CN104372081B - The LAMP detection primer of one group of Eggs of Silkworm microsporidian and kit - Google Patents

The LAMP detection primer of one group of Eggs of Silkworm microsporidian and kit Download PDF

Info

Publication number
CN104372081B
CN104372081B CN201410592795.XA CN201410592795A CN104372081B CN 104372081 B CN104372081 B CN 104372081B CN 201410592795 A CN201410592795 A CN 201410592795A CN 104372081 B CN104372081 B CN 104372081B
Authority
CN
China
Prior art keywords
primer
silkworm
kit
dna
detection
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201410592795.XA
Other languages
Chinese (zh)
Other versions
CN104372081A (en
Inventor
刘吉平
程伟
晏育伟
宋小景
杨思佳
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
South China Agricultural University
Original Assignee
South China Agricultural University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by South China Agricultural University filed Critical South China Agricultural University
Priority to CN201410592795.XA priority Critical patent/CN104372081B/en
Publication of CN104372081A publication Critical patent/CN104372081A/en
Priority to PCT/CN2015/088349 priority patent/WO2016065983A1/en
Application granted granted Critical
Publication of CN104372081B publication Critical patent/CN104372081B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/10—Protozoa; Culture media therefor
    • C12N1/105—Protozoal isolates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/02—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms
    • C12Q1/04—Determining presence or kind of microorganism; Use of selective media for testing antibiotics or bacteriocides; Compositions containing a chemical indicator therefor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/90—Protozoa ; Processes using protozoa

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biomedical Technology (AREA)
  • Immunology (AREA)
  • Analytical Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Virology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Plant Pathology (AREA)
  • Toxicology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses LAMP detection primer group and the kit of one group of Eggs of Silkworm microsporidian.Described primer sets includes Outside primer Sep3F3/Sep3B3 and inner primer Sep3FIP/Sep3BIP, and sequence is as shown in SEQ ID NO:1～4.The present invention utilizes this primer to establish LAMP detection method and the kit of Eggs of Silkworm microsporidian, described kit include above-mentioned primer sets, 2 × reaction buffer, positive reference substance, negative controls, nitrite ion (or fluorescent staining liquid),BstArchaeal dna polymerase, sealing fluid and sterilized water.The result of the method detection can visually observe under natural light or agarose gel electrophoresis is observed or real-time fluorescence curves is observed and judged.The method is simple to operate, detection is the shortest, result is prone to judge, high specificity, it is possible to detectable concentration is 5.0 × 10‑3The silkworm seed DNA that the silkworm of the infected silkworm microsporidian of ng/ μ L is produced.

Description

The LAMP detection primer of one group of Eggs of Silkworm microsporidian and kit
Technical field
The invention belongs to biological technical field.LAMP detection more particularly, to one group of Eggs of Silkworm microsporidian is drawn Thing and kit.
Background technology
Pebrine disease is that pathogenic nosema bombycis (Nosema bombycis, N.b) is through the lower infection of food or embryo Ovum (tire) infects, and makes a kind of crushing epidemic disease of silkworm infection morbidity, is also to affect China's Silk Industry sustainable and stable development at present Important epidemic disease, because granulosis harm, the economic loss that causes is the most heavy in annual various places.Meanwhile, the micro-spore of Wild insect Worm can cross-infection silkworm, and can propagate between silkworm body and during different silkworm, cause large quantities of silkworm egg to be scrapped, seriously restrict silkworm egg Trade and silkworm industry sustainable development.Pebrine disease has been classified as Imported and exported animals and has quarantined the quarantine name of two class epidemic diseases by China Record.Each department Can Ye authorities and associated production unit put into a large amount of human and material resources and financial resources, take conventional microscope microscopy Female moth, eliminates the conventional method of the silkworm egg that band poison mother moth gives birth to and carries out preventing and treating pebrine disease, but poor effect.
Initially people differentiate silkworm whether infected silkworm granulosis mainly micro-according in microscope undertissue lapping liquid Sporozoan form and size are carried out, and this method has contained the popular of silkworm district granulosis all over the world the most effectively, saves The sericulture in the Jiu Liao world.And Eggs of Silkworm microsporidian is detected mainly by by the silkworm seed pickling after 24h of laying eggs Processing, carry out microscopic examination after egg-incubation is collected ants, this method not only consumes the plenty of time, and sediments microscope inspection Shortcoming be the technology to operating personnel and skill requirement higher, and be difficult to other spore analogs and nosema bombycis spore Son is distinguished.Along with popularizing of round pcr, people begin to use PCR method to detect nosema bombycis and to reach Higher sensitivity.Mostly the primer being currently used for pebrine disease PCR detection is the (Terry for target gene SSUrRNA R S, Smith JE, Bouchon D, et al. Ultrastructural characterization and molecular taxonomy of Nosema granulosis sp. n., a transovarially transmitted, feminizing (TTF) microsporidium. J. Eukaryot. Microbiol. 1999, (46): 492-499； Huang Wei-Fone , Tsai Shu-Jen , Lo Chu-Fang , et al. The novel organization and complete sequence of the ribosomal RNA gene of Nosema bombycis .Fungal Genetics and Biology, 2004.41 (5): 473-481).But Liu Ji equality (2004) (Liu Jiping, Cao Yang, Smith J. E. etc. the PCR molecular diagnostic techniques research of simulated infection pebrine disease. Scientia Agricultura Sinica, 2004,37 (12): 1925-1931) research finds, guards the primer detection micro-spore of silkworm seed of section design based on 16SrDNA Worm, often has non-purpose band and false positive results occurs, thus it is speculated that there may be certain inhibiting substances in silkworm seed extract and does Disturb and cause of disease microsporidian genomic DNA has effectively been expanded.The result checked order according to nosema bombycis transcript profile in this laboratory, Be found that nosema bombycis septin3 gene (accession number: KJ451482.1) through sequence verification, experiments verify that discovery with The PCR primer detection silkworm seed microsporidian that septin3 gene designs for target sequence there is no non-specific band and false positive results. But the PCR primer using this gene to design is low for the detection sensitivity of nosema bombycis, and operating procedure is more, spend Time is longer, is unsuitable for the shortcomings such as field detection, is unfavorable in actual production promoting widely and using.A bigger problem Be existing disclosed detection primer be all with the DNA of microsporidian as template, but the separation of microsporidian and collect more complicated, Time-consumingly, pole is unfavorable for detecting in a large number or Site Detection.
On the other hand, microsporidian parasitizes in silkworm seed, and silkworm seed content is apparently higher than microsporidian to be detected, and is carrying Taking in the DNA sample of acquisition, both DNA exist simultaneously, and Eggs of Silkworm DNA causes serious interference to detecting, therefore, if it is desired to Want directly to carry out with silkworm seed DNA for template the detection of microsporidian, detection is had higher requirement.
Summary of the invention
The technical problem to be solved in the present invention overcomes in existing detection silkworm seed whether infected silkworm microsporidian technology Deficiency, designs LAMP detection primer with nosema bombycis septin3 gene for target gene and is used for detecting silkworm seed microsporidian, carry Confession one is simpler and quick detection method than PCR detection method.
It is an object of the invention to provide the LAMP detection primer group of one group of Eggs of Silkworm microsporidian.
Another object of the present invention is to provide the application of described LAMP detection primer.
Still a further object of the present invention is to provide a kind of inspection utilizing above-mentioned LAMP detection primer to set up vertical nosema bombycis Survey method and kit.
Above-mentioned purpose of the present invention is achieved through the following technical solutions:
The invention provides the LAMP detection primer group of one group of Eggs of Silkworm microsporidian, described primer sets includes that one is external Side primer Sep3F3/Sep3B3 and pair of inside primer Sep3FIP/Sep3BIP, the nucleotide sequence of described primer is the most such as Shown in SEQ ID NO:1～4.
The LAMP detection primer group that present invention also offers above-mentioned Eggs of Silkworm microsporidian is preparing the micro-spore of Eggs of Silkworm Application in terms of sub-worm detection kit.
Present invention also offers a kind of Eggs of Silkworm microsporidian LAMP detection kit, including pair of outside primer Sep3F3/Sep3B3 and pair of inside primer Sep3FIP/Sep3BIP, the nucleotide sequence of described primer is respectively such as SEQ ID Shown in NO:1～4.
Described kit also includes 2 × reaction buffer, positive reference substance, negative controls, nitrite ion or fluorescent staining Liquid, Bst DNA polymerase, sealing fluid and sterilized water.
Preferably, the component of described 2 × reaction buffer is as follows: 20mM Tris-HCl, pH8.8；10mM KCl；2 mM MgSO4；20mM(NH4)2SO4；0.1% Triton X-100；2.8mM dNTPs；1M glycine betaine；25mM MgCl2。
Preferably, described positive reference substance is Septin3-DNA-pMD recombinant plasmid；Described negative controls is normal family Silkworm DNA.
The preparation of described Septin3-DNA-pMD recombinant plasmid: utilize primer Sep3F and Sep3R, with nosema bombycis DNA is that template carries out PCR amplification, and extension amplification outcome enters pMD-19T carrier and obtains；
The nucleotide sequence of described primer Sep3F and Sep3R is as shown in SEQ ID NO:5～6.
Preferably, described nitrite ion is 10000 × SYBR Green I or fluorescence indicator 1 × SYBR Green I.
Preferably, described sealing fluid is glycerine.
