WO2015044472A1 - Method for the simultaneous detection of pathogenic micro-organisms - Google Patents

Method for the simultaneous detection of pathogenic micro-organisms Download PDF

Info

Publication number
WO2015044472A1
WO2015044472A1 PCT/ES2014/000162 ES2014000162W WO2015044472A1 WO 2015044472 A1 WO2015044472 A1 WO 2015044472A1 ES 2014000162 W ES2014000162 W ES 2014000162W WO 2015044472 A1 WO2015044472 A1 WO 2015044472A1
Authority
WO
WIPO (PCT)
Prior art keywords
oligonucleotide
sequence seq
coli
primers
designed
Prior art date
Application number
PCT/ES2014/000162
Other languages
Spanish (es)
French (fr)
Inventor
Germán VILLAMIZAR RODRÍGUEZ
Felipe LOMBÓ BRUGOS
Maria NIÑO GONZÁLEZ
Juan MUÑIZ SALAS
Maria Isabel GONZÁLEZ ALVAREZ
Cristina GARCIA GORDO
Original Assignee
Universidad De Oviedo
Alce Calidad, S.L.
Industrias Lácteas Asturianas, S.A.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Universidad De Oviedo, Alce Calidad, S.L., Industrias Lácteas Asturianas, S.A. filed Critical Universidad De Oviedo
Publication of WO2015044472A1 publication Critical patent/WO2015044472A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/16—Primer sets for multiplex assays
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • the present invention relates to a method for the simultaneous detection of multiple pathogenic microorganisms, in particular foodborne pathogens, by the use of primer pairs and probes specifically designed for the detection of said microorganisms.
  • the invention also relates to the set of pairs of primers and probes designed for this purpose and to the kit containing them. Therefore, the present invention falls within the field of microbiology, in particular in the field of food microbiology.
  • a disease of food origin can be defined as: "any disease of an infectious or toxigenic nature, which is or is thought to have been caused by water or food”.
  • the reduction of the time in which the results are produced is a critical factor that has a direct impact on the economy of the agri-food industries.
  • the delay in the market launch of the products it produces translates into increased storage costs, especially if they are perishable products, and a reduction in the possibility of profit, since if the Food is not available to the intermediary or the consumer, no income is earned from its sale.
  • the speed and accuracy in the detection of a pathogen are not only economically relevant.
  • the early detection of a food outbreak makes it possible to limit its incidence, preventing the spread and increasing the number of cases. In addition, it facilitates the selection and application of the most appropriate treatment for the patient.
  • Patent application US2013 / 01231 19 describes the use of primers for the detection of foodborne pathogens. Such primers allow the simultaneous detection of multiple microorganisms through their use in molecular techniques, such as PCR-multiplex and PCR-multiplex in real time.
  • Patent application EP2020449 describes a method for the simultaneous, multiple detection and quantification of Listeria spp., Staphylococcus aureus, Campylobacter jejuni and / or E. coli 0157: 1-17, in one or more samples, by an amplification reaction multiplex using a real-time PCR (qRTi-PCR).
  • qRTi-PCR real-time PCR
  • Fukushima, H. et al. 2003 (Journal of Clinical Microbiology, 41 (11): 5134-5146) describe the detection of 8 of the 17 species of food-borne pathogens examined through the use of qRTi- PCR.
  • Patent application US2005 / 0239086 describes a method for the detection of one or more target nucleic acid sequences in a sample, useful in the search for pathogenic microorganisms in food.
  • none of these methods allows simultaneous detection of the main pathogenic microorganisms usually present in food.
  • the inventors have developed a method for the simultaneous detection of foodborne pathogenic microorganisms based on a set of primer pairs specifically designed to simultaneously detect up to 1 1 types of pathogenic microorganisms by multiplex PCR, among which is Campylobacter jejuni, Cronobacter sakazakii, an enterohemorrhagic strain of Escherichia coli, Listeria monocytogenes, Salmonella spp., Shigella spp., Bacillus cereus, Clostr ⁇ dium per ⁇ ringens, a microorganism of the Enterobacteriaceae family, Escherichia coli and Staphylococcus aureus. Additionally, if any B. cereus, C. per ⁇ ringens, a microorganism of the Enterobacteriaceae, E. coli or S. aureus family is detected, the method allows quantification of the same, as pairs of primers and probes have been designed to such effect.
  • the set of primer pairs of the invention (and allowing simultaneous detection of up to 1 1 types of pathogenic microorganisms), a collection of 66 microorganisms formed by food-borne pathogens and interfering bacteria that can be found both in food matrices and in the environment. From this collection, the pathogenic microorganisms of interest were selected and cultured, after which the genomic DNA was extracted from each of them. Next, genetic targets with high specificity and conservation were selected, and the regions corresponding to domains conserved between strains of the same species were selected for the design of the primers.
  • PCR corresponds to the polymerase chain reaction acronym whereby millions of copies of the desired DNA regions can be obtained. It is characterized by the use of pairs of primers that delimit the region from which millions of copies will be made, which is also known as "amplifying DNA" during PCR.
  • the PCR is composed of a certain number of cycles, in turn composed of three phases in which the DNA strands are separated, the primers are joined and the new DNA strands are elongated. In each cycle, if the reaction efficiency is 100%, exponential growth of the DNA fragments subject to amplification occurs.
  • multiplex amplification reaction is understood as the polymerase chain reaction (PCR) in which more than one DNA sequence is amplified in the same reaction, by using two or more primer pairs. in a single tube together with the rest of the reaction reagents in order to simultaneously amplify multiple DNA sequences.
  • PCR polymerase chain reaction
  • qPCR quantitative PCR
  • qRTi-qPCR real-time PCR
  • oligonucleotide refers to the sequence of nucleotide bases linked by phospho-diester bonds, usually not greater than 50 nucleotides.
  • primer or “first” or “oligonucleotide” (“oligo”) is understood as the nucleotide sequence from which DNA polymerase initiates the synthesis of a new DNA molecule.
  • the primers are short nucleotide sequences, approximately 15-24 nucieotides in length that can be aligned with a strand of target DNA thanks to the complementarity of bases to form a hybrid between the primer and the target strand of DNA. Then, the DNA polymerase enzyme can extend the primer along the DNA strand. Methods for preparing and using primers are widely known to those skilled in the art.
  • primer pair or “first pair” is understood as the set of two primers which, when used in the same amplification or PCR reaction, allow multiple copies of a DNA target sequence to be obtained.
  • Each of the primers hybridized with the target sequence, so that the bounded nucleotide sequence is amplified by each pair of primers.
  • the extent of the primers during the PCR cycles determines the 2 N exponential multiplication of the nucleotide sequence bounded by the primers, N being the number of cycles of the PCR reaction.
  • sample means any matter capable of containing DNA.
  • aliquot is understood as the part that is taken from an initial volume (liquid aliquot) or an initial mass (solid aliquot), to be used in a laboratory test, the physical properties of which Chemicals, as well as their composition, represent those of the original substance. Normally, aliquots are the result of distributing an initial volume in several equal parts.
  • the inventors have designed a set of primer pairs that, when used in a multiplex PCR, allow the presence of the main food-borne pathogens to be detected.
  • the invention relates to an in vitro method for the simultaneous detection of Campylobacter jejuni, Cronobacter sakazakii, an enterohemorrhagic strain of Escherichia coli, Listeria monocytogenes, Salmonella spp. and Shigella spp. in a sample;
  • method of the invention comprising:
  • step b) Carry out a multiplex PCR on the DNA isolated in step a) by using the following primer pairs:
  • the pair of primers formed by the oligonucleotide comprising the sequence SEQ ID NO: 15 and the oligonucleotide comprising the sequence SEQ ID NO: 16 designed to amplify L. monocytogenes The primer pair formed by the oligonucleotide comprising the sequence SEQ ID NO: 17 and the oligonucleotide comprising the sequence SEQ ID NO: 18 designed to amplify Salmonella spp.
  • SEQ ID NO: 20 designed to amplify Shigella spp. Y
  • the enterohemorrhagic strain of E. coli is E. coli 0157: H7, the species of Salmonella spp. It is enteric Salmonella and / or the species of Shigella spp. It's Shigella dysenter ⁇ ae.
  • the method of the invention comprises isolating or extracting the DNA from a sample, for which it is necessary to collect it.
  • Sample collection should be done with the appropriate protocol and methodology depending on the characteristics of the sample, that is, if it is a liquid, solid, frozen, lyophilized sample etc. As the person skilled in the art knows, the collection of the sample should be carried out avoiding all external contamination, both environmental and human, to ensure its integrity and reliable results. It is necessary to use clean, dry, leak-free, wide-mouth, sterile containers of an appropriate sample size. Likewise, the conservation conditions, the transport, the time between the collection of the sample and its delivery in the laboratory, as well as the performance of the analysis influence the results obtained since the microbial population can undergo qualitative and quantitative changes. All these considerations are widely known by the person skilled in the art, and the protocols and procedures for collecting samples are clearly standardized and established by the competent authorities.
  • the sample is a sample of food that, in another even more particular embodiment, the food is a dairy product, a meat product, fish, egg, an ovoderivative, a vegetable, a pastry product, A prepared meal or a drink.
  • the protocol and methodology for Collecting samples from these products are widely known and routine practice for the person skilled in the art.
  • sample processing can be carried out immediately after being received by the laboratory or it can be processed later, in which case the sample must be stored until use.
  • the storage must be carried out under the appropriate conditions, and it is most usual to freeze them at -20 ° C.
  • the sample When the sample is to be analyzed, it must be thawed following the standard protocols established for this purpose and widely known to the person skilled in the art.
  • the extraction of DNA consists of a lysis stage, which consists in breaking the structures that confine the cytoplasm and releasing its contents to the medium, and another one of purification, which implies the withdrawal of the final solution of most elements that can interfere with PCR DNA extraction
  • a lysis stage which consists in breaking the structures that confine the cytoplasm and releasing its contents to the medium, and another one of purification, which implies the withdrawal of the final solution of most elements that can interfere with PCR DNA extraction
  • any method known to those skilled in the art including, but not limited to, density gradient centrifugations, two-phase extraction using aqueous phenol or chloroform with ethanol, column chromatography, methods based on the ability of DNA to bind on glass surfaces and / or silicates, such as diatomaceous earth preparations or glass beds, using commercial kits, for example, "Q-Biogene fast DNA kit” or "QIAamp (R) DNA Blood Mini Kit “ (Qiagen, Hilden, Germany) or the "G-Spin llp” (
  • the method of the invention comprises a step b), in which a multiplex amplification reaction (multiplex PCR) is carried out on the DNA isolated in step a).
  • a multiplex amplification reaction multiplex PCR
  • ID NO: 12 designed to amplify an enterohemorrhagic strain of E. coli
  • the method of the invention further comprises the detection of at least 1, preferably 2, 3, 4 or 5 of the microorganisms selected from the list consisting of Bacillus cereus, Clostridium perfringens, a microorganism of the Enterobacteriaceae family , Escherichia coli and Staphylococcus aureus by using the following pairs of primers:
  • the pair of primers formed by the oligonucleotide comprising the sequence SEQ ID NO: 1 and the oligonucleotide comprising the sequence SEQ ID NO: 2 designed to amplify B. cereus The primer pair formed by the oiigonucleotide comprising the sequence SEQ ID NO: 5 and the oiigonucleotide comprising the sequence SEQ ID NO: 6 designed to amplify C. perfr ⁇ ngens,
  • ID NO: 14 designed to amplify a microorganism of the Enterobacteriaceae family
  • the nucleotide sequences of the primer pairs are shown in Table 1.
  • Table 1 primer pairs of the method of the invention.
  • the method of the invention allows the simultaneous detection of up to 11 different types of microorganisms, that is, 7 species ⁇ Campylobacter jejuni, Cronobacter sakazakii, Bacillus cereus, Clostridium perfringens, Escherichia coli, Listeria monocytogenes and Staphylococcus aureus), a family (Enterobacteriaceae family), two genera (Salmonella spp. and Shigella spp.) and one strain (the enterohemorrhagic strains of Escherichia coli).
  • 7 species ⁇ Campylobacter jejuni, Cronobacter sakazakii, Bacillus cereus, Clostridium perfringens, Escherichia coli, Listeria monocytogenes and Staphylococcus aureus
  • a family Enterobacteriaceae family
  • two genera Salmonella spp. and Shigella spp.
  • one strain
  • a multiplex amplification reaction requires a series of reagents, including, but not limited to, the template DNA, the enzyme DNA polymerase, at least two pairs of primers (each primer being each pair complementary to one of the two strands of the DNA), deoxynucleotide triphosphates (dNTPs), magnesium chloride (MgCI 2 ), reaction buffer and optional additives, which can be added separately by mixing in the laboratory or Purchase pre-mixed, as is the case of Qiagen ultiplex PCR Kit (Qiagen, Valencia, CA), to which the primer pairs are added in the appropriate concentrations and the template DNA.
  • the PCR is carried out in a thermocycler that performs the cycles in the exact times and temperatures programmed, such as the hybridization temperature, which depends on the melting temperature of each of the primers used in the reaction or the temperature of extension.
  • the method of the invention comprises the detection of the amplification products [step c)], which can be carried out by any of the methods described in the state of the art .
  • the amplification products or amplicons can be separated.
  • Virtually any conventional method used to separate the amplification products can be used within the framework of the present invention.
  • Techniques for separating amplification products are widely described in the state of the art. Techniques for separating amplification products include, without limitation, submerged electrophoresis with Methafor gels, polyacrylamide gels electrophoresis and capillary electrophoresis.
  • the size of the separated fragments is identified, for which any of the methods of identification of amplification fragments known in the state of the art can be used, such as hybridization with labeled probes (for example with a fluorophore) which will be detected by a detector and processed by a computer system, staining, for example, with ethidium bromide, silver staining, etc.
  • labeled probes for example with a fluorophore
  • staining for example, with ethidium bromide, silver staining, etc.
  • electropherogram can be generated where the size of the amplified fragments can be identified.
  • the mapping of the primers participating in said multiplex amplification reaction can be carried out in order to be able to subsequently detect the amplified fragments.
  • the marking of amplification products can be carried out by conventional methods. Said marking can be direct, for which fluorophores can be used, for example, Cy3, Cy5, fluorescein, alexa, etc., enzymes, for example, alkaline phosphatase, peroxidase, etc., isotopes radioactive, for example, P, ⁇ , etc., or any other marker known to the person skilled in the art.
  • said marking can be indirect through the use of chemical, enzymatic methods, etc .
  • the amplification product may incorporate a member of a specific binding pair, for example, avidin or streptavidin conjugated with a fluorochrome (pathogen), and the probe binds to the other member of the specific binding pair, for example, biotin (indicator), the reading being carried out by fluorimetry, etc.
  • the amplification product may incorporate a member of a specific binding pair, for example, an anti-digoxigenin antibody conjugated to an enzyme (locus), and the The probe binds to the other member of the specific binding pair, for example, digoxigenin (indicator), etc., transforming the enzyme substrate into a luminescent or fluorescent product and reading by chemo-luminescence, fluorimetry, etc.
  • the marking of the amplification product is carried out by marking, at one of its ends, one of the oligonucleotides of each pair of primers.
  • the compound used in the oligonucleotide mapping is selected from the group consisting of a radioisotope, a fluorescent material, digoxigenin and biotin.
  • 5- FAM 5-carboxyfluorescein
  • 6-FAM t-FAM tetrachlorinated analog
  • HEX 6- FAM hexachlorinated analog
  • ROX 6-carboxytetramethylrodamine
  • microorganisms object of the detection method of the invention may be desirable to quantify some of them, that is, to know the amount of microorganisms present in the starting product from which the sample is derived.
  • European legislation allows a maximum of 500 CFU / g of minced meat for human consumption (colony-forming units / g), as long as they are not enterohemorrhagic strains, in which In case the maximum allowed limit is 0 CFU / g.
  • the method of the invention additionally comprises, prior to step a), the homogenization of the sample and the subsequent extraction of two or more aliquots from the homogenized sample, wherein, one of the aliquots It is used in stage a) and the other is used in case you want to quantify the microorganisms previously detected. Once the aliquots are present, one is used in the detection and the other can be preserved or stored in case its subsequent use is necessary.
  • microorganisms that, although pathogenic, may be present in the food that is intended for human or animal consumption as long as the individual's health is not compromised, which is determined by the number of cells of these pathogens present in that food.
  • These microorganisms include, but are not limited to, B. cereus, C. perfringens, a microorganism of the Enterobacteriaceae Family, E. coli and / or S. aureus. Therefore, if its presence is detected in the sample after applying the method of the invention, it is desirable to know the concentration of the microorganism / s detected / s present in it, so it has to be quantified. .
  • the quantification can be carried out by any of the methods that exist in the state of the art and are routinely used in microbiological analysis laboratories.
  • the quantification method chosen is a Real Time PCR or quantitative PCR.
  • the inventors have designed pairs of primers and probes specifically aimed at B. cereus, C. perfringens, a microorganism of the Enterobacteriaceae Family, E. coli and / or S. aureus.
  • the pairs of primers and probes specifically directed to these microorganisms are described in Tables 2 and 3.
  • Table 2 primer pairs used in the quantification of ⁇ . cereus, C. perfringens, a microorganism of the Enterobacteriaceae Family, E. coli and / or S. aureus
  • step c probes used in the quantification of B. cereus, C. perfringens, microorganism of the Enterobacteriaceae Family, E. coli and / or S. aureus.
  • the method comprises additionally the following stages:
  • SEQ ID NO: 34 if the microorganism to be detected is B. cereus
  • step e quantify the amplified products in step e).
  • the inventors have designed probes that allow to detect the internal control of the amplification or IAC (English, Internal! Amplification Control) in order to validate the accuracy of the qRTi -PCR, allowing to distinguish true negative results from false negatives caused by a malfunction of the PCR (due to inhibitions, deterioration of the PCR reagents, etc.).
  • the inventors have designed a chimeric type IAC that has a heterologous DNA sequence to all study microorganisms and that consists in a zone internal to the gene that encodes the enzyme cinnamoyl-CoA reductase from Eucalyptus globulus. By flanking this region of heterologous DNA, the corresponding sequences have been added to the hybridization sites of the five primer pairs designed for the qRTi-PCR amplification of the five pathogens to be quantified. Said IAC consists in the independent amplification of an artificial DNA sequence that is co-amplified with the pathogen's target DNA during PCR.
  • the IAC is incorporated into the reaction mixture at a carefully adjusted concentration, so that the specificity and sensitivity of the test are not affected by the competitive amplification of both DNAs.
  • the IAC amplification signal may disappear in positive samples with a high DNA content of the pathogen.
  • the IAC signal must always be detected in negative samples (absence of the pathogen). If no signal is obtained from the IAC or the pathogen, the cause of the PCR reaction malfunction must be clarified, verifying the integrity of the PCR reagents or applying alternative solutions to eliminate inhibition problems.
  • the qRTi-PCR comprises at least one probe for internal amplification control selected from the list consisting of:
  • the nucleic acid probe comprising oligonucleotide SEQ ID NO: 39 in the event that the quantified microorganism is E. coli, a microorganism of the Enterobacteriaceae or S. aureus family,
  • nucleic acid probe comprising oligonucleotide SEQ ID NO: 41 in case the quantified microorganism is C. perfringens or E.coli
  • the probes employed in the method of the invention are marked at one of their ends that, in another even more particular embodiment, the compound with which the marking is carried out is a fluorophore.
  • fluorophores that can be employed in probe mapping include, but are not limited to, 5-carboxyfluorescein (5-FAM), 6-FAM, tetrachlorinated t-FA analog (TET), 6-FAM hexachlorinated analog (HEX) ), 6-carboxytetramethylrodamine (TAMRA), 6-carboxy-X-rhodamine (ROX), 6-carboxy-4 ', 5'-dichloro-2', 7'- dimethoxyfluorescein (JOE), NED, Cy-3, Cy-5, Cy-5.5, fluorescein-6-isothiocinate (FITC) and tetramethylrodamine-5-isothiocinate (TRITC).
  • 5-FAM 5-carboxyfluorescein
  • 6-FAM tetrachlor
  • the method of the invention comprises the detection of pathogenic microorganisms by multiplex PCR.
  • microorganisms are very low in the sample, they may not be detected.
  • the method of the invention comprises culturing the sample in an enrichment medium.
  • the sample is homogenized and divided into two or more aliquots, where only the aliquot used in step a) of the method it is cultivated in an enrichment medium, while the rest of aliquots will be used in the subsequent quantification. Therefore, in another particular embodiment, the aliquot employed in step a) is grown in an enrichment medium.
  • the incubation time varies depending on the microorganisms to be detected (for example, between 16 and 48 hours for C. jejuni, and between 16 and 24 hours for C. sakazakii, an enterohemorrhagic strain of E. coli, L.
  • the incubation time of the sample in the enrichment culture medium is between 16 and 48 hours, preferably between 16 and 24 hours.
  • the enrichment medium to be used will be one or the other.
  • Enrichment cultures suitable for the growth of microorganisms that are detected by the method of the invention are commercially available.
  • the enrichment medium can also be prepared in the laboratory, in which case the ingredients to be included in the medium are also commercially available, and the nutritional requirements of the microorganisms are described in the prior art. Based on this information, a suitable enrichment medium can be developed for the microorganism / s detected.
  • the enrichment culture medium comprises Buffered Peptone Water, Defibrinated and Hemolyzed Horse Blood, Mannitol and Campyiobacter Growth Supplement. This enrichment medium is suitable for simultaneous incubation of all microorganisms detected by using the method of the invention.
  • the enrichment medium comprises
  • the inventors have developed a method for the simultaneous detection of foodborne pathogenic microorganisms based on a set of primer pairs specifically designed to simultaneously detect up to 1 1 types of pathogenic microorganisms by multiplex PCR.
  • set of primer pairs of the invention which comprises
  • ID NO: 16 designed to amplify L. monocytogenes
  • the hemorrhagic strain of E. coli is E. coli 0157: 1-17, the species of Salmonella spp. It is enteric Salmonella and / or the species of Shigella spp. It's Shigella dysenteriae.
  • primer pairs that are part of the set of primer pairs of the invention have been designed so that, if desired, they can be used simultaneously with one or more primer pairs directed to other microorganisms of interest, such as, C. per ⁇ r ⁇ ngens, a microorganism of the family Enterobacteriaceae, E. coli, S. aureus or B. cereus.
  • the set of primer pairs of the invention further comprises 1, preferably 2, 3, 4 or 5 of the primer pairs selected from the list consisting of:
  • ID NO: 2 designed to amplify B. cereus.
  • the set of primer pairs of the invention allows simultaneous detection of 1 1 types of microorganisms among which are Campylobacter jejuni, Cronobacter sakazakii, an enterohemorrhagic strain of Escherichia coli, Listeria monocytogenes, Salmonella spp., Shigella spp. , Bacillus cereus, Clostridium perfringens, a microorganism of the family Enterobacter ⁇ aceae, Escherichia coli and Staphylococcus aureus.
  • 1 1 types of microorganisms among which are Campylobacter jejuni, Cronobacter sakazakii, an enterohemorrhagic strain of Escherichia coli, Listeria monocytogenes, Salmonella spp., Shigella spp. , Bacillus cereus, Clostridium perfringens, a microorganism of the family Enterobacter ⁇ aceae, Escherichia
  • the set of primer pairs according to the invention further comprises at least 1, preferably 2, 3, 4 or 5, of the primer pairs and probes selected from the group consisting of :
  • the microorganism to be detected is B. cereus,
  • the technique of choice to carry out the quantification of Bacillus cereus, Clostridium perfringens, a microorganism of the Enterobacteriaceae family, Escher ⁇ chia coli Staphylococcus aureus is quantitative or Real Time PCR. Therefore, in a particular embodiment, the probes are marked at one of their ends which, in another even more particular embodiment, are labeled with a fluorophore. Examples of compounds that can be used as probes markers have been previously described in the method of the invention.
  • the set of primers of the invention comprises, in addition to the primer pairs and probes SEQ ID NO: 1 to 38, at least one internal amplification control of the quantitative PCR selected from the group consisting of the SEQ sequences ID NO: 40, SEQ ID NO: 41 and SEQ ID NO. 42 ..
  • the invention relates to the in vitro use of the set of primer pairs of the invention for the simultaneous detection of C. jejuni, C. sakazakii, an enterohemorrhagic strain of E. coli, L. monocytogenes, Salmonella spp. and Shigella spp.
  • the hemorrhagic strain of E. co // ' is £. coli 0157: H7, the species of Salmonella spp. It is enteric Salmonella and / or the species of Shigella spp. It's Shigella dysenteriae.
  • the set of primer pairs of the invention can also comprise pairs of primers aimed at detecting ⁇ . cereus, C. per ⁇ ringens, a microorganism of the family Enterobacter ⁇ aceae, E. coli and S. aureus.
  • the invention relates to the use of the set of primer pairs of the invention for the simultaneous detection of C. jejuni, C. sakazakii, an enterohemorrhagic strain of £. coli, L. monocytogenes, Salmonella spp. and Shigella spp and at least 1, preferably 2, 3, 4 or 5 of the microorganisms selected from the list consisting of B. cereus, C. per ⁇ ringens, a microorganism of the Enterobacteriaceae family, E. coli and S. aureus.
  • the invention relates to a kit useful for the implementation of the method of the invention, which comprises the set of primer pairs of the invention.
  • the invention relates to a kit comprising the set of primer pairs of the invention.
  • the kit of the invention in addition to comprising the set of primer pairs of the invention, may optionally include the reagents necessary to carry out a multiplex amplification reaction, including, without limiting to, deoxynucleotides triphosphate (dNTPs), divalent and / or monovalent ions, a buffer solution (buffer) that maintains the proper pH for the functioning of DNA polymerase, DNA polymerase or mixture of different polymerases, etc.
  • dNTPs deoxynucleotides triphosphate
  • buffer solution buffer
  • kit of the invention does not comprise the reagents necessary to practice the method of the invention, these are commercially available and can be found as part of a kit. Any commercially available kit containing the reagents necessary to carry out an amplification reaction can be used successfully in the practice of the method of the invention.
  • the kit of the invention can comprise the pairs of primers of the invention already marked, or the reagents necessary to carry out the marking thereof.
  • the different methods that exist in the state of the art to perform the mareaje of the primers, as well as the types of compounds that can be used in said mareaje have been explained previously here.
  • the kit of the invention is also useful in the implementation of the method of invention. Therefore, in a sixth aspect, the invention relates to the use of the kit of the invention for the simultaneous detection of C. jejuni, C. sakazakii, an enterohemorrhagic strain of E. coli, L. monocytogenes, Salmonella spp. and Shigella spp.
  • the hemorrhagic strain of E. coli is E. coli 0157: H7, the species of Salmonella spp. It is enteric Salmonella and / or the species of Shigella spp. It's Shigella dysenter ⁇ ae.
  • the invention relates to the use of the kit of the invention for the simultaneous detection of C. jejuni, C. sakazakii, an enterohemorrhagic strain of E. coli, L monocytogenes, Salmonella spp. and Shigella spp and at least 1, preferably 2, 3, 4 or 5 of the microorganisms selected from the list consisting of B. cereus, C. perfringens, a microorganism of the Enterobacteriaceae family, E. coli and S. aureus.
  • the word "comprises" and its variants are not intended to exclude other technical characteristics, additives, components or Steps.
  • other objects, advantages and features of the invention will be derived partly from the description and partly from the practice of the invention.
  • the following examples and figures simply illustrate the present invention and are not intended to be limiting thereof.
  • Figure 1 Agarose gel. Optimization of primers GVR-BC-Mpx-up / rp, on DNA of B. cereus CECT 131, with five temperature series (Tm) and 16 combinations of primer concentration.
  • FIG. 1 Agarose gel. Optimization of GVR-CJ-Mpx-up / rp primers, on C. jejuni ATCC 49943 DNA, with five temperature series (Tm) and 16 combinations of primer concentration.
  • FIG. 1 Agarose gel. Optimization of primers GVR-CS-Mpx-up / rp, on DNA from C. sakazakii ATCC 894 BAA, with five temperature series (Tm) and 16 combinations of primer concentration.
  • Figure 4. Agarosa gel. Optimization of GVR-CP-Mpx-up / rp primers on C. per ⁇ ringens CECT 376T DNA, with five temperature series (Tm) and 16 combinations of primer concentration.
  • FIG. 1 Agarose gel. Optimization of GVR-EC-Mpx-up / rp primers, on E. coli CECT 4267 DNA, with five temperature series (Tm) and 16 combinations of primer concentration.
  • Figure 6 Agarose gel. Optimization of primers GVR-H7-Mpx-up / rp, on DNA of E. coli 0157.H7, with five temperature series (Tm) and 16 combinations of primer concentration.
  • FIG. 7 Agarose gel. Optimization of primers GVR-SE-Mpx-up / rp, on S. enteric CECT 443 DNA, with five temperature series (Tm) and 16 combinations of primer concentration.
  • Figure 8. Agarose gel. Optimization of primers GVR-EB-Mpx-up / rp, on DNA of the Ententobacteria Pantoea ananatis CECT 4858T, with five temperature series (Tm) and 16 combinations of primer concentration.
  • Figure 9. Agarose gel. Optimization of primers GVR-LM-Mpx-up / rp, on DNA of L. monocytogenes CECT 91 1, with five temperature series (Tm) and 16 combinations of primer concentration.
  • Figure 10 Agarose gel. Optimization of primers GVR-SA-Mpx-up / rp, on S. aureus CECT 240 DNA, with five temperature series (Tm) and 16 combinations of primer concentration.
  • FIG. 11 Agarose gel. Optimization of GVR-SH-Mpx-up / rp primers, on S. dysenteriae CECT 584 DNA, with five temperature series (Tm) and 16 combinations of primer concentration.
  • FIG. 12 Electropherogram. Multiplex PCR with 1 1 pairs of primers and the B. cereus (BC), C. jejuni (CJ), C. per ⁇ ringens (CP), C. sakaza ii (CS), E coli (EC), £ coli 0157 . ⁇ 7 (H7), Family Enterobacteriaceae (EB), L monocytogenes (LM), Salmonella spp. (SE), Shigella spp. (SH) and S. aureus (SA), at 56 ° C.
  • BC B. cereus
  • CJ C. jejuni
  • CP C. per ⁇ ringens
  • CS C. sakaza ii
  • E EC E coli
  • £ coli 0157 . ⁇ 7 H7
  • EB Family Enterobacteriaceae
  • LM L monocytogenes
  • SE Salmonella spp.
  • SH Shigella spp.
  • SA S. aureus
  • FIG. 13A-B Electropherograms Multiplex PCR on gDNA of the two groups of microorganisms.
  • the electropherogram A corresponds to those belonging to the Enterobacteriaceae Family (C. sakazakii, E. coli, E. coli 0157: 1-17, Salmonella spp. And Shigella spp.)
  • Fig. 13B the electrophoregram B, to those not enterobacteria (B. cereus, C. jejuni, C. per ⁇ ringens, L. monocytogenes and S. aureus).
  • FIG. 14A-K Electropherograms of the amplification products obtained by multiplex PCR, for the 1 microorganisms of this work, independently.
  • Y the intensity of the detected fluorescence is indicated
  • X the size in base pairs
  • Fig. 15A C. jejuni
  • Fig. 15B B. cereus
  • Fig. 15C L. monocytogenes
  • Fig. 15D C. per ⁇ ringens
  • FIG. 15E Enterobacteriaceae family
  • FIG. 15F C Sakazakii
  • FIG. 15G E. coli 0157: H7
  • Fig. 15G E. coli 0157: H7
  • FIG. 15H S. aureus, (Fig. 151) E. coli, (Fig. 15J) Shigella spp. and (Fig. 15K) Salmonella spp.
  • Figures 15A-B Amplifications obtained by qRTi-PCR with serial decimal dilutions of gDNA from Family Enterobacteriaceae ⁇ Pantoea ananatis CECT 48458) (Fig. 15A) and S. aureus CECT 240 (Fig. 15B), in order to establish the minimum detection threshold reached with Optimized concentrations of specific primers and probe.
  • Figures 16A-C Amplifications obtained by qRTi-PCR with serial decimal dilutions of E.coli CECT 4167 cDNA (Fig. 16A); B. cereus CECT 131 (Fig. 16B) and C. perfringens CECT 376-T (Fig. 16C) in order to establish the minimum detection threshold reached with optimized concentrations of specific primers and probe.
  • Figures 17A-C Amplification curves obtained in qRTi-PCR with decimal dilutions of the reference DNA stock of pGVR-QIAC and using the TaqMan-GVR-IAC1 probe as a reporter (Fig. 17A); TaqMan-GVR-IAC2 (Fig. 17B) and TaqMan-GVR-IAC3 (Fig. 17C).
  • Fig. 17A Amplification curves obtained in qRTi-PCR with decimal dilutions of the reference DNA stock of pGVR-QIAC and using the TaqMan-GVR-IAC1 probe as a reporter
  • Fig. 17B TaqMan-GVR-IAC2
  • TaqMan-GVR-IAC3 Fig. 17C.
  • the value of ARn is represented, while in the abscissa axis the amplification cycles are indicated.
  • Figures 18A-C Patterns obtained in the amplification of C. perfringens duplex combinations, according to table 14, incorporating pGVR-QIAC and its respective probe.
  • Fig. 18A C. perfringens / E.coli combination.
  • Fig. 18B C. perfringens / S. aureus combination.
  • Fig. 18C perfringens / B. cereus combination.
  • CP TaqMan-GVR-CP (VIC) probe
  • EC TaqMan-GVR-EC (NED) probe
  • SA TaqMan-GVR-SA (FAM) probe
  • IAC2 TaqMan-GVR-IAC2 probe (NED)
  • IAC3 TaqMan-GVR-IAC3 (FAM) probe.
  • FIGS 19A-B Patterns obtained in the amplification of duplex combinations of E. coli, according to table 33, incorporating pGVR-QIAC and its respective probe.
  • Fig. 19A E. coli I S. aureus combination.
  • Fig. 19B E. coli / B. cereus combination.
  • EC TaqMan-GVR-EC (NED) probe
  • SA TaqMan-GVR-SA (FAM) probe
  • BC TaqMan-GVR-BC (FAM) probe.
  • IAC1 TaqMan-GVR-IAC1 (VIC) probe.
  • Figure 20 Patterns obtained in the amplification of the duplex combinations of S. aureus with E. coli, according to table 14, incorporating pGVR-QIAC and its respective probe.
  • SA TaqMan-GVR-SA (FAM) probe;
  • BC2 TaqMan-GVR-BC2 (VIC) probe.
  • IAC1 TaqMan-GVR-IAC2 (NED) probe.
  • Figures 21A-D Patterns obtained in the amplification of the duplex combinations of Family Enterobacteriaceae, according to table 14, incorporating pGVR-QIAC and its respective probe.
  • FIG. 21 A Enterobacteriaceae I C. perfringens combination.
  • Fig. 21 B Enterobacteriaceae / E.
  • Figure 22 Representative diagram of the steps taken for the addition of the different hybridization sites of the specific primers (to four microorganisms and a family of foodborne pathogens) to the heterologous sequence of £. globulus used as internal amplification control.
  • Figure 23 Graphical representation of the final structure of the internal chimeric amplification control elaborated.
  • Figures 24A-H Growth curves obtained for: B. cereus (Fig. 14A), C. jejuni (Fig. 24B), C. perfringens (Fig. 24C), C. sakazakii (Fig. 24D), L monocytogenes (Fig. 24E), S. aureus (Fig. 24F), Enteric Salmonella (Fig. 24G) and E. coli (Fig. 24H)).
  • E. coli an enterohemorrhagic strain of E. coli (such as 0157: 1-17) and S. dysenteriae, the curve in Figure 24H has been used.
  • Figure 25 Electrophoresis gel. Control amplification obtained from a matrix artificially contaminated with B.
  • E. coli an enterohemorrhagic strain of E. coli (as 0157: 1-17) ( ⁇ 7), P. ananatis (Fam. Enterobacteriaceae) (EB), L. monocytogenes (LM), Enteric Salmonella. (SE), S. dysenteriae (SD) and S. aureus (SA).
  • Matrix Red meat (CR).
  • a collection of 66 microorganisms formed by pathogens of food origin and interfering bacteria that can be found both in food matrices and in the environment has been generated.
  • the type strains were supplied by the Spanish Type Culture Collection (CECT), the American Type Culture Coilection (ATCC) and the Deutsche Sammlung von Mikroorganismen und Zellkulturen (DSMZ), in form of lyophilized cultures, which were reconstituted and cultivated following the recommended instructions.
  • CECT Spanish Type Culture Collection
  • ATCC American Type Culture Coilection
  • DSMZ Deutsche Sammlung von Mikroorganismen und Zellkulturen
  • the conditions and culture media used correspond to those recommended by the suppliers of the strains (Table 4).
  • Edwardsiella takes TSA 26 ° ANF
  • the glycerol preservation has been used to guarantee the availability of standard strain cultures over time, aliquots being stored, in duplicate of each strain, in 50% glycerol at -80 ° C.
  • an isolated colony obtained from an culture by depletion in solid medium, was inoculated in 5 mL of liquid culture medium and incubated at the corresponding temperature overnight. Then, this culture was centrifuged at 10,000 rpm for 10 min, the supernatant was discarded and the cell pellet was resuspended in 750 ⁇ of TSB or LB. 750 ⁇ of 50% glycerol was added and stored in a cryovial at -80 ° C until use.
  • Freeze drying has been used to guarantee the availability of the different strains in the very long term. The process performed is described below:
  • cryoprotective medium consisting of: MOPS (0.5%), skim milk powder (2%), trehalose (1, 7%) and water up to 50 mL
  • MOPS 0.5%)
  • skim milk powder 2%
  • trehalose 1, 7%
  • water up to 50 mL
  • the pH of this cryoprotectant medium was adjusted to a value of 7.5 with KOH.
  • the suspension was frozen at -70 ° C in glass capsule vials, keeping them at this temperature for one night.
  • the commercial StrataPrep® Plasmid Miniprep Kit (Agilent Technologies) was used for the isolation of plasmid DNA, following the protocol included therein.
  • the pCRBIunt vector (Life Technologies) has been used, which has the following characteristics: lac promoter; lacZot-ccdB; MCS; T7 promoter; banding sites for primers
  • DNA fragments were purified from agarose gels, using the commercial StrataPrep® Gel Extraction Kit; or from PCR products, using StrataPrep® PCR Purification Kit, both from the Agilent Technologies commercial house. The products of these purifications were eluted in autoclaved Milli-Q water.
  • T4 DNA ligase (5 U / pL) (Fermentas) and its respective buffer was used to ligate blunt DNA fragments into plasmid vectors.
  • ligation mixtures were prepared in a final volume of 10 pL whose standard composition is shown in Table 7.
  • primers were designed to amplify specific DNA sequences to each microorganism of interest. For this, genetic targets with high specificity and conservation were selected. The nucleotide sequences of DNA and proteins corresponding to these targets were obtained from the GenBank database (NCBI). Alignments were then carried out between them and the rest of the sequences deposited in GenBank through the BLAST-n and BLAST-p applications, available on the NCBI website. The regions corresponding to domains conserved between strains of the same species were selected for the design of the primers, which was carried out with the Primer3 online application (Rozen et al. 1998) and with the FastPCR ® program V.6.0.138 beta 2 (Kalendar et al, 2009), in the case of conventional PCR.
  • NCBI GenBank database
  • TaqMan ® primers and probes were designed with the Primer Express Version 3.0 software (Life Technologies).
  • Multiplex mode PCRs were carried out for the multiple detection of ten microorganisms and a family of foodborne pathogens, using the designed primers.
  • two initial mixtures of primers were prepared at a defined concentration, starting from the storage concentration of 100 pmol / pL of each of them, and the reagent concentrations and amplification conditions recommended by the manufacturer.
  • reaction TaqMan Gene Expression Master Mix (Applied Biosystems) was used, which contains the enzyme DNA polymerase, deoxyribonucleotides triphosphate, reaction buffer, Mg +2 and also the fluorophore ROX as passive reference. a) Preparation of standard line for quantification.
  • RNA present in each extract was removed by treatment for 2 hours at 37 ° C, with 10 pL of bovine pancreas RNAse A (ROCHE) and 2 ⁇ _ of Aspergillus oryzae T1 RNAse (SIGMA)
  • m mass of the double stranded DNA sample, in ng.
  • bp target length in base pairs (bp).
  • an internal amplification control (IAC) was designed and constructed consisting of a DNA sequence exogenous to the microorganisms used and the sequences corresponding to the sites banding of primers designed for qRTi-PCR reactions.
  • the exogenous sequence selected corresponds to a 120 bp fragment of the cinnamoyl-CoA reductase gene of Eucalyptus globulus (GenBank AY656818).
  • This DNA fragment that contain the upstream (up) and banding sequences of primers added at each end thereof reverse (rp) used for the qRTi-PCR reactions of each of the five types of pathogens to be quantified, new primers were designed in turn to annihilate the sequence of this exogenous gene and to incorporate the sequences into the 5 ' ends corresponding to the banding sites of the primers for each of the five genetic targets specific to the pathogens to be quantified.
  • the fragment to be used as a chimeric IAC was thus generated.
  • TaqMan-GVR-lAC For the detection of IAC amplification, a specific TaqMan ® probe (TaqMan-GVR-lAC) was designed, with three different versions each incorporating a different fluorophore, so that any of the duplex combinations of these five became possible types of pathogens. c) qRTi-PCR uniplex.
  • QRTi-PCR assays were performed in uniplex mode, in which only a pair of primers (up / rp) and a specific probe for a given microorganism were added. Initially, reactions were carried out with serial dilutions of the gDNA of each microorganism, its primers and corresponding probe.
  • Table 9 Amplification conditions for samples to be quantified by qRTi-uniplex PCR. d) qRTi-PCR duplex.
  • QRTi-PCR assays were carried out in multiplex mode, for the simultaneous detection of two pathogenic microorganisms.
  • the pair of primers and the specific TaqMan® probe were included in each reaction to each of these two pathogens, also adding the IAC with its respective probe. All possible combinations of TaqMan® probes corresponding to the five pathogens and the IAC (Table 10) were developed.
  • RESULTS Design and optimization of a multiplex PCR method (mPCR) for the simultaneous detection of seven species, two genera, a family and a strain of foodborne pathogenic bacteria.
  • mPCR multiplex PCR method
  • a genetic target was selected for the purpose of its subsequent amplification with a pair of primers specific thereto, and thus detect the microorganism in question.
  • Targets were chosen that corresponded to genes with a high degree of conservation in the treated species, in order to avoid variations between serovars or strains of the corresponding microorganism. Similarly, all these targets were chosen so that they did not exist in other related species, such as the interferers used here as a negative control.
  • primer pairs were designed for amplification of a specific region of that DNA from each pathogenic microorganism.
  • the different amplification regions selected differ premeditated in length, so that amplification products generated in multiplex PCR can be easily differentiated by capillary electrophoresis or agarose gel.
  • Table 1 Couples of primers designed for the multiplex detection of eight microorganisms, two genera and a family of foodborne pathogens.
  • the theoretical amplification Tm in all cases is 56 ° C.
  • the concentrations of each primer and the Tm of the reaction were optimized to achieve the amplification of all targets in multiplex reactions.
  • the individual optimization of each pair of primers began by testing 16 combinations of concentration of the primer up and the rp, as well as five different hybridization temperatures for each of those 16 combinations (Table 15).
  • TaqMan TM specific genetic targets were chosen for the design of primer pairs and probes TaqMan TM specific to each of the expected amplicons.
  • the use of these TaqMan TM probes makes it possible to avoid the generation of false positive results (such as those that are sometimes generated when using SYBR GREEN or other intercalating fluorescent compounds in the cDNA), since fluorescence is only detected from specifically hydrolyzed TaqMan probes by DNA polymerase during the amplification reaction.
  • Table 2 pairs of primers used in the quantification of B. cereus, C. perfringens, a microorganism of the Enterobacteriaceae Family, E. coli and / or S. aureus.
  • Table 3 probes used in the quantification of B. cereus, C. perfringens, microorganism of the Enterobacteriaceae Family, E. coli and / or S. aureus.
  • Conventional PCRs were performed using these new designed pairs of primers and the gDNA of each microorganism, in order to obtain amplicons that were subsequently cloned in the commercial PCR-Blunt vector to be able to sequence them, and check the coincidence of these amplicons generated with the theoretical genetic targets.
  • tests were carried out with serial dilutions of the stock reference DNA of each microorganism, quantified by spectrophotometry, in order to determine the minimum detection threshold of each type of reaction, expressed in terms of genomic equivalents of the microorganism. They were calculated from the mass of gDNA in pg, obtained by spectrophotometry, and the number of base pairs of the genome of each microorganism, using the following equation:
  • Genome (pb) mass (pg) ⁇ 0.978 x ⁇ Q 9
  • Table 22 Mass of a genome (or equivalent genomes, GE) for microorganisms quantifiable by qRTi-PCR. Source: genomes online.
  • an internal chimeric amplification control (QIAC) was designed, which was made up of a DNA sequence heterologous to the targets selected for detection and quantification, as well as all the microorganisms in the collection: a fragment internal to the cinnamoyl-CoA reductase gene of Eucalyptus globulus (GenBank AY656818).
  • a first pair of primers (GVR-QIAC1-up / rp) was designed that hybridized at the ends of the 120 bp sequence of the E. globulus gene and added to the resulting amplicon the hybridization sequences for the up primers of the Enterobacteriaceae and C. perfringens family, and for the rp primers of S. aureus and E. coli.
  • a second pair of primers (GVT-QIAC2-up / rp) was designed, which added to the PCR product generated in the previous stage, the hybridization sites for the up primers of S. aureus, B cereus and C.
  • GVR-QIAC3-up / rp a third pair of primers (GVR-QIAC3-up / rp) was designed, which added the hybridization sites for the up primers of E. coli and S. aureus, and for the rp primers of the Enterobacteriaceae family and C. perfringens.
  • a recognition site for the Hind ⁇ restriction enzyme was added, while at the rp primer, another for the SamHI enzyme to facilitate checking the fragment orientation after cloning it.
  • an insert of approximately 360 bp was obtained, which was ligated into the PCR-Blunt vector, obtaining a stable and easy to maintain and use QIAC form.
  • TaqMan probes were evaluated in reactions carried out with the up primer for Enterobacteriaceae and the rp primer for E. coli, both flanking the heterologous sequence contained in the chimera, and serial dilutions of the stock reference DNA of this plasmid pGVR-QIAC ( Figures 17A-C).
  • Quantification tests were carried out with cDNA samples obtained from cultures of B. cereus, C. perfringens, E.coli, Familia enterobacteriaceae (£. Coli) and S. aureus.
  • tubes were inoculated with 5 mL of TSB medium, with 10 pL of the glycerol stock of each of the microorganisms, incubating at 37 ° C and stirring (250 rpm) until obtaining a D.0. 60 o- 0.6 (exponential growth).
  • gDNA standards for each microorganism were prepared from previously extracted gDNA. For this, serial dilutions were made from 10 ° to 10 "4 , quantifying the concentration of the DNA present by spectrophotometry.
  • a validation process of the multiplex PCR detection and qRTi-PCR quantification methods developed in this invention was carried out, by comparing the method of the invention with the classical methods commonly applied in the food industry field, and which usually consist of colony counting on solid media plates or similar semi-automated or spiking systems.
  • the cDNA samples of all types were subjected to multiplex PCR reactions (in duplicate for each sample) for the detection of the corresponding microorganisms, as described in the previous sections.
  • the cDNA samples from artificial contamination with five microorganisms ( ⁇ . Cereus, C. perfringens, E. coli, Family Enterobacteriaceae and S. aureus) were subjected to quantification reactions (in duplicate for each sample) using qRTi-PCR, following the protocol developed in previous sections.
  • Table 31 A Results obtained in the detection in plates of solid culture medium and mPCR, of seven species, a genus and a family of food pathogens.
  • BC B, cereus
  • CJ C. jejuni
  • CP C. perfringens
  • CS C. sakazakir '
  • EC E. coli
  • EB Enterobacteriaceae
  • LM L monocytogenes
  • P Presence
  • A Absence.
  • Table 31 B Results obtained in the detection in plates of solid culture medium and mPCR, of seven species, a genus and a family of food pathogens.
  • BC B. cereus
  • CJ C. jejuni
  • CP C. perfringens
  • CS C. sakazakü
  • EC E. coli
  • EB Enterobacteriaceae
  • LM L monocytogenes
  • A Absence.
  • O Classic plate method and M mPCR.
  • Tables 32A-32E Results obtained in the quantification in plates of solid culture medium and qRTi-PCR, of four species and a family of food pathogens.
  • BC B. cereus
  • CP C. perfringens
  • EC E. coli
  • EB Enterobacteriaceae
  • SA S. aureus
  • C Classic Plate Method
  • Q qRTi-PCR. 5. Cultivation and enrichment of microorganisms. 5.1 Growth lines.
  • GVRUM medium is composed of buffered peptone water (Merck) (20 g / L), defibrinated and hemolysed horse blood (Oxoid) (50 mL / L), mannitol (20 g / L) and Campylobacter growth supplement ( Oxoid, # SR0232E) (2 vials of 2mL / L).
  • Merck buffered peptone water
  • Oxoid defibrinated and hemolysed horse blood
  • Oxoid 50 mL / L
  • mannitol 20 g / L
  • Campylobacter growth supplement Oxoid, # SR0232E

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Analytical Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention relates to an in vitro method for the simultaneous detection of Campylobacter jejuni, Cronobacter sakazakii, an enterohemorrhagic strain of Escherichia coli, Listeria monocytogenes, Salmonella spp. and Shigella spp. in a sample, said method comprising: a) isolating the DNA of said sample; b) carrying out a multiplex PCR on the DNA isolated in step a) with a group of primer pairs designed for this purpose; and c) detecting the amplification products obtained in step b). The invention also relates to a group of primer pairs especially designed for implementing said in vitro method, and to a kit comprising the above-mentioned group of primer pairs.

Description

Método para la detección simultánea de microorganismos patógenos  Method for the simultaneous detection of pathogenic microorganisms
DESCRIPCIÓN La presente invención se refiere a un método para detección simultánea de múltiples microorganismos patógenos, en particular, patógenos de transmisión alimentaria, mediante el empleo de parejas de cebadores y sondas diseñados específicamente para la detección de dichos microorganismos. Asimismo, la invención también se relaciona con el conjunto de parejas de cebadores y sondas diseñados a tal efecto y con el kit que los contiene. Por lo tanto, la presente invención se engloba dentro del campo de la microbiología, en particular, en el campo de la microbiología alimentaria.  DESCRIPTION The present invention relates to a method for the simultaneous detection of multiple pathogenic microorganisms, in particular foodborne pathogens, by the use of primer pairs and probes specifically designed for the detection of said microorganisms. Likewise, the invention also relates to the set of pairs of primers and probes designed for this purpose and to the kit containing them. Therefore, the present invention falls within the field of microbiology, in particular in the field of food microbiology.
ESTADO DE LA TÉCNICA Las patologías asociadas a microorganismos, fundamentalmente bacterias, representan una de las principales causas de enfermedad y mortalidad a nivel mundial. Se puede definir una enfermedad de origen alimentario como: "cualquier enfermedad de naturaleza infecciosa o toxigénica, que es o se piensa que ha sido causada por el agua o los alimentos". STATE OF THE TECHNIQUE The pathologies associated with microorganisms, mainly bacteria, represent one of the main causes of disease and mortality worldwide. A disease of food origin can be defined as: "any disease of an infectious or toxigenic nature, which is or is thought to have been caused by water or food".
De esta forma, toda aquella infección producida por microorganismos habitual o extraordinariamente presentes en alimentos, o sus toxinas, y siempre que la vía de entrada al organismo sea la entérica, es considerada como de origen alimentario. Debido a la globalización del comercio, hoy en día es posible consumir productos frescos provenientes de los lugares más distantes al lugar de residencia, con tiempos de transporte muy breves. Esto supone que patógenos que usualmente han causado enfermedades en ciertas regiones, ahora puedan encontrarse en otras en las que nunca antes se habían detectado. Además, este tipo de intercambios comerciales ha elevado la complejidad de las cadenas de comercialización de tal forma que se ha requerido la aplicación de normas y recomendaciones internacionales que garanticen la inocuidad de los alimentos, tales como las propuestas de la Comisión Internacional del Codex Alimentaríus o la normativa europea en materia de seguridad alimentaria establecida por la EFSA. In this way, any infection caused by microorganisms usually or extraordinarily present in food, or its toxins, and provided that the route of entry to the organism is enteric, is considered as of food origin. Due to the globalization of trade, today it is possible to consume fresh produce from the most distant places to the place of residence, with very short transport times. This means that pathogens that have usually caused diseases in certain regions can now be found in others where they have never been detected before. In addition, this type of trade has increased the complexity of the commercialization chains in such a way that the application of international standards and recommendations that guarantee food safety, such as the proposals of the International Codex Alimentaríus Commission or European food safety regulations established by EFSA.
Toda esta normativa de seguridad repercute de forma directa en los recursos de la industria alimentaria, ya que es necesario un control exhaustivo de los procesos productivos, identificando riesgos y minimizándolos de tal manera que se garantice la inocuidad del producto final. All these safety regulations have a direct impact on the resources of the food industry, since a thorough control of the processes is necessary productive, identifying risks and minimizing them in such a way that the safety of the final product is guaranteed.
Entre los métodos utilizados tradicionalmente tanto en el ámbito industrial, como en el académico y el sanitario, se encuentran la detección y recuento de microorganismos mediante técnicas de cultivo, métodos bioquímicos y métodos inmunológicos. Estos métodos se basan en la identificación de características morfológicas, bioquímicas, fisiológicas e inmunologicas, tales como: la forma de la colonia, su color, la reacción a la tinción de Gram, presencia de endosporas, flagelos, catálisis enzimáticas, fermentación de hidratos de carbono, temperatura de crecimiento, tolerancia al pH y sales, resistencia a antibióticos y tipos de antígenos somáticos, flagelares y capsulares (Yousef, 2008). Sin embargo, si bien han sido útiles durante muchos años, presentan ciertas limitaciones especialmente en lo que a rapidez se refiere. Estas técnicas son bastante laboriosas, ya que para realizar ensayos de detección o cuantificación es necesaria la preparación de los medios de cultivo específicos y el dispensado de los mismos en gran número de placas, seguido por el procesamiento de las muestras alimentarias, que en muchos casos requiere diversas formas de enriquecimiento, y la siembra en las placas de medio sólido. Si se suma el tiempo de preparación previa y el de incubación es posible que los resultados sean obtenidos hasta en 60 horas. Among the methods traditionally used both in the industrial field, as in the academic and health, are the detection and counting of microorganisms through culture techniques, biochemical methods and immunological methods. These methods are based on the identification of morphological, biochemical, physiological and immunological characteristics, such as: the shape of the colony, its color, the reaction to Gram staining, presence of endospores, flagella, enzymatic catalysis, fermentation of hydrates. carbon, growth temperature, pH and salt tolerance, resistance to antibiotics and types of somatic, flagellar and capsular antigens (Yousef, 2008). However, although they have been useful for many years, they have certain limitations, especially in terms of speed. These techniques are quite laborious, since in order to carry out detection or quantification tests it is necessary to prepare the specific culture media and to dispense them in a large number of plates, followed by the processing of food samples, which in many cases It requires various forms of enrichment, and planting in solid medium plates. If the previous preparation time and the incubation time are added, the results may be obtained in up to 60 hours.
La reducción del tiempo en el que se producen los resultados es un factor crítico que repercute directamente sobre la economía de las industrias agroalimentarias. Para una empresa de este tipo, el retardo en la salida al mercado de los productos que elabora, se traduce en el aumento de costes por almacenamiento, especialmente si son productos perecederos, y en una reducción de la posibilidad de ganancia, ya que si el alimento no está disponible para el intermediario o el consumidor, no se perciben ingresos por su venta. Pero la rapidez y la precisión en la detección de un patógeno no solo son relevantes desde el punto de vista económico. La detección temprana de un brote alimentario permite limitar la incidencia del mismo, evitando la propagación y el aumento del número de casos. Además, facilita la selección y aplicación del tratamiento más adecuado para el paciente. De esta forma el desarrollo de métodos que generen resultados más precisos en tiempos reducidos, supone un logro que provee beneficios tanto para las empresas del sector agroalimentario, como para el ámbito médico-sanitario. Así, se han desarrollado métodos genéticos de detección de microorganismos que solventan los inconvenientes de los métodos tradicionales de detección. Entre los métodos clásicos se encuentran, por ejemplo, la reacción en cadena de la polimerasa convencional (PCR), la reacción en cadena de la polimerasa cuantitativa a tiempo real (qRTi-PCR), la tecnología VeraCore™ o los microarrays. The reduction of the time in which the results are produced is a critical factor that has a direct impact on the economy of the agri-food industries. For a company of this type, the delay in the market launch of the products it produces, translates into increased storage costs, especially if they are perishable products, and a reduction in the possibility of profit, since if the Food is not available to the intermediary or the consumer, no income is earned from its sale. But the speed and accuracy in the detection of a pathogen are not only economically relevant. The early detection of a food outbreak makes it possible to limit its incidence, preventing the spread and increasing the number of cases. In addition, it facilitates the selection and application of the most appropriate treatment for the patient. In this way, the development of methods that generate more precise results in reduced times, supposes an achievement that provides benefits both for companies in the agri-food sector, and for the medical-sanitary field. Thus, genetic methods of detection of microorganisms have been developed that solve the drawbacks of traditional detection methods. Classic methods include, for example, the conventional polymerase chain reaction (PCR), the real-time quantitative polymerase chain reaction (qRTi-PCR), VeraCore ™ technology or microarrays.
La solicitud de patente US2013/01231 19 describe el uso de cebadores para la detección de patógenos transmitidos a través de los alimentos. Dichos cebadores permiten la detección simultánea de múltiples microorganismos mediante su empleo en técnicas moleculares, tales como PCR-multiplex y PCR-multiplex a tiempo real. Patent application US2013 / 01231 19 describes the use of primers for the detection of foodborne pathogens. Such primers allow the simultaneous detection of multiple microorganisms through their use in molecular techniques, such as PCR-multiplex and PCR-multiplex in real time.
La solicitud de patente EP2020449 describe un método para la detección y cuantificación simultánea, múltiple, de Listeria spp., Staphylococcus aureus, Campylobacter jejuni y/o E. coli 0157:1-17, en una o más muestras, mediante una reacción de amplificación multiplex usando una PCR a tiempo real (qRTi-PCR). Patent application EP2020449 describes a method for the simultaneous, multiple detection and quantification of Listeria spp., Staphylococcus aureus, Campylobacter jejuni and / or E. coli 0157: 1-17, in one or more samples, by an amplification reaction multiplex using a real-time PCR (qRTi-PCR).
Wang, R.F. et al. 1997 (J Appl Microbiol, 83(6): 727-736) describen la detección de Escherichia coli, E. co//'-ETEC, E. coli-0157:H7, Shigella spp., Salmonella spp., Yersinia enterocolitica, Y. pseudotuberculosis, Vibrio cholerae, V. parahaemolyticus, V. vulnificus, Listeria monocytogenes, Staphylococcus aureus y Bacillus cereus mediante reacción en cadena de la polimerasa. Wang, RF et al. 1997 (J Appl Microbiol, 83 (6): 727-736) describe the detection of Escherichia coli, E. co // ' -ETEC, E. coli-0157: H7, Shigella spp., Salmonella spp., Yersinia enterocolitica, Y. pseudotuberculosis, Vibrio cholerae, V. parahaemolyticus, V. vulnificus, Listeria monocytogenes, Staphylococcus aureus and Bacillus cereus by polymerase chain reaction.
Fukushima, H. et al. 2003 (Journal of Clinical Microbiology, 41 (11 ): 5134-5146) describen la detección de 8 de las 17 especies de patógenos alimentarios examinados mediante el empleo de qRTi- PCR. Fukushima, H. et al. 2003 (Journal of Clinical Microbiology, 41 (11): 5134-5146) describe the detection of 8 of the 17 species of food-borne pathogens examined through the use of qRTi- PCR.
La solicitud de patente US2005/0239086 describe un método para la detección de una o más secuencias de ácido nucleico diana en una muestra, útil en la búsqueda de microorganismos patógenos en alimentos. Sin embargo, ninguno de estos métodos permite la detección simultánea de los principales microorganismos patógenos habitualmente presentes en los alimentos. Por lo tanto, existe en el estado de la técnica la necesidad de proporcionar un método de detección de microorganismos patógenos alternativos a los existentes en el estado de la técnica que permita la detección múltiple y la cuantificación rápida y eficaz de, principalmente, microorganismos patógenos transmitidos por vía alimentaria y otros de importancia industrial. Patent application US2005 / 0239086 describes a method for the detection of one or more target nucleic acid sequences in a sample, useful in the search for pathogenic microorganisms in food. However, none of these methods allows simultaneous detection of the main pathogenic microorganisms usually present in food. By therefore, there is a need in the state of the art to provide a method of detecting pathogenic microorganisms alternative to those existing in the state of the art that allows multiple detection and rapid and efficient quantification of, mainly, pathogenic microorganisms transmitted by food route and others of industrial importance.
DESCRIPCIÓN DE LA INVENCIÓN DESCRIPTION OF THE INVENTION
Los inventores han desarrollado un método para la detección simultánea de microorganismos patógenos alimentarios basado en un conjunto de parejas de cebadores diseñados específicamente para detectar de forma simultánea hasta 1 1 tipos de microorganismos patógenos mediante una PCR multiplex, entre los que se encuentra Campylobacter jejuni, Cronobacter sakazakii, una cepa enterohemorrágica de Escherichia coli, Listeria monocytogenes, Salmonella spp., Shigella spp., Bacillus cereus, Clostrídium períringens, un microorganismo de la familia Enterobacteriaceae, Escherichia coli y Staphylococcus aureus. Adicionalmente, en caso de que alguno B. cereus, C. períringens, un microorganismo de la familia Enterobacteriaceae, E. coli o S. aureus sea detectado, el método permite la cuantificación del mismo, pues se han diseñado parejas de cebadores y sondas a tal efecto. The inventors have developed a method for the simultaneous detection of foodborne pathogenic microorganisms based on a set of primer pairs specifically designed to simultaneously detect up to 1 1 types of pathogenic microorganisms by multiplex PCR, among which is Campylobacter jejuni, Cronobacter sakazakii, an enterohemorrhagic strain of Escherichia coli, Listeria monocytogenes, Salmonella spp., Shigella spp., Bacillus cereus, Clostrídium períringens, a microorganism of the Enterobacteriaceae family, Escherichia coli and Staphylococcus aureus. Additionally, if any B. cereus, C. períringens, a microorganism of the Enterobacteriaceae, E. coli or S. aureus family is detected, the method allows quantification of the same, as pairs of primers and probes have been designed to such effect.
Así, para el diseño del conjunto de parejas de cebadores de la invención (y que permite la detección simultánea de hasta 1 1 tipos de microorganismos patógenos), se partió de una colección de 66 microorganismos formada por patógenos de origen alimentario y bacterias interferentes que pueden encontrarse tanto en matrices alimentarias como en el ambiente. A partir de dicha colección, los microorganismos patógenos de interés fueron seleccionados y cultivados, tras lo cual se procedió a extraer el ADN genómico de cada uno de ellos. A continuación, se seleccionaron dianas genéticas con alta especificidad y conservación, y las regiones correspondientes a dominios conservados entre cepas de la misma especie fueron seleccionadas para el diseño de los cebadores. Paralelamente, para la detección y cuantificación por qRTi-PCR de cuatro microorganismos y una familia de patógenos de origen alimentario de los microorganismos detectados originalmente, se diseñaron nuevos cebadores y sondas TaqMan®. Así, en base a estos conjuntos de parejas de cebadores, se han desarrollado los distintos aspectos inventivos que forman parte de la presente invención y que serán descritos en detalle a continuación. Previamente a la descripción de dichos aspectos inventivos, se incluye un listado de definiciones donde se explica el significado de los términos empleados en el contexto de la presente invención para ayudar en la comprensión de la misma. Thus, for the design of the set of primer pairs of the invention (and allowing simultaneous detection of up to 1 1 types of pathogenic microorganisms), a collection of 66 microorganisms formed by food-borne pathogens and interfering bacteria that can be found both in food matrices and in the environment. From this collection, the pathogenic microorganisms of interest were selected and cultured, after which the genomic DNA was extracted from each of them. Next, genetic targets with high specificity and conservation were selected, and the regions corresponding to domains conserved between strains of the same species were selected for the design of the primers. In parallel, for the detection and quantification by qRTi-PCR of four microorganisms and a family of foodborne pathogens of the originally detected microorganisms, new TaqMan ® primers and probes were designed. Thus, based on these sets of primer pairs, the various inventive aspects that are part of the present invention and which will be described in detail below have been developed. Prior to the description of said inventive aspects, a list of definitions is included explaining the meaning of the terms used in the context of the present invention to aid in the understanding thereof.
Definiciones "un" runa" Definitions "a" rune "
El uso de la palabra "un" o "una" cuando se usa junto con el término "comprender" o "comprende" en las reivindicaciones y/o la descripción puede significar "uno", pero también es consistente con el significado de "uno o más", "al menos uno" y "uno o más de uno".  The use of the word "a" or "a" when used in conjunction with the term "understand" or "comprises" in the claims and / or the description may mean "one," but is also consistent with the meaning of "one. or more "," at least one "and" one or more than one ".
PCRPCR
PCR corresponde a las siglas de reacción en cadena de la polimerasa mediante la cual se pueden obtener millones de copias de las regiones de ADN deseadas. Se caracteriza por el empleo de parejas de cebadores que acotan la región de la que se realizaran millones de copias, lo que también se conoce como "amplificar ADN" durante la PCR. La PCR está compuesta por un número determinado de ciclos, compuestos a su vez por tres fases en las que las hebras de ADN se separan, se unen los cebadores y se elongan las nuevas hebras de ADN. En cada ciclo, si la eficiencia de la reacción es del 100% se produce un crecimiento exponencial de los fragmentos de ADN objeto de la amplificación. PCR corresponds to the polymerase chain reaction acronym whereby millions of copies of the desired DNA regions can be obtained. It is characterized by the use of pairs of primers that delimit the region from which millions of copies will be made, which is also known as "amplifying DNA" during PCR. The PCR is composed of a certain number of cycles, in turn composed of three phases in which the DNA strands are separated, the primers are joined and the new DNA strands are elongated. In each cycle, if the reaction efficiency is 100%, exponential growth of the DNA fragments subject to amplification occurs.
Reacción de amplificación multiplex Multiplex amplification reaction
En la presente invención se entiende por "Reacción de amplificación multiplex" a la reacción en cadena de la polimerasa (PCR) en la cual se amplifica más de una secuencia de ADN en una misma reacción, mediante el empleo de dos o más parejas de cebadores en un único tubo junto con el resto de los reactivos de la reacción con el fin de amplificar simultáneamente múltiples secuencias de ADN.  In the present invention, "multiplex amplification reaction" is understood as the polymerase chain reaction (PCR) in which more than one DNA sequence is amplified in the same reaction, by using two or more primer pairs. in a single tube together with the rest of the reaction reagents in order to simultaneously amplify multiple DNA sequences.
Reacción de amplificación a Tiempo Real o Cuantitativa Real-time or Quantitative amplification reaction
En la presente invención se entiende por PCR cuantitativa (qPCR) o PCR en tiempo real (qRTi-qPCR) a una variante de la reacción en cadena de la polimerasa (PCR) utilizada para amplificar y simultáneamente cuantificar de forma absoluta la cantidad de ADN o ARN presente en la muestra original. In the present invention quantitative PCR (qPCR) or real-time PCR (qRTi-qPCR) is understood as a variant of the polymerase chain reaction (PCR) used to amplify and simultaneously quantify absolutely the amount of DNA or RNA present in the original sample.
Oligonucleótido Oligonucleotide
El término "oligonucleótido" hace referencia a la secuencia de bases de nucieótidos unidos por enlaces fosfo-diéster, habitualmente no mayor de 50 nucieótidos. The term "oligonucleotide" refers to the sequence of nucleotide bases linked by phospho-diester bonds, usually not greater than 50 nucleotides.
Cebador Primer
En la presente invención se entiende por "cebador" o "primer" u "oligonucleótido" ("oligo") a la secuencia de nucieótidos a partir de la cual la ADN polimerasa inicia la síntesis de una molécula nueva de ADN. Los cebadores son secuencias nucleotídicas cortas, aproximadamente de 15-24 nucieótidos de longitud que se pueden alinear con una hebra de ADN diana gracias a la complementariedad de bases para formar un híbrido entre el cebador y la hebra diana de ADN. Después, el enzima ADN polimerasa puede extender el cebador a lo largo de la hebra diana de ADN. Los métodos para preparar y usar cebadores son ampliamente conocidos por el experto en la materia.  In the present invention, "primer" or "first" or "oligonucleotide" ("oligo") is understood as the nucleotide sequence from which DNA polymerase initiates the synthesis of a new DNA molecule. The primers are short nucleotide sequences, approximately 15-24 nucieotides in length that can be aligned with a strand of target DNA thanks to the complementarity of bases to form a hybrid between the primer and the target strand of DNA. Then, the DNA polymerase enzyme can extend the primer along the DNA strand. Methods for preparing and using primers are widely known to those skilled in the art.
Pareja de cebadores Pair of primers
En el contexto de la presente invención se entiende por "pareja de cebadores" o "primer pair", al conjunto de dos cebadores que, empleados en una misma reacción de amplificación o PCR, permiten obtener múltiples copias de una secuencia diana de ADN. Cada uno de los cebadores híbrida con la secuencia diana, de manera que se amplifica la secuencia de nucieótidos acotada mediante cada pareja de cebadores. La extensión de los cebadores durante los ciclos de PCR determina la multiplicación exponencial 2N de la secuencia de nucieótidos acotada por los cebadores, siendo N el número de ciclos de la reacción PCR. In the context of the present invention, "primer pair" or "first pair" is understood as the set of two primers which, when used in the same amplification or PCR reaction, allow multiple copies of a DNA target sequence to be obtained. Each of the primers hybridized with the target sequence, so that the bounded nucleotide sequence is amplified by each pair of primers. The extent of the primers during the PCR cycles determines the 2 N exponential multiplication of the nucleotide sequence bounded by the primers, N being the number of cycles of the PCR reaction.
Muestra Sample
En el contexto de la presente invención, se entiende por "muestra" cualquier materia susceptible de contener ADN. Alícuota In the context of the present invention, "sample" means any matter capable of containing DNA. Aliquot
En el contexto de la presente invención, se entiende por "alícuota" a la parte que se toma de un volumen (alícuota líquida) o de una masa (alícuota sólida) iniciales, para ser usada en una prueba de laboratorio, cuyas propiedades físicas y químicas, así como su composición, representan las de la sustancia original. Normalmente las alícuotas son el resultado de repartir un volumen inicial en varias partes iguales.  In the context of the present invention, "aliquot" is understood as the part that is taken from an initial volume (liquid aliquot) or an initial mass (solid aliquot), to be used in a laboratory test, the physical properties of which Chemicals, as well as their composition, represent those of the original substance. Normally, aliquots are the result of distributing an initial volume in several equal parts.
Método de la invención Los inventores han diseñado un conjunto de parejas de cebadores que, empleados en una PCR multiplex, permite detectar la presencia de los principales microorganismos patógenos alimentarios. Method of the invention The inventors have designed a set of primer pairs that, when used in a multiplex PCR, allow the presence of the main food-borne pathogens to be detected.
Así, en un primer aspecto, la invención se relaciona con un método in vitro para la detección simultánea de Campylobacter jejuni, Cronobacter sakazakii, una cepa enterohemorrágica de Escherichia coli, Listeria monocytogenes, Salmonella spp. y Shigella spp. en una muestra; de aquí en adelante "método de la invención", que comprende: Thus, in a first aspect, the invention relates to an in vitro method for the simultaneous detection of Campylobacter jejuni, Cronobacter sakazakii, an enterohemorrhagic strain of Escherichia coli, Listeria monocytogenes, Salmonella spp. and Shigella spp. in a sample; Hereinafter "method of the invention", comprising:
a) Aislar el ADN de dicha muestra,  a) Isolate the DNA from said sample,
b) Llevar a cabo una PCR multiplex sobre el ADN aislado en la etapa a) mediante el empleo de las siguientes parejas de cebadores:  b) Carry out a multiplex PCR on the DNA isolated in step a) by using the following primer pairs:
La pareja de cebadores formada por el oligonucleótido que comprende la secuencia SEQ ID NO: 3 y el oligonucleótido que comprende la secuencia SEQ ID NO: 4 diseñados para amplificar C. jejuni,  The primer pair formed by the oligonucleotide comprising the sequence SEQ ID NO: 3 and the oligonucleotide comprising the sequence SEQ ID NO: 4 designed to amplify C. jejuni,
La pareja de cebadores formada por el oligonucleótido que comprende la secuencia SEQ ID NO: 7 y el oligonucleótido que comprende la secuencia SEQ ID NO: 8 diseñados para amplificar C. sakazakii,  The primer pair formed by the oligonucleotide comprising the sequence SEQ ID NO: 7 and the oligonucleotide comprising the sequence SEQ ID NO: 8 designed to amplify C. sakazakii,
- La pareja de cebadores formada por el oligonucleótido que comprende la secuencia SEQ ID NO: 1 1 y el oligonucleótido que comprende la secuencia SEQ ID NO: 12 diseñados para amplificar una cepa enterohemorrágica de E. coli,  The primer pair formed by the oligonucleotide comprising the sequence SEQ ID NO: 1 1 and the oligonucleotide comprising the sequence SEQ ID NO: 12 designed to amplify an enterohemorrhagic strain of E. coli,
- La pareja de cebadores formada por el oligonucleótido que comprende la secuencia SEQ ID NO: 15 y el oligonucleótido que comprende la secuencia SEQ ID NO: 16 diseñados para amplificar L. monocytogenes, La pareja de cebadores formada por el oligonucleótido que comprende la secuencia SEQ ID NO: 17 y el oligonucleótido que comprende la secuencia SEQ ID NO: 18 diseñados para amplificar Salmonella spp. - The pair of primers formed by the oligonucleotide comprising the sequence SEQ ID NO: 15 and the oligonucleotide comprising the sequence SEQ ID NO: 16 designed to amplify L. monocytogenes, The primer pair formed by the oligonucleotide comprising the sequence SEQ ID NO: 17 and the oligonucleotide comprising the sequence SEQ ID NO: 18 designed to amplify Salmonella spp.
La pareja de cebadores formada por el oligonucleótido que comprende la secuencia SEQ ID NO: 19 y el oligonucleótido que comprende la secuencia The primer pair formed by the oligonucleotide comprising the sequence SEQ ID NO: 19 and the oligonucleotide comprising the sequence
SEQ ID NO: 20 diseñados para amplificar Shigella spp. y SEQ ID NO: 20 designed to amplify Shigella spp. Y
c) Detectar los productos de amplificación obtenidos en la etapa b).  c) Detect the amplification products obtained in step b).
En una realización particular del método de la invención, la cepa enterohemorrágica de E. coli es E. coli 0157:H7, la especie de Salmonella spp. es Salmonella entérica y/o la especie de Shigella spp. es Shigella dysenteríae. In a particular embodiment of the method of the invention, the enterohemorrhagic strain of E. coli is E. coli 0157: H7, the species of Salmonella spp. It is enteric Salmonella and / or the species of Shigella spp. It's Shigella dysenteríae.
En una primera etapa [etapa a)], el método de la invención comprende aislar o extraer el ADN de una muestra, para lo cual es necesario la recolección de la misma. In a first stage [step a)], the method of the invention comprises isolating or extracting the DNA from a sample, for which it is necessary to collect it.
La recogida de muestras debe hacerse con el protocolo y la metodología adecuada en función de las características de la muestra, es decir, si es una muestra líquida, sólida, congelada, liofilizada etc. Como sabe el experto en la materia, la recolección de la muestra se debe efectuar evitando toda contaminación externa, tanto ambiental como humana para asegurar la integridad de misma y unos resultados fiables. Es necesario emplear recipientes limpios, secos, libres de fugas, de boca ancha, estériles y de un tamaño apropiado a la muestra. Asimismo, las condiciones de conservación, el transporte, el tiempo comprendido entre la recolección de la muestra y su entrega en el laboratorio, así como la realización del análisis influyen en los resultados obtenidos ya que la población microbiana puede sufrir cambios cualitativos y cuantitativos. Todas estas consideraciones son ampliamente conocidas por el experto en la materia, y los protocolos y procedimientos de recogida de muestras están claramente estandarizados y establecidos por las autoridades competentes. Cualquier muestra susceptible de estar contaminada con Campylobacter jejuni, Cronobacter sakazakii, una cepa enterohemorrágica de Escherichia coli, Listeria monocytogenes, Salmonella spp. y Shigella spp. puede ser analizada con el método de la invención. No obstante, en una realización particular, la muestra es una muestra de alimento que, en otra realización todavía más particular, el alimento es un producto lácteo, un producto cárnico, pescado, huevo, un ovoderivado, un vegetal, un producto de pastelería, una comida preparada o una bebida. El protocolo y la metodología para recoger muestras procedentes de estos productos son ampliamente conocidos y práctica de rutina para el experto en la materia. Sample collection should be done with the appropriate protocol and methodology depending on the characteristics of the sample, that is, if it is a liquid, solid, frozen, lyophilized sample etc. As the person skilled in the art knows, the collection of the sample should be carried out avoiding all external contamination, both environmental and human, to ensure its integrity and reliable results. It is necessary to use clean, dry, leak-free, wide-mouth, sterile containers of an appropriate sample size. Likewise, the conservation conditions, the transport, the time between the collection of the sample and its delivery in the laboratory, as well as the performance of the analysis influence the results obtained since the microbial population can undergo qualitative and quantitative changes. All these considerations are widely known by the person skilled in the art, and the protocols and procedures for collecting samples are clearly standardized and established by the competent authorities. Any sample susceptible to contamination with Campylobacter jejuni, Cronobacter sakazakii, an enterohemorrhagic strain of Escherichia coli, Listeria monocytogenes, Salmonella spp. and Shigella spp. It can be analyzed with the method of the invention. However, in a particular embodiment, the sample is a sample of food that, in another even more particular embodiment, the food is a dairy product, a meat product, fish, egg, an ovoderivative, a vegetable, a pastry product, A prepared meal or a drink. The protocol and methodology for Collecting samples from these products are widely known and routine practice for the person skilled in the art.
Una vez recogida la muestra esta debe llevarse al laboratorio donde será procesada para extraer el ADN. El procesamiento de la muestra puede llevarse a cabo inmediatamente después de ser recibida por el laboratorio o puede ser procesada más tarde, en cuyo caso la muestra debe ser almacenada hasta su uso. Como sabe el experto en la materia, el almacenamiento debe realizarse en las condiciones adecuadas, siendo lo más habitual congelarlas a -20° C. Cuando la muestra vaya a ser analizada, ésta deberá ser descongelada siguiendo los protocolos estándar establecidos para tal propósito y ampliamente conocidos por el experto en la materia. Once the sample is collected, it must be taken to the laboratory where it will be processed to extract the DNA. Sample processing can be carried out immediately after being received by the laboratory or it can be processed later, in which case the sample must be stored until use. As the person skilled in the art knows, the storage must be carried out under the appropriate conditions, and it is most usual to freeze them at -20 ° C. When the sample is to be analyzed, it must be thawed following the standard protocols established for this purpose and widely known to the person skilled in the art.
En el caso de las muestras alimentarias puede presentarse una distribución no homogénea de los microorganismos. Por lo tanto, para asegurar una distribución lo más uniforme posible, previamente a la extracción del ADN puede ser conveniente homogenizar la muestra. Esto puede hacerse mediante el empleo, por ejemplo, del aparato Stomacher®, en el que unas paletas golpean ligeramente la muestra previamente introducida en una bolsa de plástico junto con un diluyente. Dicho golpeteo liberará a las bacterias de las partículas de alimento, debido en parte a la agitación violenta del líquido y en parte por la compresión que sufre la muestra por las paletas. No es necesaria una homogenización completa de la muestra. In the case of food samples, an inhomogeneous distribution of microorganisms may occur. Therefore, to ensure as uniform a distribution as possible, prior to DNA extraction it may be convenient to homogenize the sample. This can be done by using, for example, the Stomacher® apparatus, in which vanes tap the previously introduced sample into a plastic bag together with a diluent. Such knocking will free bacteria from food particles, due in part to the violent agitation of the liquid and partly by the compression suffered by the sample by the blades. A complete homogenization of the sample is not necessary.
Una vez obtenida la muestra, esta debe ser procesada para obtener el ADN de la misma. La extracción de ADN consta de una etapa de lisis, que consiste en romper las estructuras que confinan el citoplasma y liberar al medio su contenido, y otra de purificación, que implica la retirada de la solución final de la mayoría de elementos que pueden interferir en la PCR. La extracción del ADN puede llevarse a cabo usando cualquier método conocido por los expertos en la materia que incluyen, sin limitarse a, centrifugaciones en gradientes de densidad, extracción en dos fases usando fenol acuoso o cloroformo con etanol, cromatografía en columna, métodos basados en la capacidad del ADN para unirse en superficies de cristal y/o silicatos, como preparaciones de tierra diatomeas o lechos de cristal, empleando kits comerciales, por ejemplo, los kits "Q-Biogene fast DNA kit" o el"QIAamp(R) DNA Blood Mini Kit" (Qiagen, Hilden, Alemania) o el "G-Spin llp" (Intron Biotechnology, Corea) o el "Fast Prep System Bio 101 " (Qbiogene, Madrid, España) o PrepMan Ultra (Invitrogen, USA). Once the sample is obtained, it must be processed to obtain the DNA from it. The extraction of DNA consists of a lysis stage, which consists in breaking the structures that confine the cytoplasm and releasing its contents to the medium, and another one of purification, which implies the withdrawal of the final solution of most elements that can interfere with PCR DNA extraction can be carried out using any method known to those skilled in the art, including, but not limited to, density gradient centrifugations, two-phase extraction using aqueous phenol or chloroform with ethanol, column chromatography, methods based on the ability of DNA to bind on glass surfaces and / or silicates, such as diatomaceous earth preparations or glass beds, using commercial kits, for example, "Q-Biogene fast DNA kit" or "QIAamp (R) DNA Blood Mini Kit " (Qiagen, Hilden, Germany) or the "G-Spin llp" (Intron Biotechnology, Korea) or the "Fast Prep System Bio 101" (Qbiogene, Madrid, Spain) or PrepMan Ultra (Invitrogen, USA).
Tras el aislado del ADN, el método de la invención comprende una etapa b), en la que se lleva a cabo una reacción de amplificación multiplex (PCR multiplex) sobre el ADN aislado en la etapa a). Las parejas de cebadores empleadas en dicha PCR multiplex son After isolating the DNA, the method of the invention comprises a step b), in which a multiplex amplification reaction (multiplex PCR) is carried out on the DNA isolated in step a). The pairs of primers used in said multiplex PCR are
La pareja de cebadores formada por el oligonucleótido que comprende la secuencia SEQ ID NO: 3 y el oligonucleótido que comprende la secuencia SEQ ID NO: 4 diseñados para amplificar C. jejuni,  The primer pair formed by the oligonucleotide comprising the sequence SEQ ID NO: 3 and the oligonucleotide comprising the sequence SEQ ID NO: 4 designed to amplify C. jejuni,
La pareja de cebadores formada por el oligonucleótido que comprende la secuencia SEQ ID NO: 7 y el oligonucleótido que comprende la secuencia SEQ ID NO: 8 diseñados para amplificar C. sakazakii,  The primer pair formed by the oligonucleotide comprising the sequence SEQ ID NO: 7 and the oligonucleotide comprising the sequence SEQ ID NO: 8 designed to amplify C. sakazakii,
- La pareja de cebadores formada por el oligonucleótido que comprende la secuencia SEQ ID NO: 1 1 y el oligonucleótido que comprende la secuencia SEQ - The pair of primers formed by the oligonucleotide comprising the sequence SEQ ID NO: 1 1 and the oligonucleotide comprising the sequence SEQ
ID NO: 12 diseñados para amplificar una cepa enterohemorrágica de E. coli,ID NO: 12 designed to amplify an enterohemorrhagic strain of E. coli,
- La pareja de cebadores formada por el oligonucleótido que comprende la secuencia SEQ ID NO: 15 y el oligonucleótido que comprende la secuencia SEQ ID NO: 16 diseñados para amplificar L. monocytogenes, - The pair of primers formed by the oligonucleotide comprising the sequence SEQ ID NO: 15 and the oligonucleotide comprising the sequence SEQ ID NO: 16 designed to amplify L. monocytogenes,
- La pareja de cebadores formada por el oligonucleótido que comprende la secuencia SEQ ID NO: 17 y el oligonucleótido que comprende la secuencia SEQ ID NO: 18 diseñados para amplificar Salmonella spp. - The pair of primers formed by the oligonucleotide comprising the sequence SEQ ID NO: 17 and the oligonucleotide comprising the sequence SEQ ID NO: 18 designed to amplify Salmonella spp.
La pareja de cebadores formada por el oligonucleótido que comprende la secuencia SEQ ID NO: 19 y el oligonucleótido que comprende la secuencia SEQ ID NO: 20 diseñados para amplificar Shigella spp. .  The primer pair formed by the oligonucleotide comprising the sequence SEQ ID NO: 19 and the oligonucleotide comprising the sequence SEQ ID NO: 20 designed to amplify Shigella spp. .
En una realización particular, el método de la invención comprende adicionalmente, la detección de al menos 1 , preferiblemente 2, 3, 4 o 5 de los microorganismos seleccionados de la lista que consiste en Bacillus cereus, Clostrídium perfringens, un microorganismo de la familia Enterobacteriaceae, Escherichia coli y Staphylococcus aureus mediante el empleo de las siguientes parejas de cebadores: In a particular embodiment, the method of the invention further comprises the detection of at least 1, preferably 2, 3, 4 or 5 of the microorganisms selected from the list consisting of Bacillus cereus, Clostridium perfringens, a microorganism of the Enterobacteriaceae family , Escherichia coli and Staphylococcus aureus by using the following pairs of primers:
- La pareja de cebadores formada por el oligonucleótido que comprende la secuencia SEQ ID NO: 1 y el oligonucleótido que comprende la secuencia SEQ ID NO: 2 diseñados para amplificar B. cereus, La pareja de cebadores formada por el oiigonucleótido que comprende la secuencia SEQ ID NO: 5 y el oiigonucleótido que comprende la secuencia SEQ ID NO: 6 diseñados para amplificar C. perfríngens, - The pair of primers formed by the oligonucleotide comprising the sequence SEQ ID NO: 1 and the oligonucleotide comprising the sequence SEQ ID NO: 2 designed to amplify B. cereus, The primer pair formed by the oiigonucleotide comprising the sequence SEQ ID NO: 5 and the oiigonucleotide comprising the sequence SEQ ID NO: 6 designed to amplify C. perfríngens,
- La pareja de cebadores formada por el oiigonucleótido que comprende la secuencia SEQ ID NO: 13 y el oiigonucleótido que comprende la secuencia SEQ - The pair of primers formed by the oiigonucleotide comprising the sequence SEQ ID NO: 13 and the oiigonucleotide comprising the sequence SEQ
ID NO: 14 diseñados para amplificar un microorganismo de la familia Enterobacteriaceae, ID NO: 14 designed to amplify a microorganism of the Enterobacteriaceae family,
La pareja de cebadores formada por el oiigonucleótido que comprende la secuencia SEQ ID NO: 9 y el oiigonucleótido que comprende la secuencia SEQ ID NO: 10 diseñados para amplificar E. coli, o  The primer pair formed by the oiigonucleotide comprising the sequence SEQ ID NO: 9 and the oiigonucleotide comprising the sequence SEQ ID NO: 10 designed to amplify E. coli, or
- La pareja de cebadores formada por el oiigonucleótido que comprende la secuencia SEQ ID NO: 21 y el oiigonucleótido que comprende la secuencia SEQ ID NO: 22 diseñada para amplificar S. aureus. Las secuencias de nucleótidos de las parejas de cebadores se muestran en la Tabla 1 .  - The pair of primers formed by the oiigonucleotide comprising the sequence SEQ ID NO: 21 and the oiigonucleotide comprising the sequence SEQ ID NO: 22 designed to amplify S. aureus. The nucleotide sequences of the primer pairs are shown in Table 1.
Figure imgf000012_0001
(SEQ ID
Figure imgf000012_0001
(SEQ ID
NO: 6)  NO 6)
GVR- CS-Mpx- up TGGCATCATCAACACTTTCGT  GVR- CS-Mpx- up TGGCATCATCAACACTTTCGT
(SEQ ID  (SEQ ID
Cronobacter NO. 7)  Chronobacter NO. 7)
207 sakazakii GVR- CS-Mpx- rp TCGACTACTACCTGGTGGACG  207 sakazakii GVR- CS-Mpx- rp TCGACTACTACCTGGTGGACG
(SEQ ID  (SEQ ID
NO: 8)  NO: 8)
GVR- EC-Mpx- up GTTGGTGGGAAAGCGCGTTACA  GVR- EC-Mpx- up GTTGGTGGGAAAGCGCGTTACA
(SEQ ID  (SEQ ID
NO: 9)  NO: 9)
Escherichia coli 70  Escherichia coli 70
GVR- EC-Mpx- rp CGTTAAAACTGCCTGGCACAG  GVR- EC-Mpx- rp CGTTAAAACTGCCTGGCACAG
(SEQ ID  (SEQ ID
NO: 10)  NO: 10)
GVR- H7-Mpx- up TGGGTACTGTGCCTGTTACTG  GVR- H7-Mpx- up TGGGTACTGTGCCTGTTACTG
(SEQ ID  (SEQ ID
Cepa NO: 1 1 )  Strain NO: 1 1)
enterohemorrágica 216 enterohemorrhagic 216
GVR- de E. col i  GVR- from E. col i
H7-Mpx- rp AAGCCCTCGTATATCCACAGC  H7-Mpx- rp AAGCCCTCGTATATCCACAGC
(SEQ ID  (SEQ ID
NO: 12)  NO: 12)
GVR- EB-Mpx- up TCAGAGTTCCCGAAGGCACTC  GVR- EB-Mpx- up TCAGAGTTCCCGAAGGCACTC
(SEQ ID  (SEQ ID
Fam. NO: 13)  Fam. NO: 13)
77 77
Enterobacteríaceae GVR- EB-Mpx- rp GCAACGCGAAGAACCTTACCT Enterobacteriaceae GVR- EB-Mpx- rp GCAACGCGAAGAACCTTACCT
(SEQ ID  (SEQ ID
NO: 14)  NO: 14)
GVR- LM-Mpx- up TGACGAAATGGCTTACAGTGA  GVR- LM-Mpx- up TGACGAAATGGCTTACAGTGA
(SEQ ID  (SEQ ID
Listeria NO: 15)  Listeria NO: 15)
163 monocytogenes GVR- LM-Mpx- rp GCCGAAGTTTACATTCAAGCT  163 monocytogenes GVR- LM-Mpx- rp GCCGAAGTTTACATTCAAGCT
(SEQ ID  (SEQ ID
NO: 16) GVR- SE-Mpx- up CCCGA I I I I CTCTGGATGGT NO: 16) GVR- SE-Mpx- up CCCGA IIII CTCTGGATGGT
(SEQ ID  (SEQ ID
NO: 17)  NO: 17)
Salmonella spp. 176  Salmonella spp. 176
GVR- SE-Mpx- rp GGCAATAGCGTCACC I I I GA  GVR- SE-Mpx- rp GGCAATAGCGTCACC I I I GA
(SEQ ID  (SEQ ID
NO: 18)  NO: 18)
GVR- SH-Mpx- up TCAAAACACATTGATGAGTATCAGG  GVR- SH-Mpx- up TCAAAACACATTGATGAGTATCAGG
(SEQ ID  (SEQ ID
NO: 19)  NO: 19)
Shigella spp. 150  Shigella spp. 150
GVR- SH-Mpx- rp TACATCTTTTTGACCGGACTTCTTA  GVR- SH-Mpx- rp TACATCTTTTTGACCGGACTTCTTA
(SEQ ID  (SEQ ID
NO: 20)  NO: 20)
GVR- SA-Mpx- up G C AACTG AAAC AAC AG AAG CT  GVR- SA-Mpx- up G C AACTG AAAC AAC AG AAG CT
(SEQ ID  (SEQ ID
Staphylococcus NO: 21 )  Staphylococcus NO: 21)
101 aureus GVR- SA-Mpx- rp TCACGGATACCTGTACCAGCA  101 aureus GVR- SA-Mpx- rp TCACGGATACCTGTACCAGCA
(SEQ Dl  (SEQ Dl
NO: 22)  NO: 22)
Tabla 1 : parejas de cebadores del método de la invención.  Table 1: primer pairs of the method of the invention.
En total, el método de la invención permite la detección simultánea de hasta 11 tipos de microorganismos distintos, es decir, 7 especies {Campylobacter jejuni, Cronobacter sakazakii, Bacillus cereus, Clostridium perfringens, Escherichia coli, Listeria monocytogenes y Staphylococcus aureus), una familia (familia Enterobacteríaceae), dos géneros (Salmonella spp. y Shigella spp.) y una cepa (las cepas enterohemorrágicas de Escherichia coli). In total, the method of the invention allows the simultaneous detection of up to 11 different types of microorganisms, that is, 7 species {Campylobacter jejuni, Cronobacter sakazakii, Bacillus cereus, Clostridium perfringens, Escherichia coli, Listeria monocytogenes and Staphylococcus aureus), a family (Enterobacteriaceae family), two genera (Salmonella spp. and Shigella spp.) and one strain (the enterohemorrhagic strains of Escherichia coli).
Como entiende el experto en la materia, una reacción de amplificación multiplex requiere una serie de reactivos, entre los que se incluyen, sin limitar a, el ADN molde, la enzima ADN polimerasa, al menos, dos parejas de cebadores (siendo cada cebador de cada pareja complementario a una de las dos hebras del ADN), desoxinucleótidos trifosfatos (dNTPs), cloruro de magnesio (MgCI2), buffer de reacción y aditivos opcionales, que pueden añadirse por separado mezclándose en el laboratorio o adquirir previamente mezclados, como es el caso de Qiagen ultiplex PCR Kit (Qiagen, Valencia, CA), al que se le añaden las parejas de cebadores en las concentraciones adecuadas y el ADN molde. La PCR se lleva a cabo en un termociclador que realiza los ciclos en los tiempos y temperaturas programadas de forma exacta, tales como la temperatura de hibridación, que depende de la temperatura de fusión de cada uno de los cebadores utilizados en la reacción o la temperatura de extensión. As the person skilled in the art understands, a multiplex amplification reaction requires a series of reagents, including, but not limited to, the template DNA, the enzyme DNA polymerase, at least two pairs of primers (each primer being each pair complementary to one of the two strands of the DNA), deoxynucleotide triphosphates (dNTPs), magnesium chloride (MgCI 2 ), reaction buffer and optional additives, which can be added separately by mixing in the laboratory or Purchase pre-mixed, as is the case of Qiagen ultiplex PCR Kit (Qiagen, Valencia, CA), to which the primer pairs are added in the appropriate concentrations and the template DNA. The PCR is carried out in a thermocycler that performs the cycles in the exact times and temperatures programmed, such as the hybridization temperature, which depends on the melting temperature of each of the primers used in the reaction or the temperature of extension.
Tras llevar a cabo la PCR multiplex de la etapa b), el método de la invención comprende la detección de los productos de amplificación [etapa c)], lo cual puede llevarse a cabo por cualquiera de los métodos descritos en el estado de la técnica. After carrying out the multiplex PCR of step b), the method of the invention comprises the detection of the amplification products [step c)], which can be carried out by any of the methods described in the state of the art .
Tras finalizar la reacción de amplificación multiplex, se puede proceder a separar los productos de amplificación o amplicones. Prácticamente cualquier método convencional empleado para separar los productos de amplificación puede ser utilizado dentro del marco de la presente invención. Las técnicas para separar los productos de amplificación están ampliamente descritas en el estado de la técnica. Técnicas para separar los productos de amplificación incluyen, sin limitar a, electroforesis sumergida con geles de Methafor, electroforesis en geles de poliacrilamida y electroforesis capilar. Seguidamente a la separación de los productos de amplificación, se procede a identificar el tamaño de los fragmentos separados, para lo cual puede emplearse cualquiera de los procedimientos de identificación de fragmentos de amplificación conocidos del estado de la técnica, tales como hibridación con sondas marcadas (por ejemplo con un fluoróforo) que serán detectadas por un detector y procesadas mediante un sistema informático, tinción, por ejemplo, con bromuro de etidio, tinción de plata, etc. Tal como entiende el experto en la materia, si todo este proceso es integrado en un sistema informático, se puede generar una gráfica denominada electroferograma donde puede identificarse el tamaño de los fragmentos amplificados. After completing the multiplex amplification reaction, the amplification products or amplicons can be separated. Virtually any conventional method used to separate the amplification products can be used within the framework of the present invention. Techniques for separating amplification products are widely described in the state of the art. Techniques for separating amplification products include, without limitation, submerged electrophoresis with Methafor gels, polyacrylamide gels electrophoresis and capillary electrophoresis. Following the separation of the amplification products, the size of the separated fragments is identified, for which any of the methods of identification of amplification fragments known in the state of the art can be used, such as hybridization with labeled probes ( for example with a fluorophore) which will be detected by a detector and processed by a computer system, staining, for example, with ethidium bromide, silver staining, etc. As the person skilled in the art understands, if this whole process is integrated into a computer system, a graph called electropherogram can be generated where the size of the amplified fragments can be identified.
Opcionalmente, si se desea, puede llevarse a cabo el mareaje de los cebadores que participan en dicha reacción de amplificación multiplex con el fin de poder detectar posteriormente los fragmentos amplificados. El mareaje de los productos de amplificación puede realizarse por métodos convencionales. Dicho mareaje puede ser directo, para lo cual pueden utilizarse fluoróforos, por ejemplo, Cy3, Cy5, fluoresceína, alexa, etc., enzimas, por ejemplo, fosfatasa alcalina, peroxidasa, etc., isótopos radiactivos, por ejemplo, P, Ί, etc., o cualquier otro marcador conocido por el experto en la materia. Alternativamente, dicho mareaje puede ser indirecto mediante el empleo de métodos químicos, enzimátícos, etc.; a modo ilustrativo, el producto de amplificación puede incorporar un miembro de un par de unión específica, por ejemplo, avidina o estreptavidina conjugada con un fluorocromo (patógeno), y la sonda se une al otro miembro del par de unión específica, por ejemplo, biotina (indicador), efectuándose la lectura mediante fluorimetría, etc., o bien, el producto de amplificación puede incorporar un miembro de un par de unión especifica, por ejemplo, un anticuerpo anti-digoxigenina conjugado con una enzima (locus), y la sonda se une al otro miembro del par de unión específica, por ejemplo, digoxigenina (indicador), etc., transformándose el sustrato de la enzima en un producto luminiscente o fluorescente y efectuándose la lectura mediante quimio-luminiscencia, fluorimetría, etc. Así, el mareaje del producto de amplificación se lleva a cabo mediante el mareaje, en uno de sus extremos, de uno de los oligonucleótidos de cada pareja de cebadores. El compuesto empleado en el mareaje de los oligonucleótidos se selecciona del grupo que consiste en un radioisótopo, un material fluorescente, digoxigenina y biotina. Ejemplos de materiales fluorescentes que se pueden emplear en el mareaje de oligonucleótidos incluyen, sin limitar a, 5-carboxifluoresceina (5- FAM), 6-FAM, análogo tetraclorinado de t-FAM (TET), análogo hexaclorinado de 6- FAM (HEX), 6-carboxitetrametilrodamina (TAMRA), 6-carboxi-X-rodamina (ROX), 6- carboxi-4',5'-d¡cloro-2',7'-dimetoxifluoresceína (JOE), NED, Cy-3, Cy-5, Cy-5.5, fluoresceina-6-isotiocinato (FITC) y tetrametilrodamina-5-isotiocinato (TRITC). Optionally, if desired, the mapping of the primers participating in said multiplex amplification reaction can be carried out in order to be able to subsequently detect the amplified fragments. The marking of amplification products can be carried out by conventional methods. Said marking can be direct, for which fluorophores can be used, for example, Cy3, Cy5, fluorescein, alexa, etc., enzymes, for example, alkaline phosphatase, peroxidase, etc., isotopes radioactive, for example, P, Ί, etc., or any other marker known to the person skilled in the art. Alternatively, said marking can be indirect through the use of chemical, enzymatic methods, etc .; by way of illustration, the amplification product may incorporate a member of a specific binding pair, for example, avidin or streptavidin conjugated with a fluorochrome (pathogen), and the probe binds to the other member of the specific binding pair, for example, biotin (indicator), the reading being carried out by fluorimetry, etc., or the amplification product may incorporate a member of a specific binding pair, for example, an anti-digoxigenin antibody conjugated to an enzyme (locus), and the The probe binds to the other member of the specific binding pair, for example, digoxigenin (indicator), etc., transforming the enzyme substrate into a luminescent or fluorescent product and reading by chemo-luminescence, fluorimetry, etc. Thus, the marking of the amplification product is carried out by marking, at one of its ends, one of the oligonucleotides of each pair of primers. The compound used in the oligonucleotide mapping is selected from the group consisting of a radioisotope, a fluorescent material, digoxigenin and biotin. Examples of fluorescent materials that can be used in oligonucleotide mapping include, but are not limited to, 5-carboxyfluorescein (5- FAM), 6-FAM, t-FAM tetrachlorinated analog (TET), 6- FAM hexachlorinated analog (HEX) ), 6-carboxytetramethylrodamine (TAMRA), 6-carboxy-X-rhodamine (ROX), 6- carboxy-4 ', 5'-dichloro-2', 7'-dimethoxyfluorescein (JOE), NED, Cy-3 , Cy-5, Cy-5.5, fluorescein-6-isothiocinate (FITC) and tetramethylrodamine-5-isothiocinate (TRITC).
Una vez identificados los microorganismos objeto del método de detección de la invención, puede ser deseable cuantificar algunos de ellos, es decir, conocer la cantidad de microorganismos presentes en el producto de partida de donde procede la muestra. A modo de ejemplo, la legislación europea permite en el caso de E. coli un máximo de 500 UFC/g de carne picada para consumo humano (unidades formadoras de colonia/g), siempre y cuando no se trate de cepas enterohemorrágicas, en cuyo caso el límite máximo permitido es 0 UFC/g. Once the microorganisms object of the detection method of the invention have been identified, it may be desirable to quantify some of them, that is, to know the amount of microorganisms present in the starting product from which the sample is derived. As an example, in the case of E. coli, European legislation allows a maximum of 500 CFU / g of minced meat for human consumption (colony-forming units / g), as long as they are not enterohemorrhagic strains, in which In case the maximum allowed limit is 0 CFU / g.
Como sabe el experto en la materia, para conseguir una cuantificación lo más precisa posible, ésta tendría que hacerse sobre la muestra tomada inicialmente, la cual ya ha sido empleada en el método de detección. Por este motivo, a la hora de poner en práctica el método de la invención y querer cuantificar algunos de los microorganismos detectados, es conveniente dividir en varias alícuotas la muestra tomada inicialmente ya homogenizada. De esta forma, una de las alícuotas es empleada en el método de detección y la otra (procedente de la misma muestra recolectada) será empleada en la cuantificación de los microorganismos detectados. Por lo tanto, en una realización particular, el método de la invención adicionalmente comprende, previamente a la etapa a), la homogeneización de la muestra y la posterior extracción de dos o más alícuotas de la muestra homogeneizada, en donde, una de las alícuotas es empleada en la etapa a) y la otra es empleada en caso de que se quiera cuantificar los microorganismos detectados previamente. Una vez que se tienen las alícuotas, una se emplea en la detección y la otra puede ser conservada o almacenada en caso de que sea necesario su posterior uso. As the person skilled in the art knows, in order to achieve as precise a quantification as possible, it would have to be done on the sample initially taken, which has already been used in the detection method. For this reason, when practicing the method of the invention and wanting to quantify some of the microorganisms detected, it is convenient to divide the sample into several aliquots. taken initially already homogenized. Thus, one of the aliquots is used in the detection method and the other (from the same sample collected) will be used in the quantification of the microorganisms detected. Therefore, in a particular embodiment, the method of the invention additionally comprises, prior to step a), the homogenization of the sample and the subsequent extraction of two or more aliquots from the homogenized sample, wherein, one of the aliquots It is used in stage a) and the other is used in case you want to quantify the microorganisms previously detected. Once the aliquots are present, one is used in the detection and the other can be preserved or stored in case its subsequent use is necessary.
Como sabe el experto en la materia, en el caso de productos alimentarios, hay determinados microorganismos que, aunque patógenos, pueden estar presentes en el alimento que va a destinarse al consumo humano o animal siempre y cuando la salud del individuo no se vea comprometida, lo cual viene determinado por el número de células de estos patógenos presentes en ese alimento. Entre estos microorganismos se incluyen, pero no se limitan a, B. cereus, C. perfringens, un microorganismo de la Familia Enterobacteriaceae, E. coli y/o S. aureus. Por lo tanto, si su presencia es detectada en la muestra tras aplicar el método de la invención, es deseable conocer la concentración del microorganismo/s detectado/s presente/s en la misma, por lo que tiene/n que ser cuantificado/s. La cuantificación puede realizarse por cualquiera de los métodos que existen en el estado de la técnica y que son empleados en los laboratorios de análisis microbiológicos de forma rutinaria. No obstante, en una realización particular, el método de cuantificación elegido es una PCR a Tiempo Real o PCR cuantitativa. Para ello, los inventores han diseñado parejas de cebadores y sondas dirigidos específicamente a B. cereus, C. perfringens, un microorganismo de la Familia Enterobacteriaceae, E. coli y/o S. aureus. Las parejas de cebadores y sondas dirigidos específicamente a estos microorganismos se describen en la Tablas 2 y 3. As the person skilled in the art knows, in the case of food products, there are certain microorganisms that, although pathogenic, may be present in the food that is intended for human or animal consumption as long as the individual's health is not compromised, which is determined by the number of cells of these pathogens present in that food. These microorganisms include, but are not limited to, B. cereus, C. perfringens, a microorganism of the Enterobacteriaceae Family, E. coli and / or S. aureus. Therefore, if its presence is detected in the sample after applying the method of the invention, it is desirable to know the concentration of the microorganism / s detected / s present in it, so it has to be quantified. . The quantification can be carried out by any of the methods that exist in the state of the art and are routinely used in microbiological analysis laboratories. However, in a particular embodiment, the quantification method chosen is a Real Time PCR or quantitative PCR. To this end, the inventors have designed pairs of primers and probes specifically aimed at B. cereus, C. perfringens, a microorganism of the Enterobacteriaceae Family, E. coli and / or S. aureus. The pairs of primers and probes specifically directed to these microorganisms are described in Tables 2 and 3.
Figure imgf000017_0001
Figure imgf000017_0001
Figure imgf000018_0001
Figure imgf000018_0001
Tabla 2: parejas de ce badores emplead os en la cuantificación de β. cereus, C. perfringens, un microorganismo de la Familia Enterobacteriaceae, E. coli y/o S. aureus
Figure imgf000018_0002
Table 2: primer pairs used in the quantification of β. cereus, C. perfringens, a microorganism of the Enterobacteriaceae Family, E. coli and / or S. aureus
Figure imgf000018_0002
Tabla 3: sondas empleadas en la cuantificación de B. cereus, C. perfringens, microorganismo de la Familia Enterobacteriaceae, E. coli y/o S. aureus. Así, en una realización particular del método de la invención, si B. cereus, C. perfringens, un microorganismo de la Familia Enterobacteriaceae, E. coli y/o S. aureus son detectados en la etapa c), entonces, el método comprende adicionalmente las siguientes etapas: Table 3: probes used in the quantification of B. cereus, C. perfringens, microorganism of the Enterobacteriaceae Family, E. coli and / or S. aureus. Thus, in a particular embodiment of the method of the invention, if B. cereus, C. perfringens, a microorganism of the Enterobacteriaceae Family, E. coli and / or S. aureus are detected in step c), then the method comprises additionally the following stages:
d) Aislar el ADN de una de las alícuotas obtenidas previamente a la etapa a), e) Llevar a cabo una PCR a Tiempo Real (qRTi-PCR) del ADN aislado en la etapa d) de dichos microorganismos con las siguientes parejas de cebadores y sondas:  d) Isolate the DNA of one of the aliquots obtained prior to stage a), e) Carry out a Real-Time PCR (qRTi-PCR) of the DNA isolated in stage d) of said microorganisms with the following primer pairs and probes:
La pareja de cebadores formada por el oligonucleótido que comprende la secuencia SEQ ID NO: 23 y el oligonucleótido que comprende la secuencia SEQ ID NO: 24, y la sonda que comprende la secuencia SEQ ID NO: 33 o The primer pair formed by the oligonucleotide comprising the sequence SEQ ID NO: 23 and the oligonucleotide comprising the sequence SEQ ID NO: 24, and the probe comprising the sequence SEQ ID NO: 33 or
SEQ ID NO: 34 si el microorganismo a detectar es B. cereus, SEQ ID NO: 34 if the microorganism to be detected is B. cereus,
- La pareja de cebadores formada por el oligonucleótido que comprende la secuencia SEQ ID NO: 25 y el oligonucleótido que comprende la secuencia SEQ ID NO: 26, y la sonda que comprende la secuencia SEQ ID NO: 35 si el microorganismo a detectar es C. perfringens,  - The pair of primers formed by the oligonucleotide comprising the sequence SEQ ID NO: 25 and the oligonucleotide comprising the sequence SEQ ID NO: 26, and the probe comprising the sequence SEQ ID NO: 35 if the microorganism to be detected is C perfringens,
- La pareja de cebadores formada por el oligonucleótido que comprende la secuencia SEQ ID NO: 27 y el oligonucleótido que comprende la secuencia SEQ ID NO: 28, y la sonda que comprende la secuencia SEQ ID NO: 36 si el microorganismo a detectar es de la familia Enterobacteriaceae,  - The pair of primers formed by the oligonucleotide comprising the sequence SEQ ID NO: 27 and the oligonucleotide comprising the sequence SEQ ID NO: 28, and the probe comprising the sequence SEQ ID NO: 36 if the microorganism to be detected is of the Enterobacteriaceae family,
- La pareja de cebadores formada por el oligonucleótido que comprende la secuencia SEQ ID NO: 29 y el oligonucleótido que comprende la secuencia SEQ ID NO: 30, y la sonda que comprende la secuencia SEQ ID NO: 37 si el microorganismo a detectar es E. coli, y/o  - The pair of primers formed by the oligonucleotide comprising the sequence SEQ ID NO: 29 and the oligonucleotide comprising the sequence SEQ ID NO: 30, and the probe comprising the sequence SEQ ID NO: 37 if the microorganism to be detected is E coli, and / or
La pareja de cebadores formada por el oligonucleótido que comprende la secuencia SEQ ID NO: 31 y el oligonucleótido que comprende la SEQ ID NO: The primer pair formed by the oligonucleotide comprising the sequence SEQ ID NO: 31 and the oligonucleotide comprising SEQ ID NO:
32, y la sonda que comprende la secuencia SEQ ID NO: 38 si el microorganismo a detectar es S. aureus, y 32, and the probe comprising the sequence SEQ ID NO: 38 if the microorganism to be detected is S. aureus, and
f) cuantificar los productos amplificados en la etapa e). Con la finalidad de que la qRTi-PCR sea lo más fiable posible, los inventores han diseñado sondas que permiten detectar el control interno de la amplificación o IAC (del inglés, Interna! Amplification Control) con el fin de validar la precisión de la qRTi-PCR, permitiendo distinguir resultados negativos verdaderos de falsos negativos causados por un mal funcionamiento de la PCR (debido a inhibiciones, deterioro de los reactivos de PCR, etc.). Los inventores han diseñado un IAC de tipo quimérico que posee una secuencia de ADN heterólogo a todos los microorganismos de estudio y que consiste en una zona interna al gen que codifica la enzima cinnamoil-CoA-reductasa de Eucalyptus globulus. Flanqueando esta región de ADN heterólogo se han añadido las secuencias correspondientes a los sitios de hibridación de las cinco parejas de cebadores diseñados para la amplificación por qRTi-PCR de los cinco patógenos a cuantificar. Dicho IAC consiste en la amplificación independiente de una secuencia de ADN artificial que es co-amplificada con el ADN diana del patógeno durante la PCR. El IAC está incorporado a la mezcla de reacción a una concentración cuidadosamente ajustada, de modo que la especificidad y sensibilidad del test no resultan afectadas por la amplificación competitiva de ambos ADNs. Así pues, la señal de amplificación del IAC puede desaparecer en muestras positivas con un alto contenido de ADN del patógeno. No obstante, la señal del IAC debe detectarse siempre en las muestras negativas (ausencia del patógeno). Si no se obtiene señal del IAC ni del patógeno, deberá aclararse la causa del mal funcionamiento de la reacción de PCR, verificando la integridad de los reactivos de PCR o aplicando soluciones alternativas para eliminar los problemas de inhibición. f) quantify the amplified products in step e). In order to make the qRTi-PCR as reliable as possible, the inventors have designed probes that allow to detect the internal control of the amplification or IAC (English, Internal! Amplification Control) in order to validate the accuracy of the qRTi -PCR, allowing to distinguish true negative results from false negatives caused by a malfunction of the PCR (due to inhibitions, deterioration of the PCR reagents, etc.). The inventors have designed a chimeric type IAC that has a heterologous DNA sequence to all study microorganisms and that consists in a zone internal to the gene that encodes the enzyme cinnamoyl-CoA reductase from Eucalyptus globulus. By flanking this region of heterologous DNA, the corresponding sequences have been added to the hybridization sites of the five primer pairs designed for the qRTi-PCR amplification of the five pathogens to be quantified. Said IAC consists in the independent amplification of an artificial DNA sequence that is co-amplified with the pathogen's target DNA during PCR. The IAC is incorporated into the reaction mixture at a carefully adjusted concentration, so that the specificity and sensitivity of the test are not affected by the competitive amplification of both DNAs. Thus, the IAC amplification signal may disappear in positive samples with a high DNA content of the pathogen. However, the IAC signal must always be detected in negative samples (absence of the pathogen). If no signal is obtained from the IAC or the pathogen, the cause of the PCR reaction malfunction must be clarified, verifying the integrity of the PCR reagents or applying alternative solutions to eliminate inhibition problems.
Por lo tanto, en una realización particular del método de la invención, la qRTi-PCR comprende al menos una sonda para el control interno de amplificación seleccionada de la lista que consiste en: Therefore, in a particular embodiment of the method of the invention, the qRTi-PCR comprises at least one probe for internal amplification control selected from the list consisting of:
- La sonda de ácido nucleico que comprende el oligonucleótido SEQ ID NO: 39 en el caso de que el microorganismo cuantificado sea E. coli, un microorganismo de la Familia Enterobacteriaceae o S. aureus,  - The nucleic acid probe comprising oligonucleotide SEQ ID NO: 39 in the event that the quantified microorganism is E. coli, a microorganism of the Enterobacteriaceae or S. aureus family,
- La sonda de ácido nucleico que comprende el oligonucleótido SEQ ID NO: 41 en caso de que el microorganismo cuantificado sea C. perfringens o E.coli, y - La sonda de ácido nucleico que comprende el oligonucleótido SEQ ID NO: 40 en caso de que el microorganismo cuantificado sea B. cereus, C. perfringens, E. coli, un microorganismo de la Familia Enterobacteriaceae o S. aureus.  - The nucleic acid probe comprising oligonucleotide SEQ ID NO: 41 in case the quantified microorganism is C. perfringens or E.coli, and - The nucleic acid probe comprising oligonucleotide SEQ ID NO: 40 in case of that the quantified microorganism is B. cereus, C. perfringens, E. coli, a microorganism of the Enterobacteriaceae Family or S. aureus.
En una realización particular, las sondas empleadas en el método de la invención están marcadas en uno de sus extremos que, en otra realización todavía más particular, el compuesto con el que se lleva a cabo el mareaje es un fluoróforo. Ejemplos de fluoróforos que se pueden emplear en el mareaje de las sondas incluyen, sin limitar a, 5-carboxifluoresceína (5-FAM), 6-FAM, análogo tetraclorinado de t-FA (TET), análogo hexaclorinado de 6-FAM (HEX), 6-carboxitetrametilrodamina (TAMRA), 6-carboxi-X-rodamina (ROX), 6-carboxi-4',5'-dicloro-2',7'- dimetoxifluoresceina (JOE), NED, Cy-3 , Cy-5, Cy-5.5, fluoresceina-6-isotiocinato (FITC) y tetrametilrodamina-5-isotiocinato (TRITC). In a particular embodiment, the probes employed in the method of the invention are marked at one of their ends that, in another even more particular embodiment, the compound with which the marking is carried out is a fluorophore. Examples of fluorophores that can be employed in probe mapping include, but are not limited to, 5-carboxyfluorescein (5-FAM), 6-FAM, tetrachlorinated t-FA analog (TET), 6-FAM hexachlorinated analog (HEX) ), 6-carboxytetramethylrodamine (TAMRA), 6-carboxy-X-rhodamine (ROX), 6-carboxy-4 ', 5'-dichloro-2', 7'- dimethoxyfluorescein (JOE), NED, Cy-3, Cy-5, Cy-5.5, fluorescein-6-isothiocinate (FITC) and tetramethylrodamine-5-isothiocinate (TRITC).
Finalmente, tras llevar a cabo la reacción de qRTi-PCR, se procede a la cuantificación de los productos amplificados. Finally, after carrying out the qRTi-PCR reaction, the amplified products are quantified.
Tal como se ha explicado previamente a lo largo de la descripción, el método de la invención comprende la detección de microorganismos patógenos mediante una PCR multiplex. Sin embargo, si los microorganismos están una concentración muy baja en la muestra, es posible que estos no sean detectados. Para evitar esta posibilidad y asegurar que, por muy baja que sea la concentración de los microorganismos en la muestra, estos van a ser detectados, es aconsejable incubar previamente la muestra en un medio de enriquecimiento. Por lo tanto, en una realización particular, previamente a la etapa a), el método de la invención comprende el cultivo de la muestra en un medio de enriquecimiento. As previously explained throughout the description, the method of the invention comprises the detection of pathogenic microorganisms by multiplex PCR. However, if microorganisms are very low in the sample, they may not be detected. To avoid this possibility and ensure that, no matter how low the concentration of the microorganisms in the sample, these are going to be detected, it is advisable to previously incubate the sample in an enrichment medium. Therefore, in a particular embodiment, prior to step a), the method of the invention comprises culturing the sample in an enrichment medium.
Alternativamente, si además de detectar los microorganismos presentes en la muestra se deseara cuantificar los mismos en caso de que sean detectados, entonces tal como se ha explicado previamente, la muestra es homogeneizada y dividida en dos o más alícuotas, en donde solo la alícuota empleada en la etapa a) del método es cultivada en un medio de enriquecimiento, mientras que el resto de alícuotas serán empleadas en la cuantificación posterior. Por lo tanto, en otra realización particular, la alícuota empleada en la etapa a) es cultivada en un medio de enriquecimiento. El tiempo de incubación varía en función de los microorganismos que vayan a ser detectados (por ejemplo, entre 16 y 48 horas para C. jejuni, y entre 16 y 24 horas para C. sakazakii, una cepa enterohemorrágica de E. coli, L. monocytogenes, Salmonete spp. y Shigella spp.), y su elección es práctica de rutina para el experto en la materia. Por lo tanto, en una realización particular, el tiempo de incubación de la muestra en el medio de cultivo de enriquecimiento es entre 16 y 48 horas, preferiblemente entre 16 y 24 horas. Alternatively, if, in addition to detecting the microorganisms present in the sample, it is desired to quantify them if they are detected, then as explained previously, the sample is homogenized and divided into two or more aliquots, where only the aliquot used in step a) of the method it is cultivated in an enrichment medium, while the rest of aliquots will be used in the subsequent quantification. Therefore, in another particular embodiment, the aliquot employed in step a) is grown in an enrichment medium. The incubation time varies depending on the microorganisms to be detected (for example, between 16 and 48 hours for C. jejuni, and between 16 and 24 hours for C. sakazakii, an enterohemorrhagic strain of E. coli, L. monocytogenes, Salmonete spp. and Shigella spp.), and their choice is routine practice for the person skilled in the art. Therefore, in a particular embodiment, the incubation time of the sample in the enrichment culture medium is between 16 and 48 hours, preferably between 16 and 24 hours.
Como sabe el experto en la materia, a la hora de elegir el cultivo de enriquecimiento éste debe cubrir las necesidades específicas del microorganismo/s que va/n a ser cultivado/s para que se produzca el crecimiento del mismo/los mismos. Así, dependiendo del microorganismo/s que vaya/n a ser detectado/s, el medio de enriquecimiento a emplear será uno u otro. Cultivos de enriquecimiento adecuados para el crecimiento de los microorganismos que son detectados mediante el método de la invención están disponibles comercialmente. No obstante, el medio de enriquecimiento también puede prepararse en el laboratorio, en cuyo caso los ingredientes a incluir en el medio también están disponibles comercialmente, y los requisitos nutricionales de los microorganismos están descritos en el estado de la técnica. Partiendo de esta información, se puede elaborar un medio de enriquecimiento adecuado para el/los microorganismo/s detectados. Así, en una realización particular, el medio de cultivo de enriquecimiento comprende Agua de Peptona Tamponada, Sangre de Caballo Desfibrinada y Hemolisada, Manitol y Suplemento de Crecimiento de Campyiobacter. Este medio de enriquecimiento es adecuado para la incubación simultánea de todos los microorganismos detectados mediante el empleo del método de la invención. En una realización particular, el medio de enriquecimiento comprende As the person skilled in the art knows, when choosing the enrichment culture, it must cover the specific needs of the microorganism / s that will be cultivated so that the growth of the same occurs. Thus, depending on the microorganism / s to be detected, the enrichment medium to be used will be one or the other. Enrichment cultures suitable for the growth of microorganisms that are detected by the method of the invention are commercially available. However, the enrichment medium can also be prepared in the laboratory, in which case the ingredients to be included in the medium are also commercially available, and the nutritional requirements of the microorganisms are described in the prior art. Based on this information, a suitable enrichment medium can be developed for the microorganism / s detected. Thus, in a particular embodiment, the enrichment culture medium comprises Buffered Peptone Water, Defibrinated and Hemolyzed Horse Blood, Mannitol and Campyiobacter Growth Supplement. This enrichment medium is suitable for simultaneous incubation of all microorganisms detected by using the method of the invention. In a particular embodiment, the enrichment medium comprises
- entre 5-100 ml_ de sangre de caballo desfibrinada y hemolisada por cada 500 mL de medio,  - between 5-100 ml_ of defibrinated and hemolysed horse blood per 500 mL of medium,
- entre 2,5-80 g de manitol por cada 500 mL de medio, y/o  - between 2.5-80 g of mannitol per 500 mL of medium, and / or
- entre 1-8 mL de suplemento de crecimiento de Campyiobacter por cada 500 mL de medio.  - between 1-8 mL of Campyiobacter growth supplement per 500 mL of medium.
Conjunto de parejas de cebadores de la invención Set of primer pairs of the invention
Los inventores han desarrollado un método para la detección simultánea de microorganismos patógenos alimentarios basado en un conjunto de parejas de cebadores diseñados específicamente para detectar de forma simultánea hasta 1 1 tipos de microorganismos patógenos mediante una PCR multiplex. The inventors have developed a method for the simultaneous detection of foodborne pathogenic microorganisms based on a set of primer pairs specifically designed to simultaneously detect up to 1 1 types of pathogenic microorganisms by multiplex PCR.
Por lo tanto, en un segundo aspecto, la invención se relaciona con un conjunto de parejas de cebadores, de aquí en adelante "conjunto de parejas de cebadores de la invención", que comprende Therefore, in a second aspect, the invention relates to a set of primer pairs, hereinafter "set of primer pairs of the invention", which comprises
- La pareja de cebadores formada por el oligonucleótido que comprende la secuencia SEQ ID NO: 3 y el oligonucleótido que comprende la secuencia SEQ - The pair of primers formed by the oligonucleotide comprising the sequence SEQ ID NO: 3 and the oligonucleotide comprising the sequence SEQ
ID NO: 4 diseñados para amplificar C. jejuni, ID NO: 4 designed to amplify C. jejuni,
- La pareja de cebadores formada por el oligonucleótido que comprende la secuencia SEQ ID NO: 7 y el oligonucleótido que comprende la secuencia SEQ ID NO: 8 diseñados para amplificar C. sakazakii, La pareja de cebadores formada por el oligonucleótido que comprende la secuencia SEQ ID NO: 11 y el oligonucleótido que comprende la secuencia SEQ ID NO: 12 diseñados para amplificar una cepa enterohemorrágica de E. coli, La pareja de cebadores formada por el oligonucleótido que comprende la secuencia SEQ ID NO: 15 y el oligonucleótido que comprende la secuencia SEQ- The pair of primers formed by the oligonucleotide comprising the sequence SEQ ID NO: 7 and the oligonucleotide comprising the sequence SEQ ID NO: 8 designed to amplify C. sakazakii, The primer pair formed by the oligonucleotide comprising the sequence SEQ ID NO: 11 and the oligonucleotide comprising the sequence SEQ ID NO: 12 designed to amplify an enterohemorrhagic strain of E. coli, The primer pair formed by the oligonucleotide comprising the sequence SEQ ID NO: 15 and the oligonucleotide comprising the sequence SEQ
ID NO: 16 diseñados para amplificar L. monocytogenes, ID NO: 16 designed to amplify L. monocytogenes,
- La pareja de cebadores formada por el oligonucleótido que comprende la secuencia SEQ ID NO: 17 y el oligonucleótido que comprende la secuencia SEQ ID NO: 18 diseñados para amplificar Salmonella spp.,  - The pair of primers formed by the oligonucleotide comprising the sequence SEQ ID NO: 17 and the oligonucleotide comprising the sequence SEQ ID NO: 18 designed to amplify Salmonella spp.,
- La pareja de cebadores formada por el oligonucleótido que comprende la secuencia SEQ ID NO: 19 y el oligonucleótido que comprende la secuencia SEQ ID NO: 20 diseñados para amplificar Shigella spp., y  - The pair of primers formed by the oligonucleotide comprising the sequence SEQ ID NO: 19 and the oligonucleotide comprising the sequence SEQ ID NO: 20 designed to amplify Shigella spp., And
En una realización particular, la cepa hemorrágica de E. coli es E. coli 0157:1-17, la especie de Salmonella spp. es Salmonella entérica y/o la especie de Shigella spp. es Shigella dysenteriae. In a particular embodiment, the hemorrhagic strain of E. coli is E. coli 0157: 1-17, the species of Salmonella spp. It is enteric Salmonella and / or the species of Shigella spp. It's Shigella dysenteriae.
Adicionalmente, las parejas de cebadores que forman parte del conjunto de parejas de cebadores de la invención han sido diseñadas para que, si se desea, puedan emplearse simultáneamente con una o más parejas de cebadores dirigidas a otros microorganismos de interés, como son, C. períríngens, un microorganismo de la familia Enterobacteriaceae, E. coli, S. aureus o B. cereus. Additionally, the primer pairs that are part of the set of primer pairs of the invention have been designed so that, if desired, they can be used simultaneously with one or more primer pairs directed to other microorganisms of interest, such as, C. períríngens, a microorganism of the family Enterobacteriaceae, E. coli, S. aureus or B. cereus.
Por lo tanto, en una realización particular, el conjunto de parejas de cebadores de la invención comprende, además, 1 , preferiblemente 2, 3, 4 ó 5 de las parejas de cebadores seleccionadas de la lista que consiste en: Therefore, in a particular embodiment, the set of primer pairs of the invention further comprises 1, preferably 2, 3, 4 or 5 of the primer pairs selected from the list consisting of:
La pareja de cebadores formada por el oligonucleótido que comprende la secuencia SEQ ID NO: 5 y el oligonucleótido que comprende la secuencia SEQ ID NO: 6 diseñados para amplificar C. períríngens,  The primer pair formed by the oligonucleotide comprising the sequence SEQ ID NO: 5 and the oligonucleotide comprising the sequence SEQ ID NO: 6 designed to amplify C. períríngens,
- La pareja de cebadores formada por el oligonucleótido que comprende la secuencia SEQ ID NO: 13 y el oligonucleótido que comprende la secuencia SEQ ID NO: 14 diseñados para amplificar la familia Enterobacteriaceae,  - The pair of primers formed by the oligonucleotide comprising the sequence SEQ ID NO: 13 and the oligonucleotide comprising the sequence SEQ ID NO: 14 designed to amplify the Enterobacteriaceae family,
- La pareja de cebadores formada por el oligonucleótido que comprende la secuencia SEQ ID NO: 9 y el oligonucleótido que comprende la secuencia SEQ ID NO: 10 diseñados para amplificar E. coli, - La pareja de cebadores formada por el oligonucleótido que comprende la secuencia SEQ ID NO: 21 y el oligonucleótido que comprende la secuencia SEQ ID NO: 22 diseñada para amplificar S. aureus, y - The pair of primers formed by the oligonucleotide comprising the sequence SEQ ID NO: 9 and the oligonucleotide comprising the sequence SEQ ID NO: 10 designed to amplify E. coli, - The pair of primers formed by the oligonucleotide comprising the sequence SEQ ID NO: 21 and the oligonucleotide comprising the sequence SEQ ID NO: 22 designed to amplify S. aureus, and
- La pareja de cebadores formada por el oligonucleótido que comprende la secuencia SEQ ID NO: 1 y el oligonucleótido que comprende la secuencia SEQ - The pair of primers formed by the oligonucleotide comprising the sequence SEQ ID NO: 1 and the oligonucleotide comprising the sequence SEQ
ID NO: 2 diseñados para amplificar B. cereus. ID NO: 2 designed to amplify B. cereus.
En total, el conjunto de parejas de cebadores de la invención permite la detección simultánea de 1 1 tipos de microorganismos entre los que se encuentran Campylobacter jejuni, Cronobacter sakazakii, una cepa enterohemorrágica de Escherichia coli, Listeria monocytogenes, Salmonella spp., Shigella spp., Bacillus cereus, Clostridium perfringens, un microorganismo de la familia Enterobacteríaceae, Escherichia coli y Staphylococcus aureus. Por otro lado, de todos los microorganismos detectados mediante el conjunto de parejas de cebadores de la invención, puede ser deseable cuantificar algunos de ellos, es decir, conocer la cantidad de microorganismos presentes en el producto de partida de donde procede la muestra. Este es el caso de Bacillus cereus, Clostridium perfringens, un microorganismo de la familia Enterobacteríaceae, Escherichia coli y Staphylococcus aureus. En el caso de productos alimentarios, la presencia de una determinada cantidad (concentración) de estos microorganismos en el producto de partida puede ser determinante para decidir si dicho producto es adecuado para el consumo humano. Por este motivo, adicionalmente los inventores han diseñado unas parejas de cebadores y sondas que permiten la cuantificación de estos microorganismos. Por lo tanto, en otra realización todavía más particular, el conjunto de parejas de cebadores según la invención comprende, además, al menos 1 , preferiblemente 2, 3, 4 o 5, de las parejas de cebadores y sondas seleccionadas del grupo que consiste en: In total, the set of primer pairs of the invention allows simultaneous detection of 1 1 types of microorganisms among which are Campylobacter jejuni, Cronobacter sakazakii, an enterohemorrhagic strain of Escherichia coli, Listeria monocytogenes, Salmonella spp., Shigella spp. , Bacillus cereus, Clostridium perfringens, a microorganism of the family Enterobacteríaceae, Escherichia coli and Staphylococcus aureus. On the other hand, of all the microorganisms detected by the set of primer pairs of the invention, it may be desirable to quantify some of them, that is, to know the amount of microorganisms present in the starting product from which the sample is derived. This is the case of Bacillus cereus, Clostridium perfringens, a microorganism of the Enterobacteriaceae family, Escherichia coli and Staphylococcus aureus. In the case of food products, the presence of a certain amount (concentration) of these microorganisms in the starting product can be decisive in deciding whether said product is suitable for human consumption. For this reason, the inventors have also designed pairs of primers and probes that allow the quantification of these microorganisms. Therefore, in a still more particular embodiment, the set of primer pairs according to the invention further comprises at least 1, preferably 2, 3, 4 or 5, of the primer pairs and probes selected from the group consisting of :
- La pareja de cebadores formada por el oligonucleótido que comprende la secuencia SEQ ID NO: 23 y el oligonucleótido que comprende la secuencia SEQ ID NO: 24, y la sonda que comprende la secuencia SEQ ID NO: 33 o SEQ ID NO: 34 si el microorganismo a detectar es B. cereus,  - The pair of primers formed by the oligonucleotide comprising the sequence SEQ ID NO: 23 and the oligonucleotide comprising the sequence SEQ ID NO: 24, and the probe comprising the sequence SEQ ID NO: 33 or SEQ ID NO: 34 si The microorganism to be detected is B. cereus,
- La pareja de cebadores formada por el oligonucleótido que comprende la secuencia SEQ ID NO: 25 y el oligonucleótido que comprende la secuencia SEQ ID NO: 26, y la sonda que comprende la secuencia SEQ ID NO: 35 si el microorganismo a detectar es C. perfringens, - The pair of primers formed by the oligonucleotide comprising the sequence SEQ ID NO: 25 and the oligonucleotide comprising the sequence SEQ ID NO: 26, and the probe comprising the sequence SEQ ID NO: 35 if the microorganism to be detected is C. perfringens,
- La pareja de cebadores formada por el oligonucleótido que comprende la secuencia SEQ ID NO: 27 y el oligonucleótido que comprende la secuencia SEQ ID NO: 28, y la sonda que comprende la secuencia SEQ ID NO: 36 si el microorganismo a detectar es de la familia Enterobacteriaceae,  - The pair of primers formed by the oligonucleotide comprising the sequence SEQ ID NO: 27 and the oligonucleotide comprising the sequence SEQ ID NO: 28, and the probe comprising the sequence SEQ ID NO: 36 if the microorganism to be detected is of the Enterobacteriaceae family,
La pareja de cebadores formada por el oligonucleótido que comprende la secuencia SEQ ID NO: 29 y el oligonucleótido que comprende la secuencia SEQ ID NO: 30, y la sonda que comprende la secuencia SEQ ID NO: 37 si el microorganismo a detectar es E. coli, y  The primer pair formed by the oligonucleotide comprising the sequence SEQ ID NO: 29 and the oligonucleotide comprising the sequence SEQ ID NO: 30, and the probe comprising the sequence SEQ ID NO: 37 if the microorganism to be detected is E. coli, and
- La pareja de cebadores formada por el oligonucleótido que comprende la secuencia SEQ ID NO: 31 y el oligonucleótido que comprende la SEQ ID NO: 32, y la sonda que comprende la secuencia SEQ ID NO: 38 si el microorganismo a detectar es S. aureus.  - The pair of primers formed by the oligonucleotide comprising the sequence SEQ ID NO: 31 and the oligonucleotide comprising SEQ ID NO: 32, and the probe comprising the sequence SEQ ID NO: 38 if the microorganism to be detected is S. aureus
La técnica de elección para llevar a cabo la cuantificación de Bacillus cereus, Clostridium perfringens, un microorganismo de la familia Enterobacteriaceae, Escheríchia coli Staphylococcus aureus es la PCR cuantitativa o a Tiempo Real. Por lo tanto, en una realización particular, las sondas están marcadas en uno de sus extremos que, en otra realización todavía más particular, están marcadas con un fluoróforo. Ejemplos de compuestos que pueden ser empleados como marcadores de las sondas han sido descritos previamente en el método de la invención. En otra realización particular, el conjunto de cebadores de la invención comprende, además de las parejas de cebadores y sondas SEQ ID NO: 1 a 38, al menos un control de amplificación interna de la PCR cuantitativa seleccionado del grupo que consiste en las secuencias SEQ ID NO: 40, SEQ ID NO: 41 y SEQ ID NO. 42.. The technique of choice to carry out the quantification of Bacillus cereus, Clostridium perfringens, a microorganism of the Enterobacteriaceae family, Escheríchia coli Staphylococcus aureus is quantitative or Real Time PCR. Therefore, in a particular embodiment, the probes are marked at one of their ends which, in another even more particular embodiment, are labeled with a fluorophore. Examples of compounds that can be used as probes markers have been previously described in the method of the invention. In another particular embodiment, the set of primers of the invention comprises, in addition to the primer pairs and probes SEQ ID NO: 1 to 38, at least one internal amplification control of the quantitative PCR selected from the group consisting of the SEQ sequences ID NO: 40, SEQ ID NO: 41 and SEQ ID NO. 42 ..
Uso del conjunto de parejas de la invención Los inventores han desarrollado un método para la detección simultánea de microorganismos patógenos alimentarios basado en un conjunto de parejas de cebadores diseñados específicamente para detectar de forma simultánea hasta 1 1 tipos de microorganismos patógenos mediante una PCR multiplex. Por lo tanto, en un tercer aspecto, la invención se relaciona con el uso in vitro del conjunto de parejas de cebadores de la invención para la detección simultánea de C. jejuni, C. sakazakii, una cepa enterohemorrágica de E. coli, L. monocytogenes, Salmonella spp. y Shigella spp. En una realización particular, la cepa hemorrágica de E. co//' es £. coli 0157:H7, la especie de Salmonella spp. es Salmonella entérica y/o la especie de Shigella spp. es Shigella dysenteriae. Use of the set of partners of the invention The inventors have developed a method for the simultaneous detection of foodborne pathogenic microorganisms based on a set of primer pairs specifically designed to simultaneously detect up to 1 1 types of pathogenic microorganisms by multiplex PCR. Therefore, in a third aspect, the invention relates to the in vitro use of the set of primer pairs of the invention for the simultaneous detection of C. jejuni, C. sakazakii, an enterohemorrhagic strain of E. coli, L. monocytogenes, Salmonella spp. and Shigella spp. In a particular embodiment, the hemorrhagic strain of E. co // ' is £. coli 0157: H7, the species of Salmonella spp. It is enteric Salmonella and / or the species of Shigella spp. It's Shigella dysenteriae.
Tal como se ha explicado en el segundo aspecto inventivo, el conjunto de parejas de cebadores de la invención puede comprender, además, parejas de cebadores dirigidos a detectar β. cereus, C. períringens, un microorganismo de la familia Enterobacteríaceae, E. coli y lo S. aureus. As explained in the second inventive aspect, the set of primer pairs of the invention can also comprise pairs of primers aimed at detecting β. cereus, C. períringens, a microorganism of the family Enterobacteríaceae, E. coli and S. aureus.
Por lo tanto, en otra realización particular, la invención se relaciona con el uso del conjunto de parejas de cebadores de la invención para la detección simultánea de C. jejuni, C. sakazakii, una cepa enterohemorrágica de £. coli, L. monocytogenes, Salmonella spp. y Shigella spp y al menos 1 , preferiblemente 2, 3, 4 o 5 de los microorganismos seleccionados de la lista que consiste en B. cereus, C. períringens, un microorganismo de la familia Enterobacteríaceae, E. coli y S. aureus. Therefore, in another particular embodiment, the invention relates to the use of the set of primer pairs of the invention for the simultaneous detection of C. jejuni, C. sakazakii, an enterohemorrhagic strain of £. coli, L. monocytogenes, Salmonella spp. and Shigella spp and at least 1, preferably 2, 3, 4 or 5 of the microorganisms selected from the list consisting of B. cereus, C. períringens, a microorganism of the Enterobacteriaceae family, E. coli and S. aureus.
La forma en que el conjunto de parejas de cebadores de la invención puede emplearse en la detección de simultánea de C. jejuni, C. sakazakii, una cepa enterohemorrágica de E. coli, L. monocytogenes, Salmonella spp. y Shigella spp y al menos 1 , preferiblemente 2, 3, 4 o 5 de los microorganismos seleccionados de la lista que consiste en B. cereus, C. períringens, un microorganismo de la familia Enterobacteríaceae, E. coli y S. aureus, ha sido explicada en detalle en el primer aspecto inventivo. The way in which the set of primer pairs of the invention can be used in the simultaneous detection of C. jejuni, C. sakazakii, an enterohemorrhagic strain of E. coli, L. monocytogenes, Salmonella spp. and Shigella spp and at least 1, preferably 2, 3, 4 or 5 of the microorganisms selected from the list consisting of B. cereus, C. períringens, a microorganism of the Enterobacteriaceae family, E. coli and S. aureus, has been explained in detail in the first inventive aspect.
Kit de la invención Invention kit
Por otro lado, la invención se relaciona con un kit útil para la puesta en práctica del método de la invención, que comprende el conjunto de parejas de cebadores de la invención. On the other hand, the invention relates to a kit useful for the implementation of the method of the invention, which comprises the set of primer pairs of the invention.
Así, en un cuarto aspecto, la invención se relaciona con un kit que comprende el conjunto de parejas de cebadores de la invención. Como entiende el experto en la materia, el kit de la invención además de comprender el conjunto de parejas de cebadores de la invención, puede incluir, opcionalmente, los reactivos necesarios para llevar a cabo una reacción de amplificación multiplex, entre los que se incluyen, sin limitar a, desoxinucleótidos trifosfato (dNTPs), iones divalentes y/o monovalentes, una solución tampón (buffer) que mantiene el pH adecuado para el funcionamiento de la ADN polimerasa, ADN polimerasa o mezcla de distintas polimerasas, etc. No obstante, si el kit de la invención no comprende los reactivos necesarios para poner en práctica el método de la invención, estos están disponibles comercialmente y pueden encontrarse formando parte de un kit. Cualquier kit de los disponibles comercialmente que contenga los reactivos necesarios para llevar a cabo una reacción de amplificación, puede emplearse con éxito en la puesta en práctica del método de la invención. Thus, in a fourth aspect, the invention relates to a kit comprising the set of primer pairs of the invention. As the person skilled in the art understands, the kit of the invention, in addition to comprising the set of primer pairs of the invention, may optionally include the reagents necessary to carry out a multiplex amplification reaction, including, without limiting to, deoxynucleotides triphosphate (dNTPs), divalent and / or monovalent ions, a buffer solution (buffer) that maintains the proper pH for the functioning of DNA polymerase, DNA polymerase or mixture of different polymerases, etc. However, if the kit of the invention does not comprise the reagents necessary to practice the method of the invention, these are commercially available and can be found as part of a kit. Any commercially available kit containing the reagents necessary to carry out an amplification reaction can be used successfully in the practice of the method of the invention.
Por otro lado, el kit de la invención puede comprender las parejas de cebadores de la invención ya marcados, o los reactivos necesarios para llevar a cabo el mareaje de los mismos. Los distintos métodos que existen en el estado de la técnica para realizar el mareaje de los cebadores, así como los tipos de compuestos que se pueden emplear en dicho mareaje han sido explicados previamente en la presente memoria. Asimismo, el kit de la invención también es útil en la puesta en práctica del método de invención. Por lo tanto, en un sexto aspecto, la invención se relaciona con el uso del kit de la invención para la detección simultánea de C. jejuni, C. sakazakii, una cepa enterohemorrágica de E. coli, L. monocytogenes, Salmonella spp. y Shigella spp. En una realización particular, la cepa hemorrágica de E. coli es E. coli 0157:H7, la especie de Salmonella spp. es Salmonella entérica y/o la especie de Shigella spp. es Shigella dysenteríae. On the other hand, the kit of the invention can comprise the pairs of primers of the invention already marked, or the reagents necessary to carry out the marking thereof. The different methods that exist in the state of the art to perform the mareaje of the primers, as well as the types of compounds that can be used in said mareaje have been explained previously here. Likewise, the kit of the invention is also useful in the implementation of the method of invention. Therefore, in a sixth aspect, the invention relates to the use of the kit of the invention for the simultaneous detection of C. jejuni, C. sakazakii, an enterohemorrhagic strain of E. coli, L. monocytogenes, Salmonella spp. and Shigella spp. In a particular embodiment, the hemorrhagic strain of E. coli is E. coli 0157: H7, the species of Salmonella spp. It is enteric Salmonella and / or the species of Shigella spp. It's Shigella dysenteríae.
En otra realización particular, la invención se relaciona con el uso del kit de la invención para la detección simultánea de C. jejuni, C. sakazakii, una cepa enterohemorrágica de E. coli, L monocytogenes, Salmonella spp. y Shigella spp y al menos 1 , preferiblemente 2, 3, 4 o 5 de los microorganismos seleccionados de la lista que consiste en B. cereus, C. perfringens, un microorganismo de la familia Enterobacteriaceae, E. coli y S. aureus. A lo largo de la descripción y las reivindicaciones la palabra "comprende" y sus variantes no pretenden excluir otras características técnicas, aditivos, componentes o pasos. Para los expertos en la materia, otros objetos, ventajas y características de la invención se desprenderán en parte de la descripción y en parte de la práctica de la invención. Los siguientes ejemplos y figuras simplemente ilustran la presente invención y no pretender ser limitativos de la misma. In another particular embodiment, the invention relates to the use of the kit of the invention for the simultaneous detection of C. jejuni, C. sakazakii, an enterohemorrhagic strain of E. coli, L monocytogenes, Salmonella spp. and Shigella spp and at least 1, preferably 2, 3, 4 or 5 of the microorganisms selected from the list consisting of B. cereus, C. perfringens, a microorganism of the Enterobacteriaceae family, E. coli and S. aureus. Throughout the description and claims the word "comprises" and its variants are not intended to exclude other technical characteristics, additives, components or Steps. For those skilled in the art, other objects, advantages and features of the invention will be derived partly from the description and partly from the practice of the invention. The following examples and figures simply illustrate the present invention and are not intended to be limiting thereof.
BREVE DESCRIPCIÓN DE LAS FIGURAS BRIEF DESCRIPTION OF THE FIGURES
Figura 1. Gel de agarosa. Optimización de cebadores GVR-BC-Mpx-up/rp, sobre ADN de B. cereus CECT 131 , con cinco series de temperatura (Tm) y 16 combinaciones de concentración de cebadores. Figure 1. Agarose gel. Optimization of primers GVR-BC-Mpx-up / rp, on DNA of B. cereus CECT 131, with five temperature series (Tm) and 16 combinations of primer concentration.
Figura 2. Gel de agarosa. Optimización de cebadores GVR-CJ-Mpx-up/rp, sobre ADN de C. jejuni ATCC 49943, con cinco series de temperatura (Tm) y 16 combinaciones de concentración de cebadores. Figure 2. Agarose gel. Optimization of GVR-CJ-Mpx-up / rp primers, on C. jejuni ATCC 49943 DNA, with five temperature series (Tm) and 16 combinations of primer concentration.
Figura 3. Gel de agarosa. Optimización de cebadores GVR-CS-Mpx-up/rp, sobre ADN de C. sakazakii ATCC 894 BAA, con cinco series de temperatura (Tm) y 16 combinaciones de concentración de cebadores. Figura 4. Gel de Agarosa. Optimización de cebadores GVR-CP-Mpx-up/rp, sobre ADN de C. períringens CECT 376T, con cinco series de temperatura (Tm) y 16 combinaciones de concentración de cebadores. Figure 3. Agarose gel. Optimization of primers GVR-CS-Mpx-up / rp, on DNA from C. sakazakii ATCC 894 BAA, with five temperature series (Tm) and 16 combinations of primer concentration. Figure 4. Agarosa gel. Optimization of GVR-CP-Mpx-up / rp primers on C. períringens CECT 376T DNA, with five temperature series (Tm) and 16 combinations of primer concentration.
Figura 5. Gel de agarosa. Optimización de cebadores GVR-EC-Mpx-up/rp, sobre ADN de E. coli CECT 4267, con cinco series de temperatura (Tm) y 16 combinaciones de concentración de cebadores. Figure 5. Agarose gel. Optimization of GVR-EC-Mpx-up / rp primers, on E. coli CECT 4267 DNA, with five temperature series (Tm) and 16 combinations of primer concentration.
Figura 6. Gel de agarosa. Optimización de cebadores GVR-H7-Mpx-up/rp, sobre ADN de E. coli 0157.H7, con cinco series de temperatura (Tm) y 16 combinaciones de concentración de cebadores. Figure 6. Agarose gel. Optimization of primers GVR-H7-Mpx-up / rp, on DNA of E. coli 0157.H7, with five temperature series (Tm) and 16 combinations of primer concentration.
Figura 7. Gel de agarosa. Optimización de cebadores GVR-SE-Mpx-up/rp, sobre ADN de S. entérica CECT 443, con cinco series de temperatura (Tm) y 16 combinaciones de concentración de cebadores. Figura 8. Gel de agarosa. Optimización de cebadores GVR-EB-Mpx-up/rp, sobre ADN de la enterobacteria Pantoea ananatis CECT 4858T, con cinco series de temperatura (Tm) y 16 combinaciones de concentración de cebadores. Figura 9. Gel de agarosa. Optimización de cebadores GVR-LM-Mpx-up/rp, sobre ADN de L. monocytogenes CECT 91 1 , con cinco series de temperatura (Tm) y 16 combinaciones de concentración de cebadores. Figure 7. Agarose gel. Optimization of primers GVR-SE-Mpx-up / rp, on S. enteric CECT 443 DNA, with five temperature series (Tm) and 16 combinations of primer concentration. Figure 8. Agarose gel. Optimization of primers GVR-EB-Mpx-up / rp, on DNA of the Ententobacteria Pantoea ananatis CECT 4858T, with five temperature series (Tm) and 16 combinations of primer concentration. Figure 9. Agarose gel. Optimization of primers GVR-LM-Mpx-up / rp, on DNA of L. monocytogenes CECT 91 1, with five temperature series (Tm) and 16 combinations of primer concentration.
Figura 10. Gel de agarosa. Optimización de cebadores GVR-SA-Mpx-up/rp, sobre ADN de S. aureus CECT 240, con cinco series de temperatura (Tm) y 16 combinaciones de concentración de cebadores. Figure 10. Agarose gel. Optimization of primers GVR-SA-Mpx-up / rp, on S. aureus CECT 240 DNA, with five temperature series (Tm) and 16 combinations of primer concentration.
Figura 11. Gel de agarosa. Optimización de cebadores GVR-SH-Mpx-up/rp, sobre ADN de S. dysenteriae CECT 584, con cinco series de temperatura (Tm) y 16 combinaciones de concentración de cebadores. Figure 11. Agarose gel. Optimization of GVR-SH-Mpx-up / rp primers, on S. dysenteriae CECT 584 DNA, with five temperature series (Tm) and 16 combinations of primer concentration.
Figura 12. Electroferograma. PCR múltiplex con 1 1 pares de cebadores y el ADNg de B. cereus (BC), C. jejuni (CJ), C. períringens (CP), C. sakaza ii (CS), E coli (EC), £ coli 0157.Ή7 (H7), Familia Enterobacteriaceae (EB), L monocytogenes (LM), Salmonella spp. (SE), Shigella spp. (SH) y S. aureus (SA), a 56 °C. Figure 12. Electropherogram. Multiplex PCR with 1 1 pairs of primers and the B. cereus (BC), C. jejuni (CJ), C. períringens (CP), C. sakaza ii (CS), E coli (EC), £ coli 0157 .Ή7 (H7), Family Enterobacteriaceae (EB), L monocytogenes (LM), Salmonella spp. (SE), Shigella spp. (SH) and S. aureus (SA), at 56 ° C.
Figura 13A-B. Electroferogramas. PCR múltiplex sobre ADNg de los dos grupos de microorganismos. (Fig. 13A) El electroferograma A corresponde a aquellos que pertenecen a la Familia Enterobacteriaceae (C. sakazakii, E. coli, E. coli 0157:1-17, Salmonella spp. y Shigella spp.) y (Fig. 13B) el electroforegrama B, a aquellos no enterobacterias (B. cereus, C. jejuni, C. períringens, L. monocytogenes y S. aureus). Figure 13A-B Electropherograms Multiplex PCR on gDNA of the two groups of microorganisms. (Fig. 13A) The electropherogram A corresponds to those belonging to the Enterobacteriaceae Family (C. sakazakii, E. coli, E. coli 0157: 1-17, Salmonella spp. And Shigella spp.) And (Fig. 13B) the electrophoregram B, to those not enterobacteria (B. cereus, C. jejuni, C. períringens, L. monocytogenes and S. aureus).
Figuras 14A-K. Electroferogramas de los productos de amplificación obtenidos por PCR múltiplex, para los 1 microorganismos de este trabajo, de forma independiente. En el eje de ordenadas (Y) se indica la intensidad de la fluorescencia detectada, y en el eje de abscisas (X), el tamaño en pares de bases (pb), indicándose sobre cada pico el mismo. (Fig. 15A) C. jejuni , (Fig. 15B) B. cereus, (Fig. 15C) L. monocytogenes, (Fig. 15D) C. períringens, (Fig. 15E) Familia Enterobacteriaceae, (Fig. 15F) C. sakazakii, (Fig. 15G) E. coli 0157:H7, (Fig. 15H) S. aureus, (Fig.151) E. coli, (Fig. 15J) Shigella spp. y (Fig. 15K) Salmonella spp. Figuras 15A-B. Amplificaciones obtenidas por qRTi-PCR con diluciones decimales seriadas de ADNg de Familia Enterobacteriaceae {Pantoea ananatis CECT 48458) (Fig. 15A) y S. aureus CECT 240 (Fig. 15B), con el fin de establecer el umbral mínimo de detección alcanzado con las concentraciones optimizadas de cebadores y de sonda específicos. Figures 14A-K Electropherograms of the amplification products obtained by multiplex PCR, for the 1 microorganisms of this work, independently. In the ordinate axis (Y) the intensity of the detected fluorescence is indicated, and in the abscissa axis (X), the size in base pairs (bp), indicating the same on each peak. (Fig. 15A) C. jejuni, (Fig. 15B) B. cereus, (Fig. 15C) L. monocytogenes, (Fig. 15D) C. períringens, (Fig. 15E) Enterobacteriaceae family, (Fig. 15F) C Sakazakii, (Fig. 15G) E. coli 0157: H7, (Fig. 15H) S. aureus, (Fig. 151) E. coli, (Fig. 15J) Shigella spp. and (Fig. 15K) Salmonella spp. Figures 15A-B Amplifications obtained by qRTi-PCR with serial decimal dilutions of gDNA from Family Enterobacteriaceae {Pantoea ananatis CECT 48458) (Fig. 15A) and S. aureus CECT 240 (Fig. 15B), in order to establish the minimum detection threshold reached with Optimized concentrations of specific primers and probe.
Figuras 16A-C. Amplificaciones obtenidas por qRTi-PCR con diluciones decimales seriadas de ADNg de E.coli CECT 4167 (Fig. 16A); B. cereus CECT 131 (Fig. 16B) y C. perfringens CECT 376-T (Fig. 16C) con el fin de establecer el umbral mínimo de detección alcanzado con las concentraciones optimizadas de cebadores y de sonda específicos. Figures 16A-C Amplifications obtained by qRTi-PCR with serial decimal dilutions of E.coli CECT 4167 cDNA (Fig. 16A); B. cereus CECT 131 (Fig. 16B) and C. perfringens CECT 376-T (Fig. 16C) in order to establish the minimum detection threshold reached with optimized concentrations of specific primers and probe.
Figuras 17A-C. Curvas de amplificación obtenidas en qRTi-PCR con diluciones decimales del ADN de referencia stock de pGVR-QIAC y utilizando como repórter la sonda TaqMan-GVR-IAC1 (Fig. 17A); TaqMan-GVR-IAC2 (Fig. 17B) y TaqMan-GVR- IAC3 (Fig. 17C). En el eje de ordenadas se representa el valor de ARn, mientras que en el eje de abscisas se indican los ciclos de amplificación. Figures 17A-C Amplification curves obtained in qRTi-PCR with decimal dilutions of the reference DNA stock of pGVR-QIAC and using the TaqMan-GVR-IAC1 probe as a reporter (Fig. 17A); TaqMan-GVR-IAC2 (Fig. 17B) and TaqMan-GVR-IAC3 (Fig. 17C). In the ordinate axis the value of ARn is represented, while in the abscissa axis the amplification cycles are indicated.
Figuras 18A-C. Patrones obtenidos en la amplificación de las combinaciones dúplex de C. perfringens, según tabla 14, incorporando pGVR-QIAC y su respectiva sonda. (Fig. 18A) combinación C. perfringens/ E.coli. (Fig. 18B) combinación C. perfringens/ S. aureus. (Fig. 18C) combinación perfringens/ B. cereus. CP= sonda TaqMan-GVR- CP (VIC); EC= sonda TaqMan-GVR-EC (NED); SA= sonda TaqMan-GVR-SA (FAM); IAC2= sonda TaqMan-GVR-IAC2 (NED); IAC3= sonda TaqMan-GVR-IAC3 (FAM). Figures 18A-C Patterns obtained in the amplification of C. perfringens duplex combinations, according to table 14, incorporating pGVR-QIAC and its respective probe. (Fig. 18A) C. perfringens / E.coli combination. (Fig. 18B) C. perfringens / S. aureus combination. (Fig. 18C) perfringens / B. cereus combination. CP = TaqMan-GVR-CP (VIC) probe; EC = TaqMan-GVR-EC (NED) probe; SA = TaqMan-GVR-SA (FAM) probe; IAC2 = TaqMan-GVR-IAC2 probe (NED); IAC3 = TaqMan-GVR-IAC3 (FAM) probe.
Figuras 19A-B. Patrones obtenidos en la amplificación de las combinaciones dúplex de E. coli, según tabla 33, incorporando pGVR-QIAC y su respectiva sonda. (Fig. 19A) combinación E. coli I S. aureus. (Fig. 19B) combinación E. coli/ B. cereus. EC= sonda TaqMan-GVR-EC (NED); SA= sonda TaqMan-GVR-SA (FAM); BC= sonda TaqMan- GVR-BC (FAM). IAC1 = sonda TaqMan-GVR-IAC1 (VIC). Figures 19A-B. Patterns obtained in the amplification of duplex combinations of E. coli, according to table 33, incorporating pGVR-QIAC and its respective probe. (Fig. 19A) E. coli I S. aureus combination. (Fig. 19B) E. coli / B. cereus combination. EC = TaqMan-GVR-EC (NED) probe; SA = TaqMan-GVR-SA (FAM) probe; BC = TaqMan-GVR-BC (FAM) probe. IAC1 = TaqMan-GVR-IAC1 (VIC) probe.
Figura 20. Patrones obtenidos en la amplificación de las combinaciones dúplex de S. aureus con E. coli, según tabla 14, incorporando pGVR-QIAC y su respectiva sonda. SA= sonda TaqMan-GVR-SA (FAM); BC2= sonda TaqMan-GVR-BC2 (VIC). IAC1 = sonda TaqMan-GVR-IAC2 (NED). Figuras 21A-D. Patrones obtenidos en la amplificación de las combinaciones dúplex de Familia Enterobacteriaceae, según tabla 14, incorporando pGVR-QIAC y su respectiva sonda. (Fig. 21 A) combinación Enterobacteriaceae I C. perfringens. (Fig. 21 B) combinación Enterobacteriaceae / E. coli. (Fig. 21 C) combinación Enterobacteriaceae / S. aureus. (Fig. 21 D) combinación Enterobacteriaceae / B. cereus. EB= sonda TaqMan-GVR-EB (Cy5); CP= sonda Taq an-GVR-CP (VIC); BC= sonda TaqMan-GVR-BC (FAM).SA= sonda TaqMan-GVR-SA (FAM); EC= sonda TaqMan-GVR-EC (NED): IAC1 = sonda TaqMan-GVR-IAC1 (VIC); IAC2= sonda TaqMan-GVR-IAC2 (NED). Figure 20. Patterns obtained in the amplification of the duplex combinations of S. aureus with E. coli, according to table 14, incorporating pGVR-QIAC and its respective probe. SA = TaqMan-GVR-SA (FAM) probe; BC2 = TaqMan-GVR-BC2 (VIC) probe. IAC1 = TaqMan-GVR-IAC2 (NED) probe. Figures 21A-D. Patterns obtained in the amplification of the duplex combinations of Family Enterobacteriaceae, according to table 14, incorporating pGVR-QIAC and its respective probe. (Fig. 21 A) Enterobacteriaceae I C. perfringens combination. (Fig. 21 B) Enterobacteriaceae / E. coli combination. (Fig. 21 C) Enterobacteriaceae / S. aureus combination. (Fig. 21 D) Enterobacteriaceae / B. cereus combination. EB = TaqMan-GVR-EB probe (Cy5); CP = Taq an-GVR-CP (VIC) probe; BC = TaqMan-GVR-BC (FAM) probe .SA = TaqMan-GVR-SA (FAM) probe; EC = TaqMan-GVR-EC probe (NED): IAC1 = TaqMan-GVR-IAC1 probe (VIC); IAC2 = TaqMan-GVR-IAC2 (NED) probe.
Figura 22. Diagrama representativo de los pasos seguidos para la adición de los diferentes sitios de hibridación de los cebadores específicos (a cuatro microrganismos y una familia de patógenos de origen alimentario) a la secuencia heteróloga de £. globulus usada como control interno de amplificación. Figure 22. Representative diagram of the steps taken for the addition of the different hybridization sites of the specific primers (to four microorganisms and a family of foodborne pathogens) to the heterologous sequence of £. globulus used as internal amplification control.
Figura 23. Representación gráfica de la estructura final del control interno de amplificación quimérico elaborado. Figure 23. Graphical representation of the final structure of the internal chimeric amplification control elaborated.
Figuras 24A-H. Curvas de crecimiento obtenidas para: B. cereus (Fig.14A), C. jejuni (Fig. 24B), C. perfringens (Fig. 24C), C. sakazakii (Fig. 24D), L monocytogenes (Fig. 24E), S. aureus (Fig.24F), Salmonella entérica (Fig. 24G) y E. coli (Fig. 24H)). Para la Familia Enterobacteriaceae, E. coli, una cepa enterohemorrágica de E. coli (como la 0157:1-17) y S. dysenteriae, se ha utilizado la curva de la figura 24H. Figura 25. Gel de electroforesis. Amplificación control obtenida a partir de una matriz contaminada artificialmente con B. cereus (BC), C. jejuni (CJ), C. perfringens (CP), C. sakazakii (CS), E. coli (EC), una cepa enterohemorrágica de E. coli (como la 0157:1-17) (Ή7), P. ananatis (Fam. Enterobacteriaceae) (EB), L. monocytogenes (LM), Salmonella entérica. (SE), S. dysenteriae (SD) y S. aureus (SA). Matriz: Carne roja (CR). Figures 24A-H Growth curves obtained for: B. cereus (Fig. 14A), C. jejuni (Fig. 24B), C. perfringens (Fig. 24C), C. sakazakii (Fig. 24D), L monocytogenes (Fig. 24E), S. aureus (Fig. 24F), Enteric Salmonella (Fig. 24G) and E. coli (Fig. 24H)). For the Enterobacteriaceae Family, E. coli, an enterohemorrhagic strain of E. coli (such as 0157: 1-17) and S. dysenteriae, the curve in Figure 24H has been used. Figure 25. Electrophoresis gel. Control amplification obtained from a matrix artificially contaminated with B. cereus (BC), C. jejuni (CJ), C. perfringens (CP), C. sakazakii (CS), E. coli (EC), an enterohemorrhagic strain of E. coli (as 0157: 1-17) (Ή7), P. ananatis (Fam. Enterobacteriaceae) (EB), L. monocytogenes (LM), Enteric Salmonella. (SE), S. dysenteriae (SD) and S. aureus (SA). Matrix: Red meat (CR).
Figuras 26A-D. Amplificación obtenida a partir de matrices contaminadas artificialmente con: Fig. 27A: C. jejuni y cebadores GVR-CJ-Mpx-up/rp. Amplicón= 251 bp; Fig.2B: E.coli y cebadores GVR-EC-Mpx-up/rp. Amplicón: 70 bp; Fig. 27C: E. coli cebadores GVR-H7-mpx-up/rp. Amplicón: 216 bp. Fig. 27D: E. coli y cebadores GVR- EB-Mpx-up/rp. Amplicón= 77 pb. Leyenda de matrices: CR= Carne roja; P= Pollo; S= Salchicha fresca; E= Embutidos curados; F= Pescado fresco; CF= Conservas de pescado; SF= Sopa de pescado; LC= Leche cruda; Y= Yogurt; N= Nata; Q= Queso; Nt= Natillas; LP= Leche en polvo; FI1 = Fórmula infantil 1 ; FI2= Fórmula infantil 2; HC= Huevo crudo; HM= Huevo manufacturado; V= Vegetales; M=Miel; W/0= Medio sin matriz; C+= control positivo PCR, C-= Control negativo PCR. Figures 26A-D. Amplification obtained from matrices artificially contaminated with: Fig. 27A: C. jejuni and primers GVR-CJ-Mpx-up / rp. Amplicon = 251 bp; Fig. 2B: E.coli and primers GVR-EC-Mpx-up / rp. Amplicon: 70 bp; Fig. 27C: E. coli primers GVR-H7-mpx-up / rp. Amplicon: 216 bp. Fig. 27D: E. coli and primers GVR-EB-Mpx-up / rp. Amplicon = 77 bp. Matrix legend: CR = Red meat; P = Chicken; S = Fresh sausage; E = Cured sausages; F = Fresh fish; CF = Canned fish; SF = Fish soup; LC = Raw milk; Y = Yogurt; N = Cream; Q = Cheese; Nt = Custard; LP = Powdered milk; FI1 = Infant formula 1; FI2 = Infant formula 2; HC = Raw egg; HM = Manufactured egg; V = Vegetables; M = Honey; W / 0 = Medium without matrix; C + = PCR positive control, C- = PCR negative control.
Figura 27A-B. Amplificación obtenida a partir de matrices contaminadas artificialmente con: Fig. 28A: S. aureus, y cebadores GVR-SA-Mpx-up/rp. Amplicón= 101 pb. Fig. 28B: S. dysenteríae y cebadores GVR-SH-Mpx- up/rp. Amplicón= 150 pb. Leyenda de matrices: CR= Carne roja; P= Pollo; S= Salchicha fresca; E= Embutidos curados; F= Pescado fresco; CF= Conservas de pescado; SF= Sopa de pescado; LC= Leche cruda; Y= Yogurt; N= Nata; Q= Queso; Nt= Natillas; LP= Leche en polvo; FI1 = Fórmula infantil 1 ; FI2= Fórmula infantil 2; HC= Huevo crudo; HM= Huevo manufacturado; V= Vegetales; M=Miel; W/0= Medio sin matriz; C+= control positivo PCR, C-= Control negativo PCR Figure 27A-B Amplification obtained from matrices artificially contaminated with: Fig. 28A: S. aureus, and primers GVR-SA-Mpx-up / rp. Amplicon = 101 bp. Fig. 28B: S. dysenteríae and primers GVR-SH-Mpx-up / rp. Amplicon = 150 bp. Matrix legend: CR = Red meat; P = Chicken; S = Fresh sausage; E = Cured sausages; F = Fresh fish; CF = Canned fish; SF = Fish soup; LC = Raw milk; Y = Yogurt; N = Cream; Q = Cheese; Nt = Custard; LP = Powdered milk; FI1 = Infant formula 1; FI2 = Infant formula 2; HC = Raw egg; HM = Manufactured egg; V = Vegetables; M = Honey; W / 0 = Medium without matrix; C + = PCR positive control, C- = PCR negative control
EJEMPLOS EXAMPLES
A continuación se ilustrará la invención mediante unos ensayos realizados por los inventores, que pone de manifiesto la efectividad del producto de la invención. The invention will now be illustrated by tests carried out by the inventors, which demonstrates the effectiveness of the product of the invention.
Ejemplo 1 Example 1
Detección de microorganismos patógenos mediante PCR multiplex y su posterior cuantificación  Detection of pathogenic microorganisms by multiplex PCR and its subsequent quantification
MATERIALES Y MÉTODOS MATERIALS AND METHODS
1. Cepas microbianas 1. Microbial strains
1.1 Colección de microorganismos, medios y condiciones de cultivo. 1.1 Collection of microorganisms, media and culture conditions.
Se ha generado una colección de 66 microorganismos formada por patógenos de origen alimentario y bacterias interferentes que pueden encontrarse tanto en matrices alimentarias, como en el ambiente. Las cepas tipo fueron suministradas por la Colección Española de Cultivos Tipo (CECT), la American Type Culture Coilection (ATCC) y la Deutsche Sammlung von Mikroorganismen und Zellkulturen (DSMZ), en forma de cultivos liofilizados, los cuales fueron reconstituidos y cultivados siguiendo las instrucciones recomendadas. Así mismo, las condiciones y medios de cultivo utilizados corresponden a los recomendados por los proveedores de las cepas (Tabla 4). A collection of 66 microorganisms formed by pathogens of food origin and interfering bacteria that can be found both in food matrices and in the environment has been generated. The type strains were supplied by the Spanish Type Culture Collection (CECT), the American Type Culture Coilection (ATCC) and the Deutsche Sammlung von Mikroorganismen und Zellkulturen (DSMZ), in form of lyophilized cultures, which were reconstituted and cultivated following the recommended instructions. Likewise, the conditions and culture media used correspond to those recommended by the suppliers of the strains (Table 4).
Figure imgf000033_0001
Salmonella entérica CECT
Figure imgf000033_0001
Enteric Salmonella CECT
Agar Nutritivo I 37° ANF entérica var. paratyphi 554  Nutritive Agar I 37 ° ANF enteric var. paratyphi 554
Salmonella entérica CECT  Enteric Salmonella CECT
Agar Nutritivo i 37° ANF ent rica var. enteritidis 556  Nutritive Agar and 37 ° ANF ent rica var. enteritidis 556
Salmonella entérica CECT  Enteric Salmonella CECT
Agar Nutritivo I 37° ANF entericavar. infantis 707  Nutritive Agar I 37 ° ANF entericavar. infantis 707
Salmonella entérica CECT  Enteric Salmonella CECT
Agar Nutritivo I 37° ANF entérica var. choleraesuis 724  Nutritive Agar I 37 ° ANF enteric var. choleraesuis 724
Salmonella entérica CECT  Enteric Salmonella CECT
Agar Nutritivo I 37° ANF entérica var. dublin 4152  Nutritive Agar I 37 ° ANF enteric var. dublin 4152
Salmonella entérica CECT  Enteric Salmonella CECT
Agar Nutritivo I 37° ANF entérica var. virchow 4154  Nutritive Agar I 37 ° ANF enteric var. virchow 4154
DSM  DSM
Budvicia aquatica TSA 26° A  Aquatic Budvicia TSA 26 ° A
5075  5075
DSM  DSM
Buttiauxella agrestis Agar Nutritivo I 30° A  Buttiauxella agrestis Nutritive Agar I 30 ° A
4586  4586
CECT  CECT
Cedecea davisae Agar Nutritivo I 28° A  Cedecea davisae Nutritive Agar I 28 ° A
842T  842T
CECT  CECT
Citrobacter youngae LB 37° A  Citrobacter youngae LB 37 ° A
5335T  5335T
CECT  CECT
Edwardsiella tarda TSA 26° ANF  Edwardsiella takes TSA 26 ° ANF
849T  849T
CECT  CECT
Erwinia chrysanthemi Agar Nutritivo 37° A  Erwinia chrysanthemi Nutritive Agar 37 ° A
509  509
CECT  CECT
Ewingella americana TSA 26° ANF  Ewingella americana TSA 26 ° ANF
859T  859T
CECT Infusión de cerebro- CECT Brain Infusion-
Klebsiella pneumoniae 37° A Klebsiella pneumoniae 37 ° A
144 corazón (BHI)  144 heart (BHI)
CECT  CECT
Kluyvera cryocrescens Agar Nutritivo I 37° A  Kluyvera cryocrescens Nutritive Agar I 37 ° A
862T  862T
DSM  DSM
Leclerciaader carboxylata Agar Nutritivo I 37° A  Leclerciaader carboxylata Nutritive Agar I 37 ° A
5077  5077
DSM  DSM
Leminorella grimontii Agar Nutritivo I 37° A  Leminorella grimontii Nutritive Agar I 37 ° A
5078  5078
CECT  CECT
Morganella morganii Agar Nutritivo I 37° A  Morganella morganii Nutritive Agar I 37 ° A
173T CECT 173T CECT
Pantoea ananatis TSA 26° ANF  Pantoea ananatis TSA 26 ° ANF
4858T  4858T
Pectobacterium CECT  Pectobacterium CECT
TSA 26° A carotovorum 225T  TSA 26 ° A carotovorum 225T
CECT  CECT
Plesiomonas shigelloides Agar Nutritivo I 37° A  Plesiomonas shigelloides Nutritive Agar I 37 ° A
597  597
CECT  CECT
Proteus vulgaris Agar Nutritivo I 37° ANF  Proteus vulgaris Nutritive Agar I 37 ° ANF
165  165
CECT  CECT
Providencia stuartii Agar Nutritivo 1 37° A  Providencia stuartii Nutritive Agar 1 37 ° A
866T  866T
DSM  DSM
Rahnella aquatilis Agar Nutritivo 1 30° A  Rahnella aquatilis Nutritive Agar 1 30 ° A
4594  4594
CECT  CECT
Raoultella planticola Agar Nutritivo 1 30° A  Raoultella planticola Nutritive Agar 1 30 ° A
843T  843T
CECT  CECT
Serratia marcescens TSA 26° A  Serratia marcescens TSA 26 ° A
854  854
CECT  CECT
Shigella flexneri Agar Nutritivo 1 37° ANF  Shigella flexneri Nutritive Agar 1 37 ° ANF
585  585
Shigella boydii CET 583 Agar Nutritivo 1 37° ANF  Shigella boydii CET 583 Nutritive Agar 1 37 ° ANF
CECT  CECT
Shigella dysenteriae Agar Nutritivo 1 37° ANF  Shigella dysenteriae Nutritive Agar 1 37 ° ANF
584  584
CECT Infusión de cerebro- CECT Brain Infusion-
Tatumella ptyseos 30° A Tatumella ptyseos 30 ° A
869T corazón (BHI)  869T heart (BHI)
CECT  CECT
Hafnia alvei TSA 30° A  Hafnia alvei TSA 30 ° A
157  157
CECT Infusión de cerebro- CECT Brain Infusion-
Yersinia enterocolitica 26° A Yersinia enterocolitica 26 ° A
4054 corazón (BHI)  4054 heart (BHI)
CECT  CECT
Bacillus badius Agar Nutritivo 1 30° A  Bacillus badius Nutritive Agar 1 30 ° A
17T  17T
CECT  CECT
Bacillus pumilus Agar Nutritivo 1 30° A  Bacillus pumilus Nutritive Agar 1 30 ° A
29T  29T
Bacillus subtilis CECT 35 Agar Nutritivo 1 30° A  Bacillus subtilis CECT 35 Nutritive Agar 1 30 ° A
ATCC TSA+ Sangre de  ATCC TSA + Blood of
Campylobacter coli 37° MA  Campylobacter coli 37 ° MA
49941 cordero desfibrinada  49941 defibrinated lamb
DSM  DSM
Campylobacter mucosalis Columbia Blood 37° AN  Campylobacter mucosalis Columbia Blood 37 ° AN
21682 ATCC TSA+ Sangre de 21682 ATCC TSA + Blood of
Campylobacter helveticum 35° MA  Campylobacter helveticum 35 ° MA
51209 cordero desfibrinada  51209 defibrinated lamb
CECT  CECT
Clostridium botulinum Liver Broth 37° AN  Clostridium botulinum Liver Broth 37 ° AN
551  551
CECT  CECT
Clostridium butyricum Liver Broth 37° AN  Clostridium butyricum Liver Broth 37 ° AN
361T  361T
CECT  CECT
Enterobacter aerogenes Agar Nutritivo I 30° ANF  Enterobacter aerogenes Nutrient Agar I 30 ° ANF
684T  684T
CECT  CECT
Enterobacter cloacae Agar Nutritivo I 30° ANF  Enterobacter cloacae Nutritive Agar I 30 ° ANF
194T  194T
CECT  CECT
Enterobacter gergoviae Agar Nutritivo I 37° ANF  Enterobacter gergoviae Nutritive Agar I 37 ° ANF
857T  857T
DSM  DSM
Escherichia fergusonii Agar Nutritivo I 37° ANF  Escherichia fergusonii Nutritive Agar I 37 ° ANF
13698  13698
DAM  Dam
Escherichia hermannii Agar Nutritivo I 37° ANF  Escherichia hermannii Nutritive Agar I 37 ° ANF
4560  4560
ATCC  ATCC
Escherichia intermedia Agar Nutritivo 37° ANF  Escherichia intermedia Nutritive Agar 37 ° ANF
21073  21073
CECT Infusión de cerebro- CECT Brain Infusion-
Listeria grayi 37° A Listeria grayi 37 ° A
931T corazón (BHI)  931T heart (BHI)
CECT Infusión de cerebro- CECT Brain Infusion-
Listeria innocua 37° A Listeria innocua 37 ° A
91 OT corazón (BHI)  91 OT heart (BHI)
CECT Infusión de cerebro- CECT Brain Infusion-
Listeria ivanovii 37° A Listeria ivanovii 37 ° A
5379 corazón (BHI)  5379 heart (BHI)
Staphylococcus CECT  CECT Staphylococcus
Agar Nutritivo I 37° ANF epidermidis 231  Nutritive Agar I 37 ° ANF epidermidis 231
Staphylococcus CECT  CECT Staphylococcus
Agar Nutritivo I 37° ANF haemolyticus 4900T  Nutritive Agar I 37 ° ANF haemolyticus 4900T
CECT  CECT
Staphylococcus simulans Agar Nutritivo I 37° ANF  Staphylococcus simulans Nutritive Agar I 37 ° ANF
4538T  4538T
Tabla 4. Microorganismos que conforman la colección de cepas creadas para este estudio y sus condiciones de cultivo. Leyenda: A: Aerobio; AN: Anerobio; ANF: Anerobio Facultativo; MA: Microaerófilo. Así mismo, para la detección e identificación de los diferentes microorganismos de este estudio, y adicionalmente a los medios de cultivo listados en la Tabla 4, se han utilizado medios de cultivo selectivos y otros especiales con condiciones de temperatura y concentración de oxígeno específicas, según se muestra en la Tabla 5.
Figure imgf000037_0001
Sangre de Table 4. Microorganisms that make up the collection of strains created for this study and their culture conditions. Caption: A: Aerobic; AN: Anerobio; ANF: Optional Anerobio; MA: Microaerophilic. Likewise, for the detection and identification of the different microorganisms of this study, and in addition to the culture media listed in Table 4, they have been used selective and other special culture media with specific temperature and oxygen concentration conditions, as shown in Table 5.
Figure imgf000037_0001
Blood of
caballo  horse
Agua de  Water
desfribrinada y  defibrinated and
peptona BPW MERCK - - hemolisada  BPW MERCK peptone - - hemolysed
tamponada  buffered
SR0050C  SR0050C
(OXOID) microorganismos patógenos de origen alimentario.  (OXOID) pathogenic microorganisms of food origin.
La manipulación de todas las cepas, tanto para su recuperación a partir de liofilizados como para el cultivo sucesivo, se llevó a cabo en una cabina de flujo laminar de bioseguridad nivel II Telstar BiollA. The manipulation of all strains, both for recovery from lyophilisates and for successive cultivation, was carried out in a laminar flow biosecurity booth level II Telstar BiollA.
La incubación de todos los cultivos fue realizada en estufas Memmert INE500 de temperatura graduabie y las condiciones de microaerofilia y anaerobiosis fueron alcanzadas en jarras Anaeropack™ System (Mitsubishi Gas Chemical), de siete litros de volumen, con sobres AnaeroGen™ AN0035A y CampyGen™ CN0035A (Oxoid). The incubation of all cultures was carried out in Memmert INE500 stoves of graduated temperature and the conditions of microaerophilia and anaerobiosis were reached in seven-volume Anaeropack ™ System (Mitsubishi Gas Chemical) jugs, with AnaeroGen ™ AN0035A and CampyGen ™ CN0035A envelopes (Oxoid)
1.2 Conservación de cultivos 1.2 Crop conservation
La conservación en glicerol se ha utilizado para garantizar la disponibilidad en el tiempo de cultivos de cepas estándar, almacenándose alícuotas, por duplicado de cada cepa, en glicerol 50% a -80° C. Para ello una colonia aislada, obtenida a partir de un cultivo por agotamiento en medio sólido, fue inoculada en 5 mL de medio de cultivo líquido e incubada a la temperatura correspondiente por una noche. Luego, se centrifugó este cultivo a 10.000 rpm durante 10 min, se descartó el sobrenadante y el pellet celular se resuspendió en 750 μί de TSB o LB. Se añadieron 750 ί de glicerol 50% y se almacenó en un criovial a -80°C hasta su uso.  The glycerol preservation has been used to guarantee the availability of standard strain cultures over time, aliquots being stored, in duplicate of each strain, in 50% glycerol at -80 ° C. For this purpose an isolated colony, obtained from an culture by depletion in solid medium, was inoculated in 5 mL of liquid culture medium and incubated at the corresponding temperature overnight. Then, this culture was centrifuged at 10,000 rpm for 10 min, the supernatant was discarded and the cell pellet was resuspended in 750 μί of TSB or LB. 750 ί of 50% glycerol was added and stored in a cryovial at -80 ° C until use.
La liofilización se ha utilizado para garantizar a muy largo plazo la disponibilidad de las diferentes cepas. El proceso realizado se describe a continuación: Freeze drying has been used to guarantee the availability of the different strains in the very long term. The process performed is described below:
- Se cultivaron alícuotas de los diferentes microorganismos, en los medios y condiciones adecuadas.  - Aliquots of the different microorganisms were grown, in the appropriate media and conditions.
- Mediante centrifugado, se recolectaron las células y se resuspendió el pellet celular en 4 mL de un medio crioprotector compuesto por: MOPS (0,5%), leche descremada en polvo (2%), trehalosa (1 ,7%) y agua hasta 50 mL. El pH de este medio crioprotector se ajustó a un valor de 7,5 con KOH. - La suspensión se congeló a -70° C en viales capsulables de vidrio, manteniéndolos a esta temperatura por una noche. - By centrifugation, the cells were collected and the cell pellet was resuspended in 4 mL of a cryoprotective medium consisting of: MOPS (0.5%), skim milk powder (2%), trehalose (1, 7%) and water up to 50 mL The pH of this cryoprotectant medium was adjusted to a value of 7.5 with KOH. - The suspension was frozen at -70 ° C in glass capsule vials, keeping them at this temperature for one night.
- A continuación se procedió al liofilizado en un equipo Free Zone 1 Liter Benchtop Freeze Dry System (Labconco), por aproximadamente 24 horas.  - The lyophilisate was then proceeded in a Free Zone 1 Liter Benchtop Freeze Dry System (Labconco), for approximately 24 hours.
- Finalmente, una vez sellados los viales, se almacenaron a temperatura ambiente.  - Finally, once the vials were sealed, they were stored at room temperature.
1.3. Elaboración de curvas de crecimiento. 1.3. Development of growth curves.
Para conocer el número de unidades formadoras de colonias (UFC) presentes en cada inoculo utilizado, se elaboraron curvas de densidad óptica a λ= 600 nm (D06oo) versus el número de UFC, siguiendo los pasos que se indican a continuación: To determine the number of colony forming units (CFU) present in each inoculum used, curves of optical density at λ = 600 nm (D0 6 oo) versus the number of CFUs were prepared, following the steps indicated below:
a) Inocular una colonia aislada, obtenida por cultivo en placa por agotamiento, en 5 mL de medio de cultivo líquido (según Tabla 4).  a) Inoculate an isolated colony, obtained by plaque culture by depletion, in 5 mL of liquid culture medium (according to Table 4).
b) Incubar en las condiciones adecuadas hasta obtener una D060o=0,4. b) Incubate under the appropriate conditions until obtaining a D0 60 or = 0.4.
c) Hacer diluciones seriadas desde 10o hasta 10"7 y medir D06oo para cada una. d) Sembrar en placa 100 - 1000 μΙ_ de cada dilución con asa de Digralsky, por cuadruplicado, e incubar durante 24 horas. c) Make serial dilutions from 10 or up to 10 "7 and measure D0 6 oo for each one. d) Sow in plate 100 - 1000 μΙ_ of each dilution with Digralsky handle, in quadruplicate, and incubate for 24 hours.
e) Contar el número de colonias presentes y representar gráficamente DO600 versus número de colonias. e) Count the number of colonies present and graphically represent OD 600 versus number of colonies.
Las mediciones de D060o se realizaron en un espectrofotómetro Biophotometer Plus (Eppendorf), en cubetas desechables de plástico Plastibrand (BRAND) con un volumen de 1 ,5 mL y un paso de luz de 10 mm. 1.4. Spiking o contaminación artificial de matrices alimentarias. The measurements of D0 60 or were carried out on a Biophotometer Plus (Eppendorf) spectrophotometer, in disposable Plastibrand (BRAND) plastic cuvettes with a volume of 1.5 mL and a 10 mm light path. 1.4. Spiking or artificial contamination of food matrices.
Para la contaminación artificial de matrices alimentarias se inocularon alícuotas de 10 g, de 20 tipos de matrices diferentes, con 300 UFC de cada cepa en las combinaciones indicadas y por triplicado, tal y como se indica en la Tabla 6. Para ello cada alícuota se introdujo de modo aséptico en una bolsa para muestras con filtro WHIRL-PAK B01 195WA (Nasco) y se le añadió el medio de cultivo GVRUM, hasta alcanzar los 100 g medidos en una balanza de laboratorio MXX-061 (Denver Instrument). Este medio de cultivo GVRUM está compuesto por Agua de Peptona Tamponada y los siguientes ingredientes añadidos:  For artificial contamination of food matrices, 10 g aliquots of 20 different types of matrices were inoculated, with 300 CFU of each strain in the indicated and triplicate combinations, as indicated in Table 6. For this, each aliquot is introduced aseptically into a sample bag with WHIRL-PAK B01 195WA filter (Nasco) and the GVRUM culture medium was added, until reaching 100 g measured in a MXX-061 laboratory scale (Denver Instrument). This GVRUM culture medium is composed of Buffered Peptone Water and the following added ingredients:
- Sangre de caballo desfibrinada y hemolisada (25 mL sangre/500 mL de medio).  - Defibrinated and hemolysed horse blood (25 mL blood / 500 mL medium).
- Manitol 10 g/500 mL de medio. - Suplemento de crecimiento de Campyiobacter OXO ID # SR0232E (1 vial de 2 mL/500 ml_ de medio). - Mannitol 10 g / 500 mL of medium. - Campyiobacter OXO ID # SR0232E growth supplement (1 vial of 2 mL / 500 ml_ of medium).
Matrices Inóculos Matrices Inocula
Carne  Meat
fresca roja fresh red
Carne  Meat
fresca pollo fresh chicken
Salchichas  Sausages
crudas  raw
Embutidos  Sausages
Pescado  Fish
Crudo  Raw
Conservas  Preserves
de pescado of fish
Sopa de  Soup of
pescado  fish
Leche  Milk
cruda vaca raw cow
Yogur BC BC Yogurt
Nata CJ CJ cream
BC CO  BC CO
Queso CJ CP  CJ CP cheese
CS  CS
Postres E CS EB  Desserts E CS EB
BC CJ CP CS EC LM H7 SH SE SA EB lácteos B LM EC  BC CJ CP CS EC LM H7 SH SE SA EB Dairy B LM EC
EC  EC
Leche en SE SA  Leche at SE SA
LM  LM
polvo SA SA powder
Leche SE infantil en Infant SE milk in
polvo 1  powder 1
Leche  Milk
infantil en  childish in
polvo 2  powder 2
Huevo  Egg
crudo  raw
Huevo  Egg
manufactur manufactur
ado  ado
Vegetales  Vegetables
crudos  raw
Miel  Honey
Control Sin  Control Without
Matriz  Matrix
Tabla 6. Ma rices y combinaciones de microorganismos usadas en los spikings. BC: B. cereus, CJ: C. jejuni, CP: C. prefringens, CS: C. sakazakii, EB: Fam. Enterobacteriaceae, EC: E. coli, H7. E. coli 0157:H7, LM: L. monocytogenes, SA: S. aureus, SE: Salmonella spp., SH: Shigella spp. La muestra se homogenizó en un Stomacher 80 (Seward), por 60 s. Una vez homogenizada la muestra, se inoculó cada bolsa con 300 UFC del microorganismo correspondiente. En los casos en que era necesario un pre-enriquecimiento, esta bolsa se incubó a 37° C durante 24 horas. Table 6. Corners and combinations of microorganisms used in spikings. BC: B. cereus, CJ: C. jejuni, CP: C. prefringens, CS: C. sakazakii, EB: Fam. Enterobacteriaceae, EC: E. coli, H7. E. coli 0157: H7, LM: L. monocytogenes, SA: S. aureus, SE: Salmonella spp., SH: Shigella spp. The sample was homogenized in a Stomacher 80 (Seward), for 60 s. Once the sample was homogenized, each bag was inoculated with 300 CFU of the corresponding microorganism. In cases where a pre-enrichment was necessary, this bag was incubated at 37 ° C for 24 hours.
1.5. Transformación de células competentes. 1.5. Transformation of competent cells.
El protocolo utilizado para la transformación de células competentes de E. coli Top 10® (Life Technologies) (Genotipo: F- mcrA A(mrr-hsdRMS-mcrBC) q>80/acZAM15 Nac IA recA1 araD139 Aaraleu) 7697 ga/U ga/K rpsL (StrR) endA1 nupG) con plásmidos fue el descrito en Sambrook y Russel, 2001. The protocol used for the transformation of competent E. coli Top 10 ® cells (Life Technologies) (Genotype: F-mcrA A (mrr-hsdRMS-mcrBC) q> 80 / acZAM15 Nac IA recA1 araD139 Aaraleu) 7697 ga / U ga / K rpsL (Str R ) endA1 nupG) with plasmids was that described in Sambrook and Russel, 2001.
2. Obtención y manipulación de ADN 2. Collection and manipulation of DNA
2.1 Extracción de ADN genómico. a) A partir de cultivos puros de cepas estándar. 2.1 Extraction of genomic DNA. a) From pure cultures of standard strains.
A partir de cultivos en medio líquido de una noche de cada cepa estándar de la colección, se extrajo ADN mediante el kit comercial DNeasy Blood & Tissue Kit (QIAGEN), siguiendo el protocolo incluido en el mismo. Las muestras se almacenaron a -20° C. b) A partir de matrices alimentarias contaminadas artificialmente:  From cultures in liquid medium of one night of each standard strain of the collection, DNA was extracted using the commercial kit DNeasy Blood & Tissue Kit (QIAGEN), following the protocol included in it. Samples were stored at -20 ° C. B) From artificially contaminated food matrices:
Para la extracción de ADN a partir de spikings de los 20 tipos de matrices alimentarias se utilizó el sistema Prepman ULTRA® (Life Technologies), para lo cual se siguió el protocolo descrito a continuación: For the extraction of DNA from spikings of the 20 types of food matrices, the Prepman ULTRA ® system (Life Technologies) was used, for which the protocol described below was followed:
a) Centrifugar 1 mL del cultivo, a 12.500 rpm durante 1 minuto.  a) Centrifuge 1 mL of the culture, at 12,500 rpm for 1 minute.
b) Retirar el sobrenadante y añadir al pellet celular 100 μί de Prepman ULTRA®. c) Agitar en vórtex durante 30 s e incubar a 100° C en bloque seco durante 10 minutos. b) Remove the supernatant and add 100 μί of Prepman ULTRA ® to the cell pellet. c) Stir in vortex for 30, incubate at 100 ° C in dry block for 10 minutes.
d) Enfriar a temperatura ambiente y centrifugar a 12.500 rpm durante 2 minutos, e) Transferir 50 μί del sobrenadante a un tubo de microcentrífuga.  d) Cool to room temperature and centrifuge at 12,500 rpm for 2 minutes, e) Transfer 50 μί of the supernatant to a microcentrifuge tube.
0 Almacenar a -20° C.  0 Store at -20 ° C.
El centrifugado de las muestras se realizó en una microcentrífuga 5424 (Eppendorf), la agitación en un vórtex Wizard X (Velp Scientifica) y la incubación a 100° C en un bloque térmico AccuBlock™ (LabNet Biotécníca). 2.2 Aislamiento de ADN plasmídico The samples were centrifuged in a 5424 microcentrifuge (Eppendorf), shaking in a Wizard X vortex (Velp Scientifica) and incubation at 100 ° C in an AccuBlock ™ thermal block (Biotechnical LabNet). 2.2 Isolation of plasmid DNA
Para el aislamiento de ADN plasmídico se usó el kit comercial StrataPrep® Plasmid Miniprep Kit (Agilent Technologies), siguiendo el protocolo incluido en el mismo. Para la clonación de fragmentos romos obtenidos por PCR se ha utilizado el vector pCRBIunt (Life Technologies), el cual presenta las siguientes características: promotor lac; lacZot-ccdB; MCS; promotor T7; sitios de anillamiento para los cebadores  The commercial StrataPrep® Plasmid Miniprep Kit (Agilent Technologies) was used for the isolation of plasmid DNA, following the protocol included therein. For the cloning of blunt fragments obtained by PCR, the pCRBIunt vector (Life Technologies) has been used, which has the following characteristics: lac promoter; lacZot-ccdB; MCS; T7 promoter; banding sites for primers
T7/M13 up/rp; KanR; origen de replicación en E. coli colE1. T7 / M13 up / rp; Kan R ; origin of replication in E. coli colE1.
2.3. Electroforesis de ADN 2.3. DNA electrophoresis
a) Electroforesis horizontal en gel de agarosa a) Horizontal agarose gel electrophoresis
La separación de fragmentos de ADN se realizó en geles de agarosa con concentraciones desde 0,7% a 5% en tampón TBE 1X (Tris 0,9 M; Ácido Bórico 0,9 M y EDTA 20 mM pH=8), en cubetas de electroforesis horizontal KuroGel Midi 13 (VWR) a 170 V durante 40 minutos y con fuentes de energía EV265 (Consort). b) Electroforesis capilar  The DNA fragments were separated in agarose gels with concentrations from 0.7% to 5% in 1X TBE buffer (0.9 M Tris; 0.9 M Boric Acid and 20 mM EDTA pH = 8), in cuvettes of horizontal electrophoresis KuroGel Midi 13 (VWR) at 170 V for 40 minutes and with EV265 (Consort) power sources. b) Capillary electrophoresis
Los amplicones de ADN, provenientes de reacciones de PCR en múltiplex, fueron analizados mediante electroforesis capilar realizada en un Bioanalyzer 2100® con cartuchos DNA1000® y sus correspondientes reactivos (Agilent Technologies). El protocolo utilizado con el programa Expert 2100 se describe a continuación: DNA amplicons, from multiplex PCR reactions, were analyzed by capillary electrophoresis performed on a Bioanalyzer 2100 ® with DNA1000® cartridges and their corresponding reagents (Agilent Technologies). The protocol used with the Expert 2100 program is described below:
a) Colocar el cartucho en la "priming station", según las indicaciones del fabricante para el tipo de cartucho correspondiente (en este caso "DNA chip"), y colocar la jeringa en posición de 1 mL. Cerrar la unidad.  a) Place the cartridge in the "priming station", according to the manufacturer's instructions for the corresponding type of cartridge (in this case "DNA chip"), and place the syringe in a 1 mL position. Close the unit.
b) Añadir 9 pL de "gel matrix mix" en el pocilio marcado "G" con fondo oscuro. c) Desplazar el émbolo de la jeringa desde la posición 1 hasta la posición 0 y bloquearlo con el gatillo.  b) Add 9 pL of "gel matrix mix" in the well marked "G" with a dark background. c) Move the syringe plunger from position 1 to position 0 and lock it with the trigger.
d) Esperar 60 s exactos.  d) Wait 60 s exact.
e) Liberar el gatillo, esperar 5 s y luego desplazar el émbolo hasta la posición 1. f) Cargar 9 pL de "gel matrix mix" en cada uno de los dos pocilios marcados "G".  e) Release the trigger, wait 5 s and then move the plunger to position 1. f) Load 9 pL of "gel matrix mix" into each of the two wells marked "G".
(sin fondo oscuro).  (no dark background).
g) Añadir a todos los pocilios 5 pL de "marke .  g) Add to all wells 5 pL of "marke.
h) Añadir al pocilio marcado, 1 pL del DNA ladder.  h) Add to the labeled well, 1 pL of the DNA ladder.
i) Cargar 1 pL de la muestra en el pocilio correspondiente, hasta completar 1 1 , dejando el pocilio 12 libre para añadir 1 pL de agua destilada como control. j) Colocar el cartucho en el vórtex y agitar por 1 minuto a 2000 rpm (cuidando de que no se pierda por salpicadura el volumen cargado), i) Load 1 pL of the sample into the corresponding well, until completing 1 1, leaving the well 12 free to add 1 pL of distilled water as a control. j) Place the cartridge in the vortex and shake for 1 minute at 2000 rpm (taking care that the volume loaded is not lost by splashing),
k) Colocar el cartucho en el compartimiento del equipo y seleccionar en el software el tipo de cartucho.  k) Place the cartridge in the equipment compartment and select the type of cartridge in the software.
I) Iniciar la carrera.  I) Start the race.
2.4. Purificación de fragmentos de ADN 2.4. DNA fragment purification
En los casos en los que fue requerido, se purificaron fragmentos de ADN a partir de geles de agarosa, usando el kit comercial StrataPrep® Gel Extraction Kit; o a partir de productos de PCR, utilizando en kit StrataPrep® PCR Purification Kit, ambos de la casa comercial Agilent Technologies. Los productos de estas purificaciones fueron eluídos en agua Milli-Q esterilizada en autoclave.  In the cases where it was required, DNA fragments were purified from agarose gels, using the commercial StrataPrep® Gel Extraction Kit; or from PCR products, using StrataPrep® PCR Purification Kit, both from the Agilent Technologies commercial house. The products of these purifications were eluted in autoclaved Milli-Q water.
2.5 Ligación de fragmentos de ADN en vectores plásmídicos para la transformación de células competentes de Escheríchia coli 2.5 Ligation of DNA fragments into plasmid vectors for the transformation of competent cells of Escheríchia coli
La enzima T4 DNA ligasa (5 U/pL) (Fermentas) y su respectivo tampón fue usada para ligar fragmentos romos de ADN en vectores plásmídicos. Para esto se elaboraron mezclas de ligación en un volumen final de 10 pL cuya composición estándar se muestra en la Tabla 7.  The enzyme T4 DNA ligase (5 U / pL) (Fermentas) and its respective buffer was used to ligate blunt DNA fragments into plasmid vectors. For this, ligation mixtures were prepared in a final volume of 10 pL whose standard composition is shown in Table 7.
Estas ligaciones de extremos romos se incubaron durante una noche y a temperatura ambiente. These blunt end ligaments were incubated overnight and at room temperature.
Figure imgf000043_0001
Figure imgf000043_0001
Tabla 7. Composición de una mezcla para la ligación  Table 7. Composition of a mixture for ligation
de fragmentos de ADN en plásmidos.  of DNA fragments in plasmids.
2.6 Secuenciación y análisis de secuencias 2.6 Sequencing and sequence analysis
La secuenciación automática fluorescente fue realizada en un analizador genético ABI PRISM 3100 (Applied Biosystems), con el Big Dye 3.1 Terminator System (Applied Biosystems), en la Unidad de Secuenciación de los Servicios Científico-Técnicos de la Universidad de Oviedo. Las secuencias fueron analizadas y editadas mediante la aplicación bioinformática BioEdit Sequence Alignment Editor (Hall, 1999). Las mismas fueron alineadas a otras secuencias de ADN con la aplicación ClustalW2 (E BL-EBI). 3. Reacción en cadena de la polimerasa (PCR) Automatic fluorescent sequencing was performed on an ABI PRISM 3100 (Applied Biosystems) genetic analyzer, with the Big Dye 3.1 Terminator System (Applied Biosystems), in the Sequencing Unit of the Scientific-Technical Services of the University of Oviedo. The sequences were analyzed and edited using the bioinformatics application BioEdit Sequence Alignment Editor (Hall, 1999). They were aligned to other DNA sequences with the ClustalW2 (E BL-EBI) application. 3. Polymerase chain reaction (PCR)
3.1 Diseño de cebadores y sondas. 3.1 Design of primers and probes.
Tanto para PCR convencional o a tiempo final, como para PCR cuantitativa a tiempo real (qRTi-PCR), se diseñaron cebadores para amplificar secuencias de ADN específicas a cada microorganismo de interés. Para esto se seleccionaron, dianas genéticas con alta especificidad y conservación. Las secuencias de nucleótidos de ADN y de proteínas correspondientes a estas dianas fueron obtenidas a partir de la base de datos GenBank (NCBI). Se llevaron luego a cabo alineamientos entre éstas y el resto de secuencias depositadas en GenBank mediante las aplicaciones BLAST-n y BLAST-p, disponibles en la web del NCBI. Las regiones correspondientes a dominios conservados entre cepas de la misma especie fueron seleccionadas para el diseño de los cebadores, el cual se realizó con la aplicación online Primer3 (Rozen et al. 1998) y con el programa FastPCR® V.6.0.138 beta 2 (Kalendar et al, 2009), para el caso de la PCR convencional. For both conventional or end-time PCR, as well as for real-time quantitative PCR (qRTi-PCR), primers were designed to amplify specific DNA sequences to each microorganism of interest. For this, genetic targets with high specificity and conservation were selected. The nucleotide sequences of DNA and proteins corresponding to these targets were obtained from the GenBank database (NCBI). Alignments were then carried out between them and the rest of the sequences deposited in GenBank through the BLAST-n and BLAST-p applications, available on the NCBI website. The regions corresponding to domains conserved between strains of the same species were selected for the design of the primers, which was carried out with the Primer3 online application (Rozen et al. 1998) and with the FastPCR ® program V.6.0.138 beta 2 (Kalendar et al, 2009), in the case of conventional PCR.
Para la detección y cuantificación por qRTi-PCR de cuatro microorganismos y una familia de patógenos de origen alimentario se diseñaron cebadores y sondas TaqMan® (a partir de las dianas genéticas seleccionadas previamente) con el programa informático Primer Express Versión 3.0 (Life Technologies). For the detection and quantification by qRTi-PCR of four microorganisms and a family of foodborne pathogens, TaqMan ® primers and probes (from previously selected genetic targets) were designed with the Primer Express Version 3.0 software (Life Technologies).
Todos los cebadores fueron sintetizados por Thermo-Fisher Scientific y disueltos en tampón TE 1X (10 mM Tris-HCI, 1 mM EDTA.Na2) a una concentración inicial de 100 prnol/pL. Las sondas TaqMan® fueron sintetizadas por Applied Biosystems y recibidas en solución a una concentración de 100 pmol/pL en tampón TE 1X. All primers were synthesized by Thermo-Fisher Scientific and dissolved in 1X TE buffer (10 mM Tris-HCI, 1 mM EDTA.Na 2 ) at an initial concentration of 100 prnol / pL. TaqMan ® probes were synthesized by Applied Biosystems and received in solution at a concentration of 100 pmol / pL in TE 1X buffer.
3.2. PCR convencional 3.2. Conventional PCR
Todas las reacciones de amplificación, tanto uniplex como múltiplex, se llevaron a cabo en un termociclador Veriti® 96 WelIThermal-Cycler de Applied Biosystems, con la mezcla AmpliTaq Gold 360 PCR Master Mix (Applied Biosystems) la cual incluye una enzima ADN polimerasa y su tampón, MgCI2 a una concentración no indicada por el fabricante, y los desoxirribonucleótidos trifosfato (DNTPs) requeridos. a) Uniplex All amplification reactions, both uniplex and multiplex, were carried out in a Veriti® 96 WelIThermal-Cycler thermal cycler from Applied Biosystems, with the AmpliTaq Gold 360 PCR Master Mix (Applied Biosystems) which includes a DNA polymerase enzyme and its buffer, MgCI 2 at a concentration not indicated by the manufacturer, and the deoxyribonucleotide triphosphate (DNTPs) required. a) Uniplex
Se realizaron reacciones uniplex de PCR en un termociclador Veriti® 96 Well Thermal- Cycler (Applied Biosystems) para confirmar la obtención de ADN amplificable de los microorganismos en estudio a partir de los cultivos provenientes de spikings de matrices alimentarias, así como en cultivos puros o estándar. Para esto se utilizaron en modo uniplex los cebadores diseñados en mezclas de reacción bajo las condiciones indicadas por el fabricante de la mezcla que incluye la enzima polimerasa. b) Múftipfex  Uniplex PCR reactions were performed on a Veriti® 96 Well Thermal-Cycler (Applied Biosystems) thermal cycler to confirm the obtaining of amplifiable DNA from the microorganisms under study from cultures derived from food matrix spikings, as well as in pure cultures or standard. For this, primers designed in reaction mixtures were used in uniplex mode under the conditions indicated by the manufacturer of the mixture that includes the enzyme polymerase. b) Múipipfex
Se llevaron a cabo PCRs en modo múltiplex para la detección múltiple de diez microorganismos y una familia de patógenos de origen alimentario, empleando los cebadores diseñados. Para ello se prepararon dos mezclas iniciales de cebadores a una concentración definida, partiendo de la concentración almacén de 100 pmol/pL de cada uno de ellos, y de las concentraciones de reactivos y condiciones de amplificación recomendadas por el fabricante.  Multiplex mode PCRs were carried out for the multiple detection of ten microorganisms and a family of foodborne pathogens, using the designed primers. For this, two initial mixtures of primers were prepared at a defined concentration, starting from the storage concentration of 100 pmol / pL of each of them, and the reagent concentrations and amplification conditions recommended by the manufacturer.
3.3. PCR cuantitativa a Tiempo Real (qRTi-PCR) 3.3. Quantitative Real Time PCR (qRTi-PCR)
Para aquellos ensayos de qRTi-PCR en los que se utilizaron sondas cuyos fluoróforos eran NED, VIC y 6-FAM, se empleó el termociclador HT7900 Real Time PCR (Applied Biosystems) de la Unidad de Secuenciación de los Servicios Científico-Técnicos de la Universidad de Oviedo; mientras que para aquellos ensayos en los que se utilizaron sondas cuyo fluoróforo era Cy5, se utilizó un equipo 7500 Real Time PCR System (Applied Biosystems) de la empresa ALCE CALIDAD S.L. (Llanera, Asturias).  For those qRTi-PCR assays in which probes whose fluorophores were NED, VIC and 6-FAM were used, the HT7900 Real Time PCR thermal cycler (Applied Biosystems) of the Sequencing Unit of the Scientific-Technical Services of the University was used from Oviedo; while for those tests in which probes whose fluorophore was Cy5 were used, a 7500 Real Time PCR System (Applied Biosystems) from ALCE CALIDAD S.L. (Llanera, Asturias).
Para el análisis de los resultados se usaron las aplicaciones informáticas 7900 HT Sequence Detection Systems (SDS) versión 2.3 y 7500 Real-Time PCR System Sequence Detection Software, versión 1.4, ambos de Applied Biosystems. For the analysis of the results, the 7900 HT Sequence Detection Systems (SDS) version 2.3 and 7500 Real-Time PCR System Sequence Detection Software, version 1.4 applications, both of Applied Biosystems, were used.
Así mismo, en todos los ensayos se usó la mezcla comercial (master mix) de reacción TaqMan Gene Expression Master Mix (Applied Biosystems), la cual contiene la enzima ADN polimerasa, desoxirribonucleótidos trifosfato, tampón de reacción, Mg+2 y además el fluoróforo ROX como referencia pasiva. a) Elaboración de recta estándar para cuantificación. Likewise, in all the tests the commercial mixture (master mix) of reaction TaqMan Gene Expression Master Mix (Applied Biosystems) was used, which contains the enzyme DNA polymerase, deoxyribonucleotides triphosphate, reaction buffer, Mg +2 and also the fluorophore ROX as passive reference. a) Preparation of standard line for quantification.
Para la cuantificación del número de copias de cada diana genética presente en las muestras de los cuatro microorganismos y una familia de patógenos utilizados en estos experimentos, se elaboraron rectas estándar de cuantificación en cada grupo de reacciones. Para ello, se prepararon cultivos de cada microorganismo, con una D06oo=0,4, calculándose el número de UFC presentes mediante las ecuaciones de las curvas de crecimiento previamente elaboradas. A partir de estos cultivos se realizaron diluciones decimales seriadas a partir de las cuales se extrajo ADN con el sistema comercial PrepMan® (Life Technologies). To quantify the number of copies of each genetic target present in the samples of the four microorganisms and a family of pathogens used in these experiments, standard lines of quantification were prepared in each group of reactions. For this, cultures of each microorganism were prepared, with a D0 6 oo = 0.4, calculating the number of CFUs present by means of the equations of the previously elaborated growth curves. From these cultures serial serial dilutions were made from which DNA was extracted with the PrepMan ® commercial system (Life Technologies).
Una vez extraído el ADN, según el protocolo ya descrito incluido en el reactivo, se procedió a eliminar el ARN presente en cada extracto mediante un tratamiento durante 2 horas a 37° C, con 10 pL de RNAsa A de páncreas bovino (ROCHE) y 2 μΙ_ de ARNsa T1 de Aspergillus oryzae (SIGMA) Once the DNA was extracted, according to the protocol already described included in the reagent, the RNA present in each extract was removed by treatment for 2 hours at 37 ° C, with 10 pL of bovine pancreas RNAse A (ROCHE) and 2 μΙ_ of Aspergillus oryzae T1 RNAse (SIGMA)
La concentración de cada muestra se determinó por espectrofotometría a λ= 260 nm, en un Biophotometer Plus (Eppendorf), considerando que una unidad de absorbancia corresponde a 50 g/mL de ADN de doble cadena (Factor 50) calculándose el número de copias de cada diana según la siguiente ecuación: The concentration of each sample was determined by spectrophotometry at λ = 260 nm, in a Biophotometer Plus (Eppendorf), considering that an absorbance unit corresponds to 50 g / mL of double stranded DNA (Factor 50) calculating the number of copies of Each target according to the following equation:
(m * 6,02Λ:1023) (m * 6.02Λ: 10 23 )
en = in =
rp * lxlO9 * 650) rp * lxlO 9 * 650)
En donde :  Where :
cn= número de copias  cn = number of copies
m= masa de la muestra de ADN de doble cadena, en ng.  m = mass of the double stranded DNA sample, in ng.
bp= longitud de la diana en pares de bases (bp).  bp = target length in base pairs (bp).
El trazado de la recta fue realizado por el software de análisis correspondiente a cada equipo de qRTi-PCR, considerándose solamente aquellas rectas con un R2≥ 0,98. b) Construcción de un control interno de amplificación (IAC) The straight line was drawn up by the analysis software corresponding to each qRTi-PCR equipment, considering only those straight lines with an R 2 ≥ 0.98. b) Construction of an internal amplification control (IAC)
Para descartar falsos negativos en la detección y verificar el correcto funcionamiento de las reacciones de qRTi-PCR, se diseñó y construyó un control interno de amplificación (IAC) conformado por una secuencia de ADN exógena a los microorganismos utilizados y a las secuencias correspondientes a los sitios de anillamiento de los cebadores diseñados para las reacciones de qRTi-PCR. To rule out false negatives in the detection and verify the correct functioning of the qRTi-PCR reactions, an internal amplification control (IAC) was designed and constructed consisting of a DNA sequence exogenous to the microorganisms used and the sequences corresponding to the sites banding of primers designed for qRTi-PCR reactions.
La secuencia exógena seleccionada corresponde a un fragmento de 120 pb del gen de la cinamoil-CoA-reductasa de Eucalyptus globulus (GenBank AY656818). Para crear nuevas versiones de este fragmento de ADN que contuviesen añadidas en cada extremo del mismo las secuencias de anillamiento de los cebadores upstream (up) y reverse (rp) usados para las reacciones de qRTi-PCR de cada uno de los cinco tipos de patógenos a cuantificar, se diseñaron a su vez nuevos cebadores que anillasen sobre la secuencia de este gen exógeno y que en los extremos 5' incorporasen las secuencias correspondientes a los sitios de anillamiento de los cebadores para cada una de las cinco dianas genéticas específicas a los patógenos a cuantificar. Se generó así el fragmento a usar como IAC quimérico. The exogenous sequence selected corresponds to a 120 bp fragment of the cinnamoyl-CoA reductase gene of Eucalyptus globulus (GenBank AY656818). To create new versions of this DNA fragment that contain the upstream (up) and banding sequences of primers added at each end thereof reverse (rp) used for the qRTi-PCR reactions of each of the five types of pathogens to be quantified, new primers were designed in turn to annihilate the sequence of this exogenous gene and to incorporate the sequences into the 5 ' ends corresponding to the banding sites of the primers for each of the five genetic targets specific to the pathogens to be quantified. The fragment to be used as a chimeric IAC was thus generated.
Para la detección de la amplificación del IAC, se diseñó una sonda TaqMan® específica (TaqMan-GVR-lAC), con tres versiones diferentes que incorporan cada una un fluoroforo distinto, de forma que se hiciese posible cualquiera de las combinaciones dúplex de estos cinco tipos de patógenos. c) qRTi-PCR uniplex. For the detection of IAC amplification, a specific TaqMan ® probe (TaqMan-GVR-lAC) was designed, with three different versions each incorporating a different fluorophore, so that any of the duplex combinations of these five became possible types of pathogens. c) qRTi-PCR uniplex.
Se realizaron ensayos de qRTi-PCR en modo uniplex, en las cuales se añadió solo una pareja de cebadores (up/rp) y una sonda específicos para un microorganismo dado. Inicialmente se llevaron a cabo reacciones con diluciones seriadas de ADNg de cada microorganismo, sus cebadores y sonda correspondiente.  QRTi-PCR assays were performed in uniplex mode, in which only a pair of primers (up / rp) and a specific probe for a given microorganism were added. Initially, reactions were carried out with serial dilutions of the gDNA of each microorganism, its primers and corresponding probe.
Posteriormente se elaboró una recta patrón de cuantificación en cada placa de reacción, para cada microorganismo, con cinco diluciones decimales seriadas, por triplicado, del ADNg estándar ya descrito. Las concentraciones de los reactivos empleados y las condiciones de reacción inicialmente utilizadas fueron las indicadas por el fabricante de la mezcla maestra utilizada (Tablas 8 y 9). Subsequently, a straight quantification standard was developed in each reaction plate, for each microorganism, with five serial dilutions serially, in triplicate, of the standard gDNA already described. The concentrations of the reagents used and the reaction conditions initially used were those indicated by the manufacturer of the master mix used (Tables 8 and 9).
Recta Patrón de Cuantificación Straight Quantification Pattern
COMPONENTE CONC. INICIAL CONC. FINAL en la  CONC. COMPONENT INITIAL CONC. FINAL in the
reacción  reaction
qPCR Master 2X 1X  qPCR Master 2X 1X
Mix  Mix
Cebador up 20 μΜ  20 μΜ primer
Cebador rp 20 μΜ A optimizar  20 μΜ rp primer To optimize
SondaTaq an 2,5 mM  2.5 mM probe
ADNg Diluciones decimales Diluciones decimales Estándar seriadas seriadas  ADNg Decimal dilutions Standard dilutions Standard serial serials
H20 0 0 Tabla 8. Mezcla de reacción para la elaboración de recta patrón de cuantificación de microorganismos por qRTi-PCR. H 2 0 0 0 Table 8. Reaction mixture for the elaboration of straight-line quantification pattern of microorganisms by qRTi-PCR.
Figure imgf000048_0002
Figure imgf000048_0002
Tabla 9. Condiciones de amplificación para muestras a cuantificar por qRTi-PCR uniplex. d) qRTi-PCR dúplex.  Table 9. Amplification conditions for samples to be quantified by qRTi-uniplex PCR. d) qRTi-PCR duplex.
Se llevaron a cabo ensayos de qRTi-PCR en modo múltiplex, para la detección simultánea de dos microorganismos patógenos. Para ello se incluyó en cada reacción el par de cebadores y la sonda TaqMan® específica a cada uno de estos dos patógenos, añadiendo además el IAC con su respectiva sonda. Se pusieron a punto todas las combinaciones posibles de sondas TaqMan® correspondientes a los cinco patógenos y al IAC (Tabla 10).  QRTi-PCR assays were carried out in multiplex mode, for the simultaneous detection of two pathogenic microorganisms. For this, the pair of primers and the specific TaqMan® probe were included in each reaction to each of these two pathogens, also adding the IAC with its respective probe. All possible combinations of TaqMan® probes corresponding to the five pathogens and the IAC (Table 10) were developed.
Figure imgf000048_0001
TaqMan-
Figure imgf000048_0001
TaqMan-
TaqMan- TaqMan-TaqMan- TaqMan-
S. aureus FAM B. cereus VI C GVR- NED S. aureus FAM B. cereus VI C GVR- NED
GVR-SA GVR-BC  GVR-SA GVR-BC
IAC2  IAC2
TaqMan- TaqMan-
C. TaqMan-C. TaqMan-
VIC GVR- NED perfringens GVR-CP VIC GVR- NED perfringens GVR-CP
IAC2  IAC2
TaqMan- TaqMan-
TaqMan-TaqMan-
E. coli NED GVR- VI C E. coli NED GVR- VI C
GVR-EC  GVR-EC
Fam. TaqMan- IAC1  Fam. TaqMan- IAC1
Cy5  Cy5
Enterobacteriaceae GVR-EB TaqMan- Enterobacteriaceae GVR-EB TaqMan-
TaqMan-TaqMan-
S. aureus FAM GVR- NED S. aureus FAM GVR- NED
GVR-SA  GVR-SA
IAC2  IAC2
TaqMan- TaqMan-
TaqMan-TaqMan-
B. cereus FAM GVR- NED B. cereus FAM GVR- NED
GVR-BC  GVR-BC
IAC2  IAC2
Tabla 10. Combinaciones de sondas TaqMan® para microorganismos e IAC, en reacciones de qRTi-PCR dúplex. M1 : microorganismo 1 ; M2: microorganismo 2, F: fluoroforo o repórter de la sonda TaqMan. Las condiciones usadas inicialmente en la detección dúplex se muestran en las Tablas 9 y 1 1. Table 10. TaqMan ® probe combinations for microorganisms and IAC, in duplex qRTi-PCR reactions. M1: microorganism 1; M2: microorganism 2, F: fluoroforo or reporter of the TaqMan probe. The conditions initially used in duplex detection are shown in Tables 9 and 1 1.
Figure imgf000049_0001
Tabla 11. Mezcla de reacción para la cuantificación de microorganismos por qRTi- PCR
Figure imgf000049_0001
Table 11. Reaction mixture for quantification of microorganisms by qRTi- PCR
RESULTADOS 1. Diseño y optimización de un método de PCR múltiplex (mPCR) para la detección simultánea de siete especies, dos géneros, una familia y una cepa de bacterias patógenas de transmisión alimentaria. RESULTS 1. Design and optimization of a multiplex PCR method (mPCR) for the simultaneous detection of seven species, two genera, a family and a strain of foodborne pathogenic bacteria.
1.1. Selección de dianas genéticas y diseño de cebadores para su detección por PCR múltiplex. 1.1. Selection of genetic targets and design of primers for detection by multiplex PCR.
Para cada microorganismo abordado en esta invención, se seleccionó una diana genética con el objetivo de su amplificación posterior con una pareja de cebadores específicos para la misma, y detectar así el microorganismo en cuestión. Se escogieron dianas que se correspondiesen a genes con un alto grado de conservación en la especie tratada, con el fin de evitar variaciones entre serovariedades o cepas del microorganismo correspondiente. De igual forma, todas estas dianas se eligieron de modo que no existiesen en otras especies emparentadas, como las interferentes usadas aquí como control negativo.  For each microorganism addressed in this invention, a genetic target was selected for the purpose of its subsequent amplification with a pair of primers specific thereto, and thus detect the microorganism in question. Targets were chosen that corresponded to genes with a high degree of conservation in the treated species, in order to avoid variations between serovars or strains of the corresponding microorganism. Similarly, all these targets were chosen so that they did not exist in other related species, such as the interferers used here as a negative control.
Así mismo se evitó el uso de genes que codificasen toxinas presentes solamente en algunas variantes de una misma especie, para evitar que otras variedades sin esas toxinas quedasen fuera del rango de detección y se produjesen por tanto falsos negativos. Likewise, the use of genes encoding toxins present only in some variants of the same species was avoided, to prevent other varieties without those toxins from being outside the detection range and therefore producing false negatives.
Una vez escogidas las dianas genéticas específicas para cada patógeno (Tabla 12), se obtuvo su secuencia proteica desde bases de datos como GenBank, y la misma fue analizada con la herramienta BlastP, con el fin de identificar las zonas conservadas de cada proteína dentro de la misma especie, género o familia abordados y así proceder al diseño de cebadores específicos sobre esas zonas que mejor cumpliesen nuestros requerimientos en cada caso. Once the specific genetic targets for each pathogen were chosen (Table 12), its protein sequence was obtained from databases such as GenBank, and it was analyzed with the BlastP tool, in order to identify the conserved areas of each protein within the same species, genus or family addressed and thus proceed to the design of specific primers on those areas that best meet our requirements in each case.
Microorganismo Siglas Gen diana Número de acceso  Microorganism Acronyms Gen target Access number
B. cereus BC cerA-B M24149 B. cereus BC cerA-B M24149
C. jejuni CJ pldA WP002923613C. jejuni CJ pldA WP002923613
C. perfringens CP rpls WP01 1592605.1C. perfringens CP rpls WP01 1592605.1
C. sakazakii CS kpsT WP_007898503.1C. sakazakii CS kpsT WP_007898503.1
E. coli EC uidA ΕΟΧ2196.1 E. coli 0157.-H7 H7 stx2A AB168105.1 E. coli EC uidA 192196.1 E. coli 0157.-H7 H7 stx2A AB168105.1
Fam. Enterobacteriaceae EB 16S rRNA AJ62919.1  Fam. Enterobacteriaceae EB 16S rRNA AJ62919.1
L. monocytogenes LM hly ABG8185.1  L. monocytogenes LM hly ABG8185.1
Salmonella spp. SE invA ABY21687.1  Salmonella spp. INVY ABY21687.1
Shigella spp. SH ipaA ABB64682.1 Shigella spp. SH ipaA ABB64682.1
S. aureus SA coa CA36434.1S. aureus SA coa CA36434.1
Tabla 12. Dianas genéticas seleccionadas, y sus números de acceso en GenBank, para cada uno de los patógenos utilizados en esta invención. Table 12. Selected genetic targets, and their GenBank access numbers, for each of the pathogens used in this invention.
A partir de las secuencias de las dianas mostradas en la Tabla 12, se diseñaron parejas de cebadores para la amplificación de una región específica de ese ADN de cada microorganismo patógeno. Las diferentes regiones de amplificación seleccionadas difieren de modo premeditado en su longitud, de tal forma que los productos de amplificación generados en la PCR múltiplex puedan diferenciarse fácilmente por medio de electroforesis capilar o en gel de agarosa. From the sequences of the targets shown in Table 12, primer pairs were designed for amplification of a specific region of that DNA from each pathogenic microorganism. The different amplification regions selected differ premeditated in length, so that amplification products generated in multiplex PCR can be easily differentiated by capillary electrophoresis or agarose gel.
El diseño de cada uno de estos amplicones de forma individual para cada diana se realizó mediante el programa Primer3, indicando las longitudes mínima, óptima y máxima que se deseaba obtener y consiguiendo de esta forma parejas de cebadores que generasen amplicones con tamaños con al menos 10 pb de diferencia entre distintos patógenos. The design of each of these amplicons individually for each target was carried out through the Primer3 program, indicating the minimum, optimal and maximum lengths that were desired and thus obtaining pairs of primers that generated amplicons with sizes with at least 10 pb difference between different pathogens.
La lista completa de la secuencia de los cebadores obtenidos y el tamaño de los productos de amplificación generados para cada microorganismo patógeno se muestran en la Tabla 1. The complete list of the sequence of the primers obtained and the size of the amplification products generated for each pathogenic microorganism are shown in Table 1.
Figure imgf000051_0001
(SEQ ID NO:
Figure imgf000051_0001
(SEQ ID NO:
4)  4)
GVR-CP- Mpx-up  GVR-CP- Mpx-up
TGGGAAAGTTC I I I CAACACC  TGGGAAAGTTC I I I CAACACC
(SEQ ID NO:  (SEQ ID NO:
Clostridium 5)  Clostridium 5)
116 perfringens GVR-CP- Mpx-rp GAGAAAGAATCCAAGTATTCGAAG (SEQ ID NO: G  116 perfringens GVR-CP- Mpx-rp GAGAAAGAATCCAAGTATTCGAAG (SEQ ID NO: G
6)  6)
GVR-CS- Mpx-up  GVR-CS- Mpx-up
TGGCATCATCAACACTTTCGT  TGGCATCATCAACACTTTCGT
(SEQ ID NO:  (SEQ ID NO:
Cronobacter 7)  Chronobacter 7)
207 sakazakii GVR-CS- Mpx-rp  207 sakazakii GVR-CS- Mpx-rp
TCGACTACTACCTGGTGGACG  TCGACTACTACCTGGTGGACG
(SEQ ID NO:  (SEQ ID NO:
8)  8)
GVR-EC- Mpx-up  GVR-EC- Mpx-up
GTTGGTGGGAAAGCGCGTTACA  GTTGGTGGGAAAGCGCGTTACA
(SEQ ID NO:  (SEQ ID NO:
9)  9)
Escherichia coli 70  Escherichia coli 70
GVR-EC- Mpx-rp  GVR-EC- Mpx-rp
CGTTAAAACTGCCTGGCACAG  CGTTAAAACTGCCTGGCACAG
(SEQ ID NO:  (SEQ ID NO:
10)  10)
GVR-H7- Mpx-up  GVR-H7- Mpx-up
TGGGTACTGTGCCTGTTACTG  TGGGTACTGTGCCTGTTACTG
(SEQ ID NO:  (SEQ ID NO:
Cepa 1 1 )  Strain 1 1)
enterohemorrágica 216 de E. coli GVR-H7- Mpx-rp enterohemorrhagic 216 of E. coli GVR-H7- Mpx-rp
AAGCCCTCGTATATCCACAGC  AAGCCCTCGTATATCCACAGC
(SEQ ID NO:  (SEQ ID NO:
12)  12)
GVR-EB- Mpx-up  GVR-EB- Mpx-up
TCAGAGTTCCCGAAGGCACTC  TCAGAGTTCCCGAAGGCACTC
(SEQ ID NO.  (SEQ ID NO.
Fam. 13)  Fam. 13)
77 77
Enterobacteriaceae GVR-EB- Mpx-rp Enterobacteriaceae GVR-EB- Mpx-rp
GCAACGCGAAGAACCTTACCT  GCAACGCGAAGAACCTTACCT
(SEQ ID NO:  (SEQ ID NO:
14)  14)
GVR-LM- Mpx-up  GVR-LM- Mpx-up
TGACGAAATGGCTTACAGTGA  TGACGAAATGGCTTACAGTGA
(SEQ ID NO:  (SEQ ID NO:
Listeria 15)  Listeria 15)
163 monocytogenes GVR-LM- Mpx-rp  163 monocytogenes GVR-LM- Mpx-rp
GCCGAAGTTTACATTCAAGCT  GCCGAAGTTTACATTCAAGCT
(SEQ ID NO:  (SEQ ID NO:
16)  16)
Salmonella spp. GVR-SE- CCCGATTTTCTCTGGATGGT 176 Mpx-up Salmonella spp. GVR-SE- CCCGATTTTCTCTGGATGGT 176 Mpx-up
(SEQ ID NO:  (SEQ ID NO:
17)  17)
GVR-SE- Mpx-rp  GVR-SE- Mpx-rp
GGCAATAGCGTCACCTTTGA  GGCAATAGCGTCACCTTTGA
(SEQ ID NO:  (SEQ ID NO:
18)  18)
GVR-SH- Mpx-up TCAAAACACATTGATGAGTATCAG  GVR-SH- Mpx-up TCAAAACACATTGATGAGTATCAG
(SEQ ID NO: G  (SEQ ID NO: G
19)  19)
Shigella spp. 150  Shigella spp. 150
GVR-SH- Mpx-rp  GVR-SH- Mpx-rp
TACATCTTTTTGACCGGACTTCTTA  TACATCTTTTTGACCGGACTTCTTA
(SEQ ID NO:  (SEQ ID NO:
20)  twenty)
GVR-SA- Mpx-up  GVR-SA- Mpx-up
GCAACTGAAACAACAGAAGCT  GCAACTGAAACAACAGAAGCT
(SEQ ID NO:  (SEQ ID NO:
Staphylococcus 21)  Staphylococcus 21)
101 aureus GVR-SA- Mpx-rp  101 aureus GVR-SA- Mpx-rp
TCACGGATACCTGTACCAGCA  TCACGGATACCTGTACCAGCA
(SEQ DI NO:  (SEQ DI NO:
22)  22)
Tabla 1. Parejas de cebadores diseñados para la detección múltiplex de ocho microorganismos, dos géneros y una familia de patógenos alimentarios. La Tm teórica de amplificación en todos los casos es de 56° C.  Table 1. Couples of primers designed for the multiplex detection of eight microorganisms, two genera and a family of foodborne pathogens. The theoretical amplification Tm in all cases is 56 ° C.
Todas las parejas de cebadores en conjunto fueron evaluadas mediante la función Primer Test del programa FastPCR, de tal forma que se garantizase la compatibilidad teórica de dichas parejas en las reacciones múltiplex. De esta manera se garantizaba, al menos in silico, que los cebadores hibridasen lo menos posible entre ellos o sobre ellos mismos y en consecuencia se reducía la probabilidad de formar dimeros de cebadores y otras estructuras no deseadas. All primer pairs as a whole were evaluated by means of the First Test function of the FastPCR program, in such a way that the theoretical compatibility of these pairs in multiplex reactions was guaranteed. In this way it was guaranteed, at least in silico, that the primers hybridized as little as possible between them or on themselves and consequently the probability of forming dimers of primers and other unwanted structures was reduced.
Cada pareja de cebadores fue probada primero individualmente en reacciones uniplex, en las cuales se utilizó como molde el ADN genómico (ANDg) del microorganismo al que correspondían los cebadores, comprobándose de esta forma el correcto funcionamiento y la producción de amplicones con el tamaño correspondiente. Este tipo de pruebas fueron visualizadas en geles de agarosa al 5% de concentración. La composición de las mezclas de reacción y las condiciones de reacción se muestran en las Tablas 13 y 14. Componente Concentración Concentración Each pair of primers was first tested individually in uniplex reactions, in which the genomic DNA (ANDg) of the microorganism to which the primers corresponded was used as a template, thus checking the correct functioning and production of amplicons with the corresponding size. These types of tests were visualized in agarose gels at 5% concentration. The composition of the reaction mixtures and the reaction conditions are shown in Tables 13 and 14. Component Concentration Concentration
Inicial Final  Last initial
AmpliTaq Gold 360 2X 1X  AmpliTaq Gold 360 2X 1X
M áster Mix  Master Mix
Cebador UP 20 μΜ 1 μΜ Primer 20 μΜ 1 μΜ
Cebador RP 20 μΜ 1 μΜ Primer RP 20 μΜ 1 μΜ
ADNg Desconocida Desconocida  ADNg Unknown Unknown
H20 0 0H 2 0 0 0
Tabla 13. Mezcla de reacción para PCR convencional uniplex. Table 13. Reaction mixture for conventional uniplex PCR.
Figure imgf000054_0001
Figure imgf000054_0001
Tabla 14. Condiciones de reacción usadas en PCR convencional uniplex.  Table 14. Reaction conditions used in conventional uniplex PCR.
A partir de estos geles de agarosa se purificaron los amplicones obtenidos para su secuenciación posterior, y se comprobó que en todos los casos el amplicón secuenciado correspondía a la región esperada de amplificación. From these agarose gels the amplicons obtained for subsequent sequencing were purified, and it was found that in all cases the sequenced amplicon corresponded to the expected region of amplification.
De forma similar, para cada pareja de cebadores se comprobó de forma individual si eran capaces de amplificar alguna región usando como molde el ADNg de las diferentes especies de microorganismos interferentes listadas en la Tabla 4. En todos los casos, el experimento de PCR no generó ninguna banda de amplificación, lo que demostraba en principio que no eran esperables falsos positivos obtenidos por amplificación desde otras especies emparentadas filogenéticamente con los 1 tipos de patógenos ensayados. Similarly, for each pair of primers, it was individually verified whether they were able to amplify any region using as a template the gDNA of the different interfering microorganism species listed in Table 4. In all cases, the PCR experiment did not generate no amplification band, which demonstrated in principle that false positives obtained by amplification from other species related phylogenetically with the 1 types of pathogens tested were not expected.
Como excepciones a esto hay que aclarar que en el caso de la pareja de cebadores diseñada para detección de miembros de la Familia Enterobacteriaceae, se obutvo amplificación a partir de C, sakazakii, E. coli, E. coli 0157:1-17, las cuatro especies de Shigella spp. ensayadas, los 13 tipos de Salmonella spp. ensayados, y las otras 24 especies de la Familia Enterobacteriaceae de la colección representada en la Tabla 4. Además, en el caso de la pareja de cebadores para el género Salmonella, todas las especies y serovariedades del mismo (en total 13 tipos) presentes en la Tabla 4 arrojaron amplificación correcta. Por último, en el caso de la pareja de cebadores para el género Shigella, las 4 especies presentes en la Tabla 4 arrojaron amplificación correcta. As exceptions to this it should be clarified that in the case of the pair of primers designed for detection of members of the Enterobacteriaceae Family, amplification was obtained from C, sakazakii, E. coli, E. coli 0157: 1-17, four species of Shigella spp. tested, the 13 types of Salmonella spp. tested, and the other 24 Species of the Enterobacteriaceae Family from the collection represented in Table 4. In addition, in the case of the pair of primers for the genus Salmonella, all species and serovars thereof (in total 13 types) present in Table 4 showed correct amplification . Finally, in the case of the pair of primers for the genus Shigella, the 4 species present in Table 4 showed correct amplification.
1.2 Optimización del método para PCR múltiplex 1.2 Method optimization for multiplex PCR
Una vez comprobado el funcionamiento de los cebadores mediante estas reacciones uniplex sobre ADNg de cada patógeno de forma individual, se procedió a optimizar las concentraciones de cada cebador y la Tm de la reacción para conseguir la amplificación de todas las dianas en reacciones múltiplex. Para esto, se comenzó con la optimización individual de cada par de cebadores ensayando 16 combinaciones de concentración del cebador up y el rp, así como cinco temperaturas de hibridación diferentes para cada una de esas 16 combinaciones (Tabla 15). Once the functioning of the primers was verified by means of these uniplex reactions on the gDNA of each pathogen individually, the concentrations of each primer and the Tm of the reaction were optimized to achieve the amplification of all targets in multiplex reactions. For this, the individual optimization of each pair of primers began by testing 16 combinations of concentration of the primer up and the rp, as well as five different hybridization temperatures for each of those 16 combinations (Table 15).
Figure imgf000055_0001
Figure imgf000055_0001
Tabla 15. Condiciones de optimización individual para las 1 parejas de cebadores. Cada reacción fue visualizada en geles de agarosa al 5%, y los resultados se muestran en las Figuras 1 a la 1 1. Table 15. Individual optimization conditions for the 1 pairs of primers. Each reaction was visualized on 5% agarose gels, and the results are shown in Figures 1 through 1 1.
A partir de estas pruebas se identificaron las temperaturas y concentraciones óptimas de cada cebador en las cuales se había obtenido la mayor concentración del amplicón correspondiente. En la Tabla 16 se indican las combinaciones de concentración y temperatura que mostraron mayor rendimiento en las pruebas ya comentadas. From these tests the optimum temperatures and concentrations of each primer were identified in which the highest concentration of the corresponding amplicon had been obtained. Table 16 shows the concentration and temperature combinations that showed the highest performance in the tests already mentioned.
Figure imgf000056_0001
Figure imgf000056_0001
Tabla 16. Combinaciones de parejas de cebadores y temperaturas de hibridación que generaron ios mejores resultados en la optimización individual de las parejas de cebadores. En negritas se indican las temperaturas en las cuales la intensidad de la banda observada en agarosa, y correspondiente al amplicón deseado, era más intensa. Las concentraciones de cebadores se describen en la Tabla 15.  Table 16. Combinations of primer pairs and hybridization temperatures that generated the best results in individual optimization of primer pairs. In bold, the temperatures at which the intensity of the band observed in agarose, and corresponding to the desired amplicon, were more intense are indicated. Primer concentrations are described in Table 15.
A continuación, usando como referencia los resultados de la optimización individual de cada par de cebadores, se procedió a la optimización de las concentraciones y temperaturas para las reacciones múltiplex. Estos experimentos se iniciaron con los cebadores correspondientes a Salmonella spp. y a Shigella spp.. A cada par de cebadores se le asignó una concentración de las escogidas y se combinaron en todas las formas posibles con dos temperaturas de hibridación: 56° C y 58° C. En las pruebas iniciales, la visualización se llevó a cabo en geles de agarosa al 5% y a medida que el número de amplicones a obtener fue aumentando, estas visualizaciones se realizaron por electroforesis capilar en el sistema Bioanalyzer 2100. Las combinaciones 15/15, 15/16, 16/15 y 16/16 (ver Tabla 15) para los cebadores de ambos microorganismos mostraron una eficiencia bastante similar en cuanto a intensidad de bandas de amplificación se refiere. Ante la necesidad de escoger una combinación para continuar con el proceso de amplificación, se decidió mantener la combinación 16/16 de ambas parejas de cebadores y a partir de ésta, añadir una nueva pareja de cebadores, compuesta por GVR-LM- px-up/rp, específicos para L. monocytogenes, ensayando con las mismas combinaciones de la amplificación anterior y las mismas temperaturas de hibridación. Then, using the results of the individual optimization of each pair of primers as a reference, the concentrations and temperatures were optimized for the multiplex reactions. These experiments were initiated with the primers corresponding to Salmonella spp. and to Shigella spp .. Each pair of primers was assigned a concentration of the chosen ones and they were combined in all possible ways with two hybridization temperatures: 56 ° C and 58 ° C. In the initial tests, the visualization was taken to carried out in 5% agarose gels and as the number of amplicons to be obtained increased, these visualizations were performed by capillary electrophoresis in the Bioanalyzer 2100 system. The combinations 15/15, 15/16, 16/15 and 16/16 (see Table 15) for the primers of both microorganisms showed a fairly similar efficiency in terms of intensity of amplification bands. Given the need to choose a combination to continue the amplification process, it was decided to keep the combination 16/16 of both pairs of primers and from this, add a new pair of primers, consisting of GVR-LM- px-up / rp, specific for L. monocytogenes, testing with the same combinations of the above amplification and the same hybridization temperatures.
Una vez llevada a cabo esta nueva reacción de PCR, se observó que se generaban los amplicones esperados en las combinaciones ensayadas, siendo más uniformes las bandas obtenidas para los tres microorganismos, cuando se aplicó la combinación 16 (1 μΜ/1 μΜ) en las tres parejas de cebadores a una temperatura de 56° C. En estas reacciones se incluyeron muestras en las cuales se hallaba presente el ADNg de cada microorganismo de forma independiente, con el fin de facilitar la identificación de los amplicones por comparación. Once this new PCR reaction was carried out, it was observed that the expected amplicons were generated in the combinations tested, the bands obtained for the three microorganisms being more uniform, when the combination 16 (1 μΜ / 1 μΜ) was applied in the three pairs of primers at a temperature of 56 ° C. In these reactions samples were included in which the gDNA of each microorganism was present independently, in order to facilitate the identification of amplicons by comparison.
Se prosiguió a continuación con la optimización añadiendo en una nueva reacción de mPCR los cebadores correspondientes a S. aureus: GVR-SA-Mpx-up/rp, y simultáneamente en otra reacción distinta, el par de cebadores diseñado para E. coli 0157:H7, y por último en una tercera reacción ambos pares. En estos tres casos se mantuvieron los tres pares de cebadores anteriores ya optimizados (SE, SH y LM) con la combinación 16 ya descrita. En estas tres nuevas reacciones de mPCR se ensayaron las combinaciones 15 y 16 de cada nuevo par de cebadores, a 56° C y 58° C. Optimization was then continued by adding in a new mPCR reaction the primers corresponding to S. aureus: GVR-SA-Mpx-up / rp, and simultaneously in a different reaction, the pair of primers designed for E. coli 0157: H7, and finally in a third reaction both pairs. In these three cases, the three previous optimized primer pairs (SE, SH and LM) were maintained with the combination 16 already described. In these three new mPCR reactions, combinations 15 and 16 of each new pair of primers were tested at 56 ° C and 58 ° C.
A partir de este ensayo no fue ya posible seguir visualizando los amplicones mediante electroforesis en gel de agarosa al 5%, por lo que estas comprobaciones se llevaron a cabo a través de electroforesis capilar, utilizando el sistema Bioanalyzer 2100. From this test it was no longer possible to continue visualizing the amplicons by electrophoresis in 5% agarose gel, so these checks were carried out through capillary electrophoresis, using the Bioanalyzer 2100 system.
Con este ensayo se consiguió obtener amplicones para los cinco microorganismos deseados, con los cinco pares de cebadores correspondientes. Las dos combinaciones evaluadas para el par de cebadores específicos para E. coli 0157:1-17 y las utilizadas para los demás no parecieron generan grandes diferencias en los productos de amplificación en general. Pero cuando estas concentraciones fueron combinadas con diferentes temperaturas de hibridación, se favorecieron los picos correspondientes a Shigella spp. y a L. monocytogenes, específicamente con la combinación 15 para E. coli 0157:H7 a 56° C. A pesar de esto y como la diferencia no fue muy marcada, se continuó el proceso de optimización añadiendo los cebadores correspondientes a E. coli, probándose estos con las combinaciones 15 y 16 y a 56° C y 58° C, manteniendo los demás cebadores con la combinación 16. With this test it was possible to obtain amplicons for the five desired microorganisms, with the five pairs of corresponding primers. The two combinations evaluated for the pair of primers specific for E. coli 0157: 1-17 and those used for the others did not appear to generate large differences in amplification products in general. But when these concentrations were combined with different hybridization temperatures, the peaks corresponding to Shigella spp. and L. monocytogenes, specifically with the combination 15 for E. coli 0157: H7 at 56 ° C. Despite this and since the difference was not very marked, the optimization process was continued by adding the primers corresponding to E. coli, testing these with combinations 15 and 16 and at 56 ° C and 58 ° C, keeping the other primers with combination 16.
Esta misma estrategia fue mantenida en la incorporación de cada uno de los pares de cebadores restantes, ajusfando al alza o a la baja, en función de los resultados observados en cada caso, la concentración de aquellos cebadores que generaron picos más reducidos o aquellos con picos más elevados, regulando de esta manera el rendimiento de los mismos en la reacción. This same strategy was maintained in the incorporation of each of the remaining pairs of primers, adjusting up or down, depending on the results observed in each case, the concentration of those primers that generated smaller peaks or those with more peaks high, thereby regulating their performance in the reaction.
Finalmente, después de un extenso número de experimentos, se consiguió obtener amplificación para las dianas genéticas seleccionadas para B. cereus, C. jejuni, C. perfringens, C. sakazakii, E coli, E. coli 0157.H7, Familia Enterobacteriaceae, L. monocytogenes, Salmonella spp., Shigella spp. y S. aureus, utilizando los cebadores diseñados para tal fin. Las condiciones de esta amplificación múltiplex completa se describen en las Tablas 17 y 18 siguientes. Finally, after an extensive number of experiments, amplification was obtained for the genetic targets selected for B. cereus, C. jejuni, C. perfringens, C. sakazakii, E coli, E. coli 0157.H7, Family Enterobacteriaceae, L Monocytogenes, Salmonella spp., Shigella spp. and S. aureus, using primers designed for this purpose. The conditions of this complete multiplex amplification are described in Tables 17 and 18 below.
Figure imgf000058_0001
Figure imgf000058_0001
Tabla 17. Mezcla de reacción usada para la amplificación PCR múltiplex de siete especies, dos géneros, una familia y una cepa de patógenos alimentarios. Paso Temperatura Duración Ciclos Table 17. Reaction mixture used for multiplex PCR amplification of seven species, two genera, one family and one strain of foodborne pathogens. Step Temperature Duration Cycles
Desnaturalización 95° C 80 segundos 1  Denaturation 95 ° C 80 seconds 1
Desnaturalización 95° C 30 segundos  Denaturation 95 ° C 30 seconds
Anillamiento 56° C 60 segundos 35 Banding 56 ° C 60 seconds 35
Extensión 72 ° C 90 segundos Extension 72 ° C 90 seconds
Extensión final 72 0 C 420 segundos 1Final extension 72 0 C 420 seconds 1
Tabla 18. Condiciones de reacción usadas para la amplificación PCR múltipl siete especies, dos géneros, una familia y una cepa de patógenos alimentarios. Table 18. Reaction conditions used for PCR amplification multiply seven species, two genera, one family and one strain of foodborne pathogens.
Los resultados obtenidos se muestran en el electroferograma de la Figura 12. The results obtained are shown in the electropherogram of Figure 12.
Adicionalmente se llevaron a cabo otras reacciones de PCR múltiplex separando a los microorganismos en dos grupos en función a su pertenencia o no a la Familia Enterobacteriaceae. En el primer grupo se encuentran C. sakazakii, E. coli y E. coli 0157:1-17, Salmonella spp. y Shigella spp.,y, todos ellos enterobacterias. En el segundo grupo se encuentran B. cereus, C. jejuni, C. períríngens, L. monocytogenes y S. aureus, Additionally, other multiplex PCR reactions were carried out by separating the microorganisms into two groups depending on whether or not they belonged to the Enterobacteriaceae Family. In the first group are C. sakazakii, E. coli and E. coli 0157: 1-17, Salmonella spp. and Shigella spp., and, all of them enterobacteria. In the second group are B. cereus, C. jejuni, C. períríngens, L. monocytogenes and S. aureus,
Se realizó una reacción para cada grupo, en la que se encontraba presente sólo el ADNg de cada uno de los microorganismos que conformaban dicho grupo y los cebadores específicos para todos los 1 1 microorganismos, en las condiciones de concentración y temperatura aplicadas para la PCR múltiplex ya descritas (Figuras 13A-B). A reaction was performed for each group, in which only the gDNA of each of the microorganisms that made up that group and the specific primers for all 1 1 microorganisms were present, under the concentration and temperature conditions applied for multiplex PCR already described (Figures 13A-B).
Así mismo, este procedimiento se llevó a cabo con el ADNg de cada microorganismo por separado, para mostrar por separado cada amplicón y garantizar que los obtenidos en modo múltiplex se correspondían con estos (Figuras 14A-K). Likewise, this procedure was carried out with the gDNA of each microorganism separately, to show each amplicon separately and ensure that those obtained in multiplex mode corresponded with these (Figures 14A-K).
2. Diseño y optimización de un método de PCR Cuantitativa a Tiempo Real (qRTi-PCR) para la cuantificación de cuatro microorganismos y una familia de patógenos de origen alimentario. 2. Design and optimization of a Real-Time Quantitative PCR method (qRTi-PCR) for the quantification of four microorganisms and a family of foodborne pathogens.
2.1 Selección de dianas genéticas y diseño de cebadores y sondas para qRTi- PCR. 2.1 Selection of genetic targets and design of primers and probes for qRTi- PCR.
A partir de la información obtenida en los resultados del apartado 1.1 , se escogieron dianas genéticas específicas para el diseño de pares de cebadores y sondas TaqMan™ específicas para cada uno de los amplicones esperados. El uso de estas sondas TaqMan™ permite evitar la generación de falsos resultados positivos (como los generables en ocasiones al usar SYBR GREEN u otros compuestos fluorescentes intercalantes en el ADNbc), ya que sólo se detecta fluorescencia a partir de sondas TaqMan hidrolizadas de forma específica por la ADN polimerasa durante la reacción de amplificación. Based on the information obtained in the results of section 1.1, specific genetic targets were chosen for the design of primer pairs and probes TaqMan ™ specific to each of the expected amplicons. The use of these TaqMan ™ probes makes it possible to avoid the generation of false positive results (such as those that are sometimes generated when using SYBR GREEN or other intercalating fluorescent compounds in the cDNA), since fluorescence is only detected from specifically hydrolyzed TaqMan probes by DNA polymerase during the amplification reaction.
Con todos estos componentes se diseñaron experimentos con los que llevar a cabo la cuantificación por qRTi-PCR de cuatro microorganismos y una familia de patógenos de origen alimentario. Las dianas escogidas se muestran en la Tabla 19. With all these components, experiments were designed with which to carry out the quantification by qRTi-PCR of four microorganisms and a family of foodborne pathogens. The selected targets are shown in Table 19.
Número deNumber of
Microorganismo Siglas Diana Diana Acronym Microorganism
acceso  access
B. cereus cerA-B M24149  B. cereus cerA-B M24149
C. perfríngens CP rpls WP011592605.1  C. perfríngens CP rpls WP011592605.1
Familia EB 16s rRNA AJ62919.1  EB 16s family rRNA AJ62919.1
Enterobacteriaceae  Enterobacteriaceae
E. coli EC uidA EOX2196.1  E. coli EC uidA EOX2196.1
S. aureus SA coa CA36434.1  S. aureus SA coa CA36434.1
Tabla 19. Dianas genéticas seleccionadas para la cuantificación por qRTi-PCR de cuatro microorganismos y una familia de patógenos de origen alimentario.  Table 19. Genetic targets selected for quantification by qRTi-PCR of four microorganisms and a family of foodborne pathogens.
Una vez seleccionadas la dianas y obtenidas sus secuencias en GenBank, se procedió al diseño de las parejas de cebadores y sondas TaqMan™, mediante el programa informático Primer Express 3.0. La lista completa de cebadores y sondas se muestra en las Tablas 2 y 3. Once the targets were selected and their sequences were obtained in GenBank, the TaqMan ™ primer and probe pairs were designed using the Primer Express 3.0 software. The complete list of primers and probes is shown in Tables 2 and 3.
Figure imgf000060_0001
Figure imgf000061_0001
Figure imgf000060_0001
Figure imgf000061_0001
Tabla 2: parejas de cebadores empleados en la cuantificación de B. cereus, C. perfringens, un microorganismo de la Familia Enterobacteriaceae, E. coli y/o S. aureus.  Table 2: pairs of primers used in the quantification of B. cereus, C. perfringens, a microorganism of the Enterobacteriaceae Family, E. coli and / or S. aureus.
Figure imgf000061_0002
Figure imgf000061_0002
Tabla 3: sondas empleadas en la cuantificación de B. cereus, C. perfringens, microorganismo de la Familia Enterobacteriaceae, E. coli y/o S. aureus. Se realizaron PCRs convencionales utilizando estas nuevas parejas diseñadas de cebadores y el ADNg de cada microorganismo, con el objeto de obtener amplicones que posteriormente fueron clonados en el vector comercial PCR-Blunt para poder así secuenciarlos, y comprobar la coincidencia de éstos amplicones generados con las dianas genéticas teóricas. Table 3: probes used in the quantification of B. cereus, C. perfringens, microorganism of the Enterobacteriaceae Family, E. coli and / or S. aureus. Conventional PCRs were performed using these new designed pairs of primers and the gDNA of each microorganism, in order to obtain amplicons that were subsequently cloned in the commercial PCR-Blunt vector to be able to sequence them, and check the coincidence of these amplicons generated with the theoretical genetic targets.
2.2 Optimización de pares de cebadores y sondas TaqMan™. 2.2 Optimization of TaqMan ™ primer and probe pairs.
Se llevó a cabo la optimización de la concentración de cada pareja de cebadores y de cada sonda TaqMan, para poder conseguir el mejor rendimiento en cada reacción de qRTi-PCR. Para este proceso se siguieron las indicaciones suministradas por el proveedor de las sondas (Applied Biosystems), las cuales consistieron en la realización de ensayos con diferentes combinaciones de concentración del cebador up y el cebador rp (Tabla 20) a una concentración fija de la sonda, que en este caso fue de 250 nM. Con estas concentraciones se prepararon las reacciones y en función de la calidad de la señal de amplificación obtenida se escogió la que sería empleada en la segunda fase de optimización.  Optimization of the concentration of each pair of primers and each TaqMan probe was carried out, in order to achieve the best performance in each qRTi-PCR reaction. For this process, the indications provided by the supplier of the probes (Applied Biosystems) were followed, which consisted of conducting tests with different combinations of concentration of the primer up and the primer rp (Table 20) at a fixed concentration of the probe , which in this case was 250 nM. With these concentrations the reactions were prepared and based on the quality of the amplification signal obtained, the one that would be used in the second optimization phase was chosen.
Figure imgf000062_0001
Figure imgf000062_0001
Tabla 20. Combinaciones de concentración probadas para la  Table 20. Concentration combinations tested for
optimización de las parejas de cebadores usadas en qRTi-PCR  optimization of primer pairs used in qRTi-PCR
Las condiciones en que fueron realizadas las amplificaciones correspondían a las recomendadas por Applied Biosystems para ensayos de variación en el número de copias y se muestran a continuación (Tabla 21):
Figure imgf000063_0001
The conditions under which the amplifications were performed corresponded to those recommended by Applied Biosystems for tests of variation in the number of copies and are shown below (Table 21):
Figure imgf000063_0001
Applied Biosystems para parejas de cebadores y sondas TaqMan usadas en qRTi-PCR. La combinación de cebadores escogida para llevar a cabo las reacciones de qRTi- PCR fue la n° 1 de la Tabla 20 (0,9 μΜ / 0,9 μΜ), prosiguiendo a continuación con la optimización de cada sonda TaqMan, para las cuales se ensayaron las concentraciones 2,5 μΜ; 0,25 μΜ y 0,05 μΜ. Una vez realizadas todas estas pruebas y con base en los resultados obtenidos, se escogió como concentración de trabajo 0,05 μΜ para cada sonda TaqMan.  Applied Biosystems for primer pairs and TaqMan probes used in qRTi-PCR. The combination of primers chosen to carry out the qRT-PCR reactions was # 1 in Table 20 (0.9 μΜ / 0.9 μΜ), then continuing with the optimization of each TaqMan probe, for which 2.5 μΜ concentrations were tested; 0.25 μΜ and 0.05 μΜ. Once all these tests were carried out and based on the results obtained, 0.05 μΜ was chosen as the working concentration for each TaqMan probe.
2.3. qRTi-PCR uniplex. 2.3. qRTi-PCR uniplex.
Ya con las concentraciones de cebadores y sondas TaqMan definidas, se procedió a realizar pruebas con diluciones decimales seriadas del ADNg de referencia stock de cada microorganismo, cuantificado por espectrofotometría, con el fin de determinar el umbral mínimo de detección de cada tipo de reacción, expresado en términos de equivalentes genómicos del microorganismo. Los mismos fueron calculados a partir de la masa de ADNg en pg, obtenida por espectrofotometría, y el número de pares de bases del genoma de cada microorganismo, utilizando la siguiente ecuación:  With the concentrations of primers and TaqMan probes defined, tests were carried out with serial dilutions of the stock reference DNA of each microorganism, quantified by spectrophotometry, in order to determine the minimum detection threshold of each type of reaction, expressed in terms of genomic equivalents of the microorganism. They were calculated from the mass of gDNA in pg, obtained by spectrophotometry, and the number of base pairs of the genome of each microorganism, using the following equation:
Genoma (pb ) = masa (pg )■ 0,978 x\ Q 9 Genome (pb) = mass (pg) ■ 0.978 x \ Q 9
De esta forma, es posible conocer la masa correspondiente a 1 genoma de cada una de las especies tratadas, y convertir datos de masa de ADNg de cada muestra en número de genomas (Tabla 22). In this way, it is possible to know the mass corresponding to 1 genome of each one of the treated species, and to convert gDNA mass data of each sample into number of genomes (Table 22).
Figure imgf000063_0002
E. coli 5,6 0,0057259
Figure imgf000063_0002
E. coli 5.6 0.0057259
Fam. 5,6 0,0057259 Fam. 5.6 0.0057259
Enterobacteriaceae Enterobacteriaceae
C. perfringens 3,3 0,0033742  C. perfringens 3.3 0.0033742
S. aureus 2,9 0,0029652 S. aureus 2.9 0.0029652
Tabla 22. Masa de un genoma (o genomas equivalentes, GE) para los microorganismos cuantificables por qRTi-PCR. Fuente: genomes online. Table 22. Mass of a genome (or equivalent genomes, GE) for microorganisms quantifiable by qRTi-PCR. Source: genomes online.
Como se evidencia en las Figuras 15A-B y 16A-C, ha sido posible obtener amplificación significativa en las diluciones ensayadas, siendo entonces los umbrales mínimos detectables en cada caso los que se muestran en la Tabla 23. As evidenced in Figures 15A-B and 16A-C, it has been possible to obtain significant amplification in the dilutions tested, then the minimum thresholds detectable in each case are those shown in Table 23.
Figure imgf000064_0001
Figure imgf000064_0001
Tabla 23. Umbral de detección, expresado en genomas equivalentes (GE) para cada uno de los microorganismos sujetos a cuantificación por qRTi-PCR. (*) Obtenido usando como referencia en genoma de E. coli.  Table 23. Detection threshold, expressed in equivalent genomes (GE) for each of the microorganisms subject to quantification by qRTi-PCR. (*) Obtained using as a reference in genome of E. coli.
2.4. qRTi-PCR en modo dúplex. 2.4. qRTi-PCR in duplex mode.
Los valores de concentración resultantes en esta optimización, tanto para parejas de cebadores como de sondas TaqMan, fueron aplicados en reacciones dúplex de qRTi- PCR en las que se encontraban presentes ADNg de dos microorganismos y los cebadores y sondas TaqMan específicos a cada uno de ellos. Las condiciones de reacción, ciclos y temperaturas usadas en esta optimización de las reacciones qRTi- PCR dúplex fueron como las que se indican en las Tablas 15 y 16. The concentration values resulting in this optimization, both for pairs of primers and TaqMan probes, were applied in duplex reactions of qRTi-PCR in which the gDNAs of two microorganisms and the TaqMan primers and probes specific to each of them were present. . The reaction conditions, cycles and temperatures used in this optimization of the duplex qRTi-PCR reactions were as indicated in Tables 15 and 16.
Los resultados de estos ensayos se muestran en las Figuras 17A-C, 18A-C, 19A-B, 20 y 21A-D, en las que se incorpora también el control interno de amplificación (IAC) diseñado. 2.5. Diseño y construcción de un control interno de amplificación quimérico.The results of these tests are shown in Figures 17A-C, 18A-C, 19A-B, 20 and 21A-D, in which the designed internal amplification control (IAC) is also incorporated. 2.5 Design and construction of an internal control of chimeric amplification.
Con el fin de evitar la obtención de falsos resultados negativos y de confirmar el correcto funcionamiento de las reacciones de qRTi-PCR, se diseñó un control interno de amplificación quimérico (QIAC), el cual estaba conformado por una secuencia de ADN heteróloga a las dianas seleccionadas para detección y cuantificación, así como a todos los microorganismos de la colección: un fragmento interno al gen de la cinamoil-CoA reductasa de Eucalyptus globulus (GenBank AY656818). In order to avoid obtaining false negative results and to confirm the correct functioning of the qRTi-PCR reactions, an internal chimeric amplification control (QIAC) was designed, which was made up of a DNA sequence heterologous to the targets selected for detection and quantification, as well as all the microorganisms in the collection: a fragment internal to the cinnamoyl-CoA reductase gene of Eucalyptus globulus (GenBank AY656818).
La construcción de este QIAC fue llevada a cabo mediante la adición progresiva de los sitios de anillamiento de los cebadores diseñados para qRTi-PCR, por medio de reacciones de PCR en las cuales se incorporaron cebadores de gran longitud, diseñados manualmente (Tabla 24). The construction of this QIAC was carried out by the progressive addition of the banding sites of the primers designed for qRTi-PCR, by means of PCR reactions in which large, manually designed primers were incorporated (Table 24).
Figure imgf000065_0001
Figure imgf000065_0001
Tabla 24. Cebadores utilizados para la construcción del IAC quimérico (QIAC). Cada pareja añade progresivamente un grupo de sitios de anillamiento para los cebadores específicos a cada microorganismo.  Table 24. Primers used for the construction of the chimeric IAC (QIAC). Each pair progressively adds a group of banding sites for specific primers to each microorganism.
SEQ ID NO: 42 SEQ ID NO: 42
AAAATGGGAAAGTTCTTTCAACACCAAGCGGGACTTAACCCAACATTTCACAAAGGATTGTCAA GCTGCTCCTC AAAATGGGAAAGTTCTTTCAACACCAAGCGGGACTTAACCCAACATTTCACAAAGGATTGTCAA GCTGCTCCTC
SEQ ID NO: 43 SEQ ID NO: 43
AAAATGGTCTCGCTTCATATCCAAAACCGGCGTAGTTAAAGAAATCATGAAGCTCCGTCCAGCT CTCTC AAAATGGTCTCGCTTCATATCCAAAACCGGCGTAGTTAAAGAAATCATGAAGCTCCGTCCAGCT CTCTC
SEQ ID NO: 44 SEQ ID NO: 44
AAAACCGCAATTTAACAAAACACCAAGGTCGTAGTAGTGGAAGCGAATGAATGGGAAAGTTCTT TCAACACCAAAACCGCAATTTAACAAAACACCAAGGTCGTAGTAGTGGAAGCGAATGAATGGGAAAGTTCTT TCAACACC
SEQ ID NO: 45: SEQ ID NO: 45:
AAAAAAAAACAAAACGGTGGATTAAGAGAAGCAACGCCACCATCTTCAGAATGGTCTCGCTTCA TATCCAA SEQ ID NO: 46 AAAAAAGC T T G G T GAT T AC C G AC G AAAAC G AAC C G C AA T T AAC AAAAC AC C AAAAAAAAACAAAACGGTGGATTAAGAGAAGCAACGCCACCATCTTCAGAATGGTCTCGCTTCA TATCCAA SEQ ID NO: 46 AAAAAAGC TTGGT GAT T AC CG AC G AAAAC G AAC CGC AA TT AAC AAAAC AC C
SEQ ID NO: 47  SEQ ID NO: 47
AAAAGGATCCATGCAACGCGAAGAACCTTACCTAAAAAAACAAAACGGTGGATTAAGAG La inserción de las diversas secuencias de anillamiento fue realizada en tres etapas (Figura 22):  AAAAGGATCCATGCAACGCGAAGAACCTTACCTAAAAAAACAAAACGGTGGATTAAGAG The insertion of the various banding sequences was performed in three stages (Figure 22):
a) Se diseñó una primera pareja de cebadores (GVR-QIAC1-up/rp) que hibridaba en los extremos de la secuencia de 120 bp del gen de E. globulus y añadía al amplicón resultante las secuencias de hibridación para los cebadores up de la familia Enterobacteriaceae y C. perfringens, y para los cebadores rp de S. aureus y E. coli. b) En un segundo paso, se diseñó un segundo par de cebadores (GVT-QIAC2- up/rp), que añadía al producto de PCR generado en la etapa previa, los sitios de hibridación para los cebadores up de S. aureus, B. cereus y C. perfringens, y para los cebadores rp de los anteriores microorganismos, pero en orden inverso. c) Finalmente, se diseñó un tercer par de cebadores (GVR-QIAC3-up/rp), que añadía los sitios de hibridación para los cebadores up de E. coli y S. aureus, y para los cebadores rp de la familia Enterobacteriaceae y C. perfringens. En el extremo 5'de GVR-QIAC3-up, se añadió un sitio de reconocimiento para la enzima de restricción Hind\\\, mientras que en el del cebador rp, otro para la enzima SamHI para facilitar la comprobación de la orientación del fragmento después de la clonación del mismo. Finalmente se obtuvo un inserto de aproximadamente 360 bp que fue ligado en el vector PCR-Blunt, obteniéndose una forma del QIAC estable y fácil de mantener y utilizar. a) A first pair of primers (GVR-QIAC1-up / rp) was designed that hybridized at the ends of the 120 bp sequence of the E. globulus gene and added to the resulting amplicon the hybridization sequences for the up primers of the Enterobacteriaceae and C. perfringens family, and for the rp primers of S. aureus and E. coli. b) In a second step, a second pair of primers (GVT-QIAC2-up / rp) was designed, which added to the PCR product generated in the previous stage, the hybridization sites for the up primers of S. aureus, B cereus and C. perfringens, and for the rp primers of the above microorganisms, but in reverse order. c) Finally, a third pair of primers (GVR-QIAC3-up / rp) was designed, which added the hybridization sites for the up primers of E. coli and S. aureus, and for the rp primers of the Enterobacteriaceae family and C. perfringens. At the 5 ' end of GVR-QIAC3-up, a recognition site for the Hind \\\ restriction enzyme was added, while at the rp primer, another for the SamHI enzyme to facilitate checking the fragment orientation after cloning it. Finally, an insert of approximately 360 bp was obtained, which was ligated into the PCR-Blunt vector, obtaining a stable and easy to maintain and use QIAC form.
El orden de las secuencias de hibridación de los cebadores específicos para cada microorganismo en este QIAC se estableció teniendo como objetivo generar amplicones, durante las reacciones de qRTi-PCR, con un tamaño muy similar entre las diferentes parejas de cebadores para cada microorganismo patógeno, a fin de disminuir o eliminar las diferencias en la eficiencia de amplificación entre los mismos. La estructura final de este QIAC, pGVR-QIAC, se representa en la Figura 23 . Para la detección de este QIAC durante las reacciones de qRTi-PCR, se diseñaron y ensayaron tres sondas TaqMan™ distintas (TaqMan-IAC1 , TaqMan-IAC2 y TaqMan- IAC3), marcadas con tres fluoróforos diferentes (NED, VIC y FAM respectivamente) para poder ser compatibles con las sondas específicas a los microorganismos ensayados en cada caso. El funcionamiento de estas sondas TaqMan fue evaluado en reacciones llevadas a cabo con el cebador up para Enterobacteriaceae y el cebador rp para E. coli, ambos flanqueantes a la secuencia heteróloga contenida de la quimera, y diluciones decimales seriadas del ADN de referencia stock de este plásmido pGVR- QIAC (Figuras 17A-C). The order of the hybridization sequences of the specific primers for each microorganism in this QIAC was established with the objective of generating amplicons, during qRTi-PCR reactions, with a very similar size between the different pairs of primers for each pathogenic microorganism, to in order to reduce or eliminate the differences in amplification efficiency between them. The final structure of this QIAC, pGVR-QIAC, is represented in Figure 23. For the detection of this QIAC during qRTi-PCR reactions, three different TaqMan ™ probes (TaqMan-IAC1, TaqMan-IAC2 and TaqMan-) were designed and tested. IAC3), marked with three different fluorophores (NED, VIC and FAM respectively) to be compatible with the probes specific to the microorganisms tested in each case. The functioning of these TaqMan probes was evaluated in reactions carried out with the up primer for Enterobacteriaceae and the rp primer for E. coli, both flanking the heterologous sequence contained in the chimera, and serial dilutions of the stock reference DNA of this plasmid pGVR-QIAC (Figures 17A-C).
Una vez confirmado el funcionamiento de las tres sondas específicas para el QIAC diseñado y construido, se procedió a incorporarlo en reacciones de qRTi-PCR uniplex y dúplex con ADNg, cebadores y sondas para los cinco tipos de microrganismos tratados y en todas las combinaciones posibles de los mismos, tal y como se descn'tbe en la Tabla 10. Los resultados obtenidos en estos ensayos se muestran en las Figuras 18A-C, 19A-B, 20 y 21A-D. Once the operation of the three specific probes for the designed and constructed QIAC was confirmed, it was incorporated into uniplex and duplex qRTi-PCR reactions with gDNA, primers and probes for the five types of microorganisms treated and in all possible combinations of thereof, as DescN 'tbe in Table 10. the results obtained in these tests are shown in Figures 18A-C, 19A-B, 21A-D and 20.
Tanto en las reacciones uniplex como para las reacciones dúplex descritas, se obtuvo amplificación conjunta de la diana genética de cada microorganismo y del QIAC, en las condiciones de concentración de cebadores y sonda previamente optimizadas. 3.6 Ensayos de cuantificación con cuatro microorganismos y una familia de patógenos de transmisión alimentaria, para su comparación con recuentos realizados en placas de medio sólido. In both the uniplex reactions and the described duplex reactions, joint amplification of the genetic target of each microorganism and of the QIAC was obtained, under the conditions of concentration of primers and probe previously optimized. 3.6 Quantification tests with four microorganisms and a family of foodborne pathogens, for comparison with counts on solid medium plates.
Se llevaron a cabo ensayos de cuantificación con muestras de ADNg obtenidas a partir de cultivos de B. cereus, C. perfringens, E.coli, Familia enterobacteriaceae (£. coli) y S. aureus. Para esto se inocularon tubos con 5 mL de medio TSB, con 10 pL del stock en glicerol de cada uno de los microorganismos, incubándose a 37° C y en agitación (250 rpm) hasta obtener una D.0.60o- 0,6 (crecimiento exponencial). A partir de cada uno de estos cultivos se prepararon diluciones decimales seriadas desde 10° hasta 10"6, con el fin de llevar a cabo un recuento en placas de medio sólido, en los respectivos medios diferenciales para cada uno de los cinco tipos de patógenos alimentarios. Las Tablas 25A y 25B muestra los resultados obtenidos en estos recuentos. Microorganismo Dil. 0 Dil. 2 Quantification tests were carried out with cDNA samples obtained from cultures of B. cereus, C. perfringens, E.coli, Familia enterobacteriaceae (£. Coli) and S. aureus. For this, tubes were inoculated with 5 mL of TSB medium, with 10 pL of the glycerol stock of each of the microorganisms, incubating at 37 ° C and stirring (250 rpm) until obtaining a D.0. 60 o- 0.6 (exponential growth). Serial decimal dilutions from 10 ° to 10 "6 were prepared from each of these cultures, in order to perform a solid medium plate count, in the respective differential media for each of the five types of pathogens Food Tables 25A and 25B show the results obtained in these counts. Microorganism Dil. 0 Dil. 2
B. cereus 2.9E+01 N/D  B. cereus 2.9E + 01 N / A
Enterobacteriaceae 9.9E+07 9.9E+06 9.9E+05  Enterobacteriaceae 9.9E + 07 9.9E + 06 9.9E + 05
E. coli 9.9E+07 9.9E+06 9,9E+05  E. coli 9.9E + 07 9.9E + 06 9.9E + 05
C. perfringens 4,36E+07 4.36E+06 4,36E+05  C. perfringens 4.36E + 07 4.36E + 06 4.36E + 05
S. aureus 3,51 E+05 3,51 E+04 3,51 E+03  S. aureus 3.51 E + 05 3.51 E + 04 3.51 E + 03
Tabla 25A - ReC R(VC)BIc-uento en placas de medios selectivos de las diluciones (Dil.) 0, 1 y 2 de los cinco microorganismos cuantificados por qRTi-PCR. Table 25A - ReC R ( VC ) B I c-count on selective media plates of dilutions (Dil.) 0, 1 and 2 of the five microorganisms quantified by qRTi-PCR.
Figure imgf000068_0001
Figure imgf000068_0001
Tabla 25B - Recuento en placas de medios selectivos de las diluciones (Dil.) 3, 4, 5 y  Table 25B - Plate count of dilution media (Dil.) 3, 4, 5 and
6 de los cinco microorganismos cuantificados por qRTi-PCR.  6 of the five microorganisms quantified by qRTi-PCR.
Se prepararon además estándares de ADNg para cada microorganismo a partir de ADNg extraído previamente. Para esto se realizaron diluciones seriadas desde 10° hasta 10"4, cuantificando por espectrofotometría la concentración del ADN presente. In addition, gDNA standards for each microorganism were prepared from previously extracted gDNA. For this, serial dilutions were made from 10 ° to 10 "4 , quantifying the concentration of the DNA present by spectrophotometry.
Una vez hecho esto se realizaron reacciones de qRTi-PCR para determinar el número de UFC/mL presente en los cultivos de cada microorganismo. Los resultados de estos ensayos se muestran en las Tablas 26, 27, 28, 29 y 30. Once this was done, qRTi-PCR reactions were performed to determine the number of CFU / mL present in the cultures of each microorganism. The results of these tests are shown in Tables 26, 27, 28, 29 and 30.
Muestra Sonda Tarea Ct Cantidad Media UFC/g Sample Probe Task Ct Quantity Average CFU / g
STBC0 Excl, STBC0 Excl,
STBC0 20,383839 5,44E+06  STBC0 20.383839 5.44E + 06
STBC0 20,411688  STBC0 20,411688
STBC1 23,831049  STBC1 23.831049
STBC1 23,562721 5,44E+05  STBC1 23.562721 5.44E + 05
STBC1 23,575003  STBC1 23,575003
STBC2 Excl,  STBC2 Excl,
STBC2 Excl, 5,44E+04 N/A N/A  STBC2 Excl, 5.44E + 04 N / A N / A
STBC2 >  STBC2>
LU 27,420425  LU 27,420425
STBC3 c  STBC3 c
05 30,751421  05 30,751421
STBC3 Έ  STBC3 Έ
c Excl, 5,44E+03  c Excl, 5.44E + 03
03  03
STBC3 I- 30,736341  STBC3 I- 30,736341
STDBC4 33,973705  STDBC4 33,973705
STDBC4 34,06501 5,44E+02  STDBC4 34.06501 5.44E + 02
STDBC4 Excl,  STDBC4 Excl,
BC0 σ ω ι o c 22,849108 1.01 E+06 9.93E+05 2,48E+07 BCO 22,90403 9.75E+05 BC0 σ ω ι oc 22.849108 1.01 E + 06 9.93E + 05 2.48E + 07 BCO 22,90403 9.75E + 05
BC1 26,038698 1.20E+05 1.03E+05 2.57E+06 BC1 26,038698 1.20E + 05 1.03E + 05 2.57E + 06
BC1 26,539566 8,55E+04 BC1 26.539566 8.55E + 04
BC2 30,933254 4,51 E+03 4.27E+03 1 .07E+05 BC2 30.933254 4.51 E + 03 4.27E + 03 1 .07E + 05
BC2 31 , 106642 4,02E+03 BC2 31, 106642 4.02E + 03
BC3 34,76712 3,46E+02 3,38E+02 8,45E+03 BC3 34,76712 3.46E + 02 3.38E + 02 8.45E + 03
BC3 34,841778 3,30E+02 BC3 34.841778 3.30E + 02
BC4 37,499996 5,56E+01 5.85E+01 ,46E+03 BC4 37,499996 5.56E + 01 5.85E + 01, 46E + 03
BC4 37,35071 6.14E+01 BC4 37,35071 6.14E + 01
BC5 Indeterminado 0,00E+00 0,00E+00 0,00E+00 BC5 Indeterminate 0.00E + 00 0.00E + 00 0.00E + 00
BC5 Indeterminado 0,00E+00 BC5 Indeterminate 0.00E + 00
BC6 Indeterminado 0,00E+00 0,00E+00 0,00E+00 BC6 Indeterminate 0.00E + 00 0.00E + 00 0.00E + 00
BC6 Indeterminado 0,00E+00 BC6 Indeterminate 0.00E + 00
CPOS Control 20,243607 5.79E+06  CPOS Control 20,243607 5.79E + 06
5,93E+06 1.48E+08 5.93E + 06 1.48E + 08
Positivo Positive
CPOS 20, 174883 6,06E+06  CPOS 20, 174883 6.06E + 06
CNEG Control 39,58717  CNEG Control 39,58717
CNEG Negativo Indeterminado  CNEG Negative Indeterminate
Tabla 26. Resultados obtenidos en la cuantificación por qRTi-PCR de muestras obtenidas a partir de la contaminación de matrices alimentarias, con B. cereus CECT 131. Cebadores: GVR-RT-BC-up/rp; Sonda=Taq an-GVR-BC (VIC). Como control positivo se ha utilizado el ADNg estándar en su dilución 0. Como control negativo, H2Od. Recta: y=-3,438433x+47,89. R2= 0,9993086. Leyenda: STBC= ADN estándar. BC= muestra desconocida. CPOS= Control positivo. CNEG= Control negativo. N/A= No analizado. Table 26. Results obtained in the quantification by qRTi-PCR of samples obtained from contamination of food matrices, with B. cereus CECT 131. Primers: GVR-RT-BC-up / rp; Probe = Taq an-GVR-BC (VIC). As a positive control the standard gDNA has been used in its dilution 0. As a negative control, H 2 Od. Straight: y = -3.438433x + 47.89. R 2 = 0.9993086. Legend: STBC = standard DNA. BC = unknown sample. CPOS = Positive control. CNEG = Negative control. N / A = Not analyzed.
Figure imgf000069_0001
Figure imgf000070_0001
Figure imgf000069_0001
Figure imgf000070_0001
Tabla 27. Resultados obtenidos en la cuantificación por qRTi-PCR de muestras obtenidas a partir de la contaminación de matrices alimentarias, con E. coli CECT 4267. Cebadores: GVR-RT-EB-up/rp; Sonda=TaqMan-GVR-EB. Como control positivo se ha utilizado el ADNg estándar en su dilución 0. Como control negativo, H2Od.Table 27. Results obtained in the quantification by qRTi-PCR of samples obtained from contamination of food matrices, with E. coli CECT 4267. Primers: GVR-RT-EB-up / rp; Probe = TaqMan-GVR-EB. As a positive control the standard gDNA has been used in its dilution 0. As a negative control, H 2 Od.
Leyenda: STEB= ADN estándar. EB= muestra desconocida. CPOS Legend: STEB = standard DNA. EB = unknown sample. CPOS
CNEG= Control negativo. N/A= No analizado.  CNEG = Negative control. N / A = Not analyzed.
Figure imgf000070_0002
Figure imgf000070_0002
Man aq- RCVP ¡- VIC) ( d nar Man a q - RCVP ¡ - V I C ) ( d na r
Figure imgf000071_0001
Figure imgf000071_0001
Tabla 28. Resultados obtenidos en la cuantificación por qRTi-PCR de muestras obtenidas a partir de la contaminación de matrices alimentarias, con E.coli CECT 4267. Cebadores: GVR-RT-EC-up/rp; Sonda=TaqMan-GVR-EC. Como control positivo se ha utilizado el ADNg estándar en su dilución 0. Como control negativo, H2Od. Recta: y=-3,271674x+24,632421. R2= 0,9830289. Leyenda: STEC= ADN estándar. EC= muestra desconocida. CPOS= Control positivo. CNEG= Control negativo. N/A= No analizado. Table 28. Results obtained in the quantification by qRTi-PCR of samples obtained from contamination of food matrices, with E.coli CECT 4267. Primers: GVR-RT-EC-up / rp; Probe = TaqMan-GVR-EC. As a positive control the standard gDNA has been used in its dilution 0. As a negative control, H 2 Od. Straight: y = -3.271674x + 24.632421. R 2 = 0.9830289. Legend: STEC = standard DNA. EC = unknown sample. CPOS = Positive control. CNEG = Negative control. N / A = Not analyzed.
Muestra Sonda Tarea Ct Cantidad Media UFC/gSample Probe Task Ct Quantity Average CFU / g
STDCP0 16,126587 STDCP0 16,126587
STDCP0 15,979957 2,48E+09  STDCP0 15,979957 2,48E + 09
N/A N/A N / A N / A
STDCP0 w 16,012886 STDCP0 w 16,012886
LU LU
STDCP1 18,53924 2,48E+08 STDCP1 18,53924 2.48E + 08
Figure imgf000072_0001
Figure imgf000072_0001
Tabla 29. Resultados obtenidos en la cuantificación por qRTi-PCR de muestras obtenidas a partir de la contaminación de matrrices alimentarias, con C. perfríngens CECT 376. Cebadores: GVR-RT-CP-up/rp; Sonda=TaqMan-GVR-CP. Como control positivo se ha utilizado el ADNg estándar en su dilución 0. Como control negativo, H2Od. Recta: y=-2,933408x+4374556. R2= 0,9830289. Leyenda: STCP= ADN estándar. CP= muestra desconocida. CPOS= Control positivo. CNEG= Control negativo. N/A= No analizado. Muestra Sonda Tarea Ct Cantidad Media UFC/gTable 29. Results obtained in the quantification by qRTi-PCR of samples obtained from contamination of food matrices, with C. perfríngens CECT 376. Primers: GVR-RT-CP-up / rp; Probe = TaqMan-GVR-CP. As a positive control the standard gDNA has been used in its dilution 0. As a negative control, H 2 Od. Straight: y = -2,933408x + 4374556. R 2 = 0.9830289. Legend: STCP = standard DNA. CP = sample unknown. CPOS = Positive control. CNEG = Negative control. N / A = Not analyzed. Sample Probe Task Ct Quantity Average CFU / g
STDSA STDSA
15,466928  15,466928
0  0
STDSA  STDSA
15,418978 6.10E+07  15,418978 6.10E + 07
0  0
STDSA MGVRSAq ian-- 15,61989 STDSA MGVRSA qi an-- 15,61989
0  0
STDSA  STDSA
18,244524  18,244524
1  one
STDSA  STDSA
dt sacres< 18,42763 6.10E+06 d t sac r is < 18,42763 6.10E + 06
1 Eádtsn 1 E ádt sn
STDSA  STDSA
18,438675  18,438675
1  one
STDSA  STDSA
21 ,974424  21, 974424
2 ra  2 ra
STDSA  STDSA
21 ,760775 6.10E+05 N/A N/A 2  21, 760775 6.10E + 05 N / A N / A 2
STDSA  STDSA
21 ,645763  21, 645763
2  2
STDSA  STDSA
25,494719  25.494719
3  3
STDSA  STDSA
24,889164 6, 10E+04  24,889164 6, 10E + 04
3  3
STDSA  STDSA
25,229448  25,229448
3  3
STDSA  STDSA
28,396624  28,396624
4  4
STDSA  STDSA
28,629251 6, 10E+03  28,629251 6, 10E + 03
4  4
STDSA I- STDSA I-
28,620834 28,620834
4  4
SAO 25,32422 5,50E+04  SAO 25,32422 5.50E + 04
5,54E+04 1.38E+06 5.54E + 04 1.38E + 06
SAO 25,305664 5.57E+04 SAO 25,305664 5.57E + 04
SA1 28,266785 7.03E+03  SA1 28,266785 7.03E + 03
6.78E+03 1.69E+05 6.78E + 03 1.69E + 05
SA1 ra 28,374033 6,52E+03 SA1 ra 28.374033 6.52E + 03
SA2 o 31 ,332685 8,24E+02  SA2 or 31, 332685 8.24E + 02
o 4.46E+02 1.12E+04 or 4.46E + 02 1.12E + 04
SA2 c 34,89109 6,84E+01 SA2 c 34.89109 6.84E + 01
SA3 34,985207 6.41 E+01  SA3 34,985207 6.41 E + 01
8,71 E+01 2.18E+03 8.71 E + 01 2.18E + 03
SA3 34,20919 1.10E+02 SA3 34,20919 1.10E + 02
SA4 36, 154125 2.83E+01  SA4 36, 154125 2.83E + 01
2,98E+01 7,46E+02 2.98E + 01 7.46E + 02
SA4 36,005795 3.14E+01 SA4 36,005795 3.14E + 01
Έ Έ
SA5 36,391 17 2.40E+01 SA5 36,391 17 2.40E + 01
1.98E+01 4,96E+02 1.98E + 01 4.96E + 02
SA5 36,99764 1.57E+01 SA5 36,99764 1.57E + 01
SA6 38, 132076 7.09E+00  SA6 38, 132076 7.09E + 00
1.31 E+01 3.27E+02 1.31 E + 01 3.27E + 02
SA6 36,718838 1.91 E+01 SA6 36.718838 1.91 E + 01
CPOS Control 15,310203 6.05E+07  CPOS Control 15,310203 6.05E + 07
Positivo 6.08E+07 1.52E+09 Positive 6.08E + 07 1.52E + 09
CPOS 15,297749 6.10E+07 CPOS 15.297749 6.10E + 07
CNEG Control Indeterminad Negatio CNEG Indeterminate Control Negative
vo Indeterminad  vo Indeterminate
CNEG  CNEG
o  or
Tabla 30. Resultados obtenidos en la cuantificacion por qRTi-PCR de muestras obtenidas a partir de la contaminación de matrrices alimentarias, con S. aureus CECT 240. Cebadores: GVR-RT-SA-up/rp; Sonda=TaqMan-GVR-SA. Como control positivo se ha utilizado el ADNg estándar en su dilución 0. Como control negativo, H2Od. Recta: y=-3,2919998x+40.,3933903. R2= 0,998031 Leyenda: STSA= ADN estándar. SA= muestra desconocida. CPOS= Control positivo. CNEG= Control negativo. N/A= No analizado. 4. Validación de los métodos de detección por mPCR y de cuantificacion por qRTi-PCR, en matrices alimentarias contaminadas artificialmente con los microorganismos relativos a este estudio. Table 30. Results obtained in the quantification by qRTi-PCR of samples obtained from contamination of food matrices, with S. aureus CECT 240. Primers: GVR-RT-SA-up / rp; Probe = TaqMan-GVR-SA. As a positive control the standard gDNA has been used in its dilution 0. As a negative control, H 2 Od. Straight: y = -3.2919998x + 40 . , 3933903. R 2 = 0.998031 Legend: STSA = standard DNA. SA = unknown sample. CPOS = Positive control. CNEG = Negative control. N / A = Not analyzed. 4. Validation of the methods of detection by mPCR and quantification by qRTi-PCR, in food matrices artificially contaminated with the microorganisms related to this study.
Se llevó a cabo un proceso de validación de los métodos de detección por PCR múltiplex y de cuantificacion por qRTi-PCR desarrollados en esta invención, mediante la comparación del método de la invención con los métodos clásicos aplicados habitualmente en el ámbito de la industria alimentaria, y que consisten habitualmente en el recuento de colonias en placas de medios sólidos o en sistemas similares semiautomatizados o spiking. A validation process of the multiplex PCR detection and qRTi-PCR quantification methods developed in this invention was carried out, by comparing the method of the invention with the classical methods commonly applied in the food industry field, and which usually consist of colony counting on solid media plates or similar semi-automated or spiking systems.
Para esto, se llevaron a cabo contaminaciones artificiales de diversas matrices alimentarias en el laboratorio del grupo de investigación Biotecnología y Terapia experimental basada en Nutracéuticos (BITTEN) (IUOPA, Universidad de Oviedo), y en la empresa Alce Calidad S.L. For this, artificial contamination of various food matrices was carried out in the laboratory of the research group Biotechnology and Experimental Therapy based on Nutraceuticals (BITTEN) (IUOPA, University of Oviedo), and in the company Alce Calidad S.L.
Para estas contaminaciones artificiales se seleccionaron cinco tipos de matrices alimentarias: Cárnicos: hamburguesa de ternera; Lácteos: leche en polvo; Comidas preparadas: fabada enlatada; Pescados y derivados: sardinas en lata; Productos de pastelería: bizcocho. For these artificial contamination, five types of food matrices were selected: Meat: beef burger; Dairy: milk powder; Prepared meals: canned fabada; Fish and fish products: canned sardines; Pastry products: cake.
Diez réplicas de 10 g de cada una de estas matrices fueron introducidas de modo aséptico en bolsas para muestras con filtro WHIRL-PAK B01 195WA (Nasco) y se les añadió a cada una el medio de cultivo universal desarrollado GVRUM hasta alcanzar los 100 g medidos en una balanza de laboratorio MXX-061 (Denver Instrument). Estas muestras fueron homogenizadas en un Stomacher 80 (Seward), durante 60 s, y a continuación fueron inoculadas con 300 UFC/ml de cada cepa. En los casos en que era necesario un pre-enriquecimiento, esta bolsa se incubó a 37° C durante 24 horas. Las muestras de 1 mL tomadas a partir de las contaminaciones artificiales realizadas en Alce Calidad S.L., se mantuvieron congeladas a -20° C en esta empresa hasta su traslado a las instalaciones de la Universidad de Oviedo, en donde se llevó a cabo la extracción del ADNg. Por otra parte, los microorganismos y matrices alimentarias que iban a ser usadas en los experimentos de contaminación artificial en Siiliker Ibérica S.A., fueron enviados desde la Universidad de Oviedo a la sede de esta empresa en Barcelona. Siiliker Ibérica S.A., por su parte, una vez obtenidas las muestras de 1 mL de matrices contaminadas en este medio de cultivo, las envió por servicio de mensajería de vuelta a Oviedo, para la extracción de ADNg. Ten replicates of 10 g of each of these matrices were aseptically introduced into sample bags with WHIRL-PAK B01 195WA filter (Nasco) and the GVRUM developed universal culture medium was added to each of them until reaching 100 g measured in a MXX-061 laboratory scale (Denver Instrument). These Samples were homogenized in a Stomacher 80 (Seward), for 60 s, and then inoculated with 300 CFU / ml of each strain. In cases where a pre-enrichment was necessary, this bag was incubated at 37 ° C for 24 hours. The 1 mL samples taken from the artificial contamination made in Alce Calidad SL, were kept frozen at -20 ° C in this company until they were transferred to the facilities of the University of Oviedo, where the extraction of the GDNA On the other hand, the microorganisms and food matrices that were going to be used in the experiments of artificial contamination in Siiliker Ibérica SA, were sent from the University of Oviedo to the headquarters of this company in Barcelona. Siiliker Ibérica SA, on the other hand, once the 1 mL samples of contaminated matrices were obtained in this culture medium, sent them by courier service back to Oviedo, for the extraction of ADNg.
La extracción de este ADNg, para ser usado tanto en reacciones de mPCR como de qRTi-PCR, se realizó siguiendo el protocolo con PrepMan Ultra ya indicado en el apartado 2.1 , b). The extraction of this cDNA, to be used in both mPCR and qRTi-PCR reactions, was performed following the protocol with PrepMan Ultra already indicated in section 2.1, b).
Las muestras de ADNg de todos los tipos fueron sometidas a reacciones de PCR múltiplex (por duplicado para cada muestra) para la detección de los microorganismos correspondientes, según se ha descrito en los apartados anteriores. Las muestras de ADNg procedentes de las contaminaciones artificiales con cinco microorganismos (β. cereus, C. perfringens, E. coli, Familia Enterobacteriaceae y S. aureus) fueron sometidas a reacciones de cuantificación (por duplicado para cada muestra) mediante qRTi-PCR, siguiendo el protocolo desarrollado en apartados anteriores. The cDNA samples of all types were subjected to multiplex PCR reactions (in duplicate for each sample) for the detection of the corresponding microorganisms, as described in the previous sections. The cDNA samples from artificial contamination with five microorganisms (β. Cereus, C. perfringens, E. coli, Family Enterobacteriaceae and S. aureus) were subjected to quantification reactions (in duplicate for each sample) using qRTi-PCR, following the protocol developed in previous sections.
Los resultados obtenidos a partir de la detección clásica y mPCR de los once tipos de patógenos se muestran en las Tablas 31 A y 31 B. Los datos obtenidos en los recuentos según el método clásico y por qRTi-PCR, se muestran en las Tablas 32A a 32E. The results obtained from the classical and mPCR detection of the eleven types of pathogens are shown in Tables 31 A and 31 B. The data obtained in the counts according to the classical method and by qRTi-PCR, are shown in Tables 32A to 32E.
Figure imgf000076_0001
Figure imgf000076_0001
Tabla 31 A. Resultados obtenidos en la detección en placas de medio de cultivo sólido y mPCR, de siete especies, un género y una familia de patógenos alimentarios. Leyenda: BC= B, cereus; CJ= C. jejuni; CP= C. perfringens; CS= C. sakazakir', EC= E. coli; EB= Enterobacteriaceae; LM= L monocytogenes; SA= S. aureus y SE= Salmonella. P= Presencia; A= Ausencia. C= Método clásico en Placa y M= mPCR. Table 31 A. Results obtained in the detection in plates of solid culture medium and mPCR, of seven species, a genus and a family of food pathogens. Legend: BC = B, cereus; CJ = C. jejuni; CP = C. perfringens; CS = C. sakazakir ' , EC = E. coli; EB = Enterobacteriaceae; LM = L monocytogenes; SA = S. aureus and SE = Salmonella. P = Presence; A = Absence. C = Classic Plate Method and M = mPCR.
Figure imgf000077_0001
Figure imgf000077_0002
Figure imgf000077_0001
Figure imgf000077_0002
Tabla 31 B. Resultados obtenidos en la detección en placas de medio de cultivo sólido y mPCR, de siete especies, un género y una familia de patógenos alimentarios. Leyenda: BC= B. cereus; CJ= C. jejuni; CP= C. perfringens; CS= C. sakazakü; EC= E. coli; EB= Enterobacteriaceae; LM= L monocytogenes; SA= S. aureus y SE= Salmonella.P= Presencia; A= Ausencia. O Método clásico en Placa y M= mPCR. Table 31 B. Results obtained in the detection in plates of solid culture medium and mPCR, of seven species, a genus and a family of food pathogens. Legend: BC = B. cereus; CJ = C. jejuni; CP = C. perfringens; CS = C. sakazakü; EC = E. coli; EB = Enterobacteriaceae; LM = L monocytogenes; SA = S. aureus and SE = Salmonella.P = Presence; A = Absence. O Classic plate method and M = mPCR.
Figure imgf000078_0001
Figure imgf000078_0001
Tabla 32A ra Table 32A ra
Figure imgf000079_0001
Figure imgf000079_0001
Figure imgf000080_0001
Figure imgf000080_0001
TABLA 32C
Figure imgf000081_0001
TABLE 32C
Figure imgf000081_0001
TABLA 32D
Figure imgf000082_0001
TABLE 32D
Figure imgf000082_0001
Tabla 32E  Table 32E
Tablas 32A- 32E Resultados obtenidos en la cuantificación en placas de medio de cultivo sólido y qRTi-PCR, de cuatro especies y una familia de patógenos alimentarios. Leyenda: BC= B. cereus; CP= C. perfringens: EC= E. coli; EB= Enterobacteriaceae y SA= S. aureus. C= Método clásico en Placa y Q=qRTi-PCR. 5. Cultivo y enriquecimiento de microorganismos. 5.1 Rectas de crecimiento. Tables 32A-32E Results obtained in the quantification in plates of solid culture medium and qRTi-PCR, of four species and a family of food pathogens. Legend: BC = B. cereus; CP = C. perfringens: EC = E. coli; EB = Enterobacteriaceae and SA = S. aureus. C = Classic Plate Method and Q = qRTi-PCR. 5. Cultivation and enrichment of microorganisms. 5.1 Growth lines.
Se obtuvieron curvas de D060o versus número de UFC/mL para cada microorganismo patógeno, tal y como se describe en la sección de Material y Métodos, utilizando el medio de cultivo correspondiente indicado en la Tabla 4. En la Figuras 24A-H se muestran las curvas obtenidas con sus respectivas ecuaciones. Curves of D0 60 or versus CFU / mL number were obtained for each pathogenic microorganism, as described in the Material and Methods section, using the corresponding culture medium indicated in Table 4. In Figures 24A-H, show the curves obtained with their respective equations.
Todos los datos se han representado mediante gráficos de regresión lineal realizados en la aplicación ofimática Excel 2007 (Microsoft). All the data has been represented by linear regression graphs made in the Excel 2007 office application (Microsoft).
Para cada microorganismo se ha obtenido una recta de regresión lineal cuya ecuación se ha utilizado en el cálculo de las UFC/mL presentes en los inóculos usados. De esta forma solamente con la determinación experimental de la D060o del mencionado inoculo, es posible establecer la concentración celular. En la Tabla 35 se hace un resumen de las rectas obtenidas para cada microorganismo. For each microorganism a linear regression line has been obtained whose equation has been used in the calculation of the CFU / mL present in the inoculums used. In this way, only with the experimental determination of D0 60 or said inoculum, it is possible to establish the cell concentration. A summary of the straight lines obtained for each microorganism is made in Table 35.
Figure imgf000083_0001
Figure imgf000083_0001
Tabla 33. Ecuaciones de la recta de regresión lineal UFC/mL versus DO600i para los microorganismos relativos a este estudio. 5.2 Desarrollo de un medio universal de pre-enriquecimiento para microorganismos. Table 33. Equations of the linear regression line CFU / mL versus OD 600i for microorganisms related to this study. 5.2 Development of a universal means of pre-enrichment for microorganisms.
Todos los ensayos de detección por PCR, tanto uniplex como múltiplex, requieren un paso previo de pre-enriquecimiento para favorecer el crecimiento y la detección de los patógenos inoculados artificialmente en las matrices alimentarias, cuando se trata de patógenos en los que no se permite legalmente su presencia en el alimento correspondiente. Para esto se ha desarrollado un medio de enriquecimiento no selectivo y universal, el cual es capaz de cubrir las necesidades nutricionales de todos los microorganismos involucrados en este trabajo. El medio GVRUM está compuesto por agua de peptona tamponada (Merck) (20 g/L), sangre desfibrinada y hemolisada de caballo (Oxoid) (50 mL/L), manitol (20 g/L) y suplemento para crecimiento de Campylobacter (Oxoid, #SR0232E) (2 viales de 2mL/L). All PCR detection assays, both uniplex and multiplex, require a previous pre-enrichment step to favor the growth and detection of artificially inoculated pathogens in food matrices, when it comes to pathogens in which their presence in the corresponding food is not legally allowed. For this, a non-selective and universal enrichment medium has been developed, which is capable of covering the nutritional needs of all the microorganisms involved in this work. GVRUM medium is composed of buffered peptone water (Merck) (20 g / L), defibrinated and hemolysed horse blood (Oxoid) (50 mL / L), mannitol (20 g / L) and Campylobacter growth supplement ( Oxoid, # SR0232E) (2 vials of 2mL / L).
Para comprobar en primer lugar la capacidad de recuperación de células viables y ADNg de los microorganismos inoculados de forma individual en las matrices procesadas con este medio, se llevaron a cabo experimentos de contaminación artificial según se describe en el apartado "Material y Métodos", sección 1.4. Para ello se sembraron en placas del medio selectivo correspondiente a cada patógeno (Tabla 5) nueve diluciones decimales de una alícuota de 1 mL del homogenizado de cada matriz inoculada en este medio universal de pre-enriquecimiento. Adicionalmente, 1 mL de cada homogenizado fue utilizado para la extracción de ADN, el cual fue sometido a reacciones de PCR con los cebadores diseñados para las reacciones de PCR múltiplex (Tabla 1 ). Los amplicones que se obtienen con cada pareja de cebadores específicos para cada microorganismo se indican en dicha Tabla 1. In order to first verify the resilience of viable cells and gDNA of the microorganisms inoculated individually in the matrices processed with this medium, artificial contamination experiments were carried out as described in the "Material and Methods" section, section 1.4. For this purpose, nine decimal dilutions of a 1 mL aliquot of the homogenate of each inoculated matrix in this universal pre-enrichment medium were seeded in plates of the selective medium corresponding to each pathogen (Table 5). Additionally, 1 mL of each homogenate was used for DNA extraction, which was subjected to PCR reactions with primers designed for multiplex PCR reactions (Table 1). The amplicons that are obtained with each pair of specific primers for each microorganism are indicated in said Table 1.
Para los ocho microorganismos, los dos géneros bacterianos y la familia de patógenos de origen alimentario, se obtuvo amplificación positiva en las matrices contaminadas artificialmente y pre-enriquecidas con el medio universal diseñado. Los resultados se encuentran en las Figuras 25, 26A-C, 27A-D y 28A-B. For the eight microorganisms, the two bacterial genera and the family of foodborne pathogens, positive amplification was obtained in the artificially contaminated matrices and pre-enriched with the designed universal medium. The results are found in Figures 25, 26A-C, 27A-D and 28A-B.

Claims

REIVINDICACIONES
1. Un método in vitro para la detección simultánea de Campyiobacter jejuni, Cronobacter sakazakii, una cepa enterohemorrágica de Escheríchia coli, Listeria monocytogenes, Salmonella spp. y Shigella spp. en una muestra que comprende: a) Aislar el ADN de dicha muestra, 1. An in vitro method for the simultaneous detection of Campyiobacter jejuni, Cronobacter sakazakii, an enterohemorrhagic strain of Escheríchia coli, Listeria monocytogenes, Salmonella spp. and Shigella spp. in a sample comprising: a) Isolate the DNA from said sample,
b) Llevar a cabo una PCR multiplex sobre el ADN aislado en la etapa a) mediante el empleo de las siguientes parejas de cebadores:  b) Carry out a multiplex PCR on the DNA isolated in step a) by using the following primer pairs:
- La pareja de cebadores formada por el oligonucleótido que comprende la secuencia SEQ ID NO: 3 y el oligonucleótido que comprende la secuencia SEQ ID NO: 4 diseñados para amplificar C. jejuni,  - The pair of primers formed by the oligonucleotide comprising the sequence SEQ ID NO: 3 and the oligonucleotide comprising the sequence SEQ ID NO: 4 designed to amplify C. jejuni,
La pareja de cebadores formada por el oligonucleótido que comprende la secuencia SEQ ID NO: 7 y el oligonucleótido que comprende la secuencia SEQ ID NO: 8 diseñados para amplificar C. sakazakii,  The primer pair formed by the oligonucleotide comprising the sequence SEQ ID NO: 7 and the oligonucleotide comprising the sequence SEQ ID NO: 8 designed to amplify C. sakazakii,
La pareja de cebadores formada por el oligonucleótido que comprende la secuencia SEQ ID NO: 1 1 y el oligonucleótido que comprende la secuencia SEQ ID NO: 12 diseñados para amplificar una cepa hemorrágica de E. coli,  The primer pair formed by the oligonucleotide comprising the sequence SEQ ID NO: 1 1 and the oligonucleotide comprising the sequence SEQ ID NO: 12 designed to amplify a hemorrhagic strain of E. coli,
La pareja de cebadores formada por el oligonucleótido que comprende la secuencia SEQ ID NO: 15 y el oligonucleótido que comprende la secuencia SEQ ID NO: 16 diseñados para amplificar L. monocytogenes,  The primer pair formed by the oligonucleotide comprising the sequence SEQ ID NO: 15 and the oligonucleotide comprising the sequence SEQ ID NO: 16 designed to amplify L. monocytogenes,
- La pareja de cebadores formada por el oligonucleótido que comprende la secuencia SEQ ID NO: 17 y el oligonucleótido que comprende la secuencia SEQ ID NO: 18 diseñados para amplificar Salmonella spp.  - The pair of primers formed by the oligonucleotide comprising the sequence SEQ ID NO: 17 and the oligonucleotide comprising the sequence SEQ ID NO: 18 designed to amplify Salmonella spp.
- La pareja de cebadores formada por el oligonucleótido que comprende la secuencia SEQ ID NO: 19 y el oligonucleótido que comprende la secuencia SEQ ID NO: 20 diseñados para amplificar Shigella spp. y  - The pair of primers formed by the oligonucleotide comprising the sequence SEQ ID NO: 19 and the oligonucleotide comprising the sequence SEQ ID NO: 20 designed to amplify Shigella spp. Y
c) Detectar los productos de amplificación obtenidos en la etapa b). Método según la reivindicación 1 , en el que la cepa enterohemorrágica de £ coli es £ coli 0157:H7, la especie de Salmonella spp. es Salmonella entérica y/o la especie de Shigella spp. es Shigella dysenteríae. c) Detect the amplification products obtained in step b). Method according to claim 1, wherein the enterohemorrhagic strain of £ coli is £ coli 0157: H7, the species of Salmonella spp. It is enteric Salmonella and / or the species of Shigella spp. It's Shigella dysenteríae.
Método según la reivindicación 1 ó 2, que adicionalmente comprende la detección simultánea de al menos 1 , preferiblemente 2, 3, 4 o 5 de los microorganismos seleccionados de la lista que consiste en Bacillus cereus, Clostridium períringens, un microorganismo de la familia Enterobacteriaceae, Escherichia coli y Staphylococcus aureus mediante el empleo de las siguientes parejas de cebadores: Method according to claim 1 or 2, which additionally comprises the simultaneous detection of at least 1, preferably 2, 3, 4 or 5 of the microorganisms selected from the list consisting of Bacillus cereus, Clostridium períringens, a microorganism of the Enterobacteriaceae family, Escherichia coli and Staphylococcus aureus by using the following pairs of primers:
La pareja de cebadores formada por el oligonucleótido que comprende la secuencia SEQ ID NO: 1 y el oligonucleótido que comprende la secuencia SEQ ID NO: 2 diseñados para amplificar B. cereus,  The primer pair formed by the oligonucleotide comprising the sequence SEQ ID NO: 1 and the oligonucleotide comprising the sequence SEQ ID NO: 2 designed to amplify B. cereus,
- La pareja de cebadores formada por el oligonucleótido que comprende la secuencia SEQ ID NO: 5 y el oligonucleótido que comprende la secuencia SEQ ID NO: 6 diseñados para amplificar C. períringens,  - The pair of primers formed by the oligonucleotide comprising the sequence SEQ ID NO: 5 and the oligonucleotide comprising the sequence SEQ ID NO: 6 designed to amplify C. períringens,
La pareja de cebadores formada por el oligonucleótido que comprende la secuencia SEQ ID NO: 13 y el oligonucleótido que comprende la secuencia SEQ ID NO: 14 diseñados para amplificar la familia Enterobacteriaceae,  The primer pair formed by the oligonucleotide comprising the sequence SEQ ID NO: 13 and the oligonucleotide comprising the sequence SEQ ID NO: 14 designed to amplify the Enterobacteriaceae family,
- La pareja de cebadores formada por el oligonucleótido que comprende la secuencia SEQ ID NO: 9 y el oligonucleótido que comprende la secuencia SEQ ID NO: 10 diseñados para amplificar £ coli, o  - The pair of primers formed by the oligonucleotide comprising the sequence SEQ ID NO: 9 and the oligonucleotide comprising the sequence SEQ ID NO: 10 designed to amplify £ coli, or
La pareja de cebadores formada por el oligonucleótido que comprende la secuencia SEQ ID NO: 21 y el oligonucleótido que comprende la secuencia SEQ ID NO: 22 diseñada para amplificar S. aureus.  The primer pair formed by the oligonucleotide comprising the sequence SEQ ID NO: 21 and the oligonucleotide comprising the sequence SEQ ID NO: 22 designed to amplify S. aureus.
Método según la reivindicación 3, que adicionalmente comprende, previamente a la etapa a), la homogeneización de la muestra y la posterior extracción de dos o más alícuotas de la muestra homogeneizada, en donde, una de las alícuotas es empleada en la etapa a) y la otra es empleada en caso de que se quiera cuantificar los microorganismos detectados en la muestra. Método según la reivindicación 4, en el que si B. cereus, C. perfringens, un microorganismo de la Familia Enterobacteriaceae, E. coli y/o S. aureus son detectados en la etapa c), entonces, el método comprende adicionalmente las siguientes etapas: Method according to claim 3, which additionally comprises, prior to step a), the homogenization of the sample and the subsequent extraction of two or more aliquots of the homogenized sample, wherein one of the aliquots is used in step a) and the other is used in case you want to quantify the microorganisms detected in the sample. Method according to claim 4, wherein if B. cereus, C. perfringens, a microorganism of the Enterobacteriaceae Family, E. coli and / or S. aureus are detected in step c), then the method further comprises the following stages:
d) Aislar el ADN de una de las alícuotas obtenidas previamente a la etapa a), e) Llevar a cabo una PCR a Tiempo Real del ADN aislado en la etapa d) de dichos microorganismos con las siguientes parejas de cebadores y sondas: d) Isolate the DNA of one of the aliquots obtained prior to stage a), e) Carry out a Real Time PCR of the DNA isolated in stage d) of said microorganisms with the following pairs of primers and probes:
- La pareja de cebadores formada por el oligonucleótido que comprende la secuencia SEQ ID NO: 23 y el oligonucleótido que comprende la secuencia SEQ ID NO: 24, y la sonda que comprende la secuencia SEQ ID NO: 33 o SEQ ID NO: 34 si el microorganismo a detectar es B. cereus,  - The pair of primers formed by the oligonucleotide comprising the sequence SEQ ID NO: 23 and the oligonucleotide comprising the sequence SEQ ID NO: 24, and the probe comprising the sequence SEQ ID NO: 33 or SEQ ID NO: 34 si The microorganism to be detected is B. cereus,
- La pareja de cebadores formada por el oligonucleótido que comprende la secuencia SEQ ID NO: 25 y el oligonucleótido que comprende la secuencia SEQ ID NO: 26, y la sonda que comprende la secuencia SEQ ID NO: 35 si el microorganismo a detectar es C. perfringens, - The pair of primers formed by the oligonucleotide comprising the sequence SEQ ID NO: 25 and the oligonucleotide comprising the sequence SEQ ID NO: 26, and the probe comprising the sequence SEQ ID NO: 35 if the microorganism to be detected is C perfringens,
- La pareja de cebadores formada por el oligonucleótido que comprende la secuencia SEQ ID NO: 27 y el oligonucleótido que comprende la secuencia SEQ ID NO: 28, y la sonda que comprende la secuencia SEQ ID NO: 36 si el microorganismo a detectar es de la familia Enterobacteriaceae, - The pair of primers formed by the oligonucleotide comprising the sequence SEQ ID NO: 27 and the oligonucleotide comprising the sequence SEQ ID NO: 28, and the probe comprising the sequence SEQ ID NO: 36 if the microorganism to be detected is of the Enterobacteriaceae family,
- La pareja de cebadores formada por el oligonucleótido que comprende la secuencia SEQ ID NO: 29 y el oligonucleótido que comprende la secuencia SEQ ID NO: 30, y la sonda que comprende la secuencia SEQ ID NO: 37 si el microorganismo a detectar es E. coli, y/o - The pair of primers formed by the oligonucleotide comprising the sequence SEQ ID NO: 29 and the oligonucleotide comprising the sequence SEQ ID NO: 30, and the probe comprising the sequence SEQ ID NO: 37 if the microorganism to be detected is E coli, and / or
La pareja de cebadores formada por el oligonucleótido que comprende la secuencia SEQ ID NO: 31 y el oligonucleótido que comprende la SEQ ID NO: 32, y la sonda que comprende la secuencia SEQ ID NO: 38 si el microorganismo a detectar es S. aureus, y The pair of primers formed by the oligonucleotide comprising the sequence SEQ ID NO: 31 and the oligonucleotide comprising SEQ ID NO: 32, and the probe comprising the sequence SEQ ID NO: 38 if the microorganism to be detected is S. aureus , Y
f) cuantificar los productos amplificados en la etapa e). f) quantify the amplified products in step e).
Método según la reivindicación 5, en el que la qRTi-PCR comprende al menos una sonda para el control interno de amplificación, seleccionada de la lista que consiste en: La sonda de ácido nucleico que comprende el oligonucleótido SEQ ID NO: 39 en el caso de que el microorganismo cuantificado sea E. coli, uno de la Familia Enterobacteriaceae o S. aureus, Method according to claim 5, wherein the qRTi-PCR comprises at least one probe for internal amplification control, selected from the list consisting of: The nucleic acid probe comprising oligonucleotide SEQ ID NO: 39 in the case where the quantified microorganism is E. coli, one of the Enterobacteriaceae or S. aureus Family,
La sonda de ácido nucleico que comprende el oligonucleótido SEQ ID NO: 41 en caso de que el microorganismo cuantificado sea C. perfringens o E.coli,  The nucleic acid probe comprising oligonucleotide SEQ ID NO: 41 in case the quantified microorganism is C. perfringens or E.coli,
La sonda de ácido nucleico que comprende el oligonucleótido SEQ ID NO: 40 en caso de que el microorganismo cuantificado sea B. cereus, C. perfringens, E. coli, uno de la Familia Enterobacteriaceae, o S. aureus, y  The nucleic acid probe comprising oligonucleotide SEQ ID NO: 40 in case the quantified microorganism is B. cereus, C. perfringens, E. coli, one of the Enterobacteriaceae Family, or S. aureus, and
Combinaciones de las mismas.  Combinations thereof.
7. Método según la reivindicación 5 ó 6, en el que las sondas están marcadas en uno de sus extremos. 7. Method according to claim 5 or 6, wherein the probes are marked at one of their ends.
8. Método según la reivindicación 7, en el que el mareaje es con un fluoróforo. 8. Method according to claim 7, wherein the marking is with a fluorophore.
9. Método según cualquiera de las reivindicaciones 1 a 3, en el que previamente a la etapa a), el método comprende el cultivo de la muestra en un medio de enriquecimiento. 9. Method according to any one of claims 1 to 3, wherein prior to step a), the method comprises culturing the sample in an enrichment medium.
10. Método según cualquiera de las reivindicaciones 4 a 8, en el que la alícuota empleada en la etapa a) es cultivada en un medio de enriquecimiento. 10. Method according to any of claims 4 to 8, wherein the aliquot used in step a) is cultured in an enrichment medium.
1 1. Método según la reivindicación 9 ó 10, en el que el tiempo de incubación de la muestra en el medio de cultivo de enriquecimiento es de entre 16 y 48 horas, 1 1. Method according to claim 9 or 10, wherein the incubation time of the sample in the enrichment culture medium is between 16 and 48 hours,
12. Método según cualquiera de las reivindicaciones 9 a 1 1 , en el que el medio de cultivo de enriquecimiento comprende Agua de Peptona Tamponada, Sangre de caballo desfibrinada y hemolisada, Manitol y Suplemento de crecimiento de Campylobacter. 12. A method according to any one of claims 9 to 1, wherein the enrichment culture medium comprises Buffered Peptone Water, Defibrinated and Hemolyzed Horse Blood, Mannitol and Campylobacter Growth Supplement.
13. Método según la reivindicación 12, en el que el medio de enriquecimiento comprende 13. Method according to claim 12, wherein the enrichment medium comprises
- Entre 5-100 mL de sangre de caballo desfibrinada y hemolisada por cada 500 mL de medio, Entre 2,5-80 g de manitol por cada 500 ml_ de medio, y/o - Between 5-100 mL of defibrinated and hemolysed horse blood per 500 mL of medium, Between 2.5-80 g of mannitol per 500 ml_ of medium, and / or
- Entre 1-8 ml_ de suplemento de crecimiento de Campypobacter por cada 500 ml_ de medio.  - Between 1-8 ml_ of Campypobacter growth supplement per 500 ml_ of medium.
14. Método según cualquiera de las reivindicaciones 1 a 13, en el que la muestra es una muestra de alimento. 14. Method according to any one of claims 1 to 13, wherein the sample is a food sample.
15. Método según la reivindicación 14, en el que alimento es un producto lácteo, un producto cárnico, pescado, huevo, un ovoderivado, un vegetal, un producto de pastelería, una comida preparada, o una bebida. 15. A method according to claim 14, wherein food is a dairy product, a meat product, fish, egg, an egg product, a vegetable, a pastry product, a prepared meal, or a beverage.
16. Un conjunto de parejas de cebadores que comprende: 16. A set of primer pairs comprising:
La pareja de cebadores formada por el oligonucleótido que comprende la secuencia SEQ ID NO: 3 y el oligonucleótido que comprende la secuencia SEQ ID NO: 4 diseñados para amplificar C. jejuni,  The primer pair formed by the oligonucleotide comprising the sequence SEQ ID NO: 3 and the oligonucleotide comprising the sequence SEQ ID NO: 4 designed to amplify C. jejuni,
La pareja de cebadores formada por el oligonucleótido que comprende la secuencia SEQ ID NO: 7 y el oligonucleótido que comprende la secuencia SEQ ID NO: 8 diseñados para amplificar C. sakazakii,  The primer pair formed by the oligonucleotide comprising the sequence SEQ ID NO: 7 and the oligonucleotide comprising the sequence SEQ ID NO: 8 designed to amplify C. sakazakii,
La pareja de cebadores formada por el oligonucleótido que comprende la secuencia SEQ ID NO: 1 1 y el oligonucleótido que comprende la secuencia SEQ ID NO: 12 diseñados para amplificar una cepa enterohemorrágica de E. coli,  The primer pair formed by the oligonucleotide comprising the sequence SEQ ID NO: 1 1 and the oligonucleotide comprising the sequence SEQ ID NO: 12 designed to amplify an enterohemorrhagic strain of E. coli,
La pareja de cebadores formada por el oligonucleótido que comprende la secuencia SEQ ID NO: 15 y el oligonucleótido que comprende la secuencia SEQ ID NO: 16 diseñados para amplificar L. monocytogenes,  The primer pair formed by the oligonucleotide comprising the sequence SEQ ID NO: 15 and the oligonucleotide comprising the sequence SEQ ID NO: 16 designed to amplify L. monocytogenes,
La pareja de cebadores formada por el oligonucleótido que comprende la secuencia SEQ ID NO: 17 y el oligonucleótido que comprende la secuencia SEQ ID NO: 18 diseñados para amplificar Salmonella spp.,  The primer pair formed by the oligonucleotide comprising the sequence SEQ ID NO: 17 and the oligonucleotide comprising the sequence SEQ ID NO: 18 designed to amplify Salmonella spp.,
- La pareja de cebadores formada por el oligonucleótido que comprende la secuencia SEQ ID NO: 19 y el oligonucleótido que comprende la secuencia SEQ ID NO: 20 diseñados para amplificar Shigella spp., y  - The pair of primers formed by the oligonucleotide comprising the sequence SEQ ID NO: 19 and the oligonucleotide comprising the sequence SEQ ID NO: 20 designed to amplify Shigella spp., And
17. Conjunto de parejas de cebadores según la reivindicación 16, en el que la cepa hemorrágica de E. coli es E. coli 0157:1-17, la especie de Salmonella spp. es Salmonella entérica y/o la especie de Shigella spp. es Shigella dysenteriae. 17. Set of primer pairs according to claim 16, wherein the hemorrhagic strain of E. coli is E. coli 0157: 1-17, the species of Salmonella spp. It is enteric Salmonella and / or the species of Shigella spp. It's Shigella dysenteriae.
18. Conjunto de parejas de cebadores según la reivindicación 16 o 17, que además comprende 1 , preferiblemente 2, 3, 4 ó 5 de las parejas de cebadores seleccionadas de la lista que consiste en: 18. Set of primer pairs according to claim 16 or 17, further comprising 1, preferably 2, 3, 4 or 5 of the primer pairs selected from the list consisting of:
La pareja de cebadores formada por el oligonucleótido que comprende la secuencia SEQ ID NO: 5 y el oligonucleótido que comprende la secuencia SEQ ID NO: 6 diseñados para amplificar C. perfringens,  The primer pair formed by the oligonucleotide comprising the sequence SEQ ID NO: 5 and the oligonucleotide comprising the sequence SEQ ID NO: 6 designed to amplify C. perfringens,
La pareja de cebadores formada por el oligonucleótido que comprende la secuencia SEQ ID NO: 13 y el oligonucleótido que comprende la secuencia SEQ ID NO: 1 diseñados para amplificar la familia Enterobacteriaceae, La pareja de cebadores formada por el oligonucleótido que comprende la secuencia SEQ ID NO: 9 y el oligonucleótido que comprende la secuencia SEQ ID NO: 10 diseñados para amplificar E. coli,  The primer pair formed by the oligonucleotide comprising the sequence SEQ ID NO: 13 and the oligonucleotide comprising the sequence SEQ ID NO: 1 designed to amplify the Enterobacteriaceae family, The primer pair formed by the oligonucleotide comprising the sequence SEQ ID NO: 9 and the oligonucleotide comprising the sequence SEQ ID NO: 10 designed to amplify E. coli,
La pareja de cebadores formada por el oligonucleótido que comprende la secuencia SEQ ID NO: 21 y el oligonucleótido que comprende la secuencia SEQ ID NO: 22 diseñada para amplificar S. aureus, y  The primer pair formed by the oligonucleotide comprising the sequence SEQ ID NO: 21 and the oligonucleotide comprising the sequence SEQ ID NO: 22 designed to amplify S. aureus, and
La pareja de cebadores formada por el oligonucleótido que comprende la secuencia SEQ ID NO: 1 y el oligonucleótido que comprende la secuencia SEQ ID NO: 2 diseñados para amplificar B. cereus.  The primer pair formed by the oligonucleotide comprising the sequence SEQ ID NO: 1 and the oligonucleotide comprising the sequence SEQ ID NO: 2 designed to amplify B. cereus.
19. Conjunto de parejas de cebadores según la reivindicación 18, que comprende, además, al menos 1 , preferiblemente 2, 3, 4 o 5, de las parejas de cebadores y sondas seleccionadas del grupo que consiste en: 19. Set of primer pairs according to claim 18, further comprising at least 1, preferably 2, 3, 4 or 5, of the primer pairs and probes selected from the group consisting of:
La pareja de cebadores formada por el oligonucleótido que comprende la secuencia SEQ ID NO: 23 y el oligonucleótido que comprende la secuencia SEQ ID NO: 24, y la sonda que comprende la secuencia SEQ ID NO: 33 o SEQ ID NO: 34 si el microorganismo a detectar es B. cereus,  The primer pair formed by the oligonucleotide comprising the sequence SEQ ID NO: 23 and the oligonucleotide comprising the sequence SEQ ID NO: 24, and the probe comprising the sequence SEQ ID NO: 33 or SEQ ID NO: 34 if the microorganism to be detected is B. cereus,
- La pareja de cebadores formada por el oligonucleótido que comprende la secuencia SEQ ID NO: 25 y el oligonucleótido que comprende la secuencia SEQ ID NO: 26, y la sonda que comprende la secuencia SEQ ID NO: 35 si el microorganismo a detectar es C. perfringens, - The pair of primers formed by the oligonucleotide comprising the sequence SEQ ID NO: 25 and the oligonucleotide comprising the sequence SEQ ID NO: 26, and the probe comprising the sequence SEQ ID NO: 35 if the microorganism to be detected is C perfringens,
- La pareja de cebadores formada por el oligonucleótido que comprende la secuencia SEQ ID NO: 27 y el oligonucleótido que comprende la secuencia SEQ ID NO: 28, y la sonda que comprende la secuencia SEQ ID NO: 36 si el microorganismo a detectar es de la familia Enterobacteriaceae, La pareja de cebadores formada por el oligonucleótido que comprende la secuencia SEQ ID NO: 29 y el oligonucleótido que comprende la secuencia SEQ ID NO: 30, y la sonda que comprende la secuencia SEQ ID NO: 37 si el microorganismo a detectar es E. coli, y - La pareja de cebadores formada por el oligonucleótido que comprende la secuencia SEQ ID NO: 31 y el oligonucleótido que comprende la SEQ ID NO: 32, y la sonda que comprende la secuencia SEQ ID NO: 38 si el microorganismo a detectar es S. aureus. 20. Conjunto de parejas de cebadores según la reivindicación 19, que comprende además un control interno de amplificación de la qRTi-PCR seleccionado del grupo que consiste en - The pair of primers formed by the oligonucleotide comprising the sequence SEQ ID NO: 27 and the oligonucleotide comprising the sequence SEQ ID NO: 28, and the probe comprising the sequence SEQ ID NO: 36 if the microorganism to be detected is of the Enterobacteriaceae family, The primer pair formed by the oligonucleotide comprising the sequence SEQ ID NO: 29 and the oligonucleotide comprising the sequence SEQ ID NO: 30, and the probe comprising the sequence SEQ ID NO: 37 if the microorganism to be detected is E. coli, and - The primer pair formed by the oligonucleotide comprising the sequence SEQ ID NO: 31 and the oligonucleotide comprising SEQ ID NO: 32, and the probe comprising the sequence SEQ ID NO: 38 if the microorganism to be detected It is S. aureus. 20. Set of primer pairs according to claim 19, further comprising an internal amplification control of the qRTi-PCR selected from the group consisting of
La sonda de ácido nucleico que comprende el oligonucleótido SEQ ID NO: 39 en el caso de que el microorganismo cuantificado sea E. coli, uno de la Familia Enterobacteriaceae o S. aureus,  The nucleic acid probe comprising oligonucleotide SEQ ID NO: 39 in the case where the quantified microorganism is E. coli, one of the Enterobacteriaceae or S. aureus Family,
La sonda de ácido nucleico que comprende el oligonucleótido SEQ ID NO: 41 en caso de que el microorganismo cuantificado sea C. perfringens o E.coli, y  The nucleic acid probe comprising oligonucleotide SEQ ID NO: 41 in case the quantified microorganism is C. perfringens or E.coli, and
La sonda de ácido nucleico que comprende el oligonucleótido SEQ ID NO: 40 en caso de que el microorganismo cuantificado sea B. cereus, The nucleic acid probe comprising oligonucleotide SEQ ID NO: 40 in case the quantified microorganism is B. cereus,
C. perfringens, E. coli, uno de la Familia Enterobacteriaceae, o S. aureus. C. perfringens, E. coli, one of the Enterobacteriaceae Family, or S. aureus.
21. Conjunto de parejas de cebadores según la reivindicación 19 ó 20, en el que las sondas están marcadas en uno de sus extremos. 21. Set of primer pairs according to claim 19 or 20, wherein the probes are marked at one of their ends.
22. Conjunto de parejas de cebadores según la reivindicación 21 , en el que el mareaje es con un fluoróforo. 23. Uso in vitro de un conjunto de parejas de cebadores según cualquiera de las reivindicaciones 16 a 22, para la detección simultánea de C. jejuni, C. sakazakii, una cepa enterohemorrágica de E. coli, L. monocytogenes, Salmonella spp. y Shigella spp. 22. Set of primer pairs according to claim 21, wherein the marking is with a fluorophore. 23. In vitro use of a set of primer pairs according to any of claims 16 to 22, for the simultaneous detection of C. jejuni, C. sakazakii, an enterohemorrhagic strain of E. coli, L. monocytogenes, Salmonella spp. and Shigella spp.
24. Uso según la reivindicación 23, en el que la cepa hemorrágica de E. coli es E. coli 0157:1-17, la especie de Salmonella spp. es Salmonella entérica y/o la especie de Shigella spp. es Shigella dysenteriae. 25. Uso según la reivindicación 23 o 24, que comprende además la detección simultánea de al menos 1 , preferiblemente 2, 3, 4 o 5 de los microorganismos seleccionados de la lista que consiste en B. cereus, C. períringens, un microorganismo de la familia Enterobacteriaceae, E. coli y S. aureus. 24. Use according to claim 23, wherein the hemorrhagic strain of E. coli is E. coli 0157: 1-17, the species of Salmonella spp. It is enteric Salmonella and / or the species of Shigella spp. It's Shigella dysenteriae. 25. Use according to claim 23 or 24, further comprising the simultaneous detection of at least 1, preferably 2, 3, 4 or 5 of the microorganisms selected from the list consisting of B. cereus, C. períringens, a microorganism of the Enterobacteriaceae, E. coli and S. aureus family.
26. Un kit que comprende un conjunto de parejas de cebadores según cualquiera de las reivindicaciones 16 a 22. 26. A kit comprising a set of primer pairs according to any one of claims 16 to 22.
27. Uso de un kit según la reivindicación 26, para la detección simultánea de C. jejuni, C. sakazakii, una cepa enterohemorrágica de E. coli, L monocytogenes, Salmonella spp. y Shigella spp.. 27. Use of a kit according to claim 26, for the simultaneous detection of C. jejuni, C. sakazakii, an enterohemorrhagic strain of E. coli, L monocytogenes, Salmonella spp. and Shigella spp ..
28. Uso según la reivindicación 27, en el que la cepa hemorrágica de E. coli es E. coli 0157.Ή7, la especie de Salmonella spp. es Salmonella entérica y/o la especie de Shigella spp. es Shigella dysenteriae 28. Use according to claim 27, wherein the hemorrhagic strain of E. coli is E. coli 0157.Ή7, the species of Salmonella spp. It is enteric Salmonella and / or the species of Shigella spp. it's Shigella dysenteriae
29. Uso según la reivindicación 28, que comprende además la detección simultánea de al menos 1 , preferiblemente 2, 3, 4 o 5 de los microorganismos seleccionados de la lista que consiste en B. cereus, C. períringens, un microorganismo de la familia Enterobacteriaceae, E. coli y S. aureus. 29. Use according to claim 28, further comprising the simultaneous detection of at least 1, preferably 2, 3, 4 or 5 of the microorganisms selected from the list consisting of B. cereus, C. períringens, a microorganism of the family Enterobacteriaceae, E. coli and S. aureus.
PCT/ES2014/000162 2013-09-27 2014-09-26 Method for the simultaneous detection of pathogenic micro-organisms WO2015044472A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
ES201331415A ES2540158B1 (en) 2013-09-27 2013-09-27 Method for the simultaneous detection of pathogenic microorganisms
ESP201331415 2013-09-27

Publications (1)

Publication Number Publication Date
WO2015044472A1 true WO2015044472A1 (en) 2015-04-02

Family

ID=52742117

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/ES2014/000162 WO2015044472A1 (en) 2013-09-27 2014-09-26 Method for the simultaneous detection of pathogenic micro-organisms

Country Status (2)

Country Link
ES (1) ES2540158B1 (en)
WO (1) WO2015044472A1 (en)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107012239A (en) * 2017-05-06 2017-08-04 雷宇 A kind of multiplex PCR classifying method of C.perfringens
CN108179208A (en) * 2018-03-13 2018-06-19 苏州百源基因技术有限公司 For detecting the specific primer of Enterobacter sakazakii and probe and real-time fluorescence quantitative PCR kit
CN112161976A (en) * 2020-09-27 2021-01-01 郑州安图生物工程股份有限公司 Substrate combination, detection reagent and detection kit for detecting escherichia coli and/or shigella
CN113584122A (en) * 2021-08-12 2021-11-02 合肥工业大学 Liquid culture medium for resuscitating xerosis cutis and salmonella

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2020449A1 (en) * 2006-04-24 2009-02-04 Sigma Alimentos, S.A. De C.V. Method for detection and multiple, simultaneous quantification of pathogens by means of real-time polymerase chain reaction
CN101928773A (en) * 2010-05-14 2010-12-29 中国人民解放军军事医学科学院卫生学环境医学研究所 Oligonucleotide primer for detecting common pathogenic bacteria by adopting fluorescent quantitation PCR (Rich Client Platform) technology, method thereof for detecting common pathogenic bacteria and application thereof

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2020449A1 (en) * 2006-04-24 2009-02-04 Sigma Alimentos, S.A. De C.V. Method for detection and multiple, simultaneous quantification of pathogens by means of real-time polymerase chain reaction
CN101928773A (en) * 2010-05-14 2010-12-29 中国人民解放军军事医学科学院卫生学环境医学研究所 Oligonucleotide primer for detecting common pathogenic bacteria by adopting fluorescent quantitation PCR (Rich Client Platform) technology, method thereof for detecting common pathogenic bacteria and application thereof

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
DATABASE WPI Week 201111, 20 June 2014 Derwent World Patents Index; Class B04 *
FUKUSHIMA H ET AL.: "Duplex real-time SYBR green PCR assays for detection of 17 species of food- or waterborne pathogens in stools''.", JOURNAL OF CLINICAL MICROBIOLOGY, vol. 41, no. 11, 2003, pages 5134 - 5146, XP002400106, DOI: doi:10.1128/JCM.41.11.5134-5146.2003 *

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107012239A (en) * 2017-05-06 2017-08-04 雷宇 A kind of multiplex PCR classifying method of C.perfringens
CN108179208A (en) * 2018-03-13 2018-06-19 苏州百源基因技术有限公司 For detecting the specific primer of Enterobacter sakazakii and probe and real-time fluorescence quantitative PCR kit
CN112161976A (en) * 2020-09-27 2021-01-01 郑州安图生物工程股份有限公司 Substrate combination, detection reagent and detection kit for detecting escherichia coli and/or shigella
CN113584122A (en) * 2021-08-12 2021-11-02 合肥工业大学 Liquid culture medium for resuscitating xerosis cutis and salmonella
CN113584122B (en) * 2021-08-12 2023-09-15 合肥工业大学 Liquid medium for recovering dry injury from Cronobacter and Salmonella

Also Published As

Publication number Publication date
ES2540158A1 (en) 2015-07-08
ES2540158B1 (en) 2016-04-21

Similar Documents

Publication Publication Date Title
Mei et al. Development and application of a visual loop-mediated isothermal amplification combined with lateral flow dipstick (LAMP-LFD) method for rapid detection of Salmonella strains in food samples
O’Grady et al. Rapid real-time PCR detection of Listeria monocytogenes in enriched food samples based on the ssrA gene, a novel diagnostic target
Elizaquivel et al. A multiplex RTi-PCR reaction for simultaneous detection of Escherichia coli O157: H7, Salmonella spp. and Staphylococcus aureus on fresh, minimally processed vegetables
Rodrı́guez-Lázaro et al. A rapid and direct real time PCR-based method for identification of Salmonella spp.
Gordillo et al. Quantification of viable Escherichia coli O157: H7 in meat products by duplex real-time PCR assays
US9546405B2 (en) Detection of Listeria species in food and environmental samples, methods and compositions thereof
Gordillo et al. Development of PCR assays for detection of Escherichia coli O157: H7 in meat products
Berri et al. PCR-based detection of Coxiella burnetii from clinical samples
Thanthrige-Don et al. A novel multiplex PCR-electronic microarray assay for rapid and simultaneous detection of bovine respiratory and enteric pathogens
Bai et al. Development of a loop-mediated isothermal amplification assay for sensitive and rapid detection of Mycoplasma bovis
Zhai et al. Development of a real-time nucleic acid sequence–based amplification assay for the rapid detection of Salmonella spp. from food
WO2015044472A1 (en) Method for the simultaneous detection of pathogenic micro-organisms
Breum et al. Prevalence of Escherichia coli O157 and verocytotoxin producing E. coli (VTEC) on Danish beef carcasses
Podeur et al. Development of a real-time PCR method coupled with a selective pre-enrichment step for quantification of Morganella morganii and Morganella psychrotolerans in fish products
Gokduman et al. Recombinant plasmid-based quantitative Real-Time PCR analysis of Salmonella enterica serotypes and its application to milk samples
Heo et al. Rapid detection of Listeria monocytogenes by real-time PCR in processed meat and dairy products
Ren et al. Detection of Salmonella enteritidis and Salmonella typhimurium in foods using a rapid, multiplex real‐time recombinase polymerase amplification assay
CN113444831A (en) Primer for detecting SARS-CoV-2 novel coronavirus and its kit, detection method and application
Luan et al. A CRISPR/Cas12a-assisted rapid detection platform by biosensing the apxIVA of Actinobacillus pleuropneumoniae
Wang et al. Detection of viable Salmonella in ice cream by TaqMan real-time polymerase chain reaction assay combining propidium monoazide
Mirtneh et al. Phenotypic and molecular characterization of the capsular serotypes of Pasteurella multocida isolated from pneumonic cases of cattle in Ethiopia
Brey et al. Design and development of an internal control plasmid for the detection of Mycobacterium avium subsp. paratuberculosis using real-time PCR
Milton et al. Development of a novel single-tube SYBR Green real-time PCR assay for simultaneous detection of Brucella spp. and Listeria monocytogenes by melt curve analysis
CN112553355A (en) Primer probe combination, kit and method for detecting listeria monocytogenes based on RAA technology
ES2850324T3 (en) Hemoplasma detection method

Legal Events

Date Code Title Description
NENP Non-entry into the national phase

Ref country code: DE

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 14847438

Country of ref document: EP

Kind code of ref document: A1

122 Ep: pct application non-entry in european phase

Ref document number: 14847438

Country of ref document: EP

Kind code of ref document: A1