CN114574611B - Cattle green alga-free PCR primer and application thereof - Google Patents
Cattle green alga-free PCR primer and application thereof Download PDFInfo
- Publication number
- CN114574611B CN114574611B CN202210086609.XA CN202210086609A CN114574611B CN 114574611 B CN114574611 B CN 114574611B CN 202210086609 A CN202210086609 A CN 202210086609A CN 114574611 B CN114574611 B CN 114574611B
- Authority
- CN
- China
- Prior art keywords
- cob
- bovine
- green
- free
- algae
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Abstract
The invention discloses a PCR detection primer designed according to bovine green-free algae cob genes, which has the nucleotide sequence as follows: cob-5-F: CTAGTTATTCAAGTCCTCG; cob-5-R: AATTACTGTAGCACCCC the nucleotide sequence of the bovine chlorella-free cob gene is shown as SEQ ID No.1, and the invention also discloses application of the PCR detection primer in bovine chlorella-free non-diagnostic detection. The PCR primer of the bovine green-algae-free cob gene is screened to obtain a pair of primers with high sensitivity and strong specificity, and the primers are combined with the fluorescent quantitative PCR technology, so that the qualitative and quantitative determination of the bovine green-algae-free in the milk sample can be directly carried out, and the method has obvious advantages in the aspect of early and rapid diagnosis of bovine green-algae-free mastitis.
Description
Technical Field
The invention belongs to the field of molecular detection, and relates to a PCR primer for bovine green-free algae (Prototheca bovis), an application of the PCR primer in detection of bovine green-free algae non-diagnostic purposes, a real-time fluorescent quantitative PCR detection method for bovine green-free algae and a kit.
Background
Bovine green-free algae (Prototheca bovis) is a yeast-like eukaryotic organism, which has been called medium-sized green-free algae type 2 (Prototheca zopfii genotype 2), and can cause mastitis in cows, and reduce milk production and milk quality in cows. In 1952, lerche reported that the first cow had no chlorella mastitis (Lerche, et al, 1952). Subsequently, cow mastitis caused by bovine green-free algae was reported successively in a plurality of countries of germany, japan, italy, poland, canada, korea, and the like. Bovine chlorella was found to be the most common mastitis pathogen in 400 cows of 16 dairy farms in Poland and 1211 samples of their surroundings, and 75.8% of cases had subclinical disease progression (Lloyd D, et al, 1968). In 2011, china reported that clinic mastitis caused by bovine green-free algae occurs for the first time, and the separation rate is up to 72.7% (Zhang Hanqi, etc., 2011). Shahid et al reported that 84 and 21 parts of bovine green-free algae were isolated from 620 parts of milk samples and 410 parts of environmental samples collected from Beijing, tianjin, shandong, etc., at 13.5% and 5.1% isolation, respectively (Shahid M, et al 2016). The subject group further found that in 40 milk samples with somatic cell numbers higher than 100 ten thousand per mL, the bovine green algae-free positive rate was as high as 65% (Xu Shunxin, 2021).
The clinical diagnosis of bovine chlorella-free mastitis is extremely prone to be misjudged as fungi or missed diagnosis, in the reported cases, bovine chlorella-free is usually infected with cows immediately after delivery, the initial clinical symptoms are usually not obvious at the beginning of lactation, subclinical or chronic passes are found (Dubravka M, et al 2006;Shahid M,et al, 2017), the milk yield of cows is reduced, the milk quality is reduced, cows secrete dilute buffalo containing white flakes, even the cows are necrotic and prematurely eliminated, and the infected cows become persistent infectious sources, so that the disease continuously spreads in farms. Because of lack of specificity of clinical symptoms, the disease is easily ignored or considered to be mastitis caused by other reasons, thus delaying treatment and treatment, and seriously threatening the health of cows, the quality safety of fresh milk and the continuous healthy development of the milk industry.
The rapid diagnosis and research of the bovine green-free algae are few at the present stage, and the separation and identification of the pathogens are the most classical diagnosis method at present, but the differential culture time of the pathogens is generally more than 48 hours, and the differential culture time is generally used as comparison and reference of other methods. The conventional PCR technology is generally used for qualitative detection of pure cultures, cannot directly detect milk samples, and has more steps and certain cross contamination risk, so that the practical application of the technology is restricted.
For example, CN110184379a discloses a method for identifying molecular biology of medium-sized green-free algae and application thereof, wherein primers are designed for cob genes of type 1 and type 2 of the medium-sized green-free algae, and PCR reaction is performed by using the designed primers and the obtained DNA template, and the result shows that the primers designed for cob gene of type 2 of the medium-sized green-free algae can amplify a target fragment from the medium-sized green-free algae gene type 2, but cannot amplify a target fragment from the medium-sized green-free algae gene type 1, and the result shows that the designed cob primers can correctly distinguish two genotypes of the medium-sized green-free algae. However, the primer has low detection sensitivity, so that the milk sample cannot be directly detected, and the milk sample needs to be subjected to pathogen separation culture to obtain amplified bacterial liquid for detection, so that quantitative detection cannot be performed.
The PCR primers of the bovine green-algae-free cob genes are subjected to mass screening to obtain a pair of primers with high sensitivity and strong specificity, and the primers can be used for directly detecting bovine green algae-free from the centrifugally treated milk sample without the steps of amplification culture and the like. The primer is combined with a real-time fluorescent quantitative PCR technology, so that qualitative or quantitative determination can be directly carried out on the bovine green alga-free in the milk sample, which cannot be realized by the traditional pathogen separation and the conventional PCR technology, and the method can realize the result in only 1 half hour, thereby being more rapid and simple. The invention also has the advantages of good specificity, high sensitivity and strong stability, and has obvious advantages in the aspect of early and rapid diagnosis of bovine non-chlorella mastitis.
