,
The primary bacterium of pneumonia gram, escherichia coli, haemophilus influenzae, Neisseria meningitidis, staphylococcus aureus, enterobacter cloacae,
Beta hemolytic streptococcus, clostridium tetani, pseudomonas aeruginosa, Enterobacter sakazakii, Lactobacillus casei, DL2000
Marker, vibrio parahaemolytious, streptococcus thermophilus, proteus mirabilis, salmonella typhimurium, NEISSERIA GONORRHOEAE, pneumonia streptococcus
Bacterium, Shigella flexneri, salmonella, streptococcus pyogenes, helicobacter pylori, negative control.
As a result it shows：Using the amplified production of specificity experiments as template, only Enterobacter sakazakii detection amplified band is size
Correct purpose band, remaining microorganism do not amplify purpose band, show that the present invention has specificity well.
Finally it should be noted that：The foregoing is only a preferred embodiment of the present invention, is not intended to restrict the invention,
Although the present invention is described in detail referring to the foregoing embodiments, for those skilled in the art, still may be used
To modify to the technical solution recorded in foregoing embodiments or carry out equivalent replacement to which part technical characteristic.
All within the spirits and principles of the present invention, any modification, equivalent replacement, improvement and so on should be included in the present invention's
Within protection domain.
Sequence table
<110>Suzhou Bai Yuan gene technology Co., Ltd
<120>For detecting the specific primer of Enterobacter sakazakii and probe and real-time fluorescence quantitative PCR kit
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1749
<212> DNA
<213>Enterobacter sakazakii (Cronobacter sakazakii)
<400> 1
atggtttccc tgccccgccc tgccgcgaca gatgtcgcgg ctcagtgttt tcttaacgcg 60
ctgctgcgtg aaacccggga ctggcaactg atccccggcg cattaccgca ggagccggcg 120
cagatccatt taccactctc tgagacgcag gcaatccgta ttgcgctgcg ctacttctct 180
ccgacgcaac atcatcagta tctgtttccg gcaatgctgg tggcaagcga taacgatagc 240
tgcgaaccca ttaatttcac aaagcttgtc gacctcattc tggcgaagcc cgccgtaaaa 300
ggcgaactga ccgatgacgt actggcccgt tttgcgcgcc gcgttcagga gagccaccgc 360
catacctggc aggcgattga actgcgtcac gactgggcca cgcttcgcgc gcagccgctc 420
aactttgcag aggcagaaca ggcgctgctg gtcgggcatg cgtttcaccc ggcaccgaaa 480
tcgcacgagc cgtttaatga gaccgaagcc cgccgctatc tgccggattt cgcgccgcgc 540
tttccgctgc gctggtttgc ggtgaataag gcgtatgtgg caggcgagag tctggcgtta 600
gatctgcgta cgcgtctgct gcgtttcgcg gcccagagcg cgcctgcgct gcttgagcac 660
tttaccgata cacgctggct ggtgccgatg cacccgtggc aggccgcgta tctgctcgcg 720
cagccgtggt gtcaggcgct ggtggagaag ggcgagctta ccgatctggg cgaagcaggc 780
gcgccgtggc tgccgaccag ttcttcgcgt tcgctctaca gcgaaaccaa taacgacatg 840
atcaaattct cgctcagcgt gcgtcttact aactcggtgc gcacgctgtc ggtaaaagaa 900
gtgaaacgcg gcatgcgtct ggcgcggatg gcgcagactc cccgctggca ggcgttgcag 960
gcgcgttatc cgaccatgcg cgtcatgcag gaagatggct ggatgggcct ttgcgacacg 1020
caggggacta ttcaggaaga gagcctgatg gcgctgcgcg tcaatctgct gttcgacacg 1080
ccagacaccc agaccaacgt gctggtgagc ctgactcagg ccgcgccgga cggcggcgac 1140
agcctgctgg cctgcgccgt gcgccgcctc agtgaacgcc tcagcctgcc gctcgcacag 1200
gcggcgcgct gctgggtgca ggcgtactgc gaacgcattc tgctgccgct tttcagcgcc 1260
gaagccgatt acggcctggt actgctggcg catcagcaaa atattctggt ggagatgcag 1320
caggatctgc cggtcggcct gatttatcgc gactgtcagg gcagcggctt taccgatggc 1380
gcgctgctgt ggcttgcgga ggccggcgag ccggaagcgg aaaaccgctt cagcgaagcc 1440
cagctgctgc gctacttccc gtattacctg ctggtgaact ccacgctggc ggtaaccgcc 1500
gcgctgggtg ccgccgggtt tgagagcgaa gaaaagctga tggcgctggt gcgtgacgcg 1560
