WO2016065983A1

WO2016065983A1 - Lamp detection primer set and reagent kit for silkworm egg microsporidium

Info

Publication number: WO2016065983A1
Application number: PCT/CN2015/088349
Authority: WO
Inventors: 刘吉平; 程伟; 晏育伟; 宋小景; 杨思佳
Original assignee: 华南农业大学
Priority date: 2014-10-29
Filing date: 2015-08-28
Publication date: 2016-05-06
Also published as: CN104372081A; CN104372081B

Abstract

Provided in the present invention are a LAMP detection primer set and a reagent kit for a silkworm egg microsporidium. The primer set comprises outer primers Sep3F3/Sep3B3 and inner primers Sep3FIP/Sep3BIP, the sequences of which are as represented by SEQ ID NO: 1-4. The present invention also utilizes the primers in establishing a LAMP detection method and the reagent kit for the silkworm egg microsporidium. The reagent kit comprises the primer set, a 2x reaction buffer, a positive control, a negative control, a chromogenic solution (or a fluorescent staining solution), Bst DNA polymerase, a barrier fluid, and sterile water. A detection result can be visually observed with the naked eyes in natural light or observed with agarose gel electrophoresis or observed with real-time fluorescence curve for determination.

Description

A group of LAMP detection primers and kits for microsporidia

Technical field

The invention belongs to the field of biotechnology. More specifically, it relates to a group of LAMP detection primers and kits for the microsporidia of the silkworm, Bombyx mori.

Background technique

Bombyx mori disease is a devastating disease caused by pathogenic infection of Nosema bombycis (Nb) through infection or embryonic egg (fetal), which causes the infection of silkworm, and is also affecting the sustainable development of silk industry in China. Important epidemics, economic losses caused by microscopic disease every year are very heavy. At the same time, the wild insect microsporidia can cross-infect the silkworm, and can spread during the silkworm and between different silkworms, resulting in the scrapping of a large number of silkworm species, which seriously restricts the silkworm trade and the sustainable development of the silkworm industry. China has listed silkworm granule disease as a quarantine list for import and export animal quarantine. The silkworm owners' management departments and related production units in various regions have invested a large amount of manpower, material resources and financial resources. The traditional microscopic microscopic examination of the female moth and the elimination of the silkworm species produced by the poisonous female moth have been carried out to prevent and control the silkworm granule disease, but the effect is not good.

At first, it was determined whether silkworm larvae were infected with silkworm granules mainly according to the morphology and size of microsporidia in the microscopic tissue. This method also effectively curbed the prevalence of microsomal disease in silkworm areas around the world and saved the world. Sericulture. The detection of microsporidia in silkworm eggs is mainly through the acid treatment of silkworm eggs after 24 hours of spawning. After the eggs are hatched and collected, the microscope is used for microscopic examination. This method not only takes a lot of time, but also microscopic examination. The disadvantage is that the operator's skill and experience are high, and it is difficult to distinguish other spore analogs from the microsporidia spores of Bombyx mori. With the popularization of PCR technology, people began to use PCR methods to detect Bombyx mori, and achieved high sensitivity. The primers currently used for PCR detection of silkworm microparticle disease are mostly directed against the target gene SSUrRNA (Terry R S, Smith JE, Bouchon D, et al. Ultrastructural characterization and molecular taxonomy of Nosema granulosis sp.n., a transovarially transmitted, feminizing ( TTF)microsporidium.J.Eukaryot.Microbiol.1999,(46):492-499;Huang Wei-Fone,Tsai Shu-Jen,Lo Chu-Fang,et al.The novel organization and complete sequence of the ribosomal RNA gene of Nosema bombycis. Fungal Genetics and Biology, 2004. 41(5): 473-481). However, Liu Jiping (2004) (Liu Jiping, Cao Yang, Smith JE et al. PCR molecular diagnostic techniques for simulating infection of silkworm microparticle disease. Chinese Agricultural Sciences, 2004, 37 (12): 1925-1931) found that based on 16SrDNA conservation The primers designed in the segment were tested for microsporidia, and there were often non-target bands and false positive results. It is speculated that there may be some inhibitory substances in the silkworm eggs extract that interfere with the effective amplification of the genomic DNA of the pathogenic microsporidia. . Based on the sequencing results of the microsporidia transcriptome of Bombyx mori, the Septin3 gene of Bombyx mori was found by sequencing (accession number: KJ451482.1). The PCR primers designed to detect the septin3 gene were used to detect silkworms. There are no non-specific bands and false positive results for Microsporidia. But use this gene The designed PCR primers have low detection sensitivity for the microsporidia, and have many operation steps, which are not suitable for field detection, and are not suitable for widespread promotion and use in actual production. A larger problem is that the currently disclosed detection primers are based on the DNA of microsporidia, but the separation and collection of microsporidia are complicated, time consuming, and extremely unfavorable for large-scale detection or on-site detection.

