AU2021104733A4 - Method for identifying and detecting pythium pathogen of red rot disease of laver - Google Patents

Abstract

OF THE DISCLOSURE The present disclosure provides a method for identifying and detecting Pythium pathogens of red rot disease of laver, and belongs to the technical field of the detection, identification and control of diseases during algal cultivation. The method is based on the design of specific primers of differential sequences of Pythium porphyrae and Pythium chondricola (pathogens of red rot disease of laver) genomes, and contains the establishment of single PCR and duplex PCR detection methods of both Pythium pathogens. The method can specifically identify and detect the possibility of the presence of P. porphyrae, P. chondricola, and both. The lower limit of detection (LLD) of single PCR primers P-for/P-rev is 103 copies, and the LLD of primers C-for/C-rev is 102 copies. The LLD of the duplex PCR is 104 copies. The disclosure establishes a specific and sensitive method for identifying Pythium pathogens of red rot disease of laver, and can identify P. porphyrae and P. chondricola without sequencing and alignment, thus providing technical support for controlling red rot disease of laver in laver cultivation. ABSTRACT DRAWING No. 7 17924507_1 (GHMatters) P116884.AU -3/3 FIG. 7 1 2 3 4 5 6 7 8 9 10 2000bp 1000bp FIG. 8 17924431_1 (GHMatters) P116884AU

Description

-3/3

FIG. 7

1 2 3 4 5 6 7 8 9 10

2000bp 1000bp

FIG. 8

17924431_1 (GHMatters) P116884AU

METHOD FOR IDENTIFYING AND DETECTING PYTHIUM PATHOGEN OF RED ROT DISEASE OF LAVER TECHNICAL FIELD

[01] The present disclosure belongs to the technical field of the detection, identification and control of diseases during algal cultivation, and specifically relates to a method for identifying and detecting Pythium pathogens of red rot disease in laver cultivation.

BACKGROUNDART

[02] Red rot disease is the major Pyropia/Porphyracultivation disease throughout the sea culture season. It outbreaks in sea areas with high water temperature, low salinity, poor water flow exchange, and insufficient drying time. Red rot disease causes host collapse rapidly, resulting in commercial quality reduction and production losses usually 30-50%, even more than 60% within a few days. The symptoms first appear as red needle-size lesions on the surface of the thallus, followed by expansion to the whole thallus in two-three days, thus leading to the large-scale necrosis of thallus. At the initial stage, disease appear as red needle-size lesion randomly on the surface of thallus. Followed by expanding to 4-5 mm in 2 days with red at the edge and yellow green in the middle. With the development of disease, the lesion expand to the whole thallus, leading to the large-scale necrosis of Pyropia/Porphyrain a week. Microscopic observation reveals typical histopathological features with host infected cells being penetrated by fungal mycelia and the cell phycoerythrin being dissolved out at the borders of the lesions.

[03] At present, it has been confirmed that a plurality of pathogens may cause red rot disease in laver, including Pythium porphyrae, Pythium chondricola, and Alternaria sp.. Pythium sp. is the main pathogen of red rot disease of laver. Arasaki identified the pathogen as a Pythium in the Oomycetes based on the mycelial morphology, reproductive mode, and life history. After more than years of taxonomic identification, Takahashi named the pathogen as Pythium porphyraeuntil the 1970s. Later, it was discovered that another species of Pythium, P. chondricola, could cause red rot disease in laver.

[04] There is no cure for red rot disease of laver so far. Only measures such as organic acid treatment of laver , seeding nets refrigeration, and prolonging the air-drying time of the laver at the early stage of the disease can effectively suppress the spread of the disease. Therefore, it is very necessary to establish a method for detecting the pathogen of red rot disease, which can provide valuable time for controlling the spread of the disease. Amano et al. established a method for detecting hyphae and zoospores of P. porphyrae using monoclonal antibodies, but this method has regional differences in the detection of pathogens. Addepalli et al. established a method that

17935405_1 (GHMatters) P116884.AU combines polyclonal antibodies and indirect fluorescence technology to detect zoospores and cysts of P. porphyrae, but the method has a weak response to other Pythium species. Park et al. designed specific primers PP-i and PP-2, based on the ITS sequence of P. porphyrae, to establish a competitive PCR method, which can detect hyphae and water zoospores, and can be used for pathogen detection and pathogen early warning of commercial laver products. In 2016, Fuchigami Tetsu established a fluorescence quantitative PCR detection method for the ITS sequence of P. porphyrae, which can shorten the detection time and has high sensitivity, but measured samples have large errors.

[05] In the two Pythium pathogens of laver, P. porphyrae and P. chondricola are different in pathogenicity, while they are identical in mycelial morphology, reproductive mode, infection characteristics, and internal transcribed spacer (ITS) sequences. Therefore, they cannot be distinguished by the above characteristics, and can only be distinguished by the difference of 4 bases in the cytochrome C oxidase subunit I and II (cox 1 and cox 2) gene sequences. At present, none of the methods for detecting pathogens of red rot disease of laver can distinguish P. porphyrae from P. chondricola.

SUMMARY

[06] To solve the above-mentioned technical problems, the present disclosure sets forth a method for designing specific primers by using genome differential sequences of P. porphyrae and P. chondricola to establish the identification of P. porphyrae and P. chondricola based on single and duplex PCR, and carries out specific detection, thus providing technical support for identifying pathogens of red rot disease of laver.

[07] The technical solution of the present disclosure is:

[08] (1) According to the information on differential sequences of P. porphyrae and P. chondricolagenomes, specific primers are designed. The whole genome sequence information on P. porphyrae NBRC NO. 30800 and P. chondricola NBRC NO. 33253 are aligned to obtain differential sequences segments between the two molds. Primers are designed to ensure that the two primer pairs have similar annealing temperatures as much as possible.

[09] (2) Designation of the identification primers for P. porphyrae: according to the obtained differential sequence segments, specific primers for P. porphyrae NBRC NO. 30800 are designed: P-for: CCTACAGCAATCCACGAGACTC (SEQ ID NO:1), and P-rev: TGCCGTAGAGAAGAACACAGAGA (SEQ ID NO:2).

[10] (3) Designation of the identification primers for P. chondricola: according to the obtained differential sequence segments, special primers for P. chondricolaNBRC NO. 33253 are designed: C-for: CGGACACGAAGACGACGCTAT (SEQ ID NO:3), and C-rev:

2 17935405_1 (GHMatters) P116884.AU

CGACTACGACTACGACTACGACTAT (SEQ ID NO:4).

[11] (4) Identification of the Pythium pathogens by single PCR technology: genomic DNAs are extracted from different Pythium strains by using the cetyltrimethyl ammonium bromide (CTAB) method, then, the DNAs of different strains are used as templates to verify the accuracy and sensitivity of the designed and synthesized primers. Specific PCR conditions are: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 55°C for 40 s, and extension at 72°C for 1 min, 35 cycles in total.

[12] (5) Construction of standard plasmids: with reference to the method reported in the literature, a ligation primer PC-merge-for is designed and synthesized as follows: TCTCTGTGTTCTTCTCTACGGCAAGTCACCGGACACGAAGACGACGCTAT (SEQ ID NO:5); a PCm fragment is amplified with PC-merge-for and C-rev, and fragment P is amplified with P-for and P-rev, respectively; after extraction from the gel, the resulting fragments are merged into a template, and P-for/C-rev is used as primer pair for overlapping PCR amplification. The PCR system and program are the same as above. After extraction from the gel, the electrophoresed fragments are ligated and transformed by the IE-Vector Zero Background Fast Cloning Kit (Insight Exbio, Qingdao). Positive clones are picked and used as standard plasmids for later use after correct sequencing and alignment.

[13] (6) Identification and detection of the Pythium pathogens of red rot disease of laver duplex PCR technology: mixed DNA of the two Pythium genomes extracted above are used as a template, two synthetic specific primer pairs are added for duplex PCR detection. The PCR system is 25 L, and the two forward and reverse primer pairs are 0.4 [M, respectively. The above standard plasmid with a copy number of 10was on the positive control template, and the negative control contains no template.

[14] (7) The optimization of the specific primer ratio in the process of identifying and detecting the Pythium pathogens of red rot disease of laver by the duplex PCR technology: the content ratio of P-for/P-rev to C-for/C-rev primers is set to 1:2, 1:3, 1:4, 1:5, 1:6, 1:1, 2:1, 3:1, 4:1, 5:1, or 6:1, respectively, the template is a standard plasmid, the concentration is 10' copies, and the amplification system and program are the same as above; products are detected by 1% agarose gel electrophoresis, and the optimal primer ratio is screened according to the band brightness.

[15] (8) The test of duplex PCR detection in the detection of the Pythium pathogens of layer: the bacterial sample DNAs from different sources are used as templates, respectively, the above mentioned optimal primer ratio and PCR conditions are used to test the specificity of this method. The results show that the resulting fragments are in line with desired ones, indicating that the specificity of the duplex PCR detection is excellent. A sensitivity test using standard plasmids as templates has proved that the sensitivity of the duplex PCR detection is 104 copies.

3 17935405_1 (GHMatters) P116884.AU

[16] The present disclosure has the following beneficial effects:

[17] 1. The two primers involved in this method have excellent specificity, and may efficiently and conveniently realize the differential identification of P. porphyrae and P. chondricola, without cross detection, thus providing technical support for the pathogen detection and disease control of red rot disease of laver;

[18] 2. It of great significance for controlling the spread of the disease and reducing losses by establishing a method for detecting pathogens of red rot disease of laver, particularly, early disease detection;

[19] 3. The established single PCR and duplex PCR detection methods do not require sequencing and sequence alignment. Only by PCR and agarose gel electrophoresis may accurately and sensitively identify and detect the presence of P. porphyrae and P. chondricola, which can substantially shorten the detection time.

BRIEF DESCRIPTION OF THE DRAWINGS

[20] FIG. 1 illustrates the amplification results of specific primers designed for P. porphyrae and P. chondricola against 8 Pythium strains. M: DL2000 Marker; 1: NBRC NO. 30800; 2: NBRC NO. 33126; 3 to 8: PYTHT201801-1, JS151205, RZ201902, LS201903, NBRC NO. 100633, and NBRC NO. 33253; 9: blank control.

[21] FIG. 2 is an electropherogram of PCR products using recombinant fragments and recombinant plasmids as templates.

[22] Panel a is an electropherogram of a recombinant fragment (M: DL2000Marker; P: fragment P; PCm: fragment PCm; PCm-L: recombinant fragment). Panel b is an electropherogram of an extracted plasmid (M: DL5000Marker; 1 to 4: recombinant plasmid DNAs).

[23] FIG. 3 illustrates specificity tests for designed primers.

[24] Panel a illustrates specificity test results of P-for/rev (1: DL2000Marker; 2: NBRC NO. 30800; 3: NBRC NO. 33126; 4 to 9: PYTHT201801-1, JS151205, RZ201902, LS201903, NBRC NO. 100633, and NBRC NO. 33253; 10: P. ultimum; 11 to 13: P. recalcitrans,P. inflatum, and P. oopapillum; 14: Opplidiopsis sp.; 15 to 17: P. carrageenovora,Alternaria sp., and B. hwajinpoensis; 18: blank control). Panel b illustrates specificity test results of C-for/rev (1: DL2000Marker; 2 to 7: PYTHT201801-1, JS151205, RZ201902, LS201903, NBRC NO.100633, and NBRC NO.33253; 8: NBRC NO. 30800; 9: NBRC NO. 33126; 10: P. ultimum; 11 to 13: P. recalcitrans,P. inflatum, and P. oopapillum; 14: Opplidiopsis sp.; 15 to 17: P. carrageenovora, Alternaria sp., and B. hwajinpoensis; 18: blank control).

[25] FIG. 4 illustrates sensitivity tests for designed primers.

[26] Standard plasmids are used to prepare gradient templates at different concentrations, and

4 17935405_1 (GHMatters) P116884.AU the templates are subjected to single PCR amplification, respectively. Panel a illustrates sensitivity tests for P-for/P-rev (1: DL2000Marker; 2 to 9: standard plasmids with 10-10° copies; 10: blank control). Panel b illustrates sensitivity tests for C-for/C-rev (1: DL2000Marker; 2 to 9: standard plasmids with 107-10° copies; 10: blank control).

[27] FIG. 5 is an electropherogram of duplex PCR amplification results.

[28] Panel a illustrates amplified products with standard plasmids as templates (1: DL2000Marker; 2 to 7: standard plasmids as templates; 8: blank control). Panel b illustrates amplified products with bacterial DNAs as templates (1: DL2000Marker; 2 to 9: genomic DNA mixtures of P. porphyrae, and P. chondricola as templates; 10: blank control).

[29] FIG. 6 illustrates the optimal results of primer ratio in duplex PCR detection.

[30] 1: DL2000 Marker; 2 to 12: primer ratios of P-for/P-rev to C-for/C-rev are 1:2, 1:3, 1:4, 1:5, 1:6, and 1:1, 2:1, 3:1, 4:1, 5:1, and 6:1, respectively; 13: blank control.

[31] FIG. 7 illustrates specificity tests for designed primers in duplex PCR.

[32] 1: DL2000Marker; 2: a positive control with standard plasmid as template; 3: a positive control with P-for/P-rev as primer; 4: a positive control with C-for/C-rev as primer; 5: NBRC NO. 30800; 6: NBRC NO. 33126; 7 to 12: PYTHT201801-1, JS151205, RZ201902, LS201903, NBRC NO. 100633, and NBRC NO. 33253; 13: P. ultimum; 14 to 16: P. recalcitrans,P. inflatum, and P. oopapillum; 17: Opplidiopsis sp.; 18 to 20: P. carrageenovora,Alternaria sp., and B. hwajinpoensis; 21: blank control.

[33] FIG. 8 illustrates sensitivity tests for the designed primers in duplex PCR. Standard plasmids are used to prepare gradient templates at different concentrations, and the templates are subjected to duplex PCR amplification, respectively. 1: DL2000Marker; 2 to 9: standard plasmids with 107-10° copies; 10: blank control.

DETAILED DESCRIPTION OF THE EMBODIMENTS

[34] The present disclosure will be described in detail below with reference to the drawings and examples. EXAMPLES

[35] I. Strains

[36] The strains used in this example were from the Japan National Institute of Technology and Evaluation (NITE), the China General Microbiological Culture Collection Center (CGMCC), and the strains isolated and preserved in this laboratory, as shown in Table 1. Herein, P. porphyrae and P. chondricola were grown in semi-seawater corn agar medium at 25°C; other Pythium strains and Alternaria sp. were grown in Potato Dextrose Agar (PDA) (Hopebio, Qingdao) medium at 25°C; Oplidiopsis sp. could not be isolated and cultured. The diseased laver containing the Oplidiopsis sp.

5 17935405_1 (GHMatters) P116884.AU cells was cryopreserved at -20°C and used as martial to extract DNA of Oplidiopsis sp.; Pseudoalteromonas carrageenovora and Bacillus hwajinpoensis were grown in Zobell 2216 medium at 20°C.

[37] Table 1 Strains used in this example Species Strain Source NBRC NO. 30800 NITE P.porphyrae NBRC NO. 33126 NITE PYTHT201801-1 Inventors' laboratory

JS151205 Inventors' laboratory CCTCC M 2020864 P. chondricola RZ201902 Inventors' laboratory LS201903 Inventors' laboratory

NITE NBRC NO. 100633 NBRC NO. 33253 NITE P. ultimum Inventors' laboratory P. ricalcitrans CGMCC P. inflatum CGMCC P. oopapillum CGMCC Alternaria sp. Inventors' laboratory Others Oplidiopsis sp. Inventors' laboratory Pseudoalteromonas Inventors' laboratory carrageenovora Bacillus hwajinpoensis Inventors' laboratory

[38] II. Primer design and optimization of single PCR conditions

[39] 1. Primer design

[40] The genomic DNAs of purely cultured P. porphyraeNBRC NO. 30800 and P. chondricola NBRC NO. 33253 hyphae were extracted for next-generation sequencing (NGS), and the genomic information of the two strains was obtained after splicing; the differential sequences of the two strains were obtained through the whole-genome alignment, and specific primers were designed on the basis of the differential sequences, namely, specific primers P-for/P-rev for P. porphyraeNBRC NO. 30800, and specific primers C-for/C-rev for P. chondricolaNBRC NO. 33253, and a ligation primer PC-merge-for were designed, the first half of the ligation primer was reversely complementary to P-rev, and the second half was C-for. The primers are as follows:

6 17935405_1 (GHMatters) P116884.AU

[41] P-for: CCTACAGCAATCCACGAGACTC (SEQ ID NO:1);

[42] P-rev: TGCCGTAGAGAAGAACACAGAGA (SEQ ID NO:2);

[43] C-for: CGGACACGAAGACGACGCTAT (SEQ ID NO:3);

[44] C-rev: CGACTACGACTACGACTACGACTAT (SEQ ID NO:4); and

[45] PC-merge-for:

[46] TCTCTGTGTTCTTCTCTACGGCAAGTCACCGGACACGAAGACGACGCTAT (SEQ ID NO:5).

[47] 2. Genomic DNA extraction

[48] The genomic DNAs of Pythium strains and Alternaria sp. were extracted by the CTAB method. The method for extracting the genomic DNA of Oplidiopsis sp. was to wash the diseased material of laver containing Oplidiopsis sp. with sterile seawater 3-5 times, remove surface impurities, and extract the genomic DNA of Oplidiopsis sp. by using a Fungal Genomic DNA Extraction Kit (SparkJade, Qingdao). The genomic DNAs of bacterial strains were extracted by using a Bacterial Genomic DNA Kit (OMEGA, USA). The extracted genomic DNA was subjected to concentration determination by NanoDrop-2000 (Thermo, USA) and cryopreserved at -20°C for later use.

[49] 3. Establishment of a single PCR system

[50] A 25 L PCR system was used, including the following components: 2xEx Taq Mix (TaKaRa, Japan), 12.5 [L; positive and negative primers, 1 L (0.4 M) each; template, 1 L; and ddH20, 9.5 L. Meanwhile, a blank control group with ddH20 as template was set up. The PCR program was: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 55 61°C for 40 s, and extension at 72°C for 1 min, 35 cycles in total; and holding at 72°C for 10 min. PCR products were detected by 1% agarose gel electrophoresis, and the electrophoresed fragments (OMEGA, USA) were subjected to gel extraction; the T vector was ligated with a pCloneEZ-TA AMP (Taihe Biotechnology Co., Ltd., Beijing) vector ligation kit, and transformed into Escherichia coli DH10 competent cells; the positive clone suspensions were picked and sent to Qingdao PsnGene for sequencing.

[51] The amplification results of specific primers P-for/P-rev designed for P. porphyrae against 8 Pythium strains of in the laboratory are shown in FIG. 1a. P. porphyraehad a specific target band with a length of 839 bp, and the fragments had 100% sequence similarity to P. porphyrae after sequencing and alignment, but P. chondricola did not show the corresponding band. The amplification results of specific primers C-for/C-rev designed for P. chondricolaagainst 8 Pythium strains of in the laboratory are shown in FIG. lb. P. chondricola had a specific target band with a length of 339 bp, and the fragments had 100% sequence similarity to P. chondricolaafter alignment, but P. porphyrae did not show the corresponding band. This result shows that P-for/P-rev can

7 17935405_1 (GHMatters) P116884.AU specifically amplify P. porphyrae, and C-for/C-rev can specifically amplify P. chondricola.

[52] III. Construction of standard plasmids and establishment of duplex PCR detection method

[53] 1. Construction of standard plasmids

[54] Overlapping PCR amplification was conducted using gel extraction products of fragments P amplified with P-for and P-rev and fragments PCm amplified with PC-merge-for and C-rev as templates and P-for/C-rev as primers. The PCR system and program were the same as above. The PCR products were detected by 1% agarose gel electrophoresis, and the electrophoresed fragments were extracted by using a gel extraction kit (OMEGA, USA). Recombinant fragments were extracted from the gel, and then ligated and transformed by the IE-Vector Zero Background Fast Cloning Kit (Insight Exbio, Qingdao). Positive colonies were picked in an aseptic bench and placed in an LB broth (supplemented with 100 [tg/mL ampicillin), and cultured under shaking at 37°C and 200 rpm for 12-16 h, and plasmids were extracted by using a common plasmid extraction kit (Insight Exbio, Qingdao). The extracted plasmid DNA was subjected to concentration determination with NanoDrop-2000 (Thermo, USA) and stored at -20°C for later use, and the copy number thereof was calculated according to the following formula:

[55] x 1023 (copies mol-')xDNA amount (g) DNA (copy) = 6.02DNA length (bp) x660 (g mol-1 bp-1)

[56] The fragment P and the fragment PCm were used as templates, and the P-for and C-rev were used as primers, PCR amplification was conducted to obtain a recombinant fragment PCm-L with an desired length of 1,251 bp (FIG. 2a). The recombinant fragment was ligated to the IE-vector, and then ligated and transformed to obtain a positive plasmid for sequence identification, with a desired sequence similarity of 100% (FIG. 2b).

[57] IV. Specificity and sensitivity tests for PCR

[58] When a specificity test was performed, PCR amplification was performed with the genomic DNAs of all strains in Table 1 as templates, and products were verified by 1% agarose gel electrophoresis. It was found that P-for/P-rev could only amplify P. porphyrae, and C-for/C-rev could only amplify P. chondricola, indicating that the two primer pairs had excellent specificity (FIG. 3).

[59] When a sensitivity test was performed, the standard plasmids were diluted with ddH20 to 8 gradients of 107, 106, 101, 104, 101, 102, 101, and 100 copies/4L and the diluents were used as templates for PCR amplification, and the products were verified by 1% agarose gel electrophoresis. It was confirmed from the test that the sensitivity values of the single PCR detection was 10' (for P for/rev) and 102 (for C-for/rev) copies (FIG. 4).

[60] V. Optimization of duplex PCR amplification conditions

[61] The duplex PCR system contained two primer pairs, i.e. P-for/P-rev and C-for/C-rev, and the template was a constructed standard plasmid with a copy number of 105 or a DNA mixture of P.

8 17935405_1 (GHMatters) P116884.AU chondricolaNBRC NO. 33253 and P. porphyraeNBRC NO. 30800. The 25 L of PCR system was as follows: 2xEx Taq Mix (TaKaRa, Japan), 12.5 [L; two forward and reverse primer pairs, 1 L (0.4 pM) each; template, 1 L; and ddH20, 7.5 [L. Meanwhile, a negative control group with ddH20 as template was set up. The PCR program was the same as above. The products were detected by 1% agarose gel electrophoresis. The results are shown in FIG. 5. Both target fragments could be amplified, and the detection effect was excellent.

[62] When the duplex PCR system was optimized, the primer content ratio of P-for/P-rev to C for/C-rev was set to 1:2, 1:3, 1:4, 1:5, 1:6, 1:1, 2:1, 3:1, 4:1, 5:1, and 6:1, respectively; the template standard plasmid was 10' copies, the amplification system and program were the same as above, the products were detected by 1% agarose gel electrophoresis (FIG. 6); when the ratio of the two specific primer pairs was 1:2, 1:3, 1:4, 1:5, 1:6, 1:1, 2:1, 3:1, 4:1, 5:1, or 6:1, two bands could be obtained; and when the ratio of the two primer pairs was set to 1:1 and 2:1, the upper and lower bands had relatively consistent brightness. Therefore, the optimal ratio was between 1:1 and 2:1, and the primer DNA concentration was 0.2 [M.

[63] VI. Technical testing and sensitivity testing of duplex PCR

[64] The strain DNAs in Table 1 was used as templates, the application test for duplex PCR technology for detecting Pythium in laver was carried out. The results showed that the positive control group showed two target bands of 893 bp and 339 bp, which were consistent with the desired fragment sizes; P. porphyrae only showed an 893 bp band, P. chondricola only showed a 339 bp band, and no band could not be amplified for other strains (FIG. 7), indicating that the specific primers for Pythium in laver designed by the present disclosure and the duplex PCR detection technology had excellent specificity.

[65] It was found that the sensitivity of the duplex PCR detection was 104 copies by using standard plasmids as templates (FIG. 8).

[66] It is to be understood that, if any prior art publication is referred to herein, such reference does not constitute an admission that the publication forms a part of the common general knowledge in the art, in Australia or any other country.

[67] In the claims which follow and in the preceding description of the invention, except where the context requires otherwise due to express language or necessary implication, the word "comprise" or variations such as "comprises" or "comprising" is used in an inclusive sense, i.e. to specify the presence of the stated features but not to preclude the presence or addition of further features in various embodiments of the invention.

9 17935405_1 (GHMatters) P116884.AU

17924419_1 Jul 2021

SEQUENCE LISTING

<110> Ocean University of China

<120> METHOD FOR IDENTIFYING AND DETECTING PYTHIUM PATHOGEN OF RED ROT DISEASE OF LAVER

<130> GWP202105516 2021104733

<160> 5

<170> PatentIn version 3.5

<210> 1 <211> 22 <212> DNA <213> Artificial Sequence

<220> <223> specific primer P-for for P. porphyrae NBRC NO. 30800

<400> 1 cctacagcaa tccacgagac tc 22

<210> 2 <211> 23 <212> DNA <213> Artificial Sequence

<220> <223> specific primer P-rev for P. porphyrae NBRC NO. 30800

<400> 2 tgccgtagag aagaacacag aga 23

<210> 3 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> specific primer C-for for P. chondricola NBRC NO. 33253

<400> 3 cggacacgaa gacgacgcta t 21

<210> 4 <211> 25 <212> DNA Page 1

17924419_1 Jul 2021

<213> Artificial Sequence

<220> <223> specific primer C-rev for P. chondricola NBRC NO. 33253

<400> 4 cgactacgac tacgactacg actat 25 2021104733

<210> 5 <211> 50 <212> DNA <213> Artificial Sequence

<220> <223> ligation primer PC-merge-for

<400> 5 tctctgtgtt cttctctacg gcaagtcacc ggacacgaag acgacgctat 50

Page 2

Claims (5)

WHAT IS CLAIMED IS:

1. A method for identifying and detecting Pythium pathogens of red rot disease of Pyropia/Porphyra,comprising designing two specific and highly sensitive primers and establishing a detecting method; wherein the primer sequences are designed according to differential sequences of Pythium porphyraeand Pythium chondricola genomes.

2. The method for identifying and detecting Pythium pathogens of red rot disease of Pyropia/Porphyra according to claim 1, wherein primer sequences for identifying Pythium porphyrae, a Pythium pathogen of red rot disease of laver, are P-for: CCTACAGCAATCCACGAGACTC (SEQ ID NO:1), and P-rev: TGCCGTAGAGAAGAACACAGAGA (SEQ ID NO:2); and primer sequences for identifying Pythium chondricola, another Pythium pathogen of red rot disease of laver, are C-for: CGGACACGAAGACGACGCTAT (SEQ ID NO:3), and C-rev: CGACTACGACTACGACTACGACTAT (SEQ ID NO:4).

3. The method for identifying and detecting Pythium pathogens of red rot disease of laver according to claims 1 to 2, wherein the method for identifying a single Pythium pathogen is implemented by single PCR detection, and the reaction conditions are: pre-denaturation at 95 0 C for min; denaturation at 95 0C for 30 s, annealing at 55-61 0C for 40 s, and extension at 720 C for 1 min, cycles in total.

4. The method for identifying and detecting Pythium pathogens of red rot disease of Pyropia/Porphyraaccording to claim 1, wherein the method for detecting Pythium pathogens of red rot disease of Pyropia/Porphyra is implemented by duplex PCR detection, and the reaction conditions are: 25 L of PCR system, 12.5 L of 2xEx Taq Mix, two forward and reverse primers pairs, 0.4 M each, and standard plasmids with a template copy number of 10'.

5. The method for identifying and detecting Pythium pathogens of red rot disease of Pyropia/Porphyraaccording to claim 4, wherein during the duplex PCR detection, two bands are obtained when the two specific primers pairs are in a molar ratio of 1:2, 1:3, 1:4, 1:5, 1:6, 1:1, 2:1, 3:1, 4:1, 5:1, or 6:1, and preferably from 1:1 to 2:1.

10 17935405_1 (GHMatters) P116884.AU

－1/3－ Jul 2021 2021104733

FIG. 1

FIG. 2

FIG. 3

17924431_1 (GHMatters) P116884.AU

－2/3－ Jul 2021 2021104733

FIG. 4

FIG. 5

FIG. 6

17924431_1 (GHMatters) P116884.AU

－3/3－ Jul 2021

FIG. 7 2021104733

FIG. 8

17924431_1 (GHMatters) P116884.AU