Disclosure of Invention
The first object of the invention is to provide a PCR primer designed according to bovine green-free algae cob genes, which can specifically amplify a 131bp sequence in bovine green-free algae cob genes and can improve the sensitivity of bovine green-free algae detection.
The second object of the invention is to provide the application of the PCR primer in detection of non-diagnostic purpose of bovine green-free algae.
The third object of the invention is to provide a detection kit for bovine green alga-free.
The fourth object of the invention is to provide a real-time fluorescent quantitative PCR detection method for non-diagnostic purpose of bovine chlorella to solve the problems of complicated operation, time and labor waste, incapability of accurately quantifying and the like of conventional PCR.
In order to achieve the above object of the present invention, the present invention adopts the following technical scheme:
the applicant designs a series of primers cob-1, cob-2, cob-3, cob-4, cob-5, cob-6 and cob-7 according to the nucleotide sequence (https:// www.ncbi.nlm.nih.gov /) of the cob gene of the bovine green-free algae (Prototheca bovis) strain SAG2021 (NC_ 045058 15499-16656) registered in the GenBank database, designs corresponding primers according to the bovine green-free algae 18SrRNA, LSrDNA, SSrRNA gene sequence, and performs PCR amplification on the bovine green-free algae by using the primers, and finally screens to obtain a pair of PCR primers with high specificity and sensitivity and high amplification efficiency, namely cob-5, wherein the nucleotide sequence of the primers is as follows:
cob-5-F：CTAGTTATTCAAGTCCTCG；
cob-5-R：AATTACTGTAGCACCCC。
the primer can amplify a segment of target fragment with the size of 131bp in bovine green-free algae cob genes, can not specifically amplify other pathogenic bacteria causing bovine mastitis (staphylococcus hemolyticus, streptococcus uberis, staphylococcus aureus and staphylococcus chromogenes) and the same genus green-free algae (Prototheca ciferrii, prototheca blaschkeae and Prototheca wickerhamii), can detect cob recombinant plasmids with the size of 1 copies/mu L in a 25 mu L system, and has higher detection sensitivity compared with the primers designed before the applicant. The nucleotide sequence of the bovine chlorella protothecoix gene is shown as SEQ ID No.1, and the nucleotide sequence of the target fragment is shown as SEQ ID No. 6.
The invention further provides a detection kit for the bovine green alga-free, which contains the PCR primer.
The invention also provides a non-diagnostic purpose real-time fluorescent quantitative PCR detection method for the bovine green alga-free, which comprises the following steps:
1) Designing PCR primers according to bovine green algae-free cob genes with nucleotide sequences shown in SEQ ID No.1, wherein the nucleotide sequences of the PCR primers are as follows:
cob-5-F：CTAGTTATTCAAGTCCTCG；
cob-5-R：AATTACTGTAGCACCCC；
2) Adding PCR primer and SYBR fluorescent dye into the detection sample to perform real-time fluorescent quantitative PCR reaction;
3) And (5) carrying out qualitative or quantitative detection on the bovine green-free algae according to the Ct value.
Preferably, the system of the real-time fluorescent quantitative PCR reaction is as follows: SYBR Green Premix Ex Taq II 12.5. Mu.L, cob-5-F0.8. Mu.L, cob-5-R0.8. Mu.L, template 1. Mu.L, RNase-Free Water make up to 25. Mu.L.
Preferably, the procedure of the real-time fluorescent quantitative PCR reaction is as follows: pre-denaturation at 95 ℃ for 30s; denaturation at 95℃for 5s, annealing at 59℃for 60s, extension at 72℃for 30s for 40 cycles; the extension was carried out again at 72℃for 10min.
Compared with the prior art, the invention has the beneficial effects that:
firstly, the PCR primer screened by the invention is combined with real-time fluorescence quantitative PCR detection, so that the detection sensitivity of the bovine chlorella is greatly improved, and finally, the detection sample such as milk can be directly reacted and detected on the basis of not carrying out pathogen separation culture, thereby improving the detection efficiency.
Second, the invention has very high specificity, and can distinguish bovine green-free algae (Prototheca bovines) from other pathogenic bacteria causing bovine mastitis (staphylococcus hemolyticus, streptococcus uberis, staphylococcus aureus, staphylococcus chromogenes) and homologous green-free algae (Prototheca ciferrii, prototheca blaschkeae, prototheca wickerhamii).
Thirdly, the invention has the advantages of high amplification efficiency, good repeatability, simple and convenient operation and the like, can perform qualitative or quantitative detection according to the Ct value and the amplification curve, does not need subsequent reaction treatment, and avoids environmental pollution and false positive detection result after the conventional PCR is uncapped.
Drawings
FIG. 1 is a graph showing the real-time fluorescence quantitative PCR amplification of 12 pairs of primers designed in example 1 of the present invention.
FIG. 2 is a graph showing the sensitivity comparison and amplification of the fluorescent quantitative PCR system for two pairs of primers cob-2 and cob-5 in example 1 of the present invention.
FIG. 3 is an electrophoretogram of PCR amplification product using cob-5 as the primer and bovine green alga-free bacterial solution as the template in example 2 of the present invention.
FIG. 4 is a real-time fluorescent quantitative PCR map of different concentration standard plasmids at the time of standard curve construction of example 2 of the present invention.
FIG. 5 is a standard curve of example 2 of the present invention drawn with a 10-fold diluted standard plasmid as a template.
FIG. 6 is a graph showing the result of electrophoresis of a general PCR product in a sensitivity comparison experiment in example 3 of the present invention.
FIG. 7 is a graph showing the result of a sensitivity test of fluorescent quantitative PCR in a sensitivity comparison test in example 3 of the present invention.
Detailed Description
The specific conditions not noted in the examples will be performed under conventional conditions or conditions suggested by the manufacturer. The reagents or apparatus used were conventional products commercially available without the manufacturer's attention.
In the following examples, specific sources of materials, reagents and equipment are referred to:
1. materials: the cattle green-free algae positive strain is separated from milk samples of a dairy farm in Hubei province. Clinical testing milk samples were from a dairy farm in Hubei province.
2. Main reagents and equipment:
omega fungus DNA miniprep Kit (Fungal DNA Kit), omega Gel Extraction Kit D gel recovery Kit, omega Plasmid Mini Kit II D6945TSA plasmid extraction Kit, takara pMD19-T Vector Cloning Kit Kit, PIM, SDA, TSB, SDB, LB, gram quick dye liquor, 1 xTAE, agar, isopropanol, absolute ethanol, takara SYBR Green Premix Ex Taq II.
3. The device comprises: the Bio-Rad CFX96 fluorescent quantitative PCR instrument is a product of Bio-Rad company in the United states, the NanoDrop2000 micro ultraviolet spectrophotometer is a product of Thermo Scientific company in the United states, a high-pressure steam sterilization pot, a water bath pot, a constant-temperature incubator, a constant-temperature shaking table, a centrifuge, a vortex instrument, an ice maker and an ultra-clean workbench.
Noun interpretation:
SAG2021, SAG2001, CBS609.66, vj_4: four bovine green-free algae (Prototheca bovins) strains of different origins.
Prototheca ciferrii: one of the members of the genus Chlorella, once designated as medium-sized Chlorella-free type 1 (Prototheca zopfii genotype), three types of Chlorella-free, prototheca bovines, prototheca blaschkeae, prototheca ciferrii, are believed to be associated with cows.
Prototheca blaschkeae: three types of green-free algae, prototheca bovis, prototheca blaschkeae, prototheca ciferrii, among the members of the genus green-free algae, are considered to be associated with cows.
Prototheca wickerhamii: one of the members of the genus Chlorella is associated with human infection.
Example 1: synthesis and screening of bovine green algae-free specific primers
1. Synthesis of bovine green algae-free specific primers
A bovine green-free algae (Prototheca bovines) strain SAG2021 (NC_ 04505815499-16656) registered in the GenBank database was able to act as the nucleotide sequence of the cob gene for green-free algae genus differentiation (https:// www.ncbi.nlm.nih.gov /). Selecting a relatively stable conserved region sequence, and submitting the selected sequence to Primer Premier 5.0 software to design primers cob-1, cob-2, cob-3, cob-4, cob-5, cob-6 and cob-7; primers 18SrRNA-1 and 18SrRNA-2 were designed based on the partial sequence of 18SrRNA of strain SAG 2001; primers LSrRNA-1 and LSrRNA-2 are designed according to the LSrDNA partial sequence of the bovine green-free algae CBS 609.66. Primers SSrRNA were designed based on the partial sequence of SSrRNA of bovine green-free algae VJ_4 (GenBank: MW 228087.1). Primers were subjected to homology matching analysis (https:// blast. Ncbi. Nlm. Nih. Gov/blast. Cgi) in GenBank database using blastn software and assigned to the Withane Biotechnology Co.Ltd.
TABLE 1 primer and probe sequences
2. Screening of bovine green algae-free specific primers
1) Fluorescent quantitative PCR amplification is carried out by using bovine green-Free algae, the reaction system is SYBR Green Premix Ex Taq II 12.5 mu L, 1. Mu.L of the upstream primer, 1. Mu.L of the downstream primer, 1. Mu.L of the template and 25. Mu.L of RNase-Free Water were added. The primers of example 1 were amplified by adding 12 pairs of primers, respectively. The reaction conditions are as follows: pre-denaturation at 95 ℃ for 30s; denaturation at 95℃for 5s, annealing at 59℃for 60s, extension at 72℃for 30s for 40 cycles; the extension was carried out again at 72℃for 10min. As a result, see FIG. 1, primers capable of generating an amplification curve and Ct values after fluorescent quantitative PCR reaction were: cob-1, cob-2, cob-3, cob-4, cob-5, cob-6, cob-7, 18SrRNA-1, 18SrRNA-2, LSrRNA-1, LSrRNA-2, SSrRNA. Wherein, the pair of cob-1 primers easily causes the excessively low amplification efficiency because the amplification product exceeds 300 bp; the 5 pairs of primers, namely 18SrRNA-1, 18SrRNA-2, LSrRNA-1, LSrRNA-2 and SSrRNA, can only be used for identifying the genus Chlorella, and can not identify other green-free algae such as Proto theca bovis, prototheca ciferrii and the like; therefore, 6 pairs of primers, cob-1, 18SrRNA-2, LSrRNA-1, LSrRNA-2, and SSrRNA, are not suitable for establishing a fluorescent quantitative PCR method for bovine green algae-free, and require further primer screening.
2) The 6 pairs of primers cob-2, cob-3, cob-4, cob-5, cob-6 and cob-7 were selected. Amplification by fluorescence quantitative PCR was performed using Prototheca bovis and Prototheca ciferrii, respectively, with a reaction system of SYBR Green Premix Ex Taq II 12.5. Mu.L, 1. Mu.L of the upstream primer, 1. Mu.L of the downstream primer, 1. Mu.L of the template, and the RNase-Free Water was made up to 25. Mu.L. The reaction procedure for fluorescent quantitative PCR was set as follows: pre-denaturation at 95 ℃ for 30s; denaturation at 95℃for 5s, annealing at 59℃for 60s, extension at 72℃for 30s for 40 cycles; the extension was carried out again at 72℃for 10min. From the viewpoint of amplification efficiency, the amplification efficiencies of cob-3, cob-4, cob-5 were relatively high, cob-2 times, and Ct values of cob-6 and cob-7 were too low. From the specificity point of view, cob-2 and cob-5 only amplified Proto theca bovis, but not Prototheca ciferrii, and cob-3 and cob-4 both amplified Proto theca bovis and Prototheca ciferrii. In the above 6 pairs of primers, the primers cob-2 and cob-5 are relatively preferable in terms of amplification efficiency and specificity.
3) Further, the sensitivity of the fluorescent quantitative PCR systems of the two pairs of primers cob-2 and cob-5 was compared, and the result is shown in FIG. 2, wherein the red amplification curve is the amplification curve of the primer cob-5, the gray color shows the amplification curve of cob-2, and 1-3 are 25, 10 and 1 copies/. Mu.L of the standard plasmid, respectively. The results showed that the fluorescence quantitative PCR using the primer cob-5 as the amplification system had a sensitivity of 1 copies/. Mu.L, which was more sensitive than the fluorescence quantitative PCR method based on the primer cob-2 (sensitivity 25 copies/. Mu.L).
In summary, the primer used in the present invention is cob-5.
3. Specificity test
Bovine green algae cob gene recombinant plasmid (pMD 19-T) is used as a positive control, lysostaphin 18013-1, streptococcus uberis 15047-3, staphylococcus aureus 15022, staphylococcus chromogenes 15047-2, prototheca ciferrii cob gene recombinant plasmid, prototheca blaschkeae cob gene recombinant plasmid and Prototheca wickerhamii cob gene recombinant plasmid are used as negative controls, and RNase free Water is set as a blank control. The real-time fluorescence quantitative PCR reaction system is SYBR Green Premix Ex Taq II 12.5 mu L, the upstream primer is 1 mu L, the downstream primer is 1 mu L, the template is added with 1 mu L, and RNase-Free Water is added to 25 mu L. The cob-5 primers were added separately for amplification. The reaction procedure for fluorescent quantitative PCR was set as follows: pre-denaturation at 95 ℃ for 30s; denaturation at 95℃for 5s, annealing at 59℃for 60s, extension at 72℃for 30s for 40 cycles; the extension was carried out again at 72℃for 10min.
As a result, only specific amplification signals were detected in the bovine green-algae-free cob recombinant plasmid reaction tube, and the Prototheca blaschkeae cob gene recombinant plasmid and the Prototheca wickerhamii cob gene recombinant plasmid had amplification curves, but the melting curves were bimodal, which indicates that they were not target products, and that bovine green-algae-free bacteria can be well distinguished by the melting curves. All other reaction tubes have no fluorescent signal accumulation, which indicates that the method has good specificity.
Example 2: drawing of a Standard Curve
1. Preparation of plasmids
1) The cob genes were amplified on the DNA of chlorella-free using the primers cob-5-F and cob-5-R. After agarose gel electrophoresis of the amplified product, specific bands (about 131bp as shown in FIG. 3) conforming to the target size were subjected to gel irradiation with an ultraviolet lamp using an Omega gel recovery kit, and then cut for gel recovery. After purification, the plasmid is connected to a Takara pMD19-T Vector, and transformed to E.coliDH5α competent cells, positive clones are selected for enrichment culture, plasmids are extracted by using an Omega plasmid small extraction kit, plasmid PCR identification is carried out on the extracted plasmids, and bacterial liquid is sent to bidirectional plasmid sequencing identification. The identified positive recombinant plasmid is used as standard substance, named cob, and placed at-20deg.C for use.
2. Establishment of a Standard Curve
OD of the extracted plasmid was determined with NanoDrop2000 260 And OD (optical density) 280 Value and concentration, OD 260 /OD 280 Plasmids with a ratio of 1.8-2.0 were used to make standard curves. Converting plasmid sample concentration into copy concentration according to plasmid molecular weight, converting plasmid into copy concentration by RNase-Free WaterSequentially diluting to 1×10 2 copies/μL-1×10 8 The templates were prepared in a total of 7 concentration gradients with a concentration of copies/. Mu.L. Using this as template, 25 μl of amplification system was established: SYBR Green Premix Ex Taq II 12.5. Mu.L, cob-5-F0.8. Mu.L, cob-5-R0.8. Mu.L, template 1. Mu.L, and RNase-Free Water to 25. Mu.L. Amplification was performed on a Bio-Rad CFX96 fluorescent quantitative PCR instrument according to the following reaction parameters: pre-denaturation at 95 ℃ for 30s; denaturation at 95℃for 5s, annealing at 59℃for 60s, extension at 72℃for 30s for 40 cycles; the extension was carried out again at 72℃for 10min. The amplification curve after the reaction is shown in FIG. 4, and the corresponding concentrations of 1-7 shown in FIG. 4 are 1×10 8 copies/μL、1×10 7 copies/μL、1×10 6 copies/μL、1×10 5 copies/μL、1×10 4 copies/μL、1×10 3 copies/μL、1×10 2 The copies/. Mu.L of standard plasmid, 8 as negative control; the analysis software is used to automatically generate a standard curve, which is shown in fig. 5.
The result shows that the initial template concentration and Ct value of the standard product all show good linear relation, and the correlation coefficient R 2 Up to 0.9997, the amplification efficiency E was 100.029%. The regression equation for the standard curve is: y= -3.4852log (x) +36.698, where Y is Ct value and x is the log value of different copy numbers of the starting template.
3. Repeatability test
To be diluted to 1X 10 5 copies/μL、1×10 4 copies/μL、1×10 3 Three concentration gradients of cobs/μl were used as templates for the batch and batch-to-batch repeated assays, each concentration was repeated 3 wells for the same reaction, and 3 reactions were repeated. The results are shown in Table 2.
TABLE 2 repeatability analysis of real-time fluorescent quantitative PCR
As can be seen from Table 2, the variation coefficient of Ct values in and among groups of the plasmid at each concentration is less than 3%, which indicates that the method has good repeatability.
Example 3: sensitivity comparison with conventional PCR method
The bovine green algae-free cob gene recombinant plasmid (pMD 19-T) was diluted to 8.99X10 at a 10-fold ratio 9 The 10 concentration pMD19-T cob plasmids of the copies/mu L-8.99X100 copies/mu L are used as templates to respectively carry out real-time fluorescence quantitative PCR and conventional PCR detection of the bovine chlorella, and the sensitivity of the two methods is compared. Both the conventional PCR detection method and the PCR method were performed using the primer cob-5. The results are shown in fig. 6 and 7. Wherein columns 2-9 in FIG. 6 correspond to 8.99X10 7 COPIES/. Mu.L-8.99X100 COPIES/. Mu.L, sequence 1 as negative control; in fig. 7, the abscissa represents Ct value (cycle number) and the ordinate represents fluorescence signal intensity. Wherein columns 1-9 in FIG. 7 correspond to 8.99X10 9 The copies/. Mu.L-8.99X100 copies/. Mu.L, sequence 10 was the negative control. As can be seen from FIG. 6, when the plasmid concentration was 8.99X10 2 When the concentration of the target fragment is less than or equal to the cobies/. Mu.L, the specific amplified band of the target fragment (131 bp) does not appear on the electrophoresis chart, which indicates that the detection limit of the conventional PCR is 8.99X10 2 COPies/. Mu.L. Real-time fluorescent quantitative PCR assay was performed using plasmids of the same concentration gradient, and the results are shown in FIG. 7 when the plasmid concentration was 8.99X10 9 The fluorescence signal intensity is higher than the detection threshold when the fluorescence signal intensity is from about 8.99X100 fluorescence/mu L, which shows that the detection lower limit of the real-time fluorescence quantitative PCR is 8.99 fluorescence quantitative PCR, and the sensitivity is 100 times of that of the conventional PCR.
Example 4: application of real-time fluorescent quantitative PCR (polymerase chain reaction) detection method for green-free bovine algae
And detecting the milk sample of the field dairy farm by using the established real-time fluorescent quantitative PCR detection method of the chlorella-free cattle, and setting a blank control. The method comprises the following steps:
1. pretreatment of milk samples
Specifically, 5-8mL of uniform milk sample is taken, and the milk sample is centrifuged at 4200r/min for 10-15min. Removing surface milk fat, taking 2mL of the lower milk sample, centrifuging at high speed, centrifuging at 14000r/min for 5min, and taking the precipitate and re-suspending with sterile PBS for later use.
2. Real-time fluorescent quantitative PCR
The reaction system of the fluorescent quantitative PCR is as follows: SYBR Green Premix Ex Taq II 12.5. Mu.L, cob-5-F0.8. Mu.L, cob-5-R0.8. Mu.L, template 1. Mu.L, RNase-Free Water make up to 25. Mu.L.
Wherein, the gene sequence of the primer is:
cob-5-F：CTAGTTATTCAAGTCCTCG；
cob-5-R：AATTACTGTAGCACCCC；
the reaction procedure of the real-time fluorescent quantitative PCR is as follows: pre-denaturation at 95 ℃ for 30s; denaturation at 95℃for 5s, annealing at 59℃for 60s, extension at 72℃for 30s for 40 cycles; the extension was carried out again at 72℃for 10min.
3. Ordinary separation culture
The method is compared with the method by using a common separation culture method, and the coincidence rate of the method is calculated. Taking 100 mu L of uniformly mixed milk sample, uniformly coating the milk sample on an SDA (serial digital access) culture medium, picking out a colony with a similar form to that of the bovine chlorella-free colony after 48-72 hours, inoculating the colony on a PIM (personal information management) identification culture medium, and then observing the form under a gram staining mirror to judge.
Real-time fluorescent quantitative PCR was performed on a Bio-Rad CFX96 fluorescent quantitative PCR instrument. The software is Bio-Rad CFX Manager. The software can directly read the detection result of the bovine chlorella in the milk sample to be tested according to the judgment of the Ct value. When the method is used for qualitative determination, the Ct value is more than 35 and is negative, and the Ct value is less than or equal to 35 and is positive. The test results are shown in Table 3.
TABLE 3 detection results of bovine Chlorella-free in milk samples
As can be seen from Table 3, the fluorescence quantitative PCR method of the present invention was used to detect 76 field milk samples, the positive detection rate of bovine green-free algae was 46% (35/76), and compared with the conventional separation culture method, the positive coincidence rate was 100% (35/35), and the Nase free Water blank control had no specific amplification. The method can be used for detecting the bovine chlorella in milk samples of field dairy farm, and whether the samples contain the bovine chlorella is determined according to Ct values and amplification curves.
In summary, the real-time fluorescent quantitative PCR detection method for the bovine green-free algae designs the specific primer according to the conserved sequence of the bovine green-free algae cytochrome b (cytochrome b) gene, and establishes the real-time fluorescent quantitative PCR detection method based on the specific primer, the whole detection process only needs 1.5 hours, the detection result can be directly obtained by reading the software matched with an instrument, the PCR amplification product does not need to be subjected to gel running and ultraviolet irradiation, and the pollution and false positives in the detection process can be effectively prevented. The method can detect 1 copies/. Mu.L cob recombinant plasmid in a 25 mu.L system, has no specific amplification on other pathogenic bacteria causing bovine mastitis (streptococcus uberis, staphylococcus aureus, staphylococcus chromogenes, prototheca ciferrii, prototheca blaschkeae and the like), and has variation coefficients of repeated detection in batch and batch to batch of less than 3%. Therefore, compared with the prior detection method, the method has the advantages of simplicity, convenience, rapidness, accuracy, sensitivity, stability and the like, and the method provides reliable technical guarantee for further researching invasion, proliferation and distribution time sequence change rules of the bovine green alga-free.
While particular embodiments of the present invention have been illustrated and described, it will be appreciated that various other changes and modifications can be made without departing from the spirit and scope of the invention. It is therefore intended to cover in the appended claims all such changes and modifications that are within the scope of this invention.
Sequence listing
<110> academy of agricultural sciences in Wuhan City
<120> bovine chlorella-free PCR primer and application thereof
<160> 32
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1158
<212> DNA
<213> bovine green-free algae (Prototheca bovis)
<400> 1
atgaaaagat tatcaatttt aaaacaacct ttattaagtg tattaaatgc tcatattatt 60
gagtatccaa caccagtaaa tattaattat ttatggggtt ttggtagttt agctggatta 120
tgtttaatga ttcaaattat tacaggtatt ttcttagcta tgcactatac accacacgta 180
gatttagctt tcttaagtgt agaacatatt atgagagatg ttgaaggtgg ctggttttta 240
cgttacatgc atgcaaatgg tgcaagtatg ttttttattg tagtatattc tcatatgttt 300
agaggattat acttttctag ttattcaagt cctcgtgaat taacttggat tgcaggtgta 360
gctattttat tattaatgat tattactgca tttatcggtt acgtattacc ttggggtcaa 420
atgagctttt ggggtgctac agtaattaca agcttagcta gtgcaattcc tgtggtgggt 480
aatagtattg taacttggct atggggtggt ttctctattg ataacgcaac attaaaccgt 540
ttctttagtt tacattattt attaccattt gtaattgctg gattatctat tgttcatatt 600
gcagcattac atcaatatgg ttcaaataac cctttaggta ttaatgcaaa aactgataaa 660
attagttttt atccatattt ttatgtgaaa gatttatttg gttggactat ttttgctttt 720
ttctttgcat attttatcta ttataatcca aacttattag gtcaccctga taattacatt 780
cctgcgaacc ctatgtcaac tccagcacat attgtaccag aatggtattt cttatgggta 840
tatgctattt tacgtagtat ccctaataaa ttagcaggtg ttgcagcgat tgctttagta 900
tttgtttcat tattttcatt accattttta aatactagtc ctattcgaag taataatttt 960
aaaccattac aacgtaaatt tttctggtta ttatttgcag attgtttatt attaagttgg 1020
attggtcaaa aacctgtaga agatccatat gtaattattg gtcagttagg ttcattattt 1080
ttcttctttt atttcttagt gtttatccca gtatctggta aattagaaca ttatttaatt 1140
caatataaag cgaaataa 1158
<210> 2
<211> 346
<212> DNA
<213> bovine green-free algae (Prototheca bovis)
<400> 2
attcctgtgg tgggtaatag tattgtaact tggctatggg gtggtttctc tattgataac 60
gcaacattaa accgtttctt tagtttacat tatttattac catttgtaat tgctggatta 120
tctattgttc atattgcagc attacatcaa tatggttcaa ataacccttt aggtattaat 180
gcaaaaactg ataaaattag tttttatcca tatttttatg tgaaagattt atttggttgg 240
actatttttg cttttttctt tgcatatttt atctattata atccaaactt attaggtcac 300
cctgataatt acattcctgc gaaccctatg tcaactccag cacata 346
<210> 3
<211> 111
<212> DNA
<213> bovine green-free algae (Prototheca bovis)
<400> 3
gatttatttg gttggactat ttttgctttt ttctttgcat attttatcta ttataatcca 60
aacttattag gtcaccctga taattacatt cctgcgaacc ctatgtcaac t 111
<210> 4
<211> 234
<212> DNA
<213> bovine green-free algae (Prototheca bovis)
<400> 4
gttattcaag tcctcgtgaa ttaacttgga ttgcaggtgt agctatttta ttattaatga 60
ttattactgc atttatcggt tacgtattac cttggggtca aatgagcttt tggggtgcta 120
cagtaattac aagcttagct agtgcaattc ctgtggtggg taatagtatt gtaacttggc 180
tatggggtgg tttctctatt gataacgcaa cattaaaccg tttctttagt ttac 234
<210> 5
<211> 121
<212> DNA
<213> bovine green-free algae (Prototheca bovis)
<400> 5
gatgttgaag gtggctggtt tttacgttac atgcatgcaa atggtgcaag tatgtttttt 60
attgtagtat attctcatat gtttagagga ttatactttt ctagttattc aagtcctcgt 120
g 121
<210> 6
<211> 131
<212> DNA
<213> bovine green-free algae (Prototheca bovis)
<400> 6
ctagttattc aagtcctcgt gaattaactt ggattgcagg tgtagctatt ttattattaa 60
tgattattac tgcatttatc ggttacgtat taccttgggg tcaaatgagc ttttggggtg 120
ctacagtaat t 131
<210> 7
<211> 99
<212> DNA
<213> bovine green-free algae (Prototheca bovis)
<400> 7
cacgtagatt tagctttctt aagtgtagaa catattatga gagatgttga aggtggctgg 60
tttttacgtt acatgcatgc aaatggtgca agtatgttt 99
<210> 8
<211> 169
<212> DNA
<213> bovine green-free algae (Prototheca bovis)
<400> 8
gtatccaaca ccagtaaata ttaattattt atggggtttt ggtagtttag ctggattatg 60
tttaatgatt caaattatta caggtatttt cttagctatg cactatacac cacacgtaga 120
tttagctttc ttaagtgtag aacatattat gagagatgtt gaaggtggc 169
<210> 9
<211> 17
<212> DNA
<213> Artificial Sequence
<400> 9
ATTCCTGTGGTGGGTAA
<210> 10
<211> 17
<212> DNA
<213> Artificial Sequence
<400> 10
TATGTGCTGGAGTTGAC
<210> 11
<211> 17
<212> DNA
<213> Artificial Sequence
<400> 11
GATTTATTTGGTTGGAC
<210> 12
<211> 17
<212> DNA
<213> Artificial Sequence
<400> 12
AGTTGACATAGGGTTCG
<210> 13
<211> 17
<212> DNA
<213> Artificial Sequence
<400> 13
AGTTATTCAAGTCCTCG
<210> 14
<211> 17
<212> DNA
<213> Artificial Sequence
<400> 14
GTAAACTAAAGAAACGG
<210> 15
<211> 17
<212> DNA
<213> Artificial Sequence
<400> 15
GATGTTGAAGGTGGCTG
<210> 16
<211> 17
<212> DNA
<213> Artificial Sequence
<400> 16
CACGAGGACTTGAATAA
<210> 17
<211> 19
<212> DNA
<213> Artificial Sequence
<400> 17
CTAGTTATTCAAGTCCTCG
<210> 18
<211> 17
<212> DNA
<213> Artificial Sequence
<400> 18
AATTACTGTAGCACCCC
<210> 19
<211> 18
<212> DNA
<213> Artificial Sequence
<400> 19
CACGTAGATTTAGCTTTC
<210> 20
<211> 17
<212> DNA
<213> Artificial Sequence
<400> 20
AAACATACTTGCACCAT
<210> 21
<211> 18
<212> DNA
<213> Artificial Sequence
<400> 21
GTATCCAACACCAGTAAA
<210> 22
<211> 17
<212> DNA
<213> Artificial Sequence
<400> 22
GCCACCTTCAACATCTC
<210> 23
<211> 20
<212> DNA
<213> Artificial Sequence
<400> 23
AAGAGCCCAGCGTGTCAATC
<210> 24
<211> 19
<212> DNA
<213> Artificial Sequence
<400> 24
CATTCCCAAGCAACCCGAC
<210> 25
<211> 18
<212> DNA
<213> Artificial Sequence
<400> 25
TAGCGTGCGTGCGAGTGA
<210> 26
<211> 18
<212> DNA
<213> Artificial Sequence
<400> 26
CGATGCTGCGTCCCAAGA
<210> 27
<211> 21
<212> DNA
<213> Artificial Sequence
<400> 27
GCTTAATTTGACTCAACACGG
<210> 28
<211> 18
<212> DNA
<213> Artificial Sequence
<400> 28
CCTGACAAGGCAACCCAC
<210> 29
<211> 20
<212> DNA
<213> Artificial Sequence
<400> 29
TCTGCCCTATCAACTTTGGA
<210> 30
<211> 20
<212> DNA
<213> Artificial Sequence
<400> 30
GATGTGGTAGCCGTTTCTCA
<210> 31
<211> 22
<212> DNA
<213> Artificial Sequence
<400> 31
GCTCGAAGACGATTAGATACCG
<210> 32
<211> 18
<212> DNA
<213> Artificial Sequence
<400> 32
TTTCAGCCTTGCGACCAT
Claims (7)
1. A PCR primer designed from bovine green algae (Prototheca) cob genes, having the nucleotide sequence as follows:
cob-5-F：CTAGTTATTCAAGTCCTCG；
cob-5-R：AATTACTGTAGCACCCC；
the nucleotide sequence of the bovine green-free algae cob gene is shown as SEQ ID No. 1.
2. The use of the PCR primer of claim 1 in the detection of non-diagnostic objects of bovine green algae.
3. The ox green alga-free detection kit is characterized in that: the kit contains the PCR primer of claim 1.
4. A real-time fluorescent quantitative PCR detection method for non-diagnostic bovine green-free algae is characterized by comprising the following steps:
1) Designing PCR primers according to bovine green algae-free cob genes with nucleotide sequences shown in SEQ ID No.1, wherein the nucleotide sequences of the PCR primers are as follows:
cob-5-F：CTAGTTATTCAAGTCCTCG；
cob-5-R：AATTACTGTAGCACCCC；
2) Adding the PCR primer and SYBR fluorescent dye into a detection sample, and performing real-time fluorescent quantitative PCR reaction;
3) And (5) carrying out qualitative or quantitative detection on the bovine green-free algae according to the Ct value.
5. The method of claim 4, wherein the real-time fluorescent quantitative PCR reaction is performed by the following system: SYBR Green Premix Ex Taq II 12.5. Mu.L, cob-5-F0.8. Mu.L, cob-5-R0.8. Mu.L, template 1. Mu.L, RNase-Free Water make up to 25. Mu.L.
6. The method of claim 4, wherein the real-time fluorescent quantitative PCR is performed as follows: pre-denaturation at 95 ℃ for 30s; denaturation at 95℃for 5s, annealing at 59℃for 60s, extension at 72℃for 30s for 40 cycles; the extension was carried out again at 72℃for 10min.
7. The method of claim 4, wherein the test sample is milk.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210086609.XA CN114574611B (en) | 2022-01-25 | 2022-01-25 | Cattle green alga-free PCR primer and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210086609.XA CN114574611B (en) | 2022-01-25 | 2022-01-25 | Cattle green alga-free PCR primer and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114574611A CN114574611A (en) | 2022-06-03 |
| CN114574611B true CN114574611B (en) | 2023-09-15 |
Family
ID=81769493
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210086609.XA Active CN114574611B (en) | 2022-01-25 | 2022-01-25 | Cattle green alga-free PCR primer and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114574611B (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110184379A (en) * | 2019-06-06 | 2019-08-30 | 武汉市农业科学院 | A kind of Prototheca zopfii molecular biological variety identification method and application |
-
2022
- 2022-01-25 CN CN202210086609.XA patent/CN114574611B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110184379A (en) * | 2019-06-06 | 2019-08-30 | 武汉市农业科学院 | A kind of Prototheca zopfii molecular biological variety identification method and application |
Non-Patent Citations (5)
| Title |
|---|
| A novel TaqMan qPCR assay for rapid detection and quantification of pro-inflammatory microalgae Prototheca spp. in milk samples;Romana Bacova等;Medical Mycology;第59卷(第8期);784-792 * |
| Jagielski,T. 等.Prototheca bovis from Poland cytochrome b gene, partial cds * |
| mitochondrial.GenBank.2019,MH389235.1. * |
| 湖北地区奶牛场中型无绿藻的分离鉴定及敏感药物筛选;李佳琳;万方学位论文全文数据库;1-46 * |
| 牛无绿藻乳腺炎的研究现状;张海艳等;动物医学进展;第44卷(第1期);122-126 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114574611A (en) | 2022-06-03 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107541509B (en) | LAMP primer combination for detecting 6 infectious pathogens of cow mastitis and application thereof | |
| CN116656850B (en) | Sequence combination for rapidly detecting rice bacterial leaf blight bacteria based on CRISPR/Cas12a-RPA and application thereof | |
| CN107365869B (en) | Method and primer for detecting Klebsiella pneumoniae by loop-mediated isothermal amplification technology | |
| CN111471776A (en) | Shrimp liver enterocytozoon detection kit and detection method thereof | |
| CN111378774A (en) | Primer group, kit and method for rapidly detecting Listeria monocytogenes | |
| CN114574611B (en) | Cattle green alga-free PCR primer and application thereof | |
| CN110735003A (en) | Universal primer, kit and detection method for detecting fungal contamination in cell product | |
| CN116479145A (en) | Multiplex fluorescence quantitative PCR primer probe set, method and kit for simultaneously detecting three bifidobacteria | |
| CN112646912B (en) | Method for identifying and detecting pathogens of pythium aphanidermatum | |
| CN112176080B (en) | Nested PCR primer group, kit and detection method for specifically detecting purple sisal leaf roll disease phytoplasma | |
| CN115747351A (en) | Kit for detecting Shigella based on CRISPR/Cas12a method and use method thereof | |
| CN115747353A (en) | Primer group, reagent, kit and detection method for detecting Listeria monocytogenes | |
| CN111621578A (en) | RU 61-00441 gene-based Salmonella spelt constant-temperature detection kit and method | |
| Al-Temimay et al. | Identification of Cryptococcus neoformans Isolates by PCRITS regions | |
| CN113136444B (en) | Microdroplet digital PCR detection method for enterococcus faecalis in medical food | |
| CN114657273B (en) | Primer pair and probe combination for detecting multiple bovine mastitis pathogens and application of primer pair and probe combination | |
| CN115873966A (en) | Novel staphylococcus aureus enterotoxin gene quadruple real-time fluorescence PCR (polymerase chain reaction) detection kit and method | |
| CN111893164B (en) | Relative quantitative detection method for bacillus CQN-2 in apostichopus japonicus intestinal tract | |
| CN116790632A (en) | Gene fragment, primer pair, kit and detection method for detecting microsporidian of bees | |
| CN112359131A (en) | LAMP primer group for detecting barley stripe disease and application thereof | |
| CN117721185A (en) | LAMP primer group of salmonella and method for detecting salmonella in fresh milk | |
| RU2455363C1 (en) | Synthetic oligonucleotide primers and method for detecting streptococcus thermophilus in starter cultures in hard cheese production | |
| CN116377092A (en) | Single-tube nested qPCR reagent for detecting Brucella | |
| CN115747352A (en) | CRISPR/Cas12a primer and kit for detecting campylobacter jejuni and using method thereof | |
| CN116179735A (en) | Construction method and application of multiplex PCR reaction system for detecting and identifying species of alternaria alternata |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |