CN104894212A - Method, primer, probe and kit for detecting cronobacter sakazakii - Google Patents

Method, primer, probe and kit for detecting cronobacter sakazakii Download PDF

Info

Publication number
CN104894212A
CN104894212A CN201510256838.1A CN201510256838A CN104894212A CN 104894212 A CN104894212 A CN 104894212A CN 201510256838 A CN201510256838 A CN 201510256838A CN 104894212 A CN104894212 A CN 104894212A
Authority
CN
China
Prior art keywords
cronobacter sakazakii
probe
primer
slope
sequence
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201510256838.1A
Other languages
Chinese (zh)
Inventor
胡双芳
肖性龙
李蓉
余以刚
庄平
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
INSPECTION AND QUARANTINE TECHNOLOGY CENTER ZHONGSHAN ENTRY-EXIT INSPECTION AND QUARANTINE
South China University of Technology SCUT
Original Assignee
INSPECTION AND QUARANTINE TECHNOLOGY CENTER ZHONGSHAN ENTRY-EXIT INSPECTION AND QUARANTINE
South China University of Technology SCUT
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by INSPECTION AND QUARANTINE TECHNOLOGY CENTER ZHONGSHAN ENTRY-EXIT INSPECTION AND QUARANTINE, South China University of Technology SCUT filed Critical INSPECTION AND QUARANTINE TECHNOLOGY CENTER ZHONGSHAN ENTRY-EXIT INSPECTION AND QUARANTINE
Priority to CN201510256838.1A priority Critical patent/CN104894212A/en
Publication of CN104894212A publication Critical patent/CN104894212A/en
Pending legal-status Critical Current

Links

Classifications

    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Landscapes

  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses a method, primer, probe and kit for detecting cronobacter sakazakii. The primer and probe for fluorogenic quantitative PCR detection are designed according to a conserved sequence of a cronobacter sakazakii genome; fluorogenic quantitative PCR detection technique of cronobacter sakazakii is established; and whether cronobacter sakazakii exists can be determined according to an amplification curve after a reaction is over. The sequence of the primer comprises an upstream primer sequence of 5'GGGATACGCAGGAGGTGGCA' and a downstream primer sequence of 5'GATGCTGCCTGCCAGCAGG'. The sequence of the probe is 5'CATTTTAGCGCTTGATACTCCCCTGGGC'. According to the invention, the method for detecting cronobacter sakazakii is good in accuracy and high in sensitivity, and whether cronobacter sakazakii exists in a sample can be fast and simply determined.

Description

A kind of method and primer, probe and test kit detecting the rugged Cronobacter sakazakii of slope
Technical field
The present invention relates to Measurement for Biotechnique, particularly the primer of slope rugged Cronobacter sakazakii Nucleotide and the method for probe and the rugged Cronobacter sakazakii of detection slope.
Background technology
The rugged Cronobacter sakazakii of slope (Cronobactersakazakii) original name Enterobacter sakazakii (Enterobactersakazakii) is that one has peritrichous, can move, amphimicrobian Gram-negative sporeless bacterium.Its epidemiology survey shows, and its cases of infection great majority are infant, mainly cause microbemia, meningitis, necrotizing enterocolitis etc., and are attended by serious neural system sequela.As a kind of conditioned pathogen, it has the lethality rate up to 40% ~ 80% to special population.Cronobacter sakazakii is extensively distributed in the numerous food such as baby milk powder, cheese, butcher's meat, water, vegetables, rice, bread, tealeaves, herbal medicine, seasonings and bean curd and food raw material.Along with a series of baby milk powder relevant to this bacterium recalls the outburst with great infection event, in baby formula milk powder, the pollution problem of the rugged Cronobacter sakazakii of slope receives global concern.
Comprise the Zurich Cronobacter sakazakii (C.turicensis) of the rugged Cronobacter sakazakii of slope at present, malonate Cronobacter sakazakii (C.malonaticus), outstanding Buddhist nun's Butterworth Cronobacter sakazakii (C.universails), Mu Tingsi Cronobacter sakazakii (C.muytjensii), the Cronobacter sakazakii confirmation of Dublin Cronobacter sakazakii (C.dublinensis) 6 kinds has pathogenic to human body, and health Supreme Being covers Cronobacter sakazakii (C.condiment), and three of up-to-date classification in 2014 kinds of C.zurichensis, C.helveticus and C.pulveris etc. 4 kinds yet there are no the report that can cause human body diseases.There is larger difference to the susceptibility of chemical substance and temperature and microbiotic aspect in each kind of bacterial strain that Cronobacter sakazakii belongs to, and the expression under specific circumstances of the virulence factor of each bacterium is also different, thus the virulence caused also is not quite similar.Research shows, the rugged Cronobacter sakazakii of slope and malonate Cronobacter sakazakii are the main bacterial strains causing human disease, has higher pathogenic.The rugged Cronobacter sakazakii of slope to external world injurious factor resistibility is strong, and distribution is wide, is isolated main bacterial strain in the milk powder of pollution Cronobacter sakazakii.Therefore carry out fast the rugged Cronobacter sakazakii of slope and identify reliably and detect detecting in food contamination and tracing to the source and clinical and epidemiology has a very important role on species level.At present following three aspect problems are mainly existed to the rapid detection of Cronobacter sakazakii:
1) existing detection method lags behind the development of Cronobacter sakazakii genus on taxonomy.
Because Cronobacter sakazakii belongs at classificatory development, many existing detection methods, cannot belong to Cronobacter sakazakii on species level and distinguishing, such as, be that Mu Tingsi Cronobacter sakazakii ATCC 51329 identifies as the rugged Cronobacter sakazakii of slope by reality.This give food pollution detection and trace to the source and clinical with epidemiology on fast shaping propose a difficult problem.
2) existing molecular method cannot adapt to the specific detection of the Cronobacter sakazakii of DNA homology each kind high.
The Major Difficulties of existing slope rugged Cronobacter sakazakii detection method be the rugged Cronobacter sakazakii of slope with other Cronobacter sakazakii and enterobacteriaceae other bacteriums particularly enterobacter cloacae in morphological specificity, physiological and biochemical property aspect has high similarity, and has high DNA homology.Therefore no matter be FDA recommendation all exists poor selectivity shortcoming to the detection method of this bacterium or the current all kinds of method for detecting based on nucleotide fragments, easily occur false positive or false negative result.The gene being used to the detection of Cronobacter sakazakii genus at present has gluA, gyrB, dnaG, ompA, ropB and zpx etc.Two guanylate cyclases are extensively present in various food-borne pathogens, and some relevant gene fragment all has the conservative property of height in many bacteriums, as vibrio cholerae, and Salmonellas and intestinal bacteria.And the cgcA gene participating in coding two guanylate cyclase in Cronobacter sakazakii genus not only has the conservative property in genus, and there is the allelic specificity difference between planting, well can also distinguish with other bacteriums of enterobacteriaceae in addition.Within 2012, cgcA gene is used in the fast typing research of Cronobacter sakazakii genus first, but has no report based on the nucleic acid detection method of the Cronobacter sakazakii of cgcA gene.
3) existing detection method cannot adapt to quick, special and high-throughout requirement.
Existing detection method mainly contains conventional biochemical detection method based on bio-chemical characteristics and RNA isolation kit, based on methods such as molecular biological PCR method, gene chip, HRM.Molecular biology method has fast than traditional Physiology and biochemistry method, high-throughput and advantage fast.Wherein based on the fluorescence quantifying PCR method of fluorescent probe mark, than regular-PCR method, there is higher detection limit and low stain, than HRM method, there is higher specificity, than biochip technology, there is cheaper cost and operability.
The present invention has reported on the basis of the rugged Cronobacter sakazakii of slope and other Cronobacter sakazakii genome sequences in analysis, designs based on cgcA gene specificity, the rapid detection that primer and fluorescent probe realize the rugged Cronobacter sakazakii of slope respectively.The Fluorescence PCR assay adopted is on the basis of regular-PCR, adds a specific fluorescent probe in amplification reaction system while adding a pair Auele Specific Primer again, uses the fluorescent PCR detector of Real-Time Monitoring to detect the technology of target nucleotide sequences.
Summary of the invention
Technical problem to be solved by this invention is to provide a kind of primer, the probe sequence that detect for the rugged Cronobacter sakazakii real-time fluorescence quantitative PCR of slope, make it possible to quickly and easily judgement sample and whether have the rugged Cronobacter sakazakii of slope, can be used for the detection of pathogenic bacterium in various milk-product.In order to reduce the detection time to the rugged Cronobacter sakazakii of slope, improve the positive rate of the rugged Cronobacter sakazakii of slope, this research application, based on the fluorescent quantitative PCR technique of TaqMam probe, sets up the method for rapid detection.
The present invention is directed to the genomic conserved sequence of the rugged Cronobacter sakazakii of slope and devise primer for fluorescence quantitative PCR detection and probe, establish the rugged Cronobacter sakazakii fluorescence quantitative PCR detection technique of slope, reaction terminates to have determined whether the rugged Cronobacter sakazakii of slope according to amplification curve.
Wherein, above-mentioned reaction conditions can be: 95 DEG C of sex change 1min; With 95 DEG C of 5s, 60 DEG C of 40s increase 40 circulate (collection fluorescence).In order to solve the problems of the technologies described above, the present invention has reported on the basis of the rugged Cronobacter sakazakii of slope and other Cronobacter sakazakii genome sequences in analysis, design primer and fluorescent probe respectively based on cgcA gene, described primer is made up of forward primer and reverse primer, and its nucleotide sequence is as follows:
Upstream primer CSPF753 sequence is 5 ' GCAGGTGCTGCTGCGAG3 ' (SEQ ID NO:2)
Downstream primer CSPR890 sequence is 5 ' GCAGATTGTCTTTGTCATACCCG3 ' (SEQ ID NO:3)
Or the upstream primer of above-mentioned primer pair extends 10 bases to 5 ' extreme direction, extend 10 bases to 3 ' extreme direction, downstream primer extends 10 bases to 3 ' extreme direction, extends the primer sequence obtained within the scope of 10 base zones to 5 ' extreme direction.
The nucleotide sequence of the probe of the present invention's design is as follows:
CSPB803:5‘TTGATCAGGTCGTCAGAATCTACGGGT3’(SEQ ID NO:4)
Or above-mentioned probe sequence extends 10 bases to 3 ' extreme direction and extends the probe sequence obtained within the scope of 10 base zones to 5 ' extreme direction.
Detect a method for the rugged Cronobacter sakazakii of slope, comprise the steps:
(1) above-mentioned probe one end is marked with reporter fluorescence dyestuff, the other end is marked with quench fluorescence dyestuff, obtains the probe being marked with fluorescein;
(2) with the DNA of testing sample for template, utilize the upstream and downstream primer described in claim 1 and the above-mentioned probe being marked with fluorescein to carry out real-time fluorescence quantitative PCR reaction, image data after each loop ends;
(3) reaction terminates to have judged whether the rugged Cronobacter sakazakii of slope according to amplification curve afterwards.
Described reporter fluorescence dyestuff adopt in following fluorophor any one: Fam, Hex, Tet, Joe, Vic, FITC, Cy3 and Cy5; Described quencher fluorescent dye adopt in following fluorophor any one: Tamra, Rox, Dabcy1, BHQ1 and BHQ2.
In the reaction system of 25 μ l, the condition of described real-time fluorescence quantitative PCR reaction is:
Component Volume Final concentration
10×PCR Buffer 1～3μl 0.4～1.2×
DNTPs (each 2.5mM) 1～3μl 0.1～0.3mM
Upstream and downstream primer (each 10 μMs) Each 1 ~ 2 μ l 0.4～0.8μM
Be marked with the probe (10 μMs) of fluorescein 0.2～0.8μl 0.08～0.32μM
Taq enzyme (5U/ μ l) 0.2～0.8μl 1～4U
The DNA of testing sample 3～5μl
RNase Free dH2O Mend to cumulative volume 25 μ l
Described real-time fluorescence quantitative PCR reaction conditions is: 95 DEG C of sex change 1min; With 95 DEG C of 5s, 60 DEG C of 40s increase 40 and circulate.
Detect a test kit for the rugged Cronobacter sakazakii of slope, comprise above-mentioned upstream and downstream primer and probe.
Described test kit also comprises 10 × PCR Buffer, dNTPs and Taq enzyme.
In the reaction system of 25 μ l, each component of test kit is as follows:
In the reaction system of 25 μ l, each component of test kit is as follows:
The present invention is according to TaqMan technology, the basis of Standard PCR with the addition of the nucleotide probe that is marked with two fluorescent dye groups, such as hold 5 ' of the probe of reporter fluorescence dye marker, quencher fluorescent dye is marked at 3 ' end of probe, both form energy trasfer structure, and the fluorescence that namely reporter fluorescence dyestuff is launched can be quenched fluorescent dye absorption, when the two distance becomes far away, restraining effect weakens, and reporter fluorescence dye signal strengthens.In amplified reaction process, probe is with the object amplified fragments hybridization in template, the 5 prime excision enzyme activity held to 3 ' is held because Taq enzyme has 5 ', cut off by probe in the amplification extension stage, the restraining effect of quencher fluorescent dye disappears, and reporter fluorescence dye signal strengthens, in the amplification extension stage, probe is cut off, the restraining effect of quencher fluorescent dye disappears, and reporter fluorescence dye signal strengthens, thus realizes the detection to the rugged Cronobacter sakazakii of slope.
Certainly, the probe of the primer pair that can provide according to the present invention or its other type of amplified production sequences Design, detects with the fluorescent PCR being suitable for different methods.
The Fluorescence PCR assay that the present invention adopts is on the basis of regular-PCR, add a specific fluorescent probe add a pair Auele Specific Primer in amplification reaction system while again, use the fluorescent PCR detector of Real-Time Monitoring to detect the technology of target nucleotide sequences.Except the advantage with regular-PCR, it also has the following advantages: (1) specificity is stronger, sensitivity is higher: due to employ more one can with the fluorescent probe of template complementary pairing, thus improve specificity, and collect fluorescent signal by self-reacting device, avoid the subjectivity of artificial judgment, can further improve sensitivity again; (2) quantitatively more accurately and reliably: totally-enclosed reaction, online Real-Time Monitoring fluorescence, need not the logarithmic phase of PCR, abandons the end point analysis method by multifactor interference of regular-PCR method; (3) scope of application is wider: the nucleic acid that can detect the rugged Cronobacter sakazakii of any slope in theory; (4) the two inspection of single tube can be realized or examine more, also can design mark in specific aim, monitoring extraction efficiency and get rid of inhibitor interference; (5) toxic reagent is not contacted, operational safety.But, quantitative fluorescent PCR for the requirement of primer relative to regular-PCR, more harsh.
The primer specificity that the present invention designs according to the rugged Cronobacter sakazakii genome sequence of slope is good, for fluorescent PCR detect highly sensitive.Detection method accuracy is strong, and highly sensitive, whether it quickly and easily can have the rugged Cronobacter sakazakii of slope by judgement sample, in various milk-product, the differential diagnosis of the rugged Cronobacter sakazakii of slope provides scientific basis.
Accompanying drawing explanation
Fig. 1 is the detected result figure of the specificity experiments of the rugged Cronobacter sakazakii detection of nucleic acids of Real-Time Fluorescent Quantitative PCR Technique slope;
Fig. 2 is the detected result figure of the sensitivity experiment of invention detection method;
Fig. 3 is that in baby formula milk powder, the rugged Cronobacter sakazakii of slope increases bacterium detected result figure.
Embodiment
For understanding the present invention better, below in conjunction with drawings and Examples, the present invention is further illustrated, but the scope of protection of present invention is not limited to the scope of embodiment statement.
Embodiment 1
Detect a method for the rugged Cronobacter sakazakii of slope, carry out according to following steps:
1. the design of primer and probe and synthesis
The rugged Cronobacter sakazakii genome sequence of all slopes is downloaded from ncbi database, by the comparative analysis to sequence, select without secondary structure and the section of high conservative (SEQ ID NO:1), its sequence is as follows: CGCTGTACATTCGCCCCTTTGATGAAAGCGTGCTGAATAAAGATCTCTCAGACAGC CCGCTTTTTAC cGCGCCAGGGCAGCGCCACCTGGCTGTCGGCGC tTGCGCGCTCGACGCGTTACCCGATTGTCGTGGTGGC gCGCGACCTGGCTTAAAAACAGTATTCCCGATTTGCTTATCAACGGTGCGCTGCTG ACTGCCATTATCCTGATGGGCA
Wherein, italic overstriking is respectively upstream and downstream primer sequence, and underscore overstriking is probe sequence.
Utilize biosoftware Primer Express 3.0 for above-mentioned section design primer and Taqman probe.And carried out the checking of Blast sequence analysis by ncbi database, guarantee that sequence and other species are without intersecting.Primer sequence is:
Upstream primer: CSPF753:5 ' GCAGGTGCTGCTGCGAG3 '
Downstream primer: CSPR890:5 ' GCAGATTGTCTTTGTCATACCCG3 '
Probe sequence: CSPB803:5 ' TTGATCAGGTCGTCAGAATCTACGGGT3 ',
5 ' the end reporter fluorescence dyestuff FAM mark of this probe, 3 ' end quencher fluorescent dye BHQ2 mark.
2. the extraction of DNA
By rugged for slope to be checked Cronobacter sakazakii nutrient solution phenol-chloroform method extracting genomic dna.Concrete steps are as follows:
2.1. add in the centrifuge tube of 1.5ml by rugged for slope to be checked Cronobacter sakazakii enrichment liquid (about 1ml), centrifugal 5 minutes of 12000r/min, removes supernatant;
2.2. add DNA cleavage liquid 700 μ l, fully mixing is resuspended, and water-bath boils 5 minutes;
2.3. isopyknic phenol-chloroform (V/V=1:1) solution is added, fully centrifugal after mixing, centrifugal 5 minutes of 13000r/min;
2.4. supernatant liquor is entered in the centrifuge tube of another 1.5ml, add isopyknic chloroform, mixing, the centrifugal 5min of 13000r/min;
2.5. supernatant is moved in the centrifuge tube of another 1.5ml, add the Virahol of 0.6 times of volume, mixing of turning upside down, centrifugal 5 minutes of 13000r/min;
2.6. use 70% alcohol flushing after abandoning supernatant, centrifugal 5 minutes of 13000r/min, careful suction abandons supernatant, and inversion is dried;
2.7. add 50 μ l DNA lysates in centrifuge tube after the drying fully to mix, stand-by as DNA profiling.
3. the foundation of Real-t imePCR system and optimization
3.1. the optimization of primer concentration is when in reaction system, other condition is identical, the primer concentration of rugged for slope Cronobacter sakazakii is done multiple proportions serial dilution from 0.1 μm of ol/l to 1.6 μm of ol/l respectively, by the com-parison and analysis of test-results, determine that best primer final concentration is 0.6 μm of ol/l.
3.2. the optimization of Taq archaeal dna polymerase (Taq enzyme) consumption is by comparing the optimization experiment result of Taq enzyme consumption (in unit Unit), and selected 2.5U is as the consumption of Taq enzyme in test kit reaction system.
3.3. the optimization of dNTPs concentration detects by using the dNTPs of different concns, selects 0.2mmol/l as the usage quantity of dNTPs in test kit reaction system after comprehensive assessment.
3.4. the optimization of concentration and probe concentration is when in reaction system, other condition is identical, the concentration and probe concentration of rugged for slope Cronobacter sakazakii is detected respectively after 0.1 μm of ol/l to 0.5 μm of ol/l does multiple proportions serial dilution, by the com-parison and analysis of test-results, determine that best probe final concentration is 0.2 μm of ol/l.
Utilize above-mentioned primer and probe to carry out the foundation of reaction system, finally determine that the slope rugged Cronobacter sakazakii real-time fluorescence quantitative PCR reaction system adopted is 25 μ l systems, required each component and respective concentration are in table 1.
Each component situation in the reaction of table 1 slope rugged Cronobacter sakazakii real-time fluorescence quantitative PCR
Component 25 μ l volumes Final concentration
10×PCR Buffer 2.5μl 1×
DNTPs, each 2.5mM 2μl 0.2mM
Upstream and downstream primer, each 10 μMs Each 1.5 μ l 0.6μM
Probe, 10 μMs 0.5μl 0.2μM
Taq enzyme, 5U/ μ l 0.5μl 2.5U
The DNA of testing sample 5μl
RNase Free dH2O 11.5μl
The instrument that note: a. uses is different, reaction parameter should be appropriately adjusted.
B. different according to detection samples sources, should suitably adjust template dosage.
4. real-time fluorescence quantitative PCR reaction conditions
After sample hose being put into ABI company 7500 fluorescent PCR instrument, following condition is set and reacts: 95 DEG C of sex change 3min; With 95 DEG C of 5s, 60 DEG C of 40s increase 40 circulate (collection fluorescence).Reaction terminates rear according to curve result of determination.
The quantitative fluorescent PCR reaction system bacterium different to 14 strains set up in embodiment 1 is utilized to detect (the rugged Cronobacter sakazakii of 6 strain slope and Mu Tingsi Cronobacter sakazakii, enterobacter cloacae (Enterobacter cloacae), intestinal bacteria (Escherichia Coli), Salmonellas (Salmonella typhimurium), Shigellae (Shigellaflexneri), Listeria monocytogenes (Listeria monocytogenes), streptococcus aureus (Staphylococcus aureus), swine streptococcus (Streptococcus suis) each strain)
Test-results: detected result as shown in Figure 1, in figure, 1 is the rugged Cronobacter sakazakii reference culture of ATCC 29544 slope, 2 ~ 6 obtain the rugged Cronobacter sakazakii of slope for Zhong Shan Entry-Exit Inspection and Quarantine Bureau is separated, and all occur corresponding specificity fluorescent amplification curve, are positive.In figure, 7 is in 1 strain Mu Tingsi Cronobacter sakazakii and figure 8 be that 1 Enterobacter cloacae does not then all have fluorescent signal to produce, and is judged to feminine gender.Intestinal bacteria, Salmonellas, Shigellae, Listeria monocytogenes, streptococcus aureus, swine streptococcus all do not have fluorescent signal to produce in addition, are judged to negative (not shown).All there is the positive " S " type amplification curve in the rugged Cronobacter sakazakii of all slopes as shown in the figure, and other bacterial strains are all without increasing as negative.Within the scope of selected bacterial strain, the primer of design and probe specificity are 100%.
Embodiment 2
The water gradient dilution that slope rugged Cronobacter sakazakii ATCC 29544DNA DEPC (diethylpyrocarbonate) extracted processes is become 4.6 × 10 7, 4.6 × 10 6, 4.6 × 10 5, 4.6 × 10 4, 4.6 × 10 3, 4.6 × 10 2, 4.6 × 10 1copy number/mL, utilize the quantitative fluorescent PCR reaction system set up in embodiment 1 to carry out relative sensitivity detection, detected result as shown in Figure 2.
Result confirms that the lowest detectable limit that the rugged Cronobacter sakazakii of slope detects all reaches 460 template copy/ml.
Embodiment 3
Get baby formula milk powder, record it according to GB 4789.40-2010 method and pollute without the rugged Cronobacter sakazakii of slope.Absorption 1ml concentration is that the bacteria suspension of 10cfu/ml is evenly mixed in 25g baby formula milk powder, leave standstill 10min, add 225ml BPW (buffered peptone water) enrichment liquid, after mixing, 37 DEG C of cultivations, 1ml enrichment liquid is respectively got respectively after 4h, 6h, 12h, 18h, 24h, the centrifugal 10min of 4000r/min, carefully chooses upper-layer fat, the centrifugal 5min of 12000r/min, abandon supernatant liquor, extract DNA by shown in embodiment 1.According to embodiment 1 set up PCR reaction conditions and carry out fluorescent PCR detection, and with DEPC water as negative control.
As shown in Figure 3, with the baby formula milk powder of fluorescence quantitative PCR detection artificial contaminated bacteria samples dosage 10cfu/25g homogenate, can detect the positive after increasing bacterium 8h, 4h and 6h fails to detect result, and result as shown in Figure 3.Time needed for the rugged Cronobacter sakazakii of slope that greatly reduces quantitative fluorescent PCR detects, for slope rugged Cronobacter sakazakii rapid detection provides new technique means.

Claims (10)

1. one kind for detecting the primer of the rugged Cronobacter sakazakii nucleotide fragments of slope, it is characterized in that, described primer sequence is: the primer pair be made up of upstream primer sequence 5 ' GGGATACGCAGGAGGTGGCA ' and downstream primer sequence 5 ' GATGCTGCCTGCCAGCAGG '; Or the upstream primer of above-mentioned primer pair extends 10 bases to 5 ' extreme direction, extend 10 bases to 3 ' extreme direction, downstream primer extends 10 bases to 3 ' extreme direction, extends the primer sequence obtained within the scope of 10 base zones to 5 ' extreme direction.
2. one kind for detecting the probe of the rugged Cronobacter sakazakii Nucleotide of slope, it is characterized in that, described probe sequence is: 5 ' CATTTTAGCGCTTGATACTCCCCTGGGC ' or extend 10 bases to 3 ' extreme direction for above-mentioned probe sequence and extend the probe sequence obtained within the scope of 10 base zones to 5 ' extreme direction.
3. detect a method for the rugged Cronobacter sakazakii of slope, it is characterized in that, comprise the steps:
(1) probe one end described in claim 2 is marked with reporter fluorescence dyestuff, the other end is marked with quench fluorescence dyestuff;
(2) with the DNA of testing sample for template, utilize the upstream and downstream primer described in claim 1 and the above-mentioned probe being marked with fluorescein to carry out real-time fluorescence quantitative PCR reaction, image data after each loop ends;
(3) reaction terminates to have judged whether the rugged Cronobacter sakazakii of slope according to amplification curve afterwards.
4. method according to claim 3, is characterized in that, described reporter fluorescence dyestuff adopt in following fluorophor any one: Fam, Hex, Tet, Joe, Vic, FITC, Cy3 and Cy5; Described quencher fluorescent dye adopt in following fluorophor any one: Tamra, Rox, Dabcy1, BHQ1 and BHQ2.
5. the method according to claim 3 or 4, it is characterized in that, in the reaction system of 25 μ l, the condition of described real-time fluorescence quantitative PCR reaction is: add 10 × PCR Buffer in reaction system, dNTPs, upstream and downstream primer, is marked with the probe of fluorescein, the DNA of the testing sample of Taq enzyme and 3 ~ 5 μ l, and with RNase Free dH 2o mends to cumulative volume 25 μ l, and the final concentration of said components is as follows:
6. method according to claim 5, is characterized in that, in the reaction system of 25 μ l, the condition of described real-time fluorescence quantitative PCR reaction is:
7. the method according to claim 3 or 4, is characterized in that, described real-time fluorescence quantitative PCR reaction conditions is: 95 DEG C of sex change 1min; With 95 DEG C of 5s, 60 DEG C of 40s increase 40 and circulate.
8. detect a test kit for the rugged Cronobacter sakazakii of slope, it is characterized in that, comprise the probe in the upstream and downstream primer of claim 1, claim 2,10 × PCR Buffer, dNTPs and Taq enzyme.
9. test kit according to claim 8, is characterized in that, in the reaction system of 25 μ l, each component is as follows:
10. test kit according to claim 9, is characterized in that, in the reaction system of 25 μ l, each component is as follows:
CN201510256838.1A 2015-05-19 2015-05-19 Method, primer, probe and kit for detecting cronobacter sakazakii Pending CN104894212A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201510256838.1A CN104894212A (en) 2015-05-19 2015-05-19 Method, primer, probe and kit for detecting cronobacter sakazakii

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201510256838.1A CN104894212A (en) 2015-05-19 2015-05-19 Method, primer, probe and kit for detecting cronobacter sakazakii

Publications (1)

Publication Number Publication Date
CN104894212A true CN104894212A (en) 2015-09-09

Family

ID=54027166

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201510256838.1A Pending CN104894212A (en) 2015-05-19 2015-05-19 Method, primer, probe and kit for detecting cronobacter sakazakii

Country Status (1)

Country Link
CN (1) CN104894212A (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108179208A (en) * 2018-03-13 2018-06-19 苏州百源基因技术有限公司 For detecting the specific primer of Enterobacter sakazakii and probe and real-time fluorescence quantitative PCR kit
CN108265102A (en) * 2016-12-30 2018-07-10 上海仁度生物科技有限公司 A kind of real-time fluorescence nucleic acid isothermal amplification detection kit of Cronobacter Enterobacter sakazakii
CN109593837A (en) * 2017-09-29 2019-04-09 东北农业大学 A method of the nanogold colorimetric method based on magnetic capture quickly detects the rugged Cronobacter sakazakii of slope

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101082624A (en) * 2007-07-10 2007-12-05 杨捷琳 ELISA adsorption testing method and for detecting Enterobacter sakazakii and used antibody thereof

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101082624A (en) * 2007-07-10 2007-12-05 杨捷琳 ELISA adsorption testing method and for detecting Enterobacter sakazakii and used antibody thereof

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
L. CARTER ET AL.: ""Multiplex PCR assay targeting a diguanylate cyclase-encoding gene,cgcA, to differentiate species within the genus Cronobacter"", 《APPLIED. ENVIRONMENTAL MICROBIOLOGY》 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108265102A (en) * 2016-12-30 2018-07-10 上海仁度生物科技有限公司 A kind of real-time fluorescence nucleic acid isothermal amplification detection kit of Cronobacter Enterobacter sakazakii
CN109593837A (en) * 2017-09-29 2019-04-09 东北农业大学 A method of the nanogold colorimetric method based on magnetic capture quickly detects the rugged Cronobacter sakazakii of slope
CN108179208A (en) * 2018-03-13 2018-06-19 苏州百源基因技术有限公司 For detecting the specific primer of Enterobacter sakazakii and probe and real-time fluorescence quantitative PCR kit

Similar Documents

Publication Publication Date Title
CN102146466B (en) Reagent for detecting brucella and complex probe fluorescence quantitative PCR (polymerase chain reaction) brucella detection method
CN104046700B (en) The detection kit of a kind of Rapid identification donkey hide, horse skin and mule skin
CN102286612B (en) Fast detection reagent kit for pathogenic microorganism
CN103602757B (en) The foundation of foot and mouth disease, vesicular stomatitis and swine pox multi-fluorescence RT-PCR detection method and application thereof
CN107988325A (en) Shrimp liver sausage born of the same parents worm（EHP）RAA constant temperature fluorescence detection method and reagent
CN110699489B (en) Real-time fluorescence PCR detection primer probe set, kit and method for African swine fever virus CD2V gene
CN102363815B (en) Reagent for detecting salmonellae by using cross primer nucleic acid isothermal amplification technology, amplification method and detection method for salmonellae
CN105039586A (en) Primer and kit for detecting duck type-II adenovirus
CN105018485A (en) Primer and probe for detecting peste des petits ruminants virus by virtue of RPA (Recombinase Polymerase Amplification) technique
CN102230013B (en) Target sequence, primer, probe and kit for detecting Mycoplasma pneumonia
CN105219772A (en) One group of nucleotide sequence and the application in salmonella and shigella detect
CN102010913B (en) Real-time fluorescence polymerase chain reaction (PCR) detection kit for screening listeria monocytogenes and detection method thereof
CN102676664B (en) Fluorescent quantitative polymerase chain reaction (PCR) primers and probes for detecting pathogenic bacteria of multiple aquatic products simultaneously and detection method
CN112522378A (en) Kit for detecting MCR gene, detection method and application thereof
CN104894212A (en) Method, primer, probe and kit for detecting cronobacter sakazakii
CN105779625A (en) Dual-fluorescence quantitative PCR (Polymerase Chain Reaction) primer, kit and method for simultaneously detecting general type and type 2 Streptococcus suis
CN103468806B (en) The method for quick of scallop pathogenic Vibrio splindidus Vibrio splendidus
CN104152546A (en) Kit and method for simultaneously detecting salmonella, listeria monocytogenes and staphylococcus aureus
CN101748197A (en) Target sequence for detection of yersinia enterocolitica and kit
CN103205485B (en) Method of detecting nucleotides of Bacillus cereus, primers for detecting and probes
CN112852988A (en) Microdroplet digital PCR detection method for simultaneously detecting penicillium and fusarium
CN112795673B (en) CRISPR (clustered regularly interspaced short palindromic repeats) detection method for Cronobacter in food and kit thereof
Hu et al. Comparison of droplet digital PCR and real‐time quantitative PCR for quantitative detection of the parasitic ciliate Ichthyophthirius multifiliis in the water environment
CN110257544B (en) Ergota germ fluorescent quantitative PCR detection reagent, detection kit and application
CN106222293B (en) Fluorescence quantification PCR primer probe and kit and the method for detecting three kinds of bacillus

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication

Application publication date: 20150909

RJ01 Rejection of invention patent application after publication