CN104962656A - TaqMan probe primer mixture, kit and fluorescent quantitative PCR detection method for quickly identifying bungarus multicinctus blyth - Google Patents

TaqMan probe primer mixture, kit and fluorescent quantitative PCR detection method for quickly identifying bungarus multicinctus blyth Download PDF

Info

Publication number
CN104962656A
CN104962656A CN201510458976.8A CN201510458976A CN104962656A CN 104962656 A CN104962656 A CN 104962656A CN 201510458976 A CN201510458976 A CN 201510458976A CN 104962656 A CN104962656 A CN 104962656A
Authority
CN
China
Prior art keywords
snake
probe
dna
mone
primer
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201510458976.8A
Other languages
Chinese (zh)
Inventor
步迅
刘艳艳
张全芳
卞如如
陈杰
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Biotechnology Research Center of Shandong Academy of Agricultural Sciences
Original Assignee
Biotechnology Research Center of Shandong Academy of Agricultural Sciences
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Biotechnology Research Center of Shandong Academy of Agricultural Sciences filed Critical Biotechnology Research Center of Shandong Academy of Agricultural Sciences
Priority to CN201510458976.8A priority Critical patent/CN104962656A/en
Publication of CN104962656A publication Critical patent/CN104962656A/en
Pending legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • C12Q1/6851Quantitative amplification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/16Primer sets for multiplex assays
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/166Oligonucleotides used as internal standards, controls or normalisation probes

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention provides a TaqMan probe primer mixture, a kit and a qPCR detection method for quickly identifying bungarus multicinctus blyth and counterfeits thereof as well as application. Mitochondrion DNA (mtDNA) has the advantages of high sensitivity, good accuracy, high speed, low degradability, stability, easiness in operation and the like and thus serves as a target gene; a competitive positive internal amplification control is artificially synthesized, a specific probe is added into the system and shares a pair of primers with the target gene, thus false negative can be effectively indicated; double multicolor fluorescent quantitative PCR refers to detection in the same tube, has the beneficial effects of accuracy and stability, easiness in operation, remarkably high sensitivity, high specificity, large flux and the like, and is especially applicable to the identification of traditional Chinese medicines with low DNA content and high degradability caused by processing, so that a new way is explored for identifying the animal-derived ingredients in food and drugs.

Description

The TaqMan probe primer mixture of a kind of quick discriminating mone snake, test kit and fluorescent quantitative PCR detection method
Technical field
The present invention relates to rare Chinese herbal medicine cultivar identification technical field, particularly relate to a kind of method differentiating mone snake, be specially a kind of TaqMan probe primer mixture of the quick discriminating mone snake true and false, test kit and fluorescent quantitative PCR detection method.
Background technology
A kind of conventional Chinese medicine that mone snake is recorded for " Chinese Pharmacopoeia " version one in 2010, derive from the snakelet dry body of Elapidae animal mone snake (Bungarus multicinctus Blyth), in the form of annular discs, dish footpath 3-6cm, snake body diameter 0.2-0.4cm, the micro-raw meat of gas, taste is micro-salty.Mone snake have dispel the wind, effect of dredging collateral, only convulsion, be mainly used in treating rheumatoid arthritis stubborn, numbness contracture, apoplexy facial hemiparalysis, hemiplegia, tic spasm, tetanus, leprosy mange, scrofula dislikes the diseases such as sore.Along with the deterioration of ecotope, animal medicinal material resource sharply reduces, because medicine source is nervous, mone snake in recent years price amount of increase is very large.Under interests are ordered about, market mone snake adulterant gets more and more, and is generally the personation such as Erythema Snake, japanning Enhydris plumbea (Boie)., especially differentiates quite difficulty in these adulterant forms of snakelet stage, and be only difficult to differentiate exactly according to morphological specificity.Traditional identification mone snake true and false method is that accuracy rate is very low by observing phenotype, effective in order to ensure safety of medicine, finds a simple and quick authentication method exactly to seem particularly important.
People are to the Study on Identification of mone snake in recent years, develop into scale discriminating, microscopical identification, physics and chemistry discriminating, biology techniques discriminating from traditional character identification, especially PCR method differentiates snake veriety, accuracy is high, favorable reproducibility, with proterties, micro-, physics and chemistry is differentiated to compare, having incomparable superiority, is also one of state-of-the-art technique means differentiating the mone snake true and false.Many scholars utilize Protocols in Molecular Biology means to mone snake real and fake discrimination: Wang Yiquan, Feng Chengqiang etc. are based on coral snake Cytb sequence, the PCR reaction of design qualification mone snake and special primer, although patent of invention CN101613759A is different with the PCR method that CN104120182A reports and special primer PCR primer length, but all detect in conjunction with agarose gel electrophoresis based on regular-PCR, operate comparatively loaded down with trivial details, the requirement of mixed adulterant Rapid identification can not be met.Patent CN104164492A is foundation sequence difference and produces specific restriction enzyme to cut site, thus causes the change of endonuclease bamhi length or the increase and decrease of number of fragments, identifies.Because DNA sample amount needed for the method is comparatively large, higher to the specification of quality of DNA, also need specific Restriction Enzyme, operate more loaded down with trivial details, limit its widespread use.One section of sequence (door, order, kind) in the different categorization levels of animal kingdom that Herbert in 2003 etc. choose Mitochondrial cytochrome c oxidase subunit I is analyzed, find that this gene all has good insight in that categorization levels, thus propose to set up the barcode recognition method based on COI gene order that a segment length is 650bp.But DNA bar code technology needs to carry out gene sequencing to species sequence, operating process is loaded down with trivial details, and the cycle is longer.
Technology based on polymerase chain reaction (PCR) progressively becomes the core methed of animal derived materials Species estimation in food and medicine.The develop rapidly of TaqMan probe real-time fluorescence PCR technology in recent years substantially increases the sensitivity of detection, specificity and accuracy, and make quantitatively tracing to the source of component content become possibility, because the whole testing process of fluorescent quantitation is stopped pipe operation, so effectively decrease the danger of the pollution in experimentation, be widely used in every field.But do not have at present any open or report a kind of method utilizing TaqMan probe primer mixture, test kit and fluorescent quantitative PCR detection method to differentiate mone snake source property fast.Therefore, the practice significance that the quick supervision to rare Chinese medicine and Chinese herbal product safety of the TaqMan probe primer mixture of a kind of quick discriminating mone snake and adulterant thereof, test kit and fluorescent quantitative PCR detection method has important novelty is set up.
Summary of the invention:
For overcoming deficiency of the prior art, the invention provides a kind of method differentiating mone snake, being specially a kind of TaqMan probe primer mixture of the quick discriminating mone snake true and false, test kit and fluorescent quantitative PCR detection method.
An object of the present invention is to provide a kind of pcr amplification primer of the mone snake animal derived materials that simultaneously increases, TaqMan probe and pcr amplification condition.
Two of the object of the invention is to provide a kind of real-time fluorescence PCR qualitative checking method simultaneously differentiating mone snake animal derived materials.
Be achieved through the following technical solutions for achieving the above object:
For differentiating a TaqMan probe Primer composition for mone snake, comprise 1 pair of Auele Specific Primer and 1 pair of specific probe:
Bmvp-COIF1 upstream primer: 5'CTGGTCTAATCGGAGCCTGT 3';
Bmvp-COIR1 downstream primer: 5'ATAAATGCGTGGGCAGTAAC 3'; As shown in SEQ ID NO.2,3;
The nucleotide sequence of described specific probe is as follows:
5'AGAGTTAACCCAACCCGGCTCGCTTTTA3', as shown in SEQ ID NO.4;
The 5' of probe is terminal modified FAM fluorophor, and 3' is terminal modified BHQ2 quencher;
Be: Bmv-COIP:5'FAM-AGAGTTAACCCAACCCGGCTCGCTTTTA-BHQ23'.
For differentiating a TaqMan probe Primer composition for mone snake, also comprise interior mark specific probe, the nucleotide sequence of this specific probe is as follows:
5'-TGACGCTAGTAGGCAAGTACGCTCCATT-3'; As shown in SEQ ID NO.6;
The 5' of this probe is terminal modified JOE fluorophor, and 3' is terminal modified BHQ2 quencher;
Be: IMP:5'JOE-TGACGCTAGTAGGCAAGTACGCTCCATT-BHQ23'.
For differentiating a test kit for mone snake, comprise TaqMan probe Primer composition described above and the necessary reagent of pcr amplification.
Test kit for differentiating mone snake according to claim 3, also comprise exogenous interior mark DNA fragmentation, its nucleotide sequence is as follows:
5'CTGGTCTAATCGGAGCCTGTATGGAGCACGCCGTAAGCTTAACCTGACGCTAGT AGGCAAGTACGCTCCATTGGTGACCTCGTTACTGCCCACGCATTTAT3'; As shown in SEQ ID NO.5.
For differentiating a test kit for mone snake, the necessary reagent of described pcr amplification comprises PCR damping fluid, MgCl2, dNTPs, Taq enzyme and ultrapure water.
Differentiate a fluorescent quantitative PCR detection method for mone snake, use above-mentioned TaqMan probe Primer composition or test kit differentiating the application in the mone snake goods true and false.
A kind of fluorescent quantitative PCR detection method differentiating mone snake, discrimination method is: get mone snake product sample, extract genomic dna, Auele Specific Primer is utilized to increase, detect fluorescent signal, if the blank of carrying out at the same time, in the normal situation of positive control experiment result, detected sample should have corresponding fluorescent signal to detect, and there is obvious amplification curve in corresponding fluorescence channel, Ct value <35, illustrate that DNA extraction is effective, mone snake specific probe signal (Bmvp) and interior mark Quality Control (IMP) are all detected, Ct value <35, then be judged to the positive, if only have interior mark Quality Control (IMP) to be all detected, mone snake FAM specific probe does not detect, then be judged to be adulterant.
Differentiate a fluorescent quantitative PCR detection method for mone snake, described PCR amplification system is: pH value is 8.9, and magnesium ion concentration is 2.5mM, and the final concentration of 4 kinds of dNTP is respectively 250 μMs, and the consumption of Taq enzyme is 1U, and the concentration of upstream and downstream primer is respectively 0.4-1 μM; The concentration of specific probe and interior mark specific probe is respectively 0.4-1 μM, and the concentration of interior mark DNA is 1pg/ μ l.Differentiate a fluorescent quantitative PCR detection method for mone snake, the condition of described pcr amplification is: 95 DEG C of 10min, 95 DEG C of 10s, 63 DEG C of 35s, collects fluorescent signal, 45 circulations.
The program is specially:
(1) the present invention is in design of primers, be target gene (as shown in SEQ ID NO.1) based on DNA bar code choice of technology cytochrome C gene, search at Genbank and download snake chondrioid COI gene order (GeneBank accession number is KF698926.1, JF700190.1, KF698937.1, KF698948.1, KF698944.1, JX233650.1, JN833612.1, JX233641.1, JX233637.1), by Mega5 analysis software comparison mone snake and common adulterant poisonless snake, Gold-banded Krait, Naja, Serpentis, yellow chain snake, Enhydris plumbea (Boie)., water snake and wolf snake COI gene homology of enjoying a double blessing, design Auele Specific Primer (as shown in SEQ ID NO.2 and SEQ ID NO.3) and TaqMan probe (as shown in SEQID NO.4), comparison result is shown in Fig. 1, wherein this primer amplified fragment length is 115bp.
(2) design construction contains the recombinant plasmid of mark DNA in positive amplification, and design corresponding TaqMan probe (as shown in SEQID NO.5), its method is: use DNA stochastic generation software to produce section of DNA sequence, make it in NCBI, after Blast, not occur the DNA fragmentation of homology with it, upper mone snake upstream primer sequence (as shown in SEQ ID NO.2) is connected at this section of random dna sequence upstream 5 ' end, downstream 3 ' is held and is connected mone snake downstream primer sequence (as shown in SEQ IDNO.3), thus form the positive amplification interior mark DNA sequence dna (as shown in SEQ ID NO.6) of 101bp, this section of amplification interior label sequence is entrusted artificial gene chemical synthesis, synthesis fragment connection carrier PMD18-T respectively, transformed competence colibacillus DH5a, plasmid extraction, and sequence verification, obtain a pair Auele Specific Primer (as shown in SEQ ID NO.2 and SEQ IDNO.3) that can share with mone snake, thus in building, mark the recombinant plasmid of DNA.
(3) this test kit comprises: PCR damping fluid, MgCl 2with the reaction mixture (2 × TaqMan Master Mix) of dNTPs, Taq enzyme, ultrapure water, the mone snake primer of high specific amplification, TaqMan probe mixture, and artificial constructed interior mark plasmid and probe mixture.
(4) condition of the present invention's PCR composite amplification reaction used: preferentially select the PCR amplification system of 20 μ l to comprise: (pH value is 8.9 to Premix, magnesium ion concentration is 2.5mM, the final concentration of 4 kinds of dNTP is respectively 250 μMs), the consumption of Taq enzyme is 1U, and the concentration of upstream and downstream primer is respectively 0.4-1 μM; The concentration of specific probe and interior mark specific probe is respectively 0.4-1 μM, and the interior mark DNA of 1pg/ μ l.
20 μ l reaction systems are as follows:
Reagent name Concentration Consumption (μ L)
TaqManMasterMix 10
Upstream and downstream primer mixture 2μM 2
TaqMan probe mixture 2μM 2
Interior mark DNA 1pg/μl 2
DNA profiling 20ng/μL 2
Distilled water 2
Cumulative volume 20
When using described test kit to carry out pcr amplification, amplification elementary reaction need the quantitative real time PCR Instrument of any model more than 2 passages or 2 passages carry out, amplification program: 95 DEG C of 10min, denaturation; 95 DEG C of 10s, 63 DEG C of 35s (collecting fluorescent signal at this), 45 circulations.
The present invention's its beneficial effect compared with existing detection technique is:
A. the present invention is based on Mitochondrial DNA (mtDNA) have highly sensitive, tolerance range good, quick, degrade little (in the course of processing mtDNA keep more complete), the advantage such as stable easily operation, therefore as target gene;
B. the present invention is by mark in design synthetic one section of competitive type positive amplification, in system, add its specific probe and share pair of primers with target gene, can effectively indicate false negative to occur, reduce the risk that multipair primer pair fluorescent PCR system produces interference simultaneously;
C. dual multicolor fluorescence quantitative PCR of the present invention detects in same pipe, without the need to uncapping, not easily pollute, have accurate stable, simple to operate, sensitivity is high, high specificity, flux is large waits beneficial effect, mone snake medicinal material, powder formulation and living materials can be identified fast and accurately, be specially adapted to identify the qualification causing the DNA content Chinese medicine true and false that is few, that highly degrade because of processing, in food and medicine, the qualification of animal derived materials explores new approach.
Accompanying drawing explanation
In order to be illustrated more clearly in the embodiment of the present invention or technical scheme of the prior art, be briefly described to the accompanying drawing used required in embodiment or description of the prior art below, apparently, accompanying drawing in the following describes is only some embodiments of the present invention, for those of ordinary skill in the art, under the prerequisite not paying creative work, other accompanying drawing can also be obtained according to these accompanying drawings.
Fig. 1 is poisonless snake, Gold-banded Krait, Naja, Serpentis, yellow chain snake, Enhydris plumbea (Boie)., water snake, enjoy a double blessing wolf snake and mone snake mitochondrial COI gene sequence alignment figure;
Fig. 2 is that the fluorescent quantitation of mone snake positive criteria product detects amplification curve diagram;
Fig. 3 is the amplified fluorescence graphic representation of negative controls;
Fig. 4 is genomic dna sensitivity test (fluorescent quantitation template DNA consumption is 0.01ng) figure;
Fig. 5 is genomic dna sensitivity test (fluorescent quantitation template DNA consumption is 0.001ng) figure.
Embodiment
Below in conjunction with the accompanying drawing in the embodiment of the present invention, be clearly and completely described the technical scheme in the embodiment of the present invention, obviously, described embodiment is only the present invention's part embodiment, instead of whole embodiments.Based on the embodiment in the present invention, those of ordinary skill in the art, not making the every other embodiment obtained under creative work prerequisite, belong to the scope of protection of the invention.
Experiment material
Certified products mone snake and Its Common Confused Varieties poisonless snake, Gold-banded Krait, Naja, Serpentis, yellow chain snake, Enhydris plumbea (Boie)., water snake, wolf snake of enjoying a double blessing are purchased from Nat'l Pharmaceutical & Biological Products Control Institute, commercially available mone snake medicinal material random selecting 20 pieces is purchased from medicinal material market, Jinan City in addition, and above sample is all verified by the comparison of DNA bar code technology gene sequencing.
Reagent and instrument
It is OMEGA brand that animal tissues extracts test kit.TaqTM Hot Star Version warm start enzyme, dNTP, Mg 2+, DNA molecular amount MakerDL1000, the PCR reaction reagent such as electrophoresis sample-loading buffer is purchased from precious biotechnology (Dalian) company limited.Primer and probe are responsible for synthesis by Sangon Biotech (Shanghai) Co., Ltd..2 × TaqMan Master Mix is DBIBioscience brand.DNA sequencing is completed by Shandong Academy of Agricultural Sciences's biotechnology center center of checking order.
ABI 7500 quantitative real time PCR Instrument is ABI Products, and Takara PCR instrument is precious biotechnology (Dalian) company limited product.5424D type supercentrifuge is Ependorf Products, and gel imaging instrument is BIO-RAD Products.
Embodiment 1
(1) design of primers: be target gene (as shown in SEQ IDNO.1) based on DNA bar code choice of technology cytochrome C gene, search at Genbank and download snake chondrioid COI gene order (GeneBank accession number is KF698926.1, JF700190.1, KF698937.1, KF698948.1, KF698944.1, JX233650.1, JN833612.1, JX233641.1, JX233637.1), by Mega5 analysis software comparison mone snake and common adulterant poisonless snake, Gold-banded Krait, Naja, Serpentis, yellow chain snake, Enhydris plumbea (Boie)., water snake and wolf snake COI gene homology of enjoying a double blessing, design Auele Specific Primer (as shown in SEQ ID NO.2 and SEQ ID NO.3) and TaqMan probe (as shown in SEQ ID NO.4), comparison result is shown in Fig. 1.
Design construction contains the recombinant plasmid of mark DNA in positive amplification, and design corresponding TaqMan probe (as shown in SEQ IDNO.5), its method is: use DNA stochastic generation software to produce section of DNA sequence, make it in NCBI, after Blast, not occur the DNA fragmentation of homology with it, upper mone snake upstream primer sequence (as shown in SEQ ID NO.2) is connected at this section of random dna sequence upstream 5 ' end, downstream 3 ' is held and is connected mone snake downstream primer sequence (as shown in SEQ ID NO.3), thus form the positive amplification interior mark DNA sequence dna (as shown in SEQ ID NO.6) of 101bp, this section of amplification interior label sequence is entrusted artificial gene chemical synthesis, synthesis fragment connection carrier PMD18-T respectively, transformed competence colibacillus DH5a, plasmid extraction, and sequence verification, obtain a pair Auele Specific Primer (as shown in SEQ ID NO.2 and SEQ ID NO.3) that can share with mone snake, thus in building, mark the recombinant plasmid of DNA.
(2) DNA extraction: get sample to be tested 50g and grind fully mixing, get 50mg and extract DNA, available animal tissues extracts test kit and extracts DNA, also can with classical lifting manipulation (with reference to molecular cloning handbook method for extracting DNA from animal tissue).Nanodrop detection of nucleic acids instrument detects DNA sample concentration and purity, requires at 1-20ng/ μ l, between OD value 1.7-1.8.
(3) real-time fluorescent PCR amplification of testing sample DNA
This test kit comprises: PCR damping fluid, MgCl 2with the reaction mixture (2 × TaqMan Master Mix) of dNTPs, Taq enzyme, ultrapure water, the mone snake primer of high specific amplification, TaqMan probe mixture, and artificial constructed interior mark plasmid and probe mixture, wherein PCR pH of cushioning fluid is 8.9, magnesium ion concentration is 2.5mM, and the final concentration of 4 kinds of dNTP is respectively 250 μMs.
Prepare according to table 1 test kit reaction system in PCR reaction tubes, PCR reaction tubes is put into quantitative real time PCR Instrument, complete pcr amplification by following reaction conditions: amplification program: 95 DEG C of 2min; 95 DEG C of 5s, 60 DEG C of 35s, collect fluorescent signal at this, 45 circulations.
Table 1 pcr amplification reaction system
Reagent name Concentration Consumption (μ L)
TaqManMasterMix 10
Upstream and downstream primer mixture 2μM 2
TaqMan probe mixture 2μM 2
Interior mark DNA 1pg/μl 2
DNA profiling 20ng/μL 2
Distilled water 2
Cumulative volume 20
Application quantitative real time PCR Instrument analysis software, analysing amplified result.
Result judges: as the accuracy guaranteeing detected result, carry out actual sample detect time, do carry out NegativeControl experiment and Positive Control test.
Negative Control tests
When preparing Real Time PCR reaction solution, with adulterant or ddH 2o substitutes and detects sample.The judgement situation of various experimental result is illustrated and sees the following form 2:
Table 2 Negative Control tests
Positive Control tests
When preparing Real Time PCR reaction solution, substituting with mone snake standard substance and detecting sample, the judgement situation of various laboratory test results is illustrated and sees the following form 3:
Table 3 Positive Control tests
Pattern detection result to be checked judges: the blank of carrying out at the same time, in the normal situation of positive control experiment result, detected sample should have corresponding fluorescent signal to detect, and there is obvious amplification curve in corresponding fluorescence channel, Ct value <35, illustrate that DNA extraction is effective, positive mone snake standard substance detected result is shown in accompanying drawing 2, mone snake specific probe signal (Bmvp) and interior mark Quality Control (IMP) are all detected, negative findings is shown in accompanying drawing 3, mone snake specific probe signal (Bmvp) does not detect, only, mark Quality Control probe (IMP) has amplified signal.
Embodiment 2
Specific test
The genomic dna extracted from adulterant poisonless snake, Gold-banded Krait, Naja, Serpentis, yellow chain snake, Enhydris plumbea (Boie)., water snake, enjoy a double blessing wolf snake and certified products mone snake is respectively template, carry out quantitative fluorescent PCR according to the reaction system optimized in embodiment 1 and reaction conditions, detect the specificity of primer and probe.
Result shows, and only have mone snake source property DNA detection CT value <35, and other samples does not have amplified signal.The results are shown in Table 4.Primer in visible test kit and probe have very strong species specificity.
Table 4 fluorescence quantitative PCR detection CT value
Embodiment 3 sensitivity test
Genomic dna sensitivity test
Extract target gene group DNA according to embodiment 1 used kit, quantitatively arrive 50ng with Nanodrop, do 10 × gradient dilution (10 -1, 10 -2, 10 -3, 10 -4, 10 -5), it is template amount that each gradient all gets 2 μ l, and each gradient establishes 12 Duplicate Samples, according to the method described above respectively to mone snake DNA detection to investigate the sensitivity of this test kit.
Result display (Fig. 4, Fig. 5), when fluorescent quantitation template DNA consumption is 0.01ng, probe still has amplification curve and CT value <35; But when template consumption is 0.001ng, CT value > 35, substantially without amplification curve, so the detection of this kit method is limited to 0.01ng;
The embodiment 4 commercially available mone snake medicinal material true and false detects
The test kit in embodiment 1 is used to detect commercially available mone snake medicinal material (random selecting 15 pieces is purchased from medicinal material market, Jinan City), with the use value of verification method.The classification and detection of sample the results are shown in Table 5.From in table, commercially available mone snake medicinal material sample detects 6 parts of adulterants.
The commercially available mone snake medicinal material of table 5
The specific embodiment of the present invention is described although above-mentioned in conjunction with the embodiments; but not limiting the scope of the invention; one of ordinary skill in the art should be understood that; on the basis of technical scheme of the present invention, those skilled in the art do not need to pay various amendment or distortion that creative work can make still within protection scope of the present invention.
SEQUENCE LISTING
 
<110> Biotechnology Research Center, Shandong Academy of Agricultural Sciences
 
<120> mono-kind differentiates fast the TaqMan probe primer mixture of mone snake, test kit and fluorescent quantitative PCR detection method
 
<130>
 
<160> 6
 
<170> PatentIn version 3.3
 
<210> 1
<211> 176
<212> DNA
<213> mone snake (Bungarus parvus)
 
<400> 1
aaccctatac ctactcttcg gagcatggtc tggtctaatc ggagcctgtc taagcatttt 60
 
aatacgcata gagttaaccc aacccggctc gcttttagga agtgaccaaa tctttaacgt 120
 
actagttact gcccacgcat ttatcataat tttctttata gtcataccaa tcataa 176
 
 
<210> 2
<211> 20
<212> DNA
<213> artificial sequence
 
<400> 2
ctggtctaat cggagcctgt 20
 
 
<210> 3
<211> 20
<212> DNA
<213> artificial sequence
 
<400> 3
ataaatgcgt gggcagtaac 20
 
 
<210> 4
<211> 28
<212> DNA
<213> artificial sequence
 
<400> 4
agagttaacc caacccggct cgctttta 28
 
 
<210> 5
<211> 101
<212> DNA
<213> artificial sequence
 
<400> 5
ctggtctaat cggagcctgt atggagcacg ccgtaagctt aacctgacgc tagtaggcaa 60
 
gtacgctcca ttggtgacct cgttactgcc cacgcattta t 101
 
 
<210> 6
<211> 28
<212> DNA
<213> artificial sequence
 
<400> 6
tgacgctagt aggcaagtac gctccatt 28
 
 
 

Claims (9)

1. for differentiating a TaqMan probe Primer composition for mone snake, it is characterized in that: comprise 1 pair of Auele Specific Primer and 1 pair of specific probe:
Bmvp-COIF1 upstream primer: 5'CTGGTCTAATCGGAGCCTGT 3';
Bmvp-COIR1 downstream primer: 5'ATAAATGCGTGGGCAGTAAC 3'; As shown in SEQ ID NO.2,3;
The nucleotide sequence of described specific probe is as follows:
5'AGAGTTAACCCAACCCGGCTCGCTTTTA 3', as shown in SEQ ID NO.4;
The 5' of probe is terminal modified FAM fluorophor, and 3' is terminal modified BHQ2 quencher.
2. for differentiating a TaqMan probe Primer composition for mone snake, it is characterized in that: also comprise interior mark specific probe, the nucleotide sequence of this specific probe is as follows:
5'-TGACGCTAGTAGGCAAGTACGCTCCATT-3'; As shown in SEQ ID NO.6;
The 5' of this probe is terminal modified JOE fluorophor, and 3' is terminal modified BHQ2 quencher.
3. for differentiating a test kit for mone snake, it is characterized in that: comprise the TaqMan probe Primer composition described in claim 1 or 2 and the necessary reagent of pcr amplification.
4. the test kit for differentiating mone snake according to claim 3, is characterized in that: also comprise exogenous interior mark DNA fragmentation, its nucleotide sequence is as follows:
5'CTGGTCTAATCGGAGCCTGTATGGAGCACGCCGTAAGCTTAACCTGACGCTAGT AGGCAAGTACGCTCCATTGGTGACCTCGTTACTGCCCACGCATTTAT3'; As shown in SEQ ID NO.5.
5. the test kit for differentiating mone snake according to claim 3, is characterized in that: the necessary reagent of described pcr amplification comprises PCR damping fluid, MgCl2, dNTPs, Taq enzyme and ultrapure water.
6. differentiate a fluorescent quantitative PCR detection method for mone snake, it is characterized in that, use the TaqMan probe Primer composition according to any one of claim 1 ~ 5 or test kit differentiating the application in the mone snake goods true and false.
7. application according to claim 6, it is characterized in that: discrimination method is: get mone snake product sample, extract genomic dna, Auele Specific Primer and probe is utilized to increase, detect fluorescent signal, if the blank of carrying out at the same time, in the normal situation of positive control experiment result, detected sample should have corresponding fluorescent signal to detect, and there is obvious amplification curve in corresponding fluorescence channel, Ct value <35, illustrate that DNA extraction is effective, mone snake specific probe signal (Bmvp) and interior mark Quality Control (IMP) are all detected, Ct value <35, then be judged to the positive, if only have interior mark Quality Control (IMP) to be all detected, mone snake FAM specific probe does not detect, then be judged to be adulterant.
8. application according to claim 6, is characterized in that: described PCR amplification system is: pH value is 8.9, and magnesium ion concentration is 2.5mM, and the final concentration of 4 kinds of dNTP is respectively 250 μMs, and the consumption of Taq enzyme is 1U, and the concentration of upstream and downstream primer is respectively 0.4-1 μM; The concentration of specific probe and interior mark specific probe is respectively 0.4-1 μM, and the concentration of interior mark DNA is 1pg/ μ l.
9. application according to claim 6, is characterized in that: the condition of described pcr amplification is: 95 DEG C of 10min, 95 DEG C of 10s, 63 DEG C of 35s, collects fluorescent signal, 45 circulations.
CN201510458976.8A 2015-07-30 2015-07-30 TaqMan probe primer mixture, kit and fluorescent quantitative PCR detection method for quickly identifying bungarus multicinctus blyth Pending CN104962656A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201510458976.8A CN104962656A (en) 2015-07-30 2015-07-30 TaqMan probe primer mixture, kit and fluorescent quantitative PCR detection method for quickly identifying bungarus multicinctus blyth

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201510458976.8A CN104962656A (en) 2015-07-30 2015-07-30 TaqMan probe primer mixture, kit and fluorescent quantitative PCR detection method for quickly identifying bungarus multicinctus blyth

Publications (1)

Publication Number Publication Date
CN104962656A true CN104962656A (en) 2015-10-07

Family

ID=54216741

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201510458976.8A Pending CN104962656A (en) 2015-07-30 2015-07-30 TaqMan probe primer mixture, kit and fluorescent quantitative PCR detection method for quickly identifying bungarus multicinctus blyth

Country Status (1)

Country Link
CN (1) CN104962656A (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111206105A (en) * 2020-02-28 2020-05-29 南方医科大学 Molecular identification method of fresh and dry Bungarus Parvus
NL2028128B1 (en) * 2021-05-02 2022-04-05 Zhejiang Academy Of Science & Tech For Inspection & Quarantine Primers, probe, kit and method for fluorescence quantitative pcr detection of phenacoccus solani ferris
CN114657256A (en) * 2020-12-23 2022-06-24 广东一方制药有限公司 Primer combination for PCR identification of Bungarus parvus medicinal materials, standard decoction and traditional Chinese medicine formula granules, application and identification method thereof

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101613759A (en) * 2009-06-30 2009-12-30 中国中医科学院中药研究所 Identify PCR method and the special primer thereof of mone snake
CN103627699A (en) * 2012-08-21 2014-03-12 中国中医科学院中药研究所 Traditional Chinese medicinal material genome DNA extraction method suitable for DNA amplification technology
CN104120182A (en) * 2014-07-21 2014-10-29 南方医科大学 Specific primer for identifying bungarus parvus based on DNA barcodes, PCR method and kit
CN104164492A (en) * 2014-07-21 2014-11-26 南方医科大学 DNA barcode based primer for identifying bungarus multicinctus, PCR-RFLP method, and kit

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101613759A (en) * 2009-06-30 2009-12-30 中国中医科学院中药研究所 Identify PCR method and the special primer thereof of mone snake
CN103627699A (en) * 2012-08-21 2014-03-12 中国中医科学院中药研究所 Traditional Chinese medicinal material genome DNA extraction method suitable for DNA amplification technology
CN104120182A (en) * 2014-07-21 2014-10-29 南方医科大学 Specific primer for identifying bungarus parvus based on DNA barcodes, PCR method and kit
CN104164492A (en) * 2014-07-21 2014-11-26 南方医科大学 DNA barcode based primer for identifying bungarus multicinctus, PCR-RFLP method, and kit

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
崔丽娜等: "基于COI条形码序列的金钱白花蛇及其混伪品的DNA分子鉴定", 《世界科学技术一中医药现代化★专题讨论:中药材DNA条形码鉴定》 *
廖婧等: "常见药用蛇类的DNA 条形码研究", 《中国药学杂志》 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111206105A (en) * 2020-02-28 2020-05-29 南方医科大学 Molecular identification method of fresh and dry Bungarus Parvus
CN114657256A (en) * 2020-12-23 2022-06-24 广东一方制药有限公司 Primer combination for PCR identification of Bungarus parvus medicinal materials, standard decoction and traditional Chinese medicine formula granules, application and identification method thereof
NL2028128B1 (en) * 2021-05-02 2022-04-05 Zhejiang Academy Of Science & Tech For Inspection & Quarantine Primers, probe, kit and method for fluorescence quantitative pcr detection of phenacoccus solani ferris

Similar Documents

Publication Publication Date Title
CN105274099B (en) The primer of 9 kinds of animal derived materials, probe compositions, kit and its detection method and application in Rapid identification food or feed
CN103898235B (en) A kind of DNA bar code method for identifying molecules of Hirudo
CN105177150B (en) A kind of the multiple PCR primer system and detection method of quick detection pig sheep ox animal derived materials
CN104046700A (en) Detection kit for quickly identifying donkey skin, horse skin and mule skin
CN105331714B (en) A kind of peronophythora litchi LAMP primer and its rapid detection method
CN105734160A (en) Primer system for PCR identification on pig, bovine and sheep derived components of livestock and PCR identification method and kit
CN108977571A (en) Identify the fluorescence PCR detection reagent kit and application of four kinds of Araeceae medicinal plants
CN102086471A (en) Kit and method for identifying and detecting Cordyceps sinensis
CN107164556A (en) It is a kind of to be used to identify bulbus fritillariae cirrhosae and fluorescent PCR detecting primer, probe compositions, kit and the detection method of adulterant and application
CN106148559A (en) The multiple PCR primer system of a kind of five kinds of animal derived materials of synchronous detecting and detection method
CN105296648A (en) Multiplex PCR detection kit for fox origin component identification and identification of fox, rabbit and dog components in animal products
CN106868188A (en) Deer in a kind of deer horn glue, ox source property multiple fluorescence PCR detection primer, probe, kit and detection method and application
CN104962656A (en) TaqMan probe primer mixture, kit and fluorescent quantitative PCR detection method for quickly identifying bungarus multicinctus blyth
CN101654709B (en) Method for using sts primer to identify ginseng species
CN102312003B (en) PCR primer pair for identifying or assisting identification of animal tissue / or organ and application thereof
CN104372081A (en) Group of LAMP (loop-mediated isothermal amplification) detection primers and kit for microsporidia in silkworm eggs
CN106947805B (en) Fluorescent PCR kit and system based on septin9 gene methylation in ARMS-PCR method detection human peripheral dissociative DNA
CN103224989A (en) Method for quickly detecting duck-derived components in food
Utzeri et al. Entomological authentication of honey based on a DNA method that distinguishes Apis mellifera mitochondrial C mitotypes: Application to honey produced by A. m. ligustica and A. m. carnica
CN117144052B (en) Primer pair, trichophyton rubrum RPA test strip kit and detection method
CN107586865A (en) A kind of detection kit for the LAMP primer of quick detection Chinese medicine west safflower and comprising the primer
CN105907852A (en) Nested fluorescent PCR detection primer, probe, kit and detection method of donkey-origin, horse-origin, swine-origin and bovine-origin in donkey-hide gelatin, and applications thereof
CN105256013B (en) A kind of the droplet PCR primer system and detection method of synchronous detection pig sheep ox animal derived materials
CN104611424A (en) PCR-RFLP method for rapidly identifying radix tetrastigme and various counterfeits and adulterants of radix tetrastigme
CN106119390A (en) A kind of based on MGB probe identification donkey skin, Corium Equi and the test kit of mule skin and detection method thereof

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication

Application publication date: 20151007

RJ01 Rejection of invention patent application after publication