ctcgcgcaac tgcgcgccac cgcgcgcgat acccgctgcc tcgattatgt gctggagagc 1620
cgccactgga actgcaaggg caacttcttc tgctatctgc acgatcacaa cgaaaacacc 1680
atcgccgacc cggcggtcat ctactttaac ttcgacaatc cgtttgcagg gagcacgcat 1740
gatgcctga 1749
<210> 2
<211> 200
<212> DNA
<213>Enterobacter sakazakii (Cronobacter sakazakii)
<400> 2
gaactgaccg atgacgtact ggcccgtttt gcgcgccgcg ttcaggagag ccaccgccat 60
acctggcagg cgattgaact gcgtcacgac tgggccacgc ttcgcgcgca gccgctcaac 120
tttgcagagg cagaacaggc gctgctggtc gggcatgcgt ttcacccggc accgaaatcg 180
cacgagccgt ttaatgagac 200
Claims (10)
1. for detecting the specific primer and probe of Enterobacter sakazakii, it is characterised in that：The probe sequence is：5’-
CGTTCAGGAGAGCCACCG-3’；
The specific primer be following sequences or be following sequences complementary strand sequence：
Upstream primer sequence is 5 '-GAACTGACCGATGACGTA-3 '；
Downstream primer sequence is 5 '-GTCTCATTAAACGGCTCG-3 '.
2. specific primer according to claim 1 and probe, it is characterised in that：The fluorescence report of 5 ' end labels in probe
Group is FAM, and the fluorescent quenching group of 3 ' end labels is BHQ.
3. specific primer according to claim 1 and probe, it is characterised in that：The sense primer and the downstream are drawn
Object is to 5 ' ends and/or 3 ' extreme directions extension one to several bases or deletes a sequence obtained to several bases.
4. a kind of real-time fluorescence quantitative PCR kit for being used to detect Enterobacter sakazakii, it is characterised in that：The real-time fluorescence is determined
It measures PCR kit and includes claim 1-3 any one of them specific primer and probe.
5. real-time fluorescence quantitative PCR kit according to claim 4, it is characterised in that：In 20 μ l PCR reaction systems
In, the dosage of the sense primer is 0.2 μ l, and the dosage of the downstream primer is 0.2 μ l, and the dosage of the probe is 0.2 μ l.
6. real-time fluorescence quantitative PCR kit according to claim 4 or 5, it is characterised in that：The real time fluorescent quantitative
PCR kit further includes series concentration standard items and positive control；The series concentration standard items are by Enterobacter sakazakii
16SrDNA genes are connect with carrier, convert into competent cell induced expression, extract recombinant plasmid, recombinant plasmid is quantified
After dilute, obtain series concentration standard items.
7. real-time fluorescence quantitative PCR kit according to claim 6, it is characterised in that：The nucleotide of the standard items
Sequence is sequence 2 in sequence table.
8. any specific primers of claim 1-3 and any real time fluorescent quantitative of probe, claim 4-7
PCR kit it is following it is any in application, the application is not for the purpose of the diagnose and treat of disease：
(1) qualitatively or quantitatively detection or auxiliary detect Enterobacter sakazakii；
(2) product of qualitative or quantitative detection or auxiliary detection Enterobacter sakazakii is prepared.
9. in a kind of detection or auxiliary detection measuring samples whether the method containing Enterobacter sakazakii, this method not examining with disease
For the purpose of disconnected and treatment, it is characterised in that：Respectively using series concentration standard items and sample to be tested DNA as template, specificity is utilized
Primer and probe carries out real-time fluorescence quantitative PCR, draws standard curve, judges to tie by the Ct values of standard curve and sample to be tested
Fruit.
10. according to the method described in claim 9, it is characterized in that：The reaction condition of the real-time fluorescence quantitative PCR is：94
DEG C pre-degeneration 2 minutes, 94 DEG C 10 seconds, 60 DEG C of 30s and collect fluorescence signal, 40 cycles.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810205116.7A CN108179208A (en) | 2018-03-13 | 2018-03-13 | For detecting the specific primer of Enterobacter sakazakii and probe and real-time fluorescence quantitative PCR kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810205116.7A CN108179208A (en) | 2018-03-13 | 2018-03-13 | For detecting the specific primer of Enterobacter sakazakii and probe and real-time fluorescence quantitative PCR kit |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108179208A true CN108179208A (en) | 2018-06-19 |
Family
ID=62553530
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810205116.7A Pending CN108179208A (en) | 2018-03-13 | 2018-03-13 | For detecting the specific primer of Enterobacter sakazakii and probe and real-time fluorescence quantitative PCR kit |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108179208A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113136441A (en) * | 2021-04-12 | 2021-07-20 | 中海生物技术(枣庄)有限公司 | Fluorescence quantitative PCR detection kit and detection method for enterobacter sakazakii and application thereof |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2011015356A1 (en) * | 2009-08-07 | 2011-02-10 | Biotecon Diagnostics Gmbh | Nucleic acids and methods for the detection of enterobacter sakazakii (cronobacter spp.) |
| CN102816761A (en) * | 2012-08-28 | 2012-12-12 | 无锡中德伯尔生物技术有限公司 | Highly specific gene fragment of Cronobacter spp. and its application |
| CN103497962A (en) * | 2013-10-15 | 2014-01-08 | 上海市计量测试技术研究院 | Plasmid standard molecular adaptable to sakazakii real-time fluorescent quantitation PCR (polymerase chain reaction) detection |
| CN103571961A (en) * | 2013-11-12 | 2014-02-12 | 光明乳业股份有限公司 | Method, primer pair, target probe, internal standard probe and kit for detecting Cronobacter sakazakii |
| WO2015044472A1 (en) * | 2013-09-27 | 2015-04-02 | Universidad De Oviedo | Method for the simultaneous detection of pathogenic micro-organisms |
| CN104894212A (en) * | 2015-05-19 | 2015-09-09 | 华南理工大学 | Method, primer, probe and kit for detecting cronobacter sakazakii |
-
2018
- 2018-03-13 CN CN201810205116.7A patent/CN108179208A/en active Pending
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2011015356A1 (en) * | 2009-08-07 | 2011-02-10 | Biotecon Diagnostics Gmbh | Nucleic acids and methods for the detection of enterobacter sakazakii (cronobacter spp.) |
| CN102816761A (en) * | 2012-08-28 | 2012-12-12 | 无锡中德伯尔生物技术有限公司 | Highly specific gene fragment of Cronobacter spp. and its application |
| WO2015044472A1 (en) * | 2013-09-27 | 2015-04-02 | Universidad De Oviedo | Method for the simultaneous detection of pathogenic micro-organisms |
| CN103497962A (en) * | 2013-10-15 | 2014-01-08 | 上海市计量测试技术研究院 | Plasmid standard molecular adaptable to sakazakii real-time fluorescent quantitation PCR (polymerase chain reaction) detection |
| CN103571961A (en) * | 2013-11-12 | 2014-02-12 | 光明乳业股份有限公司 | Method, primer pair, target probe, internal standard probe and kit for detecting Cronobacter sakazakii |
| CN104894212A (en) * | 2015-05-19 | 2015-09-09 | 华南理工大学 | Method, primer, probe and kit for detecting cronobacter sakazakii |
Non-Patent Citations (4)
| Title |
|---|
| KANG等: "Rapid detection of Enterobacter sakazakii using TaqMan real-time PCR assay", 《JOURNAL OF MICROBIOLOGY AND BIOTECHNOLOGY》 * |
| KIM,S.等: "登录号：CP011048", 《GENBANK》 * |
| 周革利: "《医学检验技术与临床应用 上》", 31 May 2017 * |
| 杨清玲等: "《分子生物学实验指导》", 31 December 2016 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113136441A (en) * | 2021-04-12 | 2021-07-20 | 中海生物技术(枣庄)有限公司 | Fluorescence quantitative PCR detection kit and detection method for enterobacter sakazakii and application thereof |
| CN113136441B (en) * | 2021-04-12 | 2022-05-13 | 中海生物技术(枣庄)有限公司 | Fluorescence quantitative PCR detection kit and detection method for enterobacter sakazakii and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108179209A (en) | For detecting the specific primer of proteus mirabilis and probe and real-time fluorescence quantitative PCR kit | |
| CN103642910B (en) | The primer of detection by quantitative Klebsiella pneumonia and probe and application thereof | |
| CN108384851A (en) | Detect multiple PCR primer, kit and the detection method of polymyxins drug resistant gene | |
| CN108841985A (en) | It is a kind of for detecting nucleotide sequence group, kit and the method for Fusarium solani | |
| WO2015196778A1 (en) | Providencia o3, o4, o8, o12, o13 and o20 specific nucleotide and application thereof | |
| CN111471794A (en) | Primer, probe, kit and method for RT-QPCR (reverse transcription-quantitative polymerase chain reaction) detection of fusarium graminearum | |
| CN110016512A (en) | The multiple fluorescence quantitative PCR detection kit and method of three kinds of bovine respiratory pathogen are detected simultaneously | |
| CN108841975A (en) | One kind is for detecting the streptococcic nucleotide sequence group of B race, kit and method | |
| CN108728559A (en) | Detect RPA primers, probe, kit and the method for escherichia coli O157 | |
| CN109439775A (en) | A kind of multi-PCR detection method of porcine pathogen | |
| WO2015180484A1 (en) | Nucleotides specific to providencia o31, o41, o42, o43 and o50 and uses thereof | |
| CN112143820B (en) | Molecular marker, detection primer and detection method for identifying lactobacillus plantarum and lactobacillus pentosus | |
| CN108179208A (en) | For detecting the specific primer of Enterobacter sakazakii and probe and real-time fluorescence quantitative PCR kit | |
| CN109402274A (en) | A kind of fluorescent quantitative RT-PCR method identifying A type and Type B ox source pasteurella multocida | |
| CN108179210A (en) | For detecting the specific primer of staphylococcus aureus and probe and real-time fluorescence quantitative PCR kit | |
| CN104745683B (en) | One group is used for specific primer and probe and the detection kit that the real-time fluorescence quantitative PCR of Lactobacillus casei is detected | |
| CN111471795A (en) | Primer, probe, kit and method for RT-QPCR (reverse transcription-quantitative polymerase chain reaction) detection of fusarium avenaceum | |
| CN108660228A (en) | Specific primer and probe for detecting shigella flexneri and real-time fluorescence quantitative PCR kit | |
| CN111549165A (en) | Primer, probe, kit and method for RT-QPCR (reverse transcription-quantitative polymerase chain reaction) detection of fusarium solani | |
| Liu et al. | Mycobacterium vicinigordonae sp. nov., a slow-growing scotochromogenic species isolated from sputum | |
| CN109439799A (en) | It is a kind of for detecting the sleeve type PCR primer and kit of pig acute diarrhea coronavirus | |
| CN108866215A (en) | A kind of real-time fluorescence quantitative PCR kit for clostridium perfringen detection | |
| CN105200045B (en) | The nucleotides special to vibrio fluvialis O11, O14, O16 and O17 and its application | |
| CN111471793A (en) | Primer, probe, kit and method for RT-QPCR (reverse transcription-quantitative polymerase chain reaction) detection of fusarium sporotrichioides | |
| CN104726553B (en) | The specific primer and probe and detection kit that one group of real-time fluorescence quantitative PCR for being used for Lactobacillus rhamnosus detects |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20180619 |
|
| RJ01 | Rejection of invention patent application after publication |