On the other hand, microsporidia are parasitic in silkworm eggs, and the egg content of silkworm eggs is significantly higher than that of microsporidia to be detected. In the DNA samples obtained by extraction, both DNAs exist simultaneously, and the DNA of silkworm eggs is seriously detected. Interference, therefore, if you want to directly use the silkworm egg DNA as a template for microsporidia detection, put forward higher requirements for detection.

Summary of the invention

The technical problem to be solved by the present invention is to overcome the deficiencies of the existing technology for detecting the infection of the silkworm microsporidia in the silkworm eggs, and design the LAMP detection primers for detecting the microsporidia of the silkworm eggs by using the septin3 gene of the microsporidia of the silkworm, and provide a A simpler and faster detection method than the PCR detection method.

It is an object of the present invention to provide a set of LAMP detection primer sets for the microsporidia of the silkworm.

Another object of the invention is to provide the use of said LAMP detection primers.

Still another object of the present invention is to provide a method and kit for detecting a microsporidia of Bombyx mori established using the above-described LAMP detection primer set.

The above object of the present invention is achieved by the following technical solutions:

The present invention provides a set of LAMP detection primer sets of Microsporidium larvae, the primer set comprising a pair of lateral primers Sep3F3/Sep3B3 and a pair of inner primers Sep3FIP/Sep3BIP, the nucleotide sequences of the primers are respectively SEQ ID NO: 1 to 4.

The invention also provides the use of the LAMP detection primer set of the above-mentioned silkworm, Bombyx mori, in the preparation of a microsporidia detection kit for silkworm eggs.

The invention also provides a detection kit for the microsporidia LAMP of Bombyx mori, comprising a pair of outer primers Sep3F3/Sep3B3 and a pair of inner primers Sep3FIP/Sep3BIP, the nucleotide sequences of the primers are respectively SEQ ID NO: 1. ~4 is shown.

The kit further includes 2X reaction buffer, a positive control, a negative control, a chromogenic solution or a fluorescent staining solution, Bst DNA polymerase, a sealing solution, and sterile water.

Preferably, the components of the 2X reaction buffer are as follows: 20 mM Tris-HCl, pH 8.8; 10 mM KCl; 2 mM MgSO ₄ ; 20 mM (NH ₄ ) ₂ SO ₄ ; 0.1% Triton X-100; 2.8 mM dNTPs ; 1 M betaine; 25 mM MgCl ₂ .

Preferably, the positive control is a Septin3-DNA-pMD recombinant plasmid; the negative control is a normal home Silkworm DNA.

Preparation of the Septin3-DNA-pMD recombinant plasmid: using the primers Sep3F and Sep3R, PCR amplification of the microsporidia DNA of the silkworm, and amplification of the amplified product into the pMD-19T vector;

The nucleotide sequences of the primers Sep3F and Sep3R are shown in SEQ ID NOS: 5-6.

Preferably, the color developing solution is 10000×SYBR Green I or a fluorescent indicator 1×SYBR Green I.

Preferably, the sealing liquid is glycerin.

Preferably, the reaction system of the kit is as follows:

When the detection result is determined by staining or agarose gel electrophoresis, the reaction system is:

When the detection result is judged by real-time fluorescence, the reaction system is:

Wherein, the concentration of the primer Sep3F3/Sep3B3 is 5 pmol/μL, and the concentration of the primer Sep3FIP/Sep3BIP is 20-40 pmol/μL.

Recommendation: When using the kit, for N samples, a (N + 3) volume reaction system (including a negative control, a positive control, and a packing error) should be prepared to ensure uniform dispensing of each reaction tube.

Preferably, the LAMP reaction conditions of the kit are: 63 ° C constant temperature reaction for 60 min; then 95 ° C, placed for 2 min inactivation.

The method for detecting microsporidia of silkworm eggs by using the kit of the present invention comprises the following steps:

S1. Extracting template DNA of the sample to be tested;

S2. Disposition reaction system: configured according to the above reaction system;

S3. Loading: After the reaction system is packed, add ddH ₂ O (blank control), template DNA, positive control, and negative control to the reaction tube, respectively; then add 20 μL of sealing solution (for the staining result, Add 1 μL of the color developing solution to the inside of the reaction tube cap to tightly cover the tube cap, taking care to prevent the coloring solution from falling into the reaction solution);

S4. Reaction: For the detection of the staining method and the agarose gel electrophoresis determination result, the reaction tube is placed in a constant temperature water bath or other constant temperature equipment, and placed at a constant temperature of 63 ° C for 30 to 60 minutes, then 95 ° C, placed for 2 minutes to inactivate; For the detection of the real-time fluorescence determination result, the reaction tube is placed in a Deaou-308C constant temperature fluorescence detector or other fluorescence detector, and the observation result is kept at a constant temperature of 63 ° C for 00 min;

S5. Interpretation of results: The results can be judged by staining (chromogenic method), agarose gel electrophoresis and real-time fluorescence;

(1) Dyeing method: the coloring liquid on the inner side of the reaction tube cap is bombarded into the reaction tube and mixed with the reaction product; the color change is observed by naked eyes under natural light, and the color of the reaction product turns green, indicating that the sample to be tested contains the silkworm egg Microsporidia; the reaction product turns orange, and does not contain the microsporidia of the silkworm;

(2) Agarose gel electrophoresis: Take 1 μL of the reaction product, mix with 1 μL of 6×loading buffer and 8 μL of ddH ₂ O, and electrophores on 1% agarose gel; if there are many trapezoidal bands of different sizes, The sample to be tested contains the microsporidia of the silkworm, Bombyx mori; if there are many trapezoidal strips of different sizes, the sample to be tested does not contain the microsporidia of the silkworm;

(3) Real-time fluorescence method: If there is an "S" type amplification curve and the amplification value exceeds the set threshold value, it is negative if the amplification value of the amplification curve does not exceed the set threshold value.

The preparation of the microsporidia DNA template of the silkworm used in the positive control kit of the present invention is carried out by using the Qiagen plant mini-rabble kit according to the method. Specifically, the following steps are included:

S1. Take 200 μL of the microsporidium sample, centrifuge at 12,000 rpm for 5 min, discard the supernatant; then resuspend by adding 50-100 μL of ddH ₂ O;

S2. Aspirate the resuspended spore liquid into a pre-cooled mortar, and fully grind the liquid nitrogen (3 times or more);

S3. Place the spores after grinding into a 1.5 mL centrifuge tube, add 400 μL of lysis buffer AP1 and 4 μL of RNase A, and vortex to mix (400 μL of lysis buffer AP1 and 4 μL of RNase A should not be mixed before use);

S4. The mixed solution is incubated at 65 ° C for 10 min (during the test tube 2 to 3 times upside down);

S5. Add 130 μL of buffer P3, mix and ice bath for 5 min; then centrifuge at 14,000 rpm for 5 min;

S6. Aspirate the supernatant in a filter column, 14,000 rpm, and centrifuge for 2 min;

S7. Move the supernatant in the centrifuge tube to a new recovery tube (do not stir the residue), add 1.5 times the volume of buffer AW1, and mix the pipette;

S8. Move 650 μL of the mixed solution to a silica gel adsorption column, centrifuge at 4,200 rpm for 1 min; repeat the step for the remaining liquid;

S9. Put the silica gel adsorption column into a new collection tube, add 500 μL buffer AW, 4,200 rpm, centrifuge for 1 min; discard the supernatant;

S10. Add 500 μL buffer AW, 14,000 rpm, and centrifuge for 2 min (to ensure that the collection tube does not touch the bottom supernatant);

S11. Move the adsorption column to a 1.5 mL or 2 mL centrifuge tube;

S12. Add 40 μL of elution buffer AE, place at room temperature for 5 min; 4,200 rpm, 1 min;

S13. Step S12 is repeated, and the refrigerator is kept at -20 ° C for use.

Our previous study found that the PCR primers designed for the target sequence of the microsporidia septin3 gene (accession number: KJ451482.1) can be used to detect microsporidia, no non-specific bands and false positives. As a result, on the one hand, the designed PCR primers have many steps for detecting the microsporidia of the silkworm, and it takes a long time. On the other hand, we are not satisfied with the specificity and sensitivity of microsporidia detection.

Loop-mediated isothermal amplification (LAMP) is a novel technique for in vitro isothermal amplification of specific nucleic acid fragments invented by Japanese scholar Notomi et al. (2000). The LAMP method has the advantages of high specificity, rapidity, high efficiency, high sensitivity, simple operation, simple detection method, and the like, and the result can be judged by the naked eye, thereby simplifying the detection process and greatly shortening the detection time. Among them, primers are the most critical factor for the LAMP detection method. The selection of target gene sequences, the design and selection of primers directly affect the quality of the test results. Even for the same target gene sequence, how to select the appropriate six regions and design the appropriate four primer sequences is very important and very significant for detection sensitivity. In the early stage, the inventors designed a series of multiple sets of LAMP primers, and considered various factors and combined with the judgment of the experimental results to screen out three sets of LAMP primers. Further, the inventors finally determined the optimal four specific primers, namely four specific primers of primer set III as a primer set for LAMP detection.

The four primer sequences of the primer set III are:

Sep3F3 (SEQ ID NO: 1): 5'-ACACATTTAGGAAAAGTGCTTTA-3'

Sep3B3 (shown in SEQ ID NO: 2): 5'-AATTTGTTACAGAAGGACTCC-3'

Sep3FIP (F1c+F2) (SEQ ID NO: 3):

5'-CTCTCTTATCACGTTTTCCATTTCA-AAGGGAAAAGAGCTCGGA-3'

Sep3BIP (B1c+B2) (SEQ ID NO: 4):

5'-TGAGGATTTGAAACGGGAAGAACAT-AATACTACCACCCACCGA-3'

Therefore, the above-mentioned LAMP detection primer set for microsporidia detection is obtained by the present inventors on the basis of obtaining the septin3 gene of the microsporidia of the silkworm, and has been obtained through extensive exploration and research, which not only overcomes the complexity of ordinary PCR operation, but also relies on expensive. The defects of the instrument, more importantly, the biggest innovations of the present invention are: 1) Compared with the ordinary PCR method, the invention is short in time, the detection result is easier to judge; 2) the method relative to the existing LAMP is applied to the micro Primers used for the detection of sporozoans, the primers used in this method directly use the silkworm egg DNA as a template, which not only overcomes the interference caused by the silkworm egg DNA, but also makes the detection result more reliable and the sensitivity is very good. In short, the method is simple to operate and detect It takes a short time, is easy to judge, and has strong specificity. It can detect 1 silkworm egg infected with silkworm microbe disease.

The invention has the following beneficial effects:

The invention discloses a group of LAMP primers for detecting microsporidia of Bombyx mori. The Sep3F/3R primer is designed by using the septin3 gene sequence as a target gene, and the PCR primer is used to verify the specificity of the target gene, and the result indicates that the primer has specificity. Using this primer as a reference, the septin3 gene was designed as a target gene to design multiple sets of LAMP primers. Three groups of LAMP primers were screened according to the design principle of LAMP primers and the amplified sequence positions of each set of primers, and then further screened according to the validity of the primers. A set of four specific primers were used as primers for LAMP detection, namely the outer primer Sep3F3/Sep3B3 and the inner primer Sep3FIP/Sep3BIP; and amplification was performed only when only four specific primers fully recognized the six regions of the target gene. Therefore, it ensures the specificity and detection of the specificity and detection of the speptin3 gene of Bombyx mori.

The invention utilizes the LAMP primer set to further establish a rapid detection method and a kit for microsporidia LAMP, and comprises four LAMP primers, a LAMP reagent, a color developing solution or a fluorescent staining liquid, etc., to form a detection reaction system, and the constant temperature condition at 63 ° C The rapid amplification of the template DNA can detect the silkworm egg DNA produced by the silkworm infected with Bombyx mori, which is 5.0×10 ^-3 ng/μL, and can detect ¹⁰³ copies/μL of the recombinant plasmid Septin3-DNA-pMD. When one of the silkworm eggs produced by the silkworm, which is infected with the microsporidia of the silkworm, is detected, it can be detected. The detection sensitivity of microsporidia has increased by an order of magnitude, which is of great significance for the detection of microsporidia.

More importantly, the microsporidium samples are parasitic in the silkworm eggs, and the silkworm egg content is significantly higher than the microsporidia to be detected. In the extracted DNA samples, both DNAs exist simultaneously, which raises the detection higher. Claim. Therefore, the biggest innovation of the present invention is that microsporidia detection is carried out directly on the silkworm egg DNA produced by the silkworm infected with the microsporidia of the silkworm, and the complicated time-consuming steps of microsporidia separation are eliminated. The primers used in the method not only avoid the interference caused by the DNA detection of the silkworm silkworm eggs, but also make the detection result more reliable and the detection sensitivity is very good.

The invention adopts the LAMP technology and adopts constant temperature amplification, and does not need to amplify a complicated and expensive amplification instrument like a PCR instrument. The invention optimizes the reaction system, and the whole reaction can be completed within 30 to 60 minutes, which greatly shortens the detection time. The human and material cost of microsporidia detection is further reduced.

The detection method of the invention has multiple choices for the determination of the detection result, and is easy to observe and judge: (1) color development method: adding a color developing liquid to the reaction product, and visually observing the color reaction, and can be visually observed under natural light. Detection results; (2) agarose gel electrophoresis: according to the electrophoresis strips, the reaction results can be observed more intuitively, and more convincing, the false positive test results can also be easily eliminated, but the cover before the electrophoresis operation The sample loading should be carried out in different rooms with the configuration reaction system to reduce the unnecessary contamination of the subsequent experiments after opening the cover; (3) Real-time fluorescence method, the result can be judged intuitively through the amplification curve, and for the sample with high concentration The result can be judged early, reducing unnecessary time wastage, but the instrument is more expensive and can be used by laboratories or companies with sufficient funds.

In summary, the rapid detection method of the LAMP of the silkworm pathogenic microsporidia of the present invention is simple in operation, short in time, does not require complicated instruments and complicated amplification procedures, and the interference of impurities on the amplification is small and reacts. The results are easy to judge and have strong specificity. It provides an important basis and technical reserve for the detection of microsporidia of silkworm eggs and the quality of silkworms by using LAMP technology. It is not only suitable for on-site or field testing, but also widely promoted in actual production. It can also better meet the needs of scientific research institutions, silkworm production units and silkworm quality inspection centers, and is easy to promote and apply in a wide range.

DRAWINGS

Figure 1 is an electrophoresis pattern of two PCR primers for detecting healthy silkworm eggs and infected silkworm eggs, M: DL 2000 DNA Marker; 1: Adding DNA to silkworm eggs; 2: Microsporidium DNA of silkworm; 3: DNA of normal silkworm eggs ; 4: ddH ₂ O.

Figure 2 is a schematic representation of the position of a common PCR primer and the three selected LAMP primer sets of the present invention on the septin3 gene.

Figure 3 is a schematic representation of the position of four LAMP primers of the present invention on a target gene sequence.

Fig. 4 is a graph showing the results of detection of different concentrations of positive control (recombinant plasmid Septin3-DNA-pMD) by the rapid detection method of the microsporidia LAMP of the silkworm, Bombyx mori L. (the result of agarose gel electrophoresis).

Fig. 5 is a diagram showing the results of detection of different concentrations of positive control (recombinant plasmid Septin3-DNA-pMD) by the rapid detection method of the microsporidia LAMP of the silkworm, Bombyx mori L. (color detection method).

Fig. 6 shows the results of detection of different concentrations of positive control (recombinant plasmid Septin3-DNA-pMD) by the rapid detection method of the microsporidia LAMP of the silkworm, Bombyx mori L. (real-time fluorescence detection results).

Fig. 7 is a graph showing the sensitivity of the rapid detection of the microsporidia LAMP of the silkworm eggs of the silkworm eggs of the silkworm eggs of the silkworm eggs of different concentrations of the silkworm eggs of the silkworm (the results of agarose gel electrophoresis).

Fig. 8 is a graph showing the sensitivity results of the silkworm egg DNA produced by the silkworm larvae of the silkworm, Bombyx mori L., by the rapid detection method of the microsporidia of the silkworm, Bombyx mori L. (color detection method).

Fig. 9 is a graph showing the sensitivity of the rapid detection of the microsporidia LAMP of the silkworm eggs of the silkworm eggs of the silkworm eggs of the silkworm eggs of different concentrations of the silkworm eggs of the silkworm (the real-time fluorescence detection results).

Fig. 10 is a view showing the detection result of the microparticles of the larvae of the larvae of the larvae of the silkworm, the larvae of the larvae of the larvae of the larvae of the larvae of the larvae of the larvae of the larvae of the larvae of the larvae of the larvae of the larvae of the larvae of the larvae of the larva

Fig. 11 is a view showing the detection result of the granule-added silkworm eggs of different numbers of microsporidia LAMP in the silkworm larvae of the present invention (the color detection method).

Fig. 12 is a diagram showing the detection result of the microparticles of the microsporidia LAMP visualized rapid detection kit of the silkworm, Bombyx mori, in the detection of different number of eggs on the silkworm eggs (real-time fluorescence detection results).

detailed description

The invention is further described in the following with reference to the drawings and specific examples, but the examples are not intended to limit the invention. Unless otherwise indicated, the reagents, methods, and devices employed in the present invention are routine reagents, methods, and devices in the art.

Unless otherwise stated, the reagents and materials used in the present invention are commercially available.

Example 1 Primer Design

1. According to the sequence of the septin3 gene (Accession number: KJ451482.1) of the microsporidia of the silkworm, which was verified by the transcriptome sequencing method and by the cloning and sequencing method, the homology analysis was carried out by BLAST software, and it was found that there is no similarity sequence. The invention designed a set of PCR primers using the gene as a target gene: the primer Sep3F/Sep3R.

The sequence of the primer Sep3F (shown in SEQ ID NO: 5) is:

5'TTCGGAGTAATAGCCAGTG 3'

The sequence of the primer Sep3R (shown in SEQ ID NO: 6) is:

5'-AATTTGTTACAGAAGGACTCC-3'

2. Using the above PCR primers to detect healthy silkworm eggs and silkworm eggs infected with Bombyx mori, the results showed that the primers were specific for the detection of microsporidia of silkworm eggs (as shown in Figure 1).

Therefore, based on the PCR primers, the position of the fragment was amplified, and the target gene designed with the septin3 gene as the LAMP primer was used to design multiple sets of LAMP primers using the online software Primer ExplorerV4 (http://primerexplorer.jp/elamp4.0.0/index.htmL). Three sets of LAMP primers, namely primer set I, primer set II and primer set III, were screened according to the design principle of LAMP primers and the positions of amplified sequences of each set of primers.

(1) Primer group I Four primer sequences are:

1F3: AGAACAAGGACCTTATCGTATT

1B3: TGAGGAGTAAAACAAGAGATGTT

1FIP: TGTGACACTTTTTGCATTGTTTCAA-ATCGTGTTCATGTTTGTCTC

1BIP: TCCCATAATTTCAAAAGCTGACATG-TTGATTTCAGATTTACGAGAACT

(2) Primer Group II Four primer sequences are:

2F3: CGGAGTAATAGCCAGTGAA

2B3: CGAGCTCTTTTCCCTTTC

2FIP: TGTTTATAAATCCCCAAGGATAC-CAGTTTTTGATTATGAAGGAGAG

2BIP: TACTCGCATCTTGATGATTTG-GCACTTTTCCTAAATGTGTT

(3) Primer III Four primer sequences are:

Sep3F3 (SEQ ID NO: 1): 5'-ACACATTTAGGAAAAGTGCTTTA-3'

Sep3B3 (shown in SEQ ID NO: 2): 5'-AATTTGTTACAGAAGGACTCC-3'

Sep3FIP (F1c+F2) (SEQ ID NO: 3):

5'-CTCTCTTATCACGTTTTCCATTTCA-AAGGGAAAAGAGCTCGGA-3'

Sep3BIP (B1c+B2) (SEQ ID NO: 4):

5'-TGAGGATTTGAAACGGGAAGAACAT-AATACTACCACCCACCGA-3'

The position of the above common PCR primers and the three groups of LAMP primer sets selected by the present invention on the septin3 gene are shown in Fig. 2.

3. According to the validity experiment of the primers, and considering various factors and combining the judgment of the experimental results, four primers of primer group III are further screened as primers for detecting LAMP, and the position of the primer group on the target gene sequence is further selected. The schematic is shown in Figure 3.

Example 2 Kit Preparation

1. Preparation of the DNA template of the microsporidia of the silkworm, using the QIAGEN plant small kit, the method is carried out according to the instructions. Specifically, the following steps are included:

S11. Move the adsorption column to a 1.5 mL or 2 mL centrifuge tube;

S13. Step S12 is repeated, and the refrigerator is kept at -20 ° C for use.

2. Preparation of positive and negative controls

Using the upstream primer Sep3F and the downstream primer Sep3R as reaction primers, PCR was carried out using the DNA of Bombyx mori The amplified product was cloned into the pMD-19T vector to obtain the Septin3-DNA-pMD plasmid and used as a positive control for the detection.

The extracted normal silkworm DNA was used as a negative control.

3, other reagents

(1) 2× reaction buffer

The components were as follows: 20 mM Tris-HCl, pH 8.8; 10 mM KCl; 2 mM MgSO ₄ ; 20 mM (NH ₄ ) ₂ SO ₄ ; 0.1% Triton X-100; 2.8 mM dNTPs; 1 M betaine; 25 mM MgCl ₂ .

(2) Coloring solution 10000×SYBR Green I (or fluorescent indicator 1×SYBR Green I), Bst DNA polymerase, sealing liquid glycerin and sterile water.

4, kit assembly

According to a certain specification, the following components were subpacked: the primer set Sep3F3/Sep3B3 was used as the external primer and Sep3FIP/Sep3BIP was used as the internal primer (Sep3F3/Sep3B3 concentration was 5 pmol/μL, and Sep3FIP/Sep3BIP concentration was 20-40 pmol/ μL), 2× reaction buffer, positive control, negative control, Bst DNA polymerase (8 U/μL), sealing solution, color developing solution (10000×SYBR Green I); fluorescent indicator (1×SYBR Green I) ; Sterilize ddH ₂ O. It is the detection reagent for the LAMP rapid detection kit for the microsporidia of Bombyx mori.

Example 3 Kit detection method

1. The LAMP reaction condition of the kit is: constant temperature reaction at 63 ° C for 30 to 60 min; then 95 ° C, placed for 2 min inactivation.

2. When the detection result is determined by staining or agarose gel electrophoresis, the reaction system of the kit is:

3. The detection steps are as follows:

S1. Extracting template DNA of the sample to be tested;

S3. Loading: After the reaction system is packed, add 2 μL of ddH ₂ O (blank control), each template DNA, and a positive control to the reaction tube, respectively; then add 20 μL of sealing solution (for the staining method, the result is Add 1 μL of the color developing solution to the inside of the reaction tube cap to tightly cover the tube cover (be careful to prevent the coloring solution from falling into the reaction solution);

S4. Reaction: For the detection of the staining method and the agarose gel electrophoresis determination result, the reaction tube is placed in a constant temperature water bath or other constant temperature equipment, and placed at a constant temperature of 63 ° C for 30 to 60 minutes, then 95 ° C, placed for 2 minutes to inactivate; For the detection of the real-time fluorescence determination result, the reaction tube is placed in a Deaou-308C constant temperature fluorescence detector or other fluorescence detector, and the observation result is kept at a constant temperature of 63 ° C for 30 to 60 minutes;

Wherein, the sample to be tested in the step S1, the silkworm egg and the silkworm egglet DNA of the silkworm added with the microsporidia of the silkworm (QIAGEN plant small kit):

Take 10 to 50 samples of silkworm eggs from silkworm eggs of silkworms or silkworms feeding on silkworms, 12,000 rpm, centrifuge for 5 min, discard the supernatant; then resuspend 50-100 μL ddH ₂ O; Spore liquid into the pre-cooled mortar, fully grind liquid nitrogen (more than 3 times); put the spores after grinding into a 1.5mL centrifuge tube, add 400μL AP1 and 4μL Rnase, vortex to mix); mixed solution Incubate at 65 ° C for 10 min (invert the tube 2 to 3 times); add 130 μL of AP2, mix and ice bath for 5 min; then centrifuge at 54,000 rpm for 5 min; pipette the supernatant into the filter column, centrifuge at 14,000 rpm for 2 min. The supernatant in the centrifuge tube was moved to a new tube (do not agitate the residue), 1.5 times the volume of AP3/E was added, and the pipette was mixed; 650 μL of the mixture was transferred to a silica gel adsorption column, and centrifuged at 4200 rpm for 1 min; Repeat this step for the remaining liquid; place the silica column into the new collection tube. Add 500 μL buffer AW, 4200 rpm, centrifuge for 1 min; discard the supernatant; add 500 μL AW, 14000 rpm, centrifuge for 2 min; (make sure the collection tube does not touch the bottom supernatant); transfer the collection tube to a 1.5 mL or 2 mL centrifuge tube; add 40 μL Buffer AE elution, room temperature for 5 min; 4200 rpm, 1 min; repeat the previous step; -20 ° C refrigerator for later use.

Example 4 Application of a kit for detection of Bombyx mori

1, different concentrations of positive control products

Using the detection method of Example 3, different concentrations of the positive control (recombinant plasmid Septin3-DNA-pMD) were examined, and the results are shown in Figures 4-6. In the figure, M is DL2000 DNA Marker; 1-7 is a recombinant plasmid Septin3-DNA-pMD diluted 10 ⁶ - 10 ⁰ copies/μL; 8 is a ddH ₂ O blank control.

The results show that the primer of the present invention and the kit thereof are capable of detecting 10 ³ copies/μL of the recombinant plasmid Septin3-DNA-pMD.

2, detection sensitivity

(1) Using the detection method of Example 3, DNA of silkworm eggs produced by silkworms infected with different concentrations of Microsporidium was detected, and the results are shown in Figs. In the figure, M is DL2000 DNA Marker; 1-7 is: 5.0 × 10 ⁰ ng / μL, 5.0 × 10 ^-1 ng / μL, 5.0 × 10 ^-2 ng / μL, 5.0 × 10 ^-3 ng / μL, 5.0 ×10 ^-4 ng/μL, 5.0 × 10 ^-5 ng/μL, 5.0 × 10 ^-6 ng/μL; 8 is a ddH ₂ O blank control.

As a result, the primer of the present invention and the kit thereof were capable of detecting the silkworm egg DNA of the silkworm infected with the microsporidia of Bombyx mori at a concentration of 5.0 × 10 ^-3 ng / μL.

(2) Using the detection method of Example 3, the eggs of different numbers of eggs were detected, and the results are shown in Figs. In the figure, M is DL2000DNA Marker; the No. 1-4 tube is a silkworm egg produced by the silkworm infected with the microsporidia of Bombyx mori, which is infected with 5, 10, 20, and the DNA extracted; Silkworm egg DNA; 6 is normal silkworm egg DNA; 7 is ddH ₂ O blank control.

The results show that the primers and the kits of the invention have excellent detection specificity and sensitivity, and the DNA of a silkworm egg produced by the silkworm infected with the microsporidia of the silkworm after the poisoning can be detected very specifically and clearly. come out.

In summary, the primers and the kits of the invention have excellent detection sensitivity and short time for the microsporidia of the silkworm, and are of great significance for rapid detection of the silkworm microbial disease in the original production.

Claims

A set of LAMP detection primers for the microsporidia of the silkworm, Bombyx mori, characterized in that the primer set comprises a pair of outer primers Sep3F3/Sep3B3 and a pair of inner primers Sep3FIP/Sep3BIP, and the nucleotide sequences of the primers are respectively SEQ ID NO: 1 to 4.
The use of the LAMP detection primer set of the microsporidia of the silkworm, Bombyx mori, according to claim 1, for the preparation of a microsporidia detection kit for silkworm eggs.
A kit for detecting a microsporidia LAMP of Bombyx mori, characterized in that it comprises a pair of outer primers Sep3F3/Sep3B3 and a pair of inner primers Sep3FIP/Sep3BIP, and the nucleotide sequences of the primers are respectively SEQ ID NO: 1 - 4 is shown.
The kit according to claim 3, characterized in that the kit further comprises 2 x reaction buffer, a positive control, a negative control, a chromogenic solution or a fluorescent staining solution, Bst DNA polymerase, a sealing solution and no Bacterial water.
The kit according to claim 4, wherein the components of the 2X reaction buffer are as follows: 20 mM Tris-HCl, pH 8.8; 10 mM KCl; 2 mM MgSO 4 ; 20 mM ( NH 4 ) 2 SO 4 ; 0.1% Triton X-100; 2.8 mM dNTPs; 1 M betaine; 25 mM MgCl 2 .
The kit according to claim 4, wherein the positive control product is a Septin3-DNA-pMD recombinant plasmid; and the negative control product is a normal silkworm DNA;

Preparation of the Septin3-DNA-pMD recombinant plasmid: using the primers Sep3F and Sep3R, PCR amplification of the microsporidia DNA of the silkworm, and amplification of the amplified product into the pMD-19T vector;

The nucleotide sequences of the primers Sep3F and Sep3R are shown in SEQ ID NOS: 5-6.
The kit according to claim 4, wherein the color developing solution is 10000 x SYBR Green I or a fluorescent indicator 1 x SYBR Green I.
The kit according to claim 4, wherein said sealing liquid is glycerin.
The kit according to any one of claims 3 to 8, wherein the reaction system of the kit is as follows:

When the detection result is determined by staining or agarose gel electrophoresis, the reaction system is:

When the detection result is judged by real-time fluorescence, the reaction system is:

Wherein, the concentration of the primer Sep3F3/Sep3B3 is 5 pmol/μL, and the concentration of the primer Sep3FIP/Sep3BIP is 20-40 pmol/μL.
The kit according to any one of claims 3 to 8, characterized in that the LAMP reaction condition of the kit is: constant temperature reaction at 63 ° C for 60 min; then inoculation at 95 ° C for 2 min.