Preferably, the reaction system of described kit is as follows:
When the judgement of testing result uses decoration method or agarose gel electrophoresis method, reaction system is:
2 × reaction buffer 12.5 μ L
Primer Sep3F3/Sep3B3 and Sep3FIP/Sep3BIP 1 μ L
Bst DNA polymerase 8U/ μ L 1 μ L
Template DNA 2 μ L
ddH2O 8.5μL；
When the judgement of testing result uses real-time fluorescence method, reaction system is:
2 × reaction buffer 12.5 μ L
Primer Sep3F3/Sep3B3 and Sep3FIP/Sep3BIP 1 μ L
Bst DNA polymerase 8U/ μ L 1 μ L
Fluorescence indicator 0.5 μ L
Template DNA 2 μ L
ddH2O 8μL；
Wherein, the concentration of described primer Sep3F3/Sep3B3 is 5pmol/ μ L, the concentration of primer Sep3FIP/Sep3BIP It is 20～40pmol/ μ L.
Suggestion: when using kit, for N number of sample, the reaction system that should prepare (N+3) times volume (includes that feminine gender is right According to, each one of positive control, and packing expends error), it is ensured that the packing of each reaction tube is uniformly.
Preferably, the LAMP reaction condition of described kit is: 63 DEG C of isothermal reaction 60 min；Then 95 DEG C, 2 are placed Min inactivates.
The method using the kit detection Eggs of Silkworm microsporidian of the present invention comprises the steps of
S1. the template DNA of testing sample is extracted；
S2. reaction system is configured: configure according to above-mentioned reaction system；
S3. sample-adding: after reaction system packing, add ddH to reaction tube the most successively2O(blank), each template DNA, Positive reference substance, negative controls；Be subsequently adding 20 μ L sealing fluids (for decoration method result of determination, be in reaction tube lid Side adds 1 μ L nitrite ion, lid is covered tightly, and notes avoiding nitrite ion to fall in reactant liquor)；
S4. reaction: for decoration method and the detection of agarose gel electrophoresis method result of determination, reaction tube is placed in thermostatted water In bath cabinet or other thermostatic equipments, 63 DEG C of constant temperature place 30～60min, then 95 DEG C, place 2min inactivation；For the most glimmering The detection of light method result of determination, puts in Deaou-308C constant-temperature fluorescence detector or other fluorescence detectors by reaction tube, and 63 DEG C constant temperature places 00min observed result；
S5. result interpretation: result interpretation can have decoration method (development process), agarose gel electrophoresis method and real-time fluorescence Method；
(1) decoration method: the nitrite ion inside reaction tube lid is sprung into reaction tube, mixes with product；At natural light Under observe by the naked eye color change, product color becomes green, illustrates that testing sample contains Eggs of Silkworm microsporidian； Product becomes orange, then do not contain Eggs of Silkworm microsporidian；
(2) agarose gel electrophoresis method: take the 1 reacted product of μ L, with 1 μ L 6 × loading buffer and 8 μ L ddH2O mixes, in 1% agarose gel electrophoresis；If the numerous trapezoid-shaped strips differed in size occur, illustrate that testing sample contains house Silkworm silkworm seed microsporidian；If without the numerous trapezoid-shaped strips differed in size, illustrating that testing sample does not contains Eggs of Silkworm microsporidian；
(3) real-time fluorescence method: if having " S " type amplification curve and amplification value to exceed the threshold value that sets as positive, if amplification song The amplification value of line is then negative not less than the threshold value set.
The present invention prepares the preparation of the nosema bombycis DNA profiling that the positive reference substance of kit is used, and uses The little extraction reagent kit of Qiagen company plant, method is carried out with reference to specification.Specifically comprise the following steps:
S1. take microsporidian sample 200 μ L, 12,000rpm, centrifugal 5min, abandon supernatant；Then add 50～100 μ L ddH2O is resuspended；
S2. drawing resuspended spore liquid in the mortar of precooling, liquid nitrogen is fully ground (more than 3 times)；
S3. the spore after grinding is put in 1.5 mL centrifuge tubes, adds 400 μ L lysis buffer AP1 and 4 μ L RNase A, vortex mixing (400 μ L lysis buffer AP1 and 4 μ L RNase A mix the most before use)；
S4. the solution after mixing, 65 DEG C, turn upside down during hatching 10 min(test tube 2～3 times)；
S5. 130 μ L buffer solution P3, ice bath 5 min after mixing are added；Then 14,000 rpm, centrifugal 5 min；
S6. absorption supernatant is in Filter column, 14,000rpm, centrifugal 2min；
S7. supernatant in centrifuge tube is moved to new recovery tube (not stirring the residue of appearance), adds the slow of 1.5 times of volumes Rushing liquid AW1, pipettor mixes；
S8. 650 μ L mixed liquors are moved in silica gel adsorption column, 4,200 rpm, centrifugal 1 min；Remaining liquid repeats this Step；
S9. silica gel adsorption column is put in new collecting pipe, add 500 μ L buffer A W, 4,200 rpm, be centrifuged 1 min；Abandon supernatant；
S10. adding 500 μ L buffer A W, 14,000 rpm, centrifugal 2 min(ensure that collecting pipe is not exposed to bottom Supernatant)；
S11. adsorption column is moved in 1.5mL or 2mL centrifuge tube；
S12. adding 40 μ L elution buffer AE, room temperature places 5 min；4,200 rpm, 1 min；
S13. repeating step S12 ,-20 DEG C of Refrigerator stores are standby.
This seminar early-stage Study finds, with nosema bombycis septin3 gene (accession number: KJ451482.1) is The PCR primer of target sequence design can well be used for detecting silkworm seed microsporidian, nothing but specific band and false positive results, but It is that on the one hand its designed PCR primer is more for nosema bombycis detection operating procedure, and the time of cost is longer.Another Aspect we for the specific and sensitivity of microsporidian detection and be unsatisfactory for.
Ring mediated isothermal amplification method (Loop-mediated isothermal amplification, LAMP) is Japanology The technology of a kind of novel in vitro isothermal duplication specific nucleic acid fragment that person Notomi etc. (2000) invent.LAMP method has specifically By force, quickly, efficiently, the advantage such as sensitiveness is high, easy and simple to handle, detection method is simple, naked eyes get final product judged result, thus simplify Detection process, the detection time is also greatly shortened.Wherein, for LAMP detection method, primer is a factor of most critical.Target base Because the quality of the selection of sequence, the design of primer and selection directly influences the quality of testing result.Even for same How target-gene sequence, select suitable six regions, and design suitable four primer sequences, have detection sensitivity The most vital effect and very big significance.The present inventor's early stage devises exactly a series of organizes LAMP primer, again more Consider various factors the judgement of Binding experiment result, filter out 3 groups of LAMP primer.Further, the present inventor is the most true Having determined four specific primers of optimum, i.e. four specific primers of primer sets III are as LAMP detection primer sets.
III 4 primer sequences of described primer sets are:
Shown in Sep3F3(SEQ ID NO:1): 5'-ACACATTTAGGAAAAGTGCTTTA-3'
Shown in Sep3B3(SEQ ID NO:2): 5'-AATTTGTTACAGAAGGACTCC-3'
Sep3FIP (F1c+F2) (shown in SEQ ID NO:3):
5'- CTCTCTTATCACGTTTTCCATTTCA-AAGGGAAAAGAGCTCGGA -3'
Sep3BIP (B1c+B2) (shown in SEQ ID NO:4):
5'-TGAGGATTTGAAACGGGAAGAACAT-AATACTACCACCCACCGA-3'
Therefore, the above-mentioned LAMP detection primer group for microsporidian detection is that the present inventor obtains the micro-spore of silkworm in early stage On the basis of sub-worm septin3 gene, obtained by substantial amounts of exploration and research, not only overcome regular-PCR operation complicated, Rely on the defect of expensive instrument, it is often more important that, the maximum innovative point of the present invention with: 1) relative to regular-PCR method, the present invention The shortest, testing result is more easy to judge；2) method relative to existing LAMP is applied to what the detection of microsporidian was used Primer, this method the primer, directly with Eggs of Silkworm DNA as template, the most well overcomes Eggs of Silkworm DNA to detection The interference caused, makes testing result relatively reliable, and sensitivity is the best.In a word, the method is simple to operate, detection is the shortest, Result is prone to judge, high specificity, it is possible to 1 silkworm seed of pebrine disease has been infected in detection.
The method have the advantages that
The invention discloses one group of LAMP primer group for nosema bombycis detection, be with septin3 gene order Designing Sep3F/3R primer for target gene, use the specific of this PCR primer checking target gene, result shows that this primer has spy The opposite sex, then with this primer as reference, septin3 gene designs for target gene and organizes LAMP primer more, according to the design of LAMP primer The extension increasing sequence position of principle and each group primer filters out 3 groups of LAMP primer, then tests into one according to the validity of primer Step filters out one group i.e. four specific primer as LAMP detection primer, i.e. Outside primer Sep3F3/Sep3B3 and inner side Primer Sep3FIP/Sep3BIP；Simultaneously in the case of only four specific primers identify 6 regions of target gene completely, Just can expand, thus ensure that it is comprehensive with detect to the specific of nosema bombycis septin3 gene magnification.
The present invention utilizes this LAMP primer group to further established LAMP method for quick and the kit of microsporidian, With four LAMP primer, LAMP reagent and nitrite ion or fluorescent staining liquid etc., constitute detection reaction system, at the constant temperature bar of 63 DEG C Under part, rapid amplifying template DNA, it is possible to detectable concentration is 5.0 × 10-3The silkworm of the infected silkworm microsporidian of ng/ μ L is produced Silkworm seed DNA, it is possible to detection 103The recombinant plasmid Septin3-DNA-pMD of copy/μ L, adds poison postoperative infection nosema bombycis Silkworm produced silkworm seed 1 time, i.e. can detect that.The detection sensitivity of microsporidian is improve again an order of magnitude, this Detection to microsporidian has great importance.
The more important thing is, microsporidian sample parasitizes in silkworm seed, and silkworm seed content is apparently higher than micro-spore to be detected Worm, in extracting the DNA sample obtained, both DNA exist simultaneously, have higher requirement detection.Therefore, the present invention is Big innovative point just with: the silkworm seed DNA directly produced with the silkworm adding poison postoperative infection nosema bombycis carries out micro-for template Sporozoite detects, and eliminates the complicated and time consumption step that microsporidian separates, and this method the primer is avoided overcoming the most well The interference that detection is caused by Eggs of Silkworm DNA, makes testing result relatively reliable, and detection sensitivity is the best.
The present invention uses LAMP technology, uses constant-temperature amplification, it is not necessary to as PCR instrument, amplification program is complicated and price is held high Expensive amplification instrument.Reaction system is optimized by the present invention, and whole reaction can complete in 30～60min, substantially reduces The detection time.Reduce further the manpower and materials cost of microsporidian detection.
The detection method of the present invention is determined with Mutiple Choice to testing result, and is easy to observe judgement: (1) develops the color Method: add nitrite ion in the reaction product, by chromogenic reaction intuitively, can visually observe interpretation detection knot under natural light Really；(2) agarose gel electrophoresis method: according to electrophoretic band can observing response result more intuitively, and more convincing, right Can also exclude easily in false positive test results, but the sample-adding of uncapping before electrophoretic procedures to exist with configuration reaction system Chummery is not carried out, and after uncapping with minimizing, later experiment is caused unnecessary pollution；(3) real-time fluorescence method, can pass through Amplification curve judged result intuitively, and the judgement for the high sample result of concentration can terminate in advance, it is unnecessary to decrease Time waste, but instrument price is costly, the laboratory more sufficient for funds or company can use.
In sum, the LAMP method for quick of silkworm cause of disease microsporidian of the present invention, simple to operate, time-consuming Short, need not the instrument of complexity and the amplification program of complexity, impurity to amplification interference is less and reaction result is prone to judge, special The opposite sex is strong, for application LAMP technology carry out Eggs of Silkworm microsporidian detection and ensure the quality of silkworm egg provide important foundation and Technological reserve, is not only suitable for scene or field detection, beneficially promotes widely in actual production and use, moreover it is possible to be the fullest The inspection poison of foot research institutions, silkworm egg production unit and silkworm egg Product Quality Verification Centers needs, it is easy to popularization and application on a large scale.
Accompanying drawing explanation
Fig. 1 is two healthy silkworm seeds of PCR primer detection and the electrophoretogram adding poison silkworm seed, M:DL 2000 DNA Marker； 1: add poison Eggs of Silkworm DNA；2: nosema bombycis DNA；3: normal Eggs of Silkworm DNA；4:ddH2O。
Fig. 2 is the position signals on septin3 gene of the three groups of LAMP primer groups of common PCR primers and primary election of the present invention Figure.
Fig. 3 is four LAMP primer of present invention position views on target-gene sequence.
Fig. 4 is Eggs of Silkworm microsporidian LAMP fast detection method of the present invention detection variable concentrations positive control (restructuring matter Grain Septin3-DNA-pMD) result (agarose gel electrophoresis method testing result).
Fig. 5 is Eggs of Silkworm microsporidian LAMP fast detection method of the present invention detection variable concentrations positive control (restructuring matter Grain Septin3-DNA-pMD) result (development process testing result).
Fig. 6 is Eggs of Silkworm microsporidian LAMP fast detection method of the present invention detection variable concentrations positive control (restructuring matter Grain Septin3-DNA-pMD) result (real-time fluorescence method testing result).
Fig. 7 is that Eggs of Silkworm microsporidian LAMP fast detection method of the present invention detects variable concentrations infected silkworm microsporidian The sensitivity result (agarose gel electrophoresis method testing result) of silkworm produced silkworm seed DNA.
Fig. 8 is that Eggs of Silkworm microsporidian LAMP fast detection method of the present invention detects variable concentrations infected silkworm microsporidian The sensitivity result (development process testing result) of silkworm produced silkworm seed DNA.
Fig. 9 is that Eggs of Silkworm microsporidian LAMP fast detection method of the present invention detects variable concentrations infected silkworm microsporidian The sensitivity result (real-time fluorescence method testing result) of silkworm produced silkworm seed DNA.
Figure 10 is that the different grain number of Eggs of Silkworm microsporidian LAMP visual quick detection kit of the present invention detection adds poison The testing result (agarose gel electrophoresis method testing result) of silkworm seed.
Figure 11 is that the different grain number of Eggs of Silkworm microsporidian LAMP visual quick detection kit of the present invention detection adds poison The testing result (development process testing result) of silkworm seed.
Figure 12 is that the different grain number of Eggs of Silkworm microsporidian LAMP visual quick detection kit of the present invention detection adds poison The testing result (real-time fluorescence method testing result) of silkworm seed.
Detailed description of the invention
Further illustrate the present invention below in conjunction with Figure of description and specific embodiment, but embodiment is not to the present invention Limit in any form.Unless stated otherwise, the present invention uses reagent, method and apparatus are the examination of the art routine Agent, method and apparatus.
Unless stated otherwise, agents useful for same of the present invention and material are commercial.
Embodiment 1 design of primers
1, according to laboratory by transcript profile sequence measurement and by the nosema bombycis of cloning and sequencing method validation Septin3 gene (Accession number:KJ451482.1) sequence, carries out homology analysis by BLAST software, finds There is no similitude sequence, the present invention devises one group of PCR primer with this gene for target gene: primer Sep3F/Sep3R.
The sequence (shown in SEQ ID NO:5) of primer Sep3F is:
5' TTCGGAGTAATAGCCAGTG 3'
The sequence (shown in SEQ ID NO:6) of primer Sep3R is:
5'- AATTTGTTACAGAAGGACTCC-3'
2, using the healthy silkworm seed of above-mentioned PCR primer detection and infected the silkworm seed of nosema bombycis, result shows, this draws Thing has specifically (as shown in Figure 1) for the detection of Eggs of Silkworm microsporidian.
Therefore based on this PCR primer amplified fragments position, the target gene designed for LAMP primer with septin3 gene, make With online software Primer ExplorerV4(http: //primerexplorer.jp/elamp4.0.0/index.htmL), LAMP primer is organized in design more, filters out 3 groups according to the design principle of LAMP primer and the extension increasing sequence position of each group primer LAMP primer, i.e. primer sets I, primer sets II and primer sets III.
(1) I 4 primer sequences of primer sets are:
1F3:AGAACAAGGACCTTATCGTATT
1B3:TGAGGAGTAAAACAAGAGATGTT
1FIP:TGTGACACTTTTTGCATTGTTTCAA-ATCGTGTTCATGTTTGTCTC
1BIP:TCCCATAATTTCAAAAGCTGACATG-TTGATTTCAGATTTACGAGAACT
(2) II 4 primer sequences of primer sets are:
2F3:CGGAGTAATAGCCAGTGAA
2B3:CGAGCTCTTTTCCCTTTC
2FIP:TGTTTATAAATCCCCAAGGATAC-CAGTTTTTGATTATGAAGGAGAG
2BIP:TACTCGCATCTTGATGATTTG-GCACTTTTCCTAAATGTGTT
(3) III 4 primer sequences of primer sets are:
Shown in Sep3F3(SEQ ID NO:1): 5'-ACACATTTAGGAAAAGTGCTTTA-3'
Shown in Sep3B3(SEQ ID NO:2): 5'-AATTTGTTACAGAAGGACTCC-3'
Sep3FIP (F1c+F2) (shown in SEQ ID NO:3):
5'- CTCTCTTATCACGTTTTCCATTTCA-AAGGGAAAAGAGCTCGGA -3'
Sep3BIP (B1c+B2) (shown in SEQ ID NO:4):
5'-TGAGGATTTGAAACGGGAAGAACAT-AATACTACCACCCACCGA-3'
The position signal on septin3 gene of the three groups of LAMP primer groups of above-mentioned common PCR primers and primary election of the present invention Figure is as shown in Figure 2.
3, then test according to the validity of primer, it is contemplated that various factors the judgement of Binding experiment result, enter one Step filters out four specific primers of primer sets III as LAMP detection primer, this primer sets position on target-gene sequence Put schematic diagram as shown in Figure 3.
Prepared by embodiment 2 kit
1, the preparation of nosema bombycis DNA profiling, uses the QIAGEN company little extraction reagent kit of plant, and method is with reference to explanation Book is carried out.Specifically comprise the following steps:
S1. take microsporidian sample 200 μ L, 12,000rpm, centrifugal 5min, abandon supernatant；Then add 50～100 μ L ddH2O is resuspended；
S2. drawing resuspended spore liquid in the mortar of precooling, liquid nitrogen is fully ground (more than 3 times)；
S3. the spore after grinding is put in 1.5 mL centrifuge tubes, adds 400 μ L lysis buffer AP1 and 4 μ L RNase A, vortex mixing (400 μ L lysis buffer AP1 and 4 μ L RNase A mix the most before use)；
S4. the solution after mixing, 65 DEG C, turn upside down during hatching 10 min(test tube 2～3 times)；
S5. 130 μ L buffer solution P3, ice bath 5 min after mixing are added；Then 14,000 rpm, centrifugal 5 min；
S6. absorption supernatant is in Filter column, 14,000rpm, centrifugal 2min；
S7. supernatant in centrifuge tube is moved to new recovery tube (not stirring the residue of appearance), adds the slow of 1.5 times of volumes Rushing liquid AW1, pipettor mixes；
S8. 650 μ L mixed liquors are moved in silica gel adsorption column, 4,200 rpm, centrifugal 1 min；Remaining liquid repeats this Step；
S9. silica gel adsorption column is put in new collecting pipe, add 500 μ L buffer A W, 4,200 rpm, be centrifuged 1 min；Abandon supernatant；
S10. adding 500 μ L buffer A W, 14,000 rpm, centrifugal 2 min(ensure that collecting pipe is not exposed to bottom Supernatant)；
S11. adsorption column is moved in 1.5mL or 2mL centrifuge tube；
S12. adding 40 μ L elution buffer AE, room temperature places 5 min；4,200 rpm, 1 min；
S13. repeating step S12 ,-20 DEG C of Refrigerator stores are standby.
2, the preparation positive and negative controls
It is reaction primer with upstream primer Sep3F and downstream primer Sep3R, carries out for template with nosema bombycis DNA PCR expands, and extension amplification outcome enters pMD-19T carrier and obtains Septin3-DNA-pMD plasmid the positive control as detection Product.
The normal silkworm DNA extracted is as negative controls.
3, other reagent
(1) 2 × reaction buffer
Component is as follows: 20mM Tris-HCl, pH8.8；10mM KCl；2 mM MgSO4；20mM(NH4)2SO4；0.1% Triton X-100；2.8mM dNTPs；1M glycine betaine；25mM MgCl2。
(2) nitrite ion 10000 × SYBR Green I(or fluorescence indicator 1 × SYBR Green I), Bst DNA gather Synthase, sealing fluid glycerine and sterilized water.
4, kit assembles
According to certain specification, following components is dispensed: with primer sets Sep3F3/Sep3B3 as external primers and As internal primer, (concentration of Sep3F3/Sep3B3 is 5pmol/ μ L to Sep3FIP/Sep3BIP, and Sep3FIP/Sep3BIP's is dense Degree is 20～40pmol/ μ L), 2 × reaction buffer, positive reference substance, negative controls, Bst DNA polymerase(8U/ μ L), sealing fluid, nitrite ion (10000 × SYBR Green I)；Fluorescence indicator (1 × SYBR Green I)；Sterilizing ddH2O。 It is all detection reagent of the LAMP quick detection kit of Eggs of Silkworm microsporidian.
Embodiment 3 kit test method
1, the LAMP reaction condition of described kit is: 63 DEG C of isothermal reaction 30～60 min；Then 95 DEG C, 2 are placed Min inactivates.
2, when the judgement of testing result uses decoration method or agarose gel electrophoresis method, the reaction system of described kit For:
2 × reaction buffer 12.5 μ L
Primer Sep3F3/Sep3B3 and Sep3FIP/Sep3BIP 1 μ L
Bst DNA polymerase 8U/ μ L 1 μ L
Template DNA 2 μ L
ddH2O 8.5μL；
When the judgement of testing result uses real-time fluorescence method, reaction system is:
2 × reaction buffer 12.5 μ L
Primer Sep3F3/Sep3B3 and Sep3FIP/Sep3BIP 1 μ L
Bst DNA polymerase 8U/ μ L 1 μ L
Fluorescence indicator 0.5 μ L
Template DNA 2 μ L
ddH2O 8μL；
Wherein, the concentration of described primer Sep3F3/Sep3B3 is 5pmol/ μ L, the concentration of primer Sep3FIP/Sep3BIP It is 20～40pmol/ μ L.
Suggestion: when using kit, for N number of sample, the reaction system that should prepare (N+3) times volume (includes that feminine gender is right According to, each one of positive control, and packing expends error), it is ensured that the packing of each reaction tube is uniformly.
3, detecting step is as follows:
S1. the template DNA of testing sample is extracted；
S2. reaction system is configured: configure according to above-mentioned reaction system；
S3. sample-adding: after reaction system packing, add the ddH of 2 μ L the most successively to reaction tube2O(blank), each mould Plate DNA, positive reference substance；It is subsequently adding 20 μ L sealing fluids, (for decoration method result of determination, will add inside reaction tube lid Enter 1 μ L nitrite ion, lid is covered tightly (attention avoids nitrite ion to fall in reactant liquor)；
S4. reaction: for decoration method and the detection of agarose gel electrophoresis method result of determination, reaction tube is placed in thermostatted water In bath cabinet or other thermostatic equipments, 63 DEG C of constant temperature place 30～60min, then 95 DEG C, place 2 min inactivations；For the most glimmering The detection of light method result of determination, puts in Deaou-308C constant-temperature fluorescence detector or other fluorescence detectors by reaction tube, and 63 DEG C constant temperature places 30～60min observed results；
S5. result interpretation: result interpretation can have decoration method (development process), agarose gel electrophoresis method and real-time fluorescence Method；
(1) decoration method: the nitrite ion inside reaction tube lid is sprung into reaction tube, mixes with product；At natural light Under observe by the naked eye color change, product color becomes green, illustrates that testing sample contains Eggs of Silkworm microsporidian； Product becomes orange, then do not contain Eggs of Silkworm microsporidian；
(2) agarose gel electrophoresis method: take the 1 reacted product of μ L, with 1 μ L 6 × loading buffer and 8 μ LddH2O mixes, in 1% agarose gel electrophoresis；If the numerous trapezoid-shaped strips differed in size occur, illustrate that testing sample contains house Silkworm silkworm seed microsporidian；If without the numerous trapezoid-shaped strips differed in size, illustrating that testing sample does not contains Eggs of Silkworm microsporidian；
(3) real-time fluorescence method: if having " S " type amplification curve and amplification value to exceed the threshold value that sets as positive, if amplification song The amplification value of line is then negative not less than the threshold value set.
Wherein, testing sample described in step S1, Eggs of Silkworm and silkworm the produced silkworm seed template of interpolation nosema bombycis The preparation method (the little extraction reagent kit of QIAGEN company plant) of DNA:
Take healthy Eggs of Silkworm or add silkworm the produced silkworm seed sample 10 of food nosema bombycis～50,12,000 Rpm, centrifugal 5 min, abandon supernatant；Then add 50～100 μ L ddH2O is resuspended；Draw resuspended spore liquid to the mortar of precooling In, liquid nitrogen is fully ground (more than 3 times)；Spore after grinding is put in 1.5 mL centrifuge tubes, add 400 μ L AP1 and 4 μ L Rnase, vortex mixes)；Solution after mixing, 65 DEG C, turn upside down during hatching 10 min(test tube 2～3 times)；Add 130 μ L AP2, ice bath 5 min after mixing；Then 14,000 rpm, centrifugal 5 min；Absorption supernatant collecting pipe in Filter column, 14, 000rpm, centrifugal 2min；Move to supernatant in centrifuge tube newly manage (residue not stirring appearance), add 1.5 times of volumes AP3/E, pipettor mixes；650 μ L mixed liquors are moved in silica gel adsorption column, 4200 rpm, centrifugal 1 min；Remaining liquid Repeat this step；Silica gel adsorption column is put in new collecting pipe.Add 500 μ L buffer AW, 4200 rpm, centrifugal 1 min； Abandon supernatant；Add 500 μ L AW, 14000 rpm, centrifugal 2 min；(ensureing that collecting pipe is not exposed to bottom supernatant)；Move and collect Pipe is in 1.5mL or 2mL centrifuge tube；Adding 40 μ L buffer AE wash-outs, room temperature places 5 min；4200 rpm, 1 min；Weight Multiple previous step；-20 DEG C of Refrigerator stores are standby.
Embodiment 4 applies kit to detect silkworm cause of disease microsporidian
1, variable concentrations positive reference substance detection
Utilize the detection method of embodiment 3, the positive control (recombinant plasmid Septin3-DNA-pMD) of variable concentrations is entered Row detection, result is as shown in accompanying drawing 4～6.In figure, M is DL2000 DNA Marker；1-7 is respectively dilution 106-100Copy/μ The recombinant plasmid Septin3-DNA-pMD of L；8 is ddH2O blank.
Result shows, the primer of the present invention and kit thereof can detect 103The recombinant plasmid Septin3-of copy/μ L DNA-pMD。
2, detection sensitivity
(1) utilize the detection method of embodiment 3, variable concentrations is infected the DNA of the produced silkworm seed of silkworm of microsporidian Detecting, result is as shown in accompanying drawing 7～9.In figure, M is DL2000 DNA Marker；1-7 is respectively as follows: 5.0 × 100 ng/μ L、5.0×10-1 ng/μL、5.0×10-2 ng/μL、5.0×10-3ng/μL、5.0×10-4 ng/μL、5.0×10-5ng/μL、 5.0×10-6ng/μL；8 is ddH2O blank.
Result shows, the primer of the present invention and kit thereof can detectable concentration be 5.0 × 10-3The infected silkworm of ng/ μ L Silkworm the produced silkworm seed DNA of microsporidian.
(2) utilize the detection method of embodiment 3, different grain numbers are added poison silkworm seed and detects, result such as accompanying drawing 10～12 Shown in.In figure, M is DL2000 DNA Marker；No. 1-4 pipe respectively add poison postoperative infection nosema bombycis silkworm produced Silkworm seed 1,5,10,20 DNA carried；5 for adding poison Eggs of Silkworm DNA；6 is normal Eggs of Silkworm DNA；7 are ddH2O blank.
Result shows, specifically and sensitivity is the most excellent, after adding poison for the primer of the present invention and kit detection thereof The DNA that the silkworm seed that the silkworm of infected silkworm microsporidian is produced is carried can the most special detect clearly.
In sum, the primer of the present invention and kit thereof more excellent to the detection sensitivity of Eggs of Silkworm microsporidian and The consuming time is shorter, and the quickly detection of pebrine disease in seed production is had great importance by this.
SEQUENCE LISTING
<110>Agricultural University Of South China
The LAMP detection primer of<120>one groups of Eggs of Silkworm microsporidians and kit
<130>
<160> 6
<170> PatentIn version 3.3
<210> 1
<211> 23
<212> DNA
<213>primer Sep3F3
<400> 1
acacatttag gaaaagtgct tta 23
<210> 2
<211> 21
<212> DNA
<213>primer Sep3B3
<400> 2
aatttgttac agaaggactc c 21
<210> 3
<211> 43
<212> DNA
<213>primer Sep3FIP
<400> 3
ctctcttatc acgttttcca tttcaaaggg aaaagagctc gga 43
<210> 4
<211> 43
<212> DNA
<213>primer Sep3BIP
<400> 4
tgaggatttg aaacgggaag aacataatac taccacccac cga 43
<210> 5
<211> 19
<212> DNA
<213>primer Sep3F
<400> 5
ttcggagtaa tagccagtg 19
<210> 6
<211> 21
<212> DNA
<213>primer Sep3R
<400> 6
aatttgttac agaaggactc c 21

Claims (8)

1. the LAMP detection primer group of one group of Eggs of Silkworm microsporidian, it is characterised in that described primer sets includes pair of outside Primer Sep3F3/Sep3B3 and pair of inside primer Sep3FIP/Sep3BIP, the nucleotide sequence of described primer is respectively such as SEQ Shown in ID NO:1～4.
2. the LAMP detection primer group of Eggs of Silkworm microsporidian described in claim 1 is preparing the detection of Eggs of Silkworm microsporidian Application in terms of kit.
3. an Eggs of Silkworm microsporidian LAMP detection kit, it is characterised in that include pair of outside primer Sep3F3/ Sep3B3 and pair of inside primer Sep3FIP/Sep3BIP, the nucleotide sequence of described primer is respectively such as SEQ ID NO:1～4 Shown in；Described kit also includes that 2 × reaction buffer, positive reference substance, negative controls, nitrite ion, Bst DNA are polymerized Enzyme, sealing fluid and sterilized water；
Described positive reference substance is Septin3-DNA-pMD recombinant plasmid；Described negative controls is normal silkworm DNA；
The preparation of described Septin3-DNA-pMD recombinant plasmid: utilize primer Sep3F and Sep3R, with nosema bombycis DNA Carrying out PCR amplification for template, extension amplification outcome enters pMD-19T carrier and obtains；
The nucleotide sequence of described primer Sep3F and Sep3R is as shown in SEQ ID NO:5～6.
Kit the most according to claim 3, it is characterised in that the component of described 2 × reaction buffer is as follows: 20mM Tris-HCl, pH8.8；10mM KCl；2 mM MgSO4；20mM(NH4)2SO4；0.1% Triton X-100；2.8mM dNTPs；1M glycine betaine；25mM MgCl2。
Kit the most according to claim 3, it is characterised in that described nitrite ion be 10000 × SYBR Green I or Fluorescence indicator 1 × SYBR Green I.
Kit the most according to claim 3, it is characterised in that described sealing fluid is glycerine.
7. according to the arbitrary described kit of claim 3～6, it is characterised in that the reaction system of described kit is as follows:
When the judgement of testing result uses decoration method or agarose gel electrophoresis method, reaction system is:
2 × reaction buffer 12.5 μ L
Primer Sep3F3/Sep3B3 and Sep3FIP/Sep3BIP 1 μ L
Bst DNA polymerase 8U/ μ L 1 μ L
Template DNA 2 μ L
ddH2O 8.5μL；
When the judgement of testing result uses real-time fluorescence method, reaction system is:
2 × reaction buffer 12.5 μ L
Primer Sep3F3/Sep3B3 and Sep3FIP/Sep3BIP 1 μ L
Bst DNA polymerase 8U/ μ L 1 μ L
Fluorescence indicator 0.5 μ L
Template DNA 2 μ L
ddH2O 8μL；
Wherein, the concentration of described primer Sep3F3/Sep3B3 is 5pmol/ μ L, and the concentration of primer Sep3FIP/Sep3BIP is 20 ～40pmol/ μ L.
8. according to the arbitrary described kit of claim 3～6, it is characterised in that the LAMP reaction condition of described kit is: 63 DEG C isothermal reaction 60 min；Then 95 DEG C, 2 min inactivations are placed.
CN201410592795.XA 2014-10-29 2014-10-29 The LAMP detection primer of one group of Eggs of Silkworm microsporidian and kit Active CN104372081B (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
CN201410592795.XA CN104372081B (en) 2014-10-29 2014-10-29 The LAMP detection primer of one group of Eggs of Silkworm microsporidian and kit
PCT/CN2015/088349 WO2016065983A1 (en) 2014-10-29 2015-08-28 Lamp detection primer set and reagent kit for silkworm egg microsporidium

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201410592795.XA CN104372081B (en) 2014-10-29 2014-10-29 The LAMP detection primer of one group of Eggs of Silkworm microsporidian and kit

Publications (2)

Publication Number Publication Date
CN104372081A CN104372081A (en) 2015-02-25
CN104372081B true CN104372081B (en) 2016-08-17

Family

ID=52551272

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201410592795.XA Active CN104372081B (en) 2014-10-29 2014-10-29 The LAMP detection primer of one group of Eggs of Silkworm microsporidian and kit

Country Status (2)

Country Link
CN (1) CN104372081B (en)
WO (1) WO2016065983A1 (en)

Families Citing this family (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104372081B (en) * 2014-10-29 2016-08-17 华南农业大学 The LAMP detection primer of one group of Eggs of Silkworm microsporidian and kit
CN105219875A (en) * 2015-11-04 2016-01-06 吉林出入境检验检疫局检验检疫技术中心 A kind of LAMP primer group for the identification of neospora and application thereof
CN105695566A (en) * 2015-11-06 2016-06-22 华南农业大学 LAMP primers for detecting silkworm egg microsporidia and rapid detection method
CN105755158A (en) * 2016-05-12 2016-07-13 福建农林大学 LAMP detection primer for Nosema ceranae and detection kit employing LAMP detection primer
CN108715905A (en) * 2018-06-01 2018-10-30 华南农业大学 The LAMP detection primer and kit of one group of mulberry mosaic dwarf disease
CN114277177B (en) * 2021-12-30 2023-05-16 广西壮族自治区蚕业技术推广站 Probe, kit and detection method for rapidly detecting microsporidian of silkworm
CN115628961B (en) * 2022-10-26 2024-09-10 山东大学 Microsporidian fluorescent staining marking method and application

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2009149166A2 (en) * 2008-06-03 2009-12-10 Children's Hospital Medical Center Methods and compositions for the diagnosis and treatment of proliferative disorders
CN102260737B (en) * 2011-05-30 2013-01-09 华南农业大学 Primers and application thereof in quick detection of nosema bombycis
CN103131773B (en) * 2013-01-24 2014-09-24 华南农业大学 LAMP visual rapid detection kit of silkworm pathogenic micro spore worms and detection method thereof
CN104017891B (en) * 2014-06-20 2015-05-20 华南农业大学 Application of septin1 gene to detection of nosema bombycis
CN104372081B (en) * 2014-10-29 2016-08-17 华南农业大学 The LAMP detection primer of one group of Eggs of Silkworm microsporidian and kit

Also Published As

Publication number Publication date
CN104372081A (en) 2015-02-25
WO2016065983A1 (en) 2016-05-06

Similar Documents

Publication Publication Date Title
CN104372081B (en) The LAMP detection primer of one group of Eggs of Silkworm microsporidian and kit
CN104017890B (en) The application in detection nosema bombycis of the EB1 gene
CN110093457A (en) A kind of African swine fever virus ASFV-LAMP detection primer group and kit
CN104017891B (en) Application of septin1 gene to detection of nosema bombycis
Liu et al. Rapid detection of P–35S and T-nos in genetically modified organisms by recombinase polymerase amplification combined with a lateral flow strip
CN104046700A (en) Detection kit for quickly identifying donkey skin, horse skin and mule skin
AU2020102244A4 (en) Primer group, kit and detection method for rapidly detecting carbapenemases genes
CN115029459A (en) Kit for visually detecting Pasteurella multocida based on CRISPR-Cas12a and application
CN104372082A (en) LAMP (loop-mediated isothermal amplification) detection primers for microsporidia in silkworm eggs and application thereof
CN105063229B (en) For detecting quantitative fluorescent PCR specific primer, probe and its kit of sheep derived material in meat products
Gou et al. The colorimetric isothermal multiple-self-matching-initiated amplification using cresol red for rapid and sensitive detection of porcine circovirus 3
CN105002295A (en) Polynucleotide, method and kit for detecting Bacillus anthraci
CN105671205B (en) Detect the RT-LAMP primer sets and kit of apis cerana metacercoid virus
CN107881254A (en) Loop-mediated isothermal amplification method detects the primer and its detection method of ramie mould bacterium
CN104031997A (en) LAMP (loop-mediated isothermal amplification) primer group for quickly detecting sporisorium scitamineum, kit and detection method thereof
CN103898225B (en) A kind of primer and discrimination method differentiating the hidden kind of Bemisia tabaci and trialeurodes vaporariorum
CN110144386A (en) For detecting the primer, probe and kit of POLE gene mutation
CN103014164B (en) Duplex fluorescent quantitation RT-PCR (Reverse Transcription-Polymerase Chain Reaction) detection kit for shellfish Bonamia and Perkinsus
CN106521038B (en) A kind of real-time fluorescence quantitative PCR detection methods of highly sensitive BHV 2 and kit
CN104962656A (en) TaqMan probe primer mixture, kit and fluorescent quantitative PCR detection method for quickly identifying bungarus multicinctus blyth
CN115873979A (en) Constant-temperature nucleic acid amplification RAA primer probe combination for detecting candida auricula and application thereof
CN108715905A (en) The LAMP detection primer and kit of one group of mulberry mosaic dwarf disease
CN105671144A (en) LAMP detection primers suitable for bombyx mori egg microsporidia and quick detection method thereof
CN106222293B (en) Fluorescence quantification PCR primer probe and kit and the method for detecting three kinds of bacillus
CN106399302A (en) Duplex fluorescent PCR method for efficiently detecting specific genes of transgenic soybean MON87701 strain and transgenic soybean MON87708 strain simultaneously

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant