CN104745683B - One group is used for specific primer and probe and the detection kit that the real-time fluorescence quantitative PCR of Lactobacillus casei is detected - Google Patents
One group is used for specific primer and probe and the detection kit that the real-time fluorescence quantitative PCR of Lactobacillus casei is detected Download PDFInfo
- Publication number
- CN104745683B CN104745683B CN201410851676.1A CN201410851676A CN104745683B CN 104745683 B CN104745683 B CN 104745683B CN 201410851676 A CN201410851676 A CN 201410851676A CN 104745683 B CN104745683 B CN 104745683B
- Authority
- CN
- China
- Prior art keywords
- primer
- probe
- lactobacillus casei
- pcr
- real
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention, which provides one group, is used for specific primer and probe that the real-time fluorescence quantitative PCR of Lactobacillus casei is detected, sense primer：LcpolA227F：5’‑CCGCGTGATGAGGATATTTATG‑3’；Anti-sense primer：LcpolA313R:5’‑AGACTTGCGAGCAAACTGGC‑3’；Probe：LcpolA256P:5’‑CGCCAAACGGCAAGTGCCAGA‑3’；The Target Nucleotide Sequence of the primer and probe amplification is referring to SEQ ID No.2 in sequence table.The present invention also provides corresponding quantitative PCR detection kit.The kit of primer and probe and the present invention using the present invention being capable of lactobacillus casei content in quick, accurate, sensitive, the good quantitative sample to be measured of specificity.
Description
Technical field
The invention belongs to technical field of microorganism detection method, and in particular to one group is used for the real-time fluorescence of Lactobacillus casei
The specific primer and probe and corresponding quantitative PCR detection kit of quantitative PCR detection.
Background technology
Probiotics is the active microorganism raw-food material that a class is conducive to health, and conventional probiotics has acidophilus at present
Lactobacillus and the major class of Bifidobacterium two, are collectively known as " healthy three beneficial bacteria " with Lactobacillus casei, but domestic at present for cheese
It is few that lactobacillus is studied.Lactobacillus casei (Lactobacillus casei) is resistant to the defense mechanism of organism, wherein
Including the enzyme in oral cavity, bile acid of low pH value and small intestine etc. in gastric juice, so enter can be in intestines after human body for Lactobacillus casei
Large number of viable in road, so as to play regulation enteral bacterium colony balance, promote the effect such as digest and assimilate of human body.Meanwhile, cheese breast bar
Bacterium has efficient norcholesterol, and can induce generation antibiotic, promotes cell division, produces antibody mediated immunity and anticancer etc. and make
With.Lactobacillus casei, which also has, alleviates lactose intolerance, strengthens human immunity, Reduce allergy, reduction cholesterol and pre- anti-cancer
The prebiotic health-care effect such as disease and suppression tumour growth.Therefore the content of detection Lactobacillus casei is in detection cheese and lactic acid bacteria
Beneficial bacterial content, enhancing immunity of organisms is most important.
Lactobacillus species are more, and phenotype is similar, it is difficult to quick and precisely distinguish, traditional quantitative detecting method is by specific micro-
Biological medium is separated and counted to viable bacteria in food, and test process needs to carry out culture medium preparation, flat board culture, bacterium colony
The steps such as counting, biochemical identification, so whole detection seems complicated, time-consuming, and accuracy rate is low.Therefore, in the urgent need to research is built
Found quick, accurate, sensitive new detecting method.Real-Time Fluorescent Quantitative PCR Technique with its higher repeatability, sensitivity and
Accuracy is quantified in microorganism and lactic acid bacteria quantitative study field is used widely.
Real-time fluorescence quantitative PCR (Fluorescence quantitative PCR) technology is stepped from Standard PCR qualitative detection
The step of upper quantization, realize leap of the round pcr from qualitative to quantitative, it is to avoid cross pollution in normal PCR Quantitative measurement
The problem of, its relatively conventional round pcr is advanced, easy to operate, realizes the mesh of monitoring, absolute quantitation and quick detection in real time
, while having the advantages that sensitivity height, specific good, simple operation, therefore it is especially suitable for the detection of lactic acid bacteria.Using newborn bar
Strain specificity, quantitative detecting method, can simplify the detection program of probiotics, improve detection efficiency, can improve China prebiotic
The detectability of bacterium, improves the quality monitoring of health food, and the long term growth for probiotics industry provides technical guarantee.
The content of the invention
The invention provides the specific primer and probe that one group of real-time fluorescence quantitative PCR for being used for Lactobacillus casei is detected
And corresponding quantitative PCR detection kit.Detection Lactobacillus casei quick, sensitive, that specificity is good can be widely used in.
The present invention, which provides one group, is used for specific primer and probe that the real-time fluorescence quantitative PCR of Lactobacillus casei is detected,
Probe uses Taqman probes, and the nucleotide sequence of the primer and probe is as follows：
Sense primer：5’-CCGCGTGATGAGGATATTTATG-3’
Anti-sense primer：5’-AGACTTGCGAGCAAACTGGC-3’
Probe：5’-CGCCAAACGGCAAGTGCCAGA-3’；
The Target Nucleotide Sequence of the primer and probe amplification is referring to SEQ ID No.2 in sequence table.
The derived sequence of above-mentioned primer and probe is also protection scope of the present invention, and the derived sequence includes primer sequence
Complementary strand sequence, while can also be to 5 ' ends and 3 ' extreme directions extension one are to several bases or delete one and obtain to several bases
Sequence.
Preferably, 5 ' end fluorescent reporter groups of the probe are FAM, TET, JOE, HEX or VIC, and 3 ' end marks are
Fluorescent quenching group TAMRA, DABCYL or BHQ.
The present invention also provides a kind of real-time fluorescence quantitative PCR detection kit of Lactobacillus casei, and the kit includes
Primer and probe described in claim 1.
Third object of the present invention is to provide application of the mentioned reagent box in quantitative detection lactobacillus casei content.
Preferably, the application is lactobacillus casei content in quantitatively detection probiotic yogurt, cheese.
Fourth object of the present invention is to provide the real-time fluorescence quantitative PCR detection method of Lactobacillus casei, and step is as follows：
(1) standard items are prepared：Lactobacillus casei polA conservative gene fragments are inserted into carrier pMD18-T, contained
There is the recombinant plasmid of polA conservative gene fragments, in this, as standard items；The Lactobacillus casei polA conservative genes fragment ginseng
See the 165-458 nucleotide sequences of SEQ ID No.1 in sequence table；
(2) Specification Curve of Increasing；
(3) specific primer and probe described in usage right requirement 1 are anti-using identical to testing sample and standard items
System is answered to carry out real-time fluorescent PCR amplification；
(4) fast quantification of lactobacillus casei in probiotic bacteria milk product is carried out by the Ct values of standard curve and testing sample
Detection.
Preferably, the Lactobacillus casei polA conservative genes fragment is obtained by the amplification of following primer：
Sense primer is 5'-ATCCTGACGAAAACAGCAATGA-3',
Anti-sense primer is 5'-TTCAGTGCCCATAGCCTTCA-3'.
Preferably, the consumption of primer and probe is 1.0 μ l described in step (3).
Preferably, the reaction condition of real-time fluorescent PCR amplification is described in step (3)：94 DEG C of pre-degenerations 2 minutes, 94 DEG C
15 seconds, 60 DEG C of 40s and collect fluorescence signal, 40 circulations.
, can be by extracting the present invention is provided to carry out the primer and probe of qualitative and quantitative analysis to Lactobacillus casei
The DNA of detected sample extracts the cDNA combination real-time fluorescence quantitative PCR detection techniques that RNA obtains reverse transcription, reachable
The purpose of lactobacillus casei content into quantitative sample to be measured quick, accurate, sensitive, that specificity is good.It is provided by the present invention
Primer and probe can carry out qualitative and quantitative analysis to the lactobacillus casei content in dairy products and cheese, to judge dairy products and
The content of Lactobacillus casei is significant in cheese, and the present invention will play a significant role in Microbiological detection of foods field.
Brief description of the drawings
Accompanying drawing is used for providing a further understanding of the present invention, and constitutes a part for specification, the reality with the present invention
Applying example is used to explain the present invention together, is not construed as limiting the invention.In the accompanying drawings：
Fig. 1 is primer and probe system Optimal Experimental result；Wherein, a represents the μ L of upstream and downstream primer 1.6, the μ L of probe 1.6；b
Represent the μ L of upstream and downstream primer 2, the μ L of probe 0.8；C represents the μ L of upstream and downstream primer 1.6, the μ L of probe 0.8；D represents the μ of upstream and downstream primer 1
L, the μ L of probe 1.6；E represents the μ L of upstream and downstream primer 2, the μ L of probe 1.6；F represents the μ L of upstream and downstream primer 2, the μ L of probe 1.0；In g representatives
The μ L of anti-sense primer 1, the μ L of probe 0.8；H represents the μ L of upstream and downstream primer 1.6, the μ L of probe 1.0；I represents the μ L of upstream and downstream primer 1, probe
1.0μL；
Fig. 2 is sensitivity experiment result；Wherein, it is 1.00 × 10 that a, which represents plasmid concentration,8Copies/ml, b represent plasmid
Concentration is 1.00 × 107It is 1.00 × 10 that copies/ml, c, which represent plasmid concentration,6It is 1.00 that copies/ml, d, which represent plasmid concentration,
×105It is 1.00 × 10 that copies/ml, e, which represent plasmid concentration,4Copies/ml, f represent plasmid concentration as 1.00 ×
103It is 1.00 × 10 that copies/ml, g, which represent plasmid concentration,2copies/ml；
Fig. 3 is specificity experiments result, wherein occur standard amplification curve for Lactobacillus casei plasmid, do not occur standard
Amplification curve for streptococcus thermophilus, bifidobacterium lactis, bifidobacterium longum, Lactobacillus plantarum, Lactobacillus rhamnosus, secondary cheese breast
Bacillus, Bulgarian lactic acid bacterium, lactobacillus acidophilus, curling lactic acid bacteria, lactobacterium acidophilus, negative control；
Fig. 4 is Lactobacillus casei standard curve.
Embodiment
Following embodiment facilitates a better understanding of the present invention, but does not limit the present invention.Experiment in following embodiments
Method, unless otherwise specified, is conventional method；The primer, probe and sequencing efforts used are by the biological work of raw work
Journey (Shanghai) limited company synthesizes and completed.Test material used in following embodiments, unless otherwise specified, is certainly
What routine biochemistry reagent shop was commercially available.
The preparation of the Lactobacillus casei of embodiment 1 (gene of DNA polymerase I) polA gene standard items
Set up real time fluorescence quantifying PCR method it may first have to which the external standards needed for preparation method, standard items should be wrapped
Containing highly conserved, special sequence, it is ensured that the high specific of reaction.PolA gene orders have the conservative of height, and it is special
There are abundant cysteine and four unique insert districts in other functional areas, in DNA replication dna with being played an important role in repairing.
PolA genetic test Lactobacillus caseis, there is higher Sensitivity and Specificity.This part is mainly using round pcr amplification cheese breast
Bacillus polA genes, are connected in plasmid vector pMD18-T using gene recombination technology, construct recombinant plasmid pMD18-
T-LcpolA, and corresponding PCR identifications and sequencing identification are carried out, most afterwards through quantitative as the standard items for treating method for building up, under
The method of one step and assessment lay the foundation.
First, the preparation of template DNA
Lactobacillus casei (reference culture) genomic DNA is extracted, the template expanded as polA gene PCRs.Step is as follows：
(1) 1ml bacteria suspensions are taken, 8000r/min is centrifuged 5 minutes, abandons supernatant；
(2) the μ l suspension bacteria liquids of TE buffer solutions 400 precipitation of 10% sucrose is added, 20mg/ml lysozyme is added after mixing
20 μ l, 37 DEG C of effect 45min；
(3) 30 μ l 10%SDS and 3 μ l 10mg/ml Proteinase Ks, 55 DEG C of water-bath 1h are added；
(4) 500 μ l phenol/chloroform/isoamyl alcohol (volume ratio 25 is added:24:1) mix, 12000r/min centrifugations 10min；
(5) supernatant is taken, 500 μ l chloroform/isoamyl alcohol (volume ratio 24 is added:1) mix, 12000r/min centrifugations 10min；
(6) supernatant is taken, 50 μ l 3M NaAc and 800 μ l absolute ethyl alcohol is added, -20 DEG C of standing 30min, centrifugation is gone
Clearly；
(7) precipitation is washed with 70% ethanol, is dried；
(8) it is dissolved in 50 μ l distilled waters, -20 DEG C of preservations.
2nd, the PCR amplifications of polA genetic fragments
1st, the design and synthesis of primer
The present invention is by Lactobacillus casei polA complete sequences in ncbi database (referring to SEQ ID No.1 in sequence table)
Carry out bioinformatics and compare analysis, choose conservative fragments sequence (the sequence table SEQ ID No.1 for being adapted to design primer and probe
In 165-458 nucleotide sequences) be target, it is soft using the softwares of Primer express 3, Primer Premier 5
Part and the softwares of Oligo 7, the periphery for devising one group of real-time fluorescence quantitative PCR primer and probe and one group of correlated series is drawn
Thing.
Lactobacillus casei polA complete sequences are as follows：
5’-CGATGTCACTTTGCTGACGCTGCCAGCGGTTAAACGGTGGCTGGAAGATGCCAAACGAGATCTGAC
AGTTTTTGATGGCAAACGAAACATCGTCGCCGCTAATCGACTCGGCGTGAAATTACCGGATATCGCTTTTGACGTGT
TATTAGCGTCCTATTTGATTAATCCTGACGAAAACAGCAATGATTTGGGTAAAATCGCTGAAGATCACGATTATCAT
GACTTGCCGCGTGATGAGGATATTTATGGCAAAGGCGCCAAACGGCAAGTGCCAGAAGACGATAAGCTGTTTGGCCA
GTTTGCTCGCAAGTCTAATGCTTTGTTCGCATTGCGGCCTGATTTGACTGGCGATTTGGAAAAGCAGGCCCAAACAG
ACTTATTCACTGATATGGAAATGCCGCTTTCTCGGGTTTTGGCAGAAATGGAAATTCAAGGGATTACCCTAAATGCT
AAAACGCTGAAGGCTATGGGCACTGAATTCTCACAAAGCATCAAGATTTTGGAAGAGAAAATCTATGCAGAAGCTGG
CGTGAAGTTCAATTTGAACTCACCAAAGCAGCTCGGCGAAATTCTTTTTGAAAAATTGAATCTGCCTGTGATCAAGA
AAACGAAGACCGGTTACTCGACAAGCGTTGACGTGTTGAACGAATTGAAATCGGCAAGTCCGATTGTGCAGGACATT
TTGGATTATCGCGGCTGGGCGAAATTAAATTCGACTTATGTTGTCGGCT-3’
The peripheral primer sequence is as follows：
Sense primer：LcpolA165F：5'-ATCCTGACGAAAACAGCAATGA-3'
Anti-sense primer：LcpolA459R：5'-TTCAGTGCCCATAGCCTTCA-3'
Amplified fragments are conservative fragments sequence, and size is：314bp.
2nd, PCR reaction systems and reaction condition
Using DNA as template, using above-mentioned peripheral primer LcpolA165F/LcpolA459R as amplimer, using following bodies
System and reaction condition enter performing PCR amplification.
PCR reaction systems：
Wherein primer uses LcpolA165F/LcpolA459R, and Taq enzyme uses the Tyke Power Taq Plus of Beijing hundred
DNA Polymerse, PCR amplification instrument is the serial 96 grads PCR instrument of the Tyke iCycling of Beijing hundred.
Amplification program/reaction condition：
94 DEG C of pre-degeneration 5min；94 DEG C of 30s, 60 DEG C of 30s, 72 DEG C of 1min, 35 circulations；72 DEG C of 10min, take 3 μ L to expand
Product carries out 1% agarose electrophoresis, detects PCR primer size, then using the DNA gel reclaim reagent of Axygen companies production
Remaining pcr amplification product is reclaimed in box purifying.
3rd, recombinant plasmid pMD18-T-LcpolA structure and conversion
1st, coupled reaction：The pcr amplification product that above-mentioned purifying is obtained is connected with pMD18-T (Dalian treasured biotech firm)
Connect, prepared using following linked system：
16 DEG C are placed in after the completion of preparation to carry out staying overnight coupled reaction.
2nd, the conversion of pMD18-T-LcpolA plasmids and PCR identifications
(1) the DH5 α competent cells frozen are taken out from -70 DEG C of ultra low temperature freezer, being placed on ice chest makes it solve naturally
Freeze；
(2) take the μ L of connection product 10 to add in 50 μ L DH5 α competent cells, gently shake up rearmounted ice bath 30 minutes；
Heat shock 90 seconds, puts cooled on ice 2min immediately in (3) 42 DEG C of water-baths after heat shock；
(4) after LB fluid nutrient mediums (being free of ampicillin) mixing that 400 μ l of precooling are added into 1.5ml EP pipes,
37 DEG C of 200 revs/min of jog culture 1h；
(5) take 100 μ l to be coated on the LB flat boards containing Amp, IPTG, X-gal after above-mentioned nutrient solution is shaken up, face up
30min is placed, after bacterium solution is cultured base absorption completely, 37 DEG C of insulating box overnight incubations of culture dish are inverted；
(6) next day is observed, and picking white monoclonal bacterium colony is in the 100 μ L LB fluid nutrient medium (moulds of benzyl containing ammonia from flat board
Element) PCR pipe in, 37 DEG C of shaken cultivations 2-3 hours.Draw 2 μ L and enter performing PCR identification as template, remaining bacterium solution is added to
Expansion is carried out in 20ml LB fluid nutrient mediums to shake.
(7) above-mentioned dilution bacterium solution is expanded with carrier universal primer RV-M/M13-47, PCR primer uses 1% Ago-Gel
Electrophoresis, by detecting that PCR primer size identifies positive transformant.
Primer RV-M/M13-47 sequences are as follows：
Primer RV-M:5’-GAGCGGATAACAATTTCACACAGG-3’
Primer M13-47:5’-CGCCAGGGTTTTCCCAGTCACGAC-3’
PCR reaction systems are as follows：
PCR amplification programs/reaction condition：94 DEG C of pre-degeneration 5min；94 DEG C of 30s, 55 DEG C of 30s, 72 DEG C of 1min, 35 are followed
Ring；72℃10min.
(8) positive recombinant plasmid is extracted using the Plasmid Preparation kit of Axygen companies production, determines concentration and purity,
It is sequenced while drawing a part of plasmid purification and delivering to Shanghai bioengineering Co., Ltd, determines the gene order of Insert Fragment
It is consistent with aim sequence.
4th, the acquisition of standard items and quantitative
1st, the μ L transferred speciess of bacillus coli DH 5 α 100 containing recombinant plasmid pMD18-T-LcpolA for obtaining step 3 in
5mL LB fluid nutrient mediums, 37 DEG C of 200rpm, which are stayed overnight, shakes training；
2nd, the bacterium solution transferred speciess of 1ml overnight incubations is taken in 30ml LB fluid nutrient mediums, 200rpm Zengjing Granules 2-3 hours, so
Plasmid is extracted using the Plasmid Preparation kit of Axygen companies production afterwards；
3rd, using Tyke bio tech ltd ultramicron ultraviolet-uisible spectrophotometer (ND5000) of Beijing hundred to carrying
The plasmid taken is measured, and determines A260, A280, the purity of plasmid is judged according to A260/A280；
4th, plasmid pMD18-T-LcpolA concentration (copy number) is calculated
(1) molecular weight=3006bp × 660 (mean molecule quantity of each pair base) of plasmid；
(2) plasmid concentration is measured for 71.09ng/ μ l, plasmid purity A260/A280=1.89, A260/A230=1.93.
Because when carrying out real-time fluorescence quantitative PCR, it is necessary to " copy number " for unit, it is therefore desirable to by Conversion of measurement unit into copies/ml.
Plasmid copies/ml=Avgadro constants × plasmid molal quantity
Wherein Avgadro constant=6.02 × 1023copies/mol。
Therefore plasmid concentration copies/ml=71.09 × 10 extracted-9g/ml×6.02×1023copies/mol÷
(3006bp × 660g/bpmol)=2.1 × 1010copies/mol
It is 1.00 × 10 that the μ l of 10 μ l plasmids+11 sterilized water, which just obtains concentration,10Plasmid, then by the plasmid carry out 10 multiple proportions
Dilution just can obtain a series of plasmid of concentration, and be saved backup in -20 DEG C.
The real-time fluorescence quantitative PCR of embodiment 2 detects the preliminary foundation of Lactobacillus casei method
First, the design and synthesis of specific primer and probe
Conservative fragments sequence using the polA genes of the Lactobacillus casei of above-mentioned selection is target, using Primer
The softwares of express 3, the softwares of Primer Premier 5 and the softwares of Oligo 7, devise one group of real-time fluorescence quantitative PCR and draw
Thing and probe, probe use Taqman probes.
As the core of the present invention, one group is used for the specific primer and probe of Lactobacillus casei real-time PCR detection
Nucleotide sequence is as follows：
Sense primer：LcpolA227F：5’-CCGCGTGATGAGGATATTTATG-3’
Anti-sense primer：LcpolA313R:5’-AGACTTGCGAGCAAACTGGC-3’
Probe：LcpolA256P:5’-CGCCAAACGGCAAGTGCCAGA-3’.
The Target Nucleotide Sequence of the primer and probe amplification is：
5’-CCGCGTGATGAGGATATTTATGGCAAAGGCGCCAAACGGCAAGTGCCAGAAGACGATAAGCTGTTT
GGCCAGTTTGCTCGCAAGTCT-3’。
2nd, the preparation of sample to be tested
A, sample total serum IgE preparation
1) tissue is put into mortar by, is added liquid nitrogen and is ground, tissue adds 1ml Trizol per 50-100mg, with homogenate
Device carries out homogenized；
2) places homogenised sample 5 minutes for (15~30 DEG C) in room temperature, takes the homogenate of clarification to carry out next step operation；
3) adds 0.2ml chloroforms per 1ml Trizol, acutely vibration 15 seconds, and room temperature is placed 3 minutes；
4) .4 DEG C, 10000 revs/min are centrifuged 15 minutes, and aqueous phase is transferred in new pipe, and 0.5ml is added per 1mlTrizol
Isopropanol or 1ml ice ethanol, -80 DEG C of refrigerator-freezers freeze or frozen more than 30 minutes in -80 DEG C of refrigerator-freezers；
5) .4 DEG C 10000 revs/min centrifuge 10 minutes, supernatant discarded；
6) at least adds the ℅ ethanol of 1ml 75 per 1ml Trizol.4 DEG C centrifuge 5 minutes no more than 7500 revs/min, abandon
Clearly；
7) room temperatures place dry or vacuum and drain RNA precipitate, add 25~200 water of the μ l without RNase, and piping and druming is mixed, and 55
~60 DEG C of placements dissolve RNA in 10 minutes, -70 DEG C of preservations.
B, post transcription cloning
Reverse transcription system and amplification condition：Total 70 DEG C of mRNA (10pg-1 μ g) 10 μ l, Oligo (dT) 1 μ l are denatured 10 points
Cooled down 10 minutes in clock, insertion ice, add the μ l of dNTP 1, μ l, the PCR dedicated waters of 0.5 μ l, 5 × RT Buffer of reverse transcriptase 0.5
7 μ l, 42 DEG C are reacted 2 hours.- 20 DEG C of preservations.
3rd, real-time fluorescence quantitative PCR condition optimizing
Using concentration as 1.00 × 106Copies/ml positive plasmid be template, using hundred Imtech produce 2 ×
Real-time PCR Premixture (probe) real-time fluorescence quantitative PCR kit is tested, and it is real-time glimmering that experiment is used
Fluorescent Quantitative PCR instrument is the FTC-3000 real-time fluorescence quantitative PCR instrument that Shanghai Fengling Biological Technology Co. Ltd. produces, Optimization Steps
The consumption of one primer provided and probe.Reaction system uses 20 μ l systems, and the amount of primer and probe uses the combination in table 1 to enter
Row reaction.
The consumption of primer and probe in the PCR reaction systems of table 1
PCR reaction conditions：94 DEG C of pre-degenerations 2 minutes, 94 DEG C 15 seconds, 60 DEG C of 40s and collect fluorescence signal, 40 circulations.
As a result reference picture 1, during 20 μ l systems of data display, when primer (5 μM) and probe (5 μM) are separately added into 1.0 μ l, Ct values are minimum,
Fluorescence signal is most strong.
4th, method is assessed
1st, sensitivity experiment
The above-mentioned plasmid prepared is subjected to a series of plasmid that 10 doubling dilutions obtain concentration, it is 1.00 to choose concentration
×108copies/ml、1.00×107copies/ml、1.00×106copies/ml、1.00×105copies/ml、1.00×
104copies/ml、1.00×103copies/ml、1.00×102Copies/ml etc. is used as gradient template.PCR reaction systems are such as
Under：
PCR reaction conditions：94 DEG C of pre-degenerations 2 minutes, 94 DEG C 15 seconds, 60 DEG C of 40s and collect fluorescence signal, 40 circulations.
Fluorescence signal according to detected by instrument obtains fluorescence curve through software processing, observes the signal of fluorescence curve, as a result reference
Fig. 2.Data display reaches 1.00 × 10 when plasmid concentration3Still there is fluorescence signal during copies/ml, but plasmid concentration reaches
1.00×102Fluorescence signal is not detected by during copies/ml, therefore the sensitivity of the inventive method is 1.00 × 103copies/
ml。
2nd, specificity experiments
In order to confirm specificity of the present invention to Lactobacillus casei detection, we have chosen other lactic acid bacterias in dairy products
Specificity experiments are done, the lactic acid bacteria of selection includes：Streptococcus thermophilus, bifidobacterium lactis, bifidobacterium longum, Lactobacillus plantarum, pair
Lactobacillus casei, Bulgarian lactic acid bacterium, lactobacillus acidophilus, curling lactic acid bacteria, lactobacterium acidophilus, Lactobacillus rhamnosus.
It is experiment that template is carried out that the specificity experiments, which are included with the genomic DNA and cDNA of above-mentioned sample,.Above-mentioned lactic acid
The DNA of bacterium is extracted and is used Tiangeng bacterial genomes DNA extraction kit (DP302-02), and RNA, which is extracted, uses hundred Tykes
The high-purity total serum IgE Rapid extraction kits (RP1202) of RNApure, cDNA synthesis uses hundred Tyke Super RT Kit cDNA
First chain synthetic agent box, the 2 × real-time PCR Premixture (probe) produced using hundred Imtech are glimmering in real time
Fluorescent Quantitative PCR kit is tested, and reaction system is as follows：
PCR reaction conditions：94 DEG C of pre-degenerations 2 minutes, 94 DEG C 15 seconds, 60 DEG C of 40s and collect fluorescence signal, 40 circulations.
Fluorescence signal according to detected by instrument obtains fluorescence curve through software processing, observes the signal of fluorescence curve, and analysis is special
Property.As a result Fig. 3, concrete outcome are referred to no matter still being detected by template of cDNA by template only Lactobacillus casei of genomic DNA
For the positive, remaining lactic acid bacteria is feminine gender, shows that the present invention has specificity well.Testing result is referring to table 2.
The specificity experiments of table 2
3rd, prepared by standard curve
Using the logarithm of the positive template of different copy numbers as abscissa, to reach the first of fluorescence threshold in PCR courses of reaction
Beginning period (Ct) obtains the standard curve of Lactobacillus casei for ordinate, and calibration curve equation is y=36.9-3.0321x, makees
The reference standard quantitative determined for testing sample, as a result with reference to Fig. 4.
4th, the quantitative detection of testing sample
Using the DNA of testing sample cDNA and standard items as template, with the specific primer of Lactobacillus casei, with identical body
System carries out the fluorescent quantitative PCR of Lactobacillus casei polA genetic fragments simultaneously.
PCR reaction systems are as follows：
PCR reaction conditions：94 DEG C of pre-degenerations 2 minutes, 94 DEG C 15 seconds, 60 DEG C of 40s and collect fluorescence signal, 40 circulations.
The fast quantification for carrying out lactobacillus casei in probiotic bacteria milk product by the Ct values of standard curve and testing sample is examined
Survey.
Finally it should be noted that：The preferred embodiments of the present invention are the foregoing is only, are not intended to limit the invention,
Although the present invention is described in detail with reference to the foregoing embodiments, for a person skilled in the art, it still may be used
To be modified to the technical scheme described in foregoing embodiments, or to which part technical characteristic progress equivalent.
Within the spirit and principles of the invention, any modifications, equivalent substitutions and improvements made etc., should be included in the present invention's
Within protection domain.
Sequence table
<110>Suzhou Bai Yuan gene technology Co., Ltd
<120>Primer and probe and determine accordingly that one group of real-time fluorescence quantitative PCR for Lactobacillus casei is detected
Measure PCR detection kit
<170> PatentIn version 3.5
<210> 1
<211> 731
<212> DNA
<213>Lactobacillus casei polA complete sequences
<400> 1
cgatgtcact ttgctgacgc tgccagcggt taaacggtgg ctggaagatg ccaaacgaga 60
tctgacagtt tttgatggca aacgaaacat cgtcgccgct aatcgactcg gcgtgaaatt 120
accggatatc gcttttgacg tgttattagc gtcctatttg attaatcctg acgaaaacag 180
caatgatttg ggtaaaatcg ctgaagatca cgattatcat gacttgccgc gtgatgagga 240
tatttatggc aaaggcgcca aacggcaagt gccagaagac gataagctgt ttggccagtt 300
tgctcgcaag tctaatgctt tgttcgcatt gcggcctgat ttgactggcg atttggaaaa 360
gcaggcccaa acagacttat tcactgatat ggaaatgccg ctttctcggg ttttggcaga 420
aatggaaatt caagggatta ccctaaatgc taaaacgctg aaggctatgg gcactgaatt 480
ctcacaaagc atcaagattt tggaagagaa aatctatgca gaagctggcg tgaagttcaa 540
tttgaactca ccaaagcagc tcggcgaaat tctttttgaa aaattgaatc tgcctgtgat 600
caagaaaacg aagaccggtt actcgacaag cgttgacgtg ttgaacgaat tgaaatcggc 660
aagtccgatt gtgcaggaca ttttggatta tcgcggctgg gcgaaattaa attcgactta 720
tgttgtcggct 731
<210> 2
<211> 87
<212> DNA
<213>Artificial sequence
<400> 2
ccgcgtgatg aggatattta tggcaaaggc gccaaacggc aagtgccaga agacgataag 60
ctgtttggcc agtttgctcg caagtct 87
Claims (7)
1. a kind of real-time fluorescence quantitative PCR detection kit of Lactobacillus casei, it is characterised in that：The kit includes drawing
Thing, probe, standard items and PCR amplifing reagents；
Wherein, the nucleotide sequence of the primer and probe is as follows：
Sense primer：5’-CCGCGTGATGAGGATATTTATG-3’；
Anti-sense primer：5’-AGACTTGCGAGCAAACTGGC-3’；
Probe： 5’-CGCCAAACGGCAAGTGCCAGA-3’；
The Target Nucleotide Sequence of the primer and probe amplification is referring to SEQ ID No.2 in sequence table；
5 ' end fluorescent reporter groups of the probe are FAM, TET, JOE, HEX or VIC, and 3 ' end marks are fluorescent quenching groups
TAMRA, DABCYL or BHQ；
The standard items are that Lactobacillus casei polA conservative gene fragments are inserted into carrier pMD18-T, and acquisition contains polA
The recombinant plasmid of conservative gene fragment, in this, as standard items；The Lactobacillus casei polA conservative gene fragments are referring to sequence
SEQ ID No.1 165-458 nucleotide sequences in table；
The PCR amplifing reagents are：
2×premix 10μl
Primer F 1.0μl
Primer R 1.0μl
Probe 1.0μl
The μ l of template 2
ddH2O is mended to 20 μ l；
Wherein, the concentration of the Primer F is 5 μM, and the concentration of the Primer R is 5 μM, and the concentration of the Probe is 5 μ
M。
2. application of the kit in quantitative detection lactobacillus casei content described in claim 1.
3. application according to claim 2, it is characterised in that：The application is in quantitatively detection probiotic yogurt, cheese
Lactobacillus casei content.
4. the real-time fluorescence quantitative PCR detection method of Lactobacillus casei, it is characterised in that：Step is as follows：
（1）Prepare standard items：Lactobacillus casei polA conservative gene fragments are inserted into carrier pMD18-T, contained
The recombinant plasmid of polA conservative gene fragments, in this, as standard items；The Lactobacillus casei polA conservative genes fragment referring to
SEQ ID No.1 165-458 nucleotide sequences in sequence table；
（2）Specification Curve of Increasing；
（3）Specific primer and probe described in usage right requirement 1 are reacted using identical testing sample and standard items
System carries out real-time fluorescent PCR amplification；The PCR amplifing reagents are：
2×premix 10μl
Primer F 1.0μl
Primer R 1.0μl
Probe 1.0μl
The μ l of template 2
ddH2O is mended to 20 μ l；
Wherein, the concentration of the Primer F is 5 μM, and the concentration of the Primer R is 5 μM, and the concentration of the Probe is 5 μ
M；
（4）The Quantitative detection of Lactobacillus casei is carried out by the Ct values of standard curve and testing sample.
5. detection method according to claim 4, it is characterised in that：The Lactobacillus casei polA conservative gene fragments
Obtained by the amplification of following primer：
Sense primer is 5'- ATCCTGACGAAAACAGCAATGA-3'；
Anti-sense primer is 5'- TTCAGTGCCCATAGCCTTCA-3'.
6. detection method according to claim 4, it is characterised in that：Step（3）Described in primer and probe consumption it is equal
For 1.0 μ l.
7. detection method according to claim 4, it is characterised in that：Step（3）Described in real-time fluorescent PCR amplification it is anti-
The condition is answered to be：94 DEG C of pre-degenerations 2 minutes, 94 DEG C 15 seconds, 60 DEG C of 40s and collect fluorescence signal, 40 circulations.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410851676.1A CN104745683B (en) | 2014-12-31 | 2014-12-31 | One group is used for specific primer and probe and the detection kit that the real-time fluorescence quantitative PCR of Lactobacillus casei is detected |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410851676.1A CN104745683B (en) | 2014-12-31 | 2014-12-31 | One group is used for specific primer and probe and the detection kit that the real-time fluorescence quantitative PCR of Lactobacillus casei is detected |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104745683A CN104745683A (en) | 2015-07-01 |
| CN104745683B true CN104745683B (en) | 2017-07-18 |
Family
ID=53585933
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410851676.1A Active CN104745683B (en) | 2014-12-31 | 2014-12-31 | One group is used for specific primer and probe and the detection kit that the real-time fluorescence quantitative PCR of Lactobacillus casei is detected |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104745683B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106755470A (en) * | 2017-01-16 | 2017-05-31 | 吉林省浦生泰生物技术有限责任公司 | A kind of method of probiotics species and content in utilization Q PCR detections mixing probiotics |
| CN110699468B (en) * | 2019-10-29 | 2023-05-02 | 圣湘生物科技股份有限公司 | Composition, kit and method for detecting human intestinal bacteria |
| CN113736894B (en) * | 2021-08-05 | 2022-11-11 | 广东君道营养科技有限公司 | Detection method of four intestinal tract protection bacteria and nucleic acid detection kit |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101712989B (en) * | 2009-09-21 | 2011-08-31 | 内蒙古农业大学 | Method for quickly, qualitatively and quantitatively measuring Lactobacillus casei in probiotic dairy products |
-
2014
- 2014-12-31 CN CN201410851676.1A patent/CN104745683B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN104745683A (en) | 2015-07-01 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP5238248B2 (en) | Method for quantitative analysis of microorganisms targeting rRNA | |
| CN103642910B (en) | The primer of detection by quantitative Klebsiella pneumonia and probe and application thereof | |
| CN108179209A (en) | For detecting the specific primer of proteus mirabilis and probe and real-time fluorescence quantitative PCR kit | |
| CN104745683B (en) | One group is used for specific primer and probe and the detection kit that the real-time fluorescence quantitative PCR of Lactobacillus casei is detected | |
| WO2015196778A1 (en) | Providencia o3, o4, o8, o12, o13 and o20 specific nucleotide and application thereof | |
| CN103184289A (en) | Method for detecting five bacteria in vinegar grains by fluorogenic quantitative PCR (polymerase chain reaction) | |
| CN113564272A (en) | Rapid identification and detection method for cheese lactobacillus in fermented milk | |
| CN106811529A (en) | The fluorescent quantificationally PCR detecting kit and primer of mycobacterium tuberculosis, probe | |
| CN108841984A (en) | It is a kind of for detecting nucleotide sequence group, kit and the method for Fusarium oxysporum | |
| CN108841975A (en) | One kind is for detecting the streptococcic nucleotide sequence group of B race, kit and method | |
| CN105063191A (en) | Specific primer and probe for real-time fluorescent quantitative PCR (polymerase chain reaction) detection on helicobacter pylori in mouth | |
| WO2015180484A1 (en) | Nucleotides specific to providencia o31, o41, o42, o43 and o50 and uses thereof | |
| CN103834745B (en) | The quantitative analysis method of milk-acid bacteria and genus bacillus in Daqu microflora | |
| CN103667271B (en) | The primer of detection by quantitative Candida albicans bacterium and probe and application thereof | |
| CN104726553B (en) | The specific primer and probe and detection kit that one group of real-time fluorescence quantitative PCR for being used for Lactobacillus rhamnosus detects | |
| CN116121415A (en) | Multiplex fluorescence quantitative PCR kit for simultaneously detecting three bifidobacteria, application and detection method | |
| CN116479145A (en) | Multiplex fluorescence quantitative PCR primer probe set, method and kit for simultaneously detecting three bifidobacteria | |
| Hu et al. | Detection of viable Lacticaseibacillus paracasei in fermented milk using propidium monoazide combined with quantitative loop-mediated isothermal amplification | |
| CN116121422A (en) | Primer probe, kit and method for identifying lactobacillus paracasei | |
| CN104450941A (en) | Method for detecting lactobacillus casei strain and kit and primer pair thereof | |
| CN102533790B (en) | PCR detection method for detecting lactobacillus plantarum ST-III and primer and kit thereof | |
| CN105603102A (en) | Specific primer and probe for real-time fluorescent PCR detection of enterococcus faecalis | |
| CN108866215B (en) | Real-time fluorescent quantitative PCR kit for detecting enterobacter aerogenes | |
| CN105400878B (en) | One group of specific primer and probe for staphylococcus epidermis real-time fluorescence PCR detection | |
| CN108660228A (en) | Specific primer and probe for detecting shigella flexneri and real-time fluorescence quantitative PCR kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |