CN106947805B

CN106947805B - Fluorescent PCR kit and system based on septin9 gene methylation in ARMS-PCR method detection human peripheral dissociative DNA

Info

Publication number: CN106947805B
Application number: CN201710090052.6A
Authority: CN
Inventors: 黄临迷; 宋卓; 袁梦兮
Original assignee: Human And Future Biotechnology (changsha) Co Ltd
Current assignee: Human And Future Biotechnology (changsha) Co Ltd
Priority date: 2017-02-20
Filing date: 2017-02-20
Publication date: 2019-10-11
Anticipated expiration: 2037-02-20
Also published as: CN106947805A

Abstract

The invention discloses a kind of fluorescence PCR method, kit and systems based on septin9 gene methylation in ARMS-PCR method detection human peripheral dissociative DNA.Method includes: that (a) carries out conversion process to the site CpG in the human peripheral dissociative DNA containing septin9 gene, so that the unmethylated site CpG is converted to UpG；(b) Fluorescence PCR is carried out using the human peripheral dissociative DNA after conversion process as template, it include: the specific primer and its probe sequence for detecting septin9 gene methylation, Taq enzyme, UNG enzyme, dNTPs, dUTP, Mg in fluorescent PCR system²⁺With PCR buffer, the first additive and Second addition, wherein the first additive includes bovine serum albumin(BSA), Second addition includes dimethyl sulfoxide, NH₄Cl and aqueous sorbitol solution.Method of the invention can be avoided the false positive phenomenon that 1 site CpG methylation represents whole gene methylation level；Methylation level detection limit is down to 1%, high sensitivity.

Description

Based on septin9 gene methylation in ARMS-PCR method detection human peripheral dissociative DNA Fluorescent PCR kit and system

Technical field

The present invention relates to the horizontal detection technique fields of gene methylation, more particularly to a kind of ARMS-PCR method that is based on to detect The fluorescence PCR method of septin9 gene methylation, kit and system in human peripheral dissociative DNA.

Background technique

Excrement both contained the normal Colon and rectum epithelial cell to fall off and free DNA, also contained largely from colorectal cancer The cancer cell and free cancer DNA to fall off；Again since enteron aisle is alkaline environment, is conducive to the preservation of DNA, makes to extract from excrement DNA mass it is preferable.Therefore excrement gene methylation is straight as a kind of non-invasive knot new, that susceptibility is high, specificity is medium Phleboedesis tumor markers can further detect suspected case according to its positive findings, the early screening as related neoplasms Means have critically important clinical value.

Paraffin tissue sections are applied not only to the morphosis of observation normal cell tissue, are also used to study, observe and judge The main means of the metamorphosis of cell tissue, due to biological tissue can be intact after fixation, paraffin embedding preservation its Morphosis, a large amount of intracellular DNA inhereditary material be able to it is intact be stored in paraffin organization, by dewaxing, cell dissociation, DNA extract and etc. the DNA inhereditary material that these are preserved can be released.Meanwhile paraffin tissue sections are also one Kind obtains the effective means of a large amount of human body flesh tissue samples in a short time, and part research is related to retrospective analysis, it is also desirable to borrow Help the fixed paraffin-embedded tissue of formalin of the long-term preservations such as pathology department.Therefore, either as the early stage of related neoplasms Screening means, or Tumorigenesis is illustrated from gene level, paraffin section tissue all has critically important early detection, grinds Study carefully and uses clinical value.

It is one group of highly conserved gtp binding protein that septin9 gene, which is located at chromosome 17q25.3, septin family, The cytokinesis process of daughter cell to be finally separating the stage most important.It is newest studies have shown that in colonic adenoma and cancerous tissue In, the great change of the methylation patterns of SEPT9_V2 transcript is only limited to the island CpG, i.e. amplicon in CGI3.Existing rank The many coherent detection commercial kits of section, the target segment of detection is exactly the most abundant region of this information of SEPT9_V2.

The method of gene methylation mainly has 3 kinds in clinical detection DNA at present: 1) direct sequencing is current using most A kind of more detection methods, mainly Sanger sequencing, when tissue samples DNA through Hypermethylation transferring reagent box processing after, warp Crossing effectively enrichment can just be sequenced, and advantage is that result is accurate and reliable, can read detected sequence information, but it is effectively enriched with first Base gene region faces great challenge in the case where transferring reagent box transfer efficiency is not high, methylated genes content is low, It is generally used to confirm other detection positive findings.2) fluorescence quantitative PCR method, on quantitative fluorescent PCR platform, using special Primer pair DNA methylation region carries out PCR amplification, carries out abrupt climatic change to amplified production using fluorescence labeling probe, examines in this way DNA content can be detected down to 1% mutation, but detects currently used for gene methylation in survey method high specificity, high sensitivity The usually single site CpG, i.e., distinguish the single site CpG by MGB probe, and methylation information does not easily cause false positive knot comprehensively Fruit, while the single detection flux of q-PCR platform is not high, probe is expensive, and the risk for being difficult to adapt to clinical big flux sample is pre- It surveys.3) high throughput sequencing technologies method is generally enriched with methylated targets region using round pcr, and then building is suitable for The library of the upper machine sequencing of NGS, finally upper machine sequencing, information analysis obtain methylated targets regional sequence information interested.But At present, in the enrichment process of methylated targets region, the specificity and validity of enrichment are big in different experiment porch gaps, And common Library development flow is many and diverse, the period is long, at high cost, and these factors all cause the limitation of methylated genes high-flux sequence Factor.

Therefore, it is badly in need of one kind at present and is able to detect 1% low frequency methylation level of gene in sample DNA, methylation covering is not Be limited to 1 site CpG, testing result can quickly, it is intuitive, facilitate and differentiated, lower-cost gene methylation detection method And kit.

Summary of the invention

The present invention provides a kind of based on septin9 gene methylation in ARMS-PCR method detection human peripheral dissociative DNA Fluorescence PCR method, kit and system only just detect fluorescent PCR signal when 10 sites CpG all methylate, avoid 1 The site CpG, which methylates, represents the false positive phenomenon of whole gene methylation level；Methylation level detection limit is sensitive down to 1% Degree is high.

According to the first aspect of the invention, the present invention provides a kind of based on ARMS-PCR method detection human peripheral dissociative DNA The fluorescence PCR method of middle septin9 gene methylation, comprising:

(a) conversion process is carried out to the site CpG in the human peripheral dissociative DNA containing above-mentioned septin9 gene, so that The unmethylated site CpG is converted to UpG；

(b) in fluorescent PCR system, fluorescence is carried out using the human peripheral dissociative DNA after above-mentioned conversion process as template PCR reaction, wherein including: in above-mentioned fluorescent PCR system

(b1) for detecting the specific primer and its probe sequence of septin9 gene methylation:

Upstream primer sequence are as follows: ATTCGTTGTGTATTAGTTATTATdITC (SEQ ID NO:1),

Fluorescence probe sequence are as follows: ATTTCGCGGTGACCGCGTA (SEQ ID NO:2),

Downstream primer sequence are as follows: GCAACAACCAACCCAACdICC (SEQ ID NO:3)；

Wherein, the dI in above-mentioned primer sequence indicates deoxyinosine nucleotide；5 ' ends of above-mentioned fluorescence probe sequence With fluorophor, 3 ' ends have quenching group and minor groove binding molecule (Minor Groove Binder, MGB)；

(b2) Taq enzyme, UNG enzyme (Uracil-N-glycosylase, uracil-N-glycosylase), dNTPs (including dATP、dCTP、dGTP、dTTP)、dUTP、Mg²⁺With PCR buffer；

(b3) the first additive and Second addition, above-mentioned first additive includes bovine serum albumin(BSA), and above-mentioned second adds Adding agent includes dimethyl sulfoxide, NH₄Cl and aqueous sorbitol solution.

Further, above-mentioned fluorophor is FAM, and above-mentioned quenching group is BHQ1.Certainly, fluorophor is also possible to Other fluorophors such as HEX, TET, quenching group are also possible to other quenching groups such as TAMRA.

Further, in above-mentioned fluorescent PCR system further include:

For detecting specific primer and its probe sequence as interior target ACTB gene methylation:

Upstream primer sequence are as follows: AAAGGGTGTAGTGTTGGGAGGTTA (SEQ ID NO:4),

Fluorescence probe sequence are as follows: TCTTCTAATAACCACCTCCCTCCTT (SEQ ID NO:5),

Downstream primer sequence are as follows: AAAACCAACCACAAAACAA (SEQ ID NO:6)；

Wherein, 5 ' ends of above-mentioned fluorescence probe sequence have fluorophor VIC, and 3 ' ends have quenching group BHQ1.

Further, contain in every above-mentioned fluorescent PCR system of 50 μ L:

2 Taq enzyme, UNG enzyme units；The dNTPs (including each 2.5mM of dATP, dCTP, dGTP, dTTP) and 2.5mM of 10mM 0.4 μ L of dUTP；The Mg of 50mM²⁺1.5μL；10 × PCR buffer, 5 μ L；The respective 1 μ L of 10 μM of primer sequence, 10 μM of probe The respective 1.5 μ L of sequence；As 20~40ng of human peripheral dissociative DNA after the conversion process of template；10mg/mL ox blood is pure 2 μ L of albumen, dimethyl sulfoxide, 250mM NH₄The water of Cl and 60% aqueous sorbitol solution, 1.25 μ L and surplus.

Further, also contain in above-mentioned every above-mentioned fluorescent PCR system of 50 μ L:

The respective 1 μ L and 10 μM of above-mentioned interior 0.5 μ L of target probe sequence of 10 μM of above-mentioned interior target primer sequence；On It states interior target primer sequence and probe sequence includes:

Downstream primer sequence are as follows: AAAACCAACCACAAAACAA (SEQ ID NO:6)；

Further, the program of above-mentioned Fluorescence PCR are as follows:

50 DEG C of reaction 2min；95 DEG C of reaction 5min；Then 60 DEG C of reaction 30s carry out 15 circulations to 95 DEG C of reaction 15s；95 Then DEG C reaction 15s is recycled and is collected fluorescence signal for 60 DEG C of reaction 30s progress 30；20 DEG C of reaction 2min.

According to the second aspect of the invention, the present invention provides a kind of based on ARMS-PCR method detection human peripheral dissociative DNA The fluorescent PCR kit of middle septin9 gene methylation, comprising:

(1) for detecting the specific primer and its probe sequence of septin9 gene methylation:

Fluorescence probe sequence are as follows: ATTTCGCGGTGACCGCGTA (SEQ ID NO:2),

Wherein, the dI in above-mentioned primer sequence indicates deoxyinosine nucleotide；5 ' ends of above-mentioned fluorescence probe sequence With fluorophor, 3 ' ends have quenching group and minor groove binding molecule；

(2) Taq enzyme, UNG enzyme, dNTPs, dUTP, Mg²⁺With PCR buffer；

(3) first additives and Second addition, above-mentioned first additive includes bovine serum albumin(BSA), above-mentioned second addition Agent includes dimethyl sulfoxide, NH₄Cl and aqueous sorbitol solution；And

Optionally, (4) are used to detect the specific primer and its probe sequence as interior target ACTB gene methylation:

Downstream primer sequence are as follows: AAAACCAACCACAAAACAA (SEQ ID NO:6)；

Further, above-mentioned fluorophor is FAM, and above-mentioned quenching group is BHQ1.

According to the third aspect of the invention we, the present invention provides a kind of based on ARMS-PCR method detection human peripheral dissociative DNA The Fluorescence PCR system of middle septin9 gene methylation, every above-mentioned fluorescent PCR reaction system of 50 μ L include:

The respective 1 μ L of (1) 10 μM of primer sequence, the respective 1.5 μ L of 10 μM of probe sequence；Wherein, above-mentioned primer sequence and Probe sequence includes:

For detecting the specific primer and its probe sequence of septin9 gene methylation:

Fluorescence probe sequence are as follows: ATTTCGCGGTGACCGCGTA (SEQ ID NO:2),

Wherein, the dI in above-mentioned primer sequence indicates deoxyinosine nucleotide；5 ' ends of above-mentioned fluorescence probe sequence With fluorophor, 3 ' ends have quenching group and minor groove binding molecule；Preferably, above-mentioned fluorophor is FAM, above-mentioned to be quenched Group is BHQ1；

(2) 2 Taq enzyme, UNG enzyme units；The 0.4 μ L of dUTP of the dNTPs and 2.5mM of 10mM；The Mg of 50mM²⁺1.5μL； 10 × PCR buffer, 5 μ L；

2 μ L of (3) first additive, 1.25 μ L of Second addition, above-mentioned first additive includes that 10mg/mL ox blood is pure Albumen, above-mentioned Second addition include dimethyl sulfoxide, 250mM NH₄Cl and 60% aqueous sorbitol solution；

(4) as 20~40ng of human peripheral dissociative DNA after the conversion process of template, wherein above-mentioned conversion is to containing There is the site CpG in the human peripheral dissociative DNA of above-mentioned septin9 gene to carry out conversion process, so that CpG unmethylated Point is converted to UpG；And

(5) water of surplus.

The respective 1 μ L and 10 μM of 0.5 μ L of interior target probe sequence of (6) 10 μM of interior target primer sequence, wherein on It states interior target primer sequence and probe sequence includes the specific primer and its probe sequence of ACTB gene methylation:

Downstream primer sequence are as follows: AAAACCAACCACAAAACAA (SEQ ID NO:6)；

The beneficial effects of the present invention are embodied in: septin9 gene methylation is realized in human peripheral dissociative DNA It detects, fragmentation degree is high in human peripheral dissociative DNA, DNA abundance is low, it is more to extract impurity, and it is free to can detecte human peripheral Septin9 gene methylation in DNA is horizontal；The detection for realizing septin9 gene hypomethylation level 1%, improves inspection Survey sensitivity；Realize and promoted by the accuracy in the single site CpG to no less than 10 sites CpG, avoid previous detection because The single island CpG represent whole gene methylation level and caused by false positive results.In addition, testing result interpretation quicklook, Previous kit generallys use △ △ CT algorithm and carries out interpretation to testing result, and wild type human DNA is easily produced after 100ng conversion Raw stronger non-specific amplification, false positive results caused by be easy to causeing result differentiation unclear, and septin9 gene of the invention Methylation level detection is not necessarily to △ △ CT algorithm, without amplified signal in 200ng people DNA, has low frequency methylation to have amplification to believe Number, it is quickly clear as a result to differentiate.

Detailed description of the invention

Fig. 1 is that the normal tissue site CpG that (do not methylate) by bisulphate processing is converted to the schematic illustration of UpG；

Fig. 2 is the schematic illustration that the tumor tissues site (methylation) CpG is CpG after bisulphate is handled；

Fig. 3 is that tumorous type can detecte out fluorescence signal, and wild type detects the schematic illustration of unstressed configuration signal, wherein dI (deoxyInosine) the 3rd base reciprocal is held for deoxyinosine modification 3 ', binding force is weak；

Fig. 4 is normal cell (no methyl after tumour (methylation) DNA 0.15ng (1%)+conversion process after conversion process Change) DNA 15ng (99%) septin9 gene target region detection signal FAM fluorescence curve figure；

Fig. 5 is normal cell (no methyl after tumour (methylation) DNA 0.15ng (1%)+conversion process after conversion process Change) DNA 15ng (99%) internal standard region detection signal VIC fluorescence curve figure；

Fig. 6 is tumour (methylation) DNA 0.15ng (100%) septin9 gene target region detection letter after conversion process Number FAM fluorescence curve figure；

Fig. 7 is tumour (methylation) DNA 0.15ng (100%) internal standard region detection signal VIC fluorescence after conversion process Curve graph；

Fig. 8 is normal cell (no methylation) DNA 15ng (100%) septin9 gene target region inspection after conversion process Survey signal FAM fluorescence curve figure；

Fig. 9 is glimmering for normal cell (no methylation) DNA 15ng (100%) internal standard region detection signal VIC after conversion process Distribution curve flux；

Figure 10 is no conversion process normal cell (no methylation) DNA 15ng (100%) septin9 gene target region Detect signal FAM fluorescence curve figure；

Figure 11 is no conversion process normal cell (no methylation) DNA 15ng (100%) internal standard region detection signal VIC Fluorescence curve figure；

Figure 12 is free plasma dna 15ng (100%) septin9 gene target region detection signal FAM after conversion process Fluorescence curve figure；

Figure 13 is free plasma dna 15ng (100%) internal standard region detection signal VIC fluorescence curve figure after conversion process.

Specific embodiment

Below by specific embodiment combination attached drawing, invention is further described in detail.

Present inventor has performed a series of researchs, and in the septin9 gene of research human faecal mass DNA, paraffin section DNA It has been invented when DNA methylation assay a kind of new based on ARMS (mutation amplification system)-PCR method detection septin9 gene methylation water Flat detection method and its kit, there is nondiagnostic purposes.Detection method of the invention is directed in people septin9 gene, 10 site CpG section design ARMs-PCR primers and its probe are no less than in SEPT9_V2 section CGI3 methylated CpG island, In conjunction with the PCR reaction solution and efficient Taq enzyme of optimization, realization is to septin9 gene in sample DNA after methylation transferring reagent processing 1% methylation level of low frequency, detection zone include no less than 10 sites CpG, testing result quickly, it is intuitive, facilitate and sentenced Not.Detection method of the invention includes: using methylation transferring reagent to (its principle is referring to Fig. 1 after biological sample DNA conversion And Fig. 2), respectively the specific island CpG region is no less than the methylation water in 10 sites CpG to septin9 gene in DNA after detection conversion It is flat, by constant gene segment C upstream CpG locus specificity ARMS design of primers and base modification, downstream CpG locus specificity (its principle is referring to figure for the design of ARMS design of primers and base modification, centre CpG site areas Taq-man MGB probe primer 3), and further to dNTPs, Mg ion, NH in PCR amplification system₄Cl, bovine serum albumin(BSA) (BSA), dimethyl sulfoxide (DMSO), the addition of the chemical reagent special ratios such as D-sorbite composition, to reach the optimum response of ARMS-PCR primer work System condition, the optimization to PCR amplification step realize septin9 gene hypomethylation level 1% in conjunction with q-PCR platform Detection, while after conversion under the wild type human DNA background of 200ng/ reaction without amplified signal, do not occur false positive situation, examines Survey result quickly, it is intuitive, facilitate and differentiated.

Specific primer and its probe sequence used in the present invention include:

Fluorescence probe sequence are as follows: ATTTCGCGGTGACCGCGTA (SEQ ID NO:2),

Wherein, the dI in primer sequence indicates deoxyinosine nucleotide；5 ' ends of fluorescence probe sequence have fluorescence Group, 3 ' ends have quenching group and minor groove binding molecule.

Specific primer and its probe sequence of the invention is specially designed, its main feature is that only at no less than 10 Fluorescent PCR signal is just detected when the site CpG methylates, so that 1 site CpG methylation be avoided to represent whole gene methylation water Flat false positive phenomenon, and the method that this false positive phenomenon is existing detection septin9 gene methylation is difficult to avoid that. Fluorescence probe sequence of the invention is when in conjunction with target area, as long as there is at least three site (preferably 3-5 site) that cannot tie It closes, then entire fluorescence probe sequence does not just combine, these sites are exactly to methylate after methylation transferring reagent conversion The site CpG and the unmethylated site CpG between discrepant site.5 ' ends of fluorescence probe sequence have fluorophor, 3 ' ends also have minor groove binding molecule other than with quenching group, can be in the uncombined situation in site further " flicking " fluorescence probe sequence is further ensured that only just detection fluorescent PCR is believed when no less than 10 sites CpG methylate Number.Meanwhile the dI in primer sequence is located at 3 ' and holds the 3rd base reciprocal, the presence of the base, so that the knot of itself and target area Resultant force dies down, once amplification is then difficult to happen instead so that the base of 3 ' end of primer sequence cannot match with target area Answer, that is, normal tissue (do not methylate) site CpG by bisulphate processing be converted to UpG in the case where, 3 ' ends Base cannot match, then amplified reaction can not occur；And methylated CpG site is after bisulphate is handled, 3 ' ends The base at end can still match, and amplified reaction occurs.Therefore, above-mentioned specific primer and its ingenious of probe sequence set Meter ensure that and only just detect fluorescent PCR signal when no less than 10 sites CpG methylate.

The present invention also uses UNG enzyme, and selective hydrolysis is broken the uracil glucosides in the double-strand containing dU or single stranded DNA Key, the DNA chain for having missing base of formation can further hydrolytic cleavage under alkaline medium and high temperature.Therefore in UNG enzyme and System existing for dUTP can be eliminated and prevent to pollute.For example, making the step of 50 DEG C of reaction 2min of setting before PCR reacts UNG enzyme effect amplified production that may be present in U base cutting environment, to exclude the false positive knot that thus may cause Fruit keeps testing result more acurrate.

The present invention uses bovine serum albumin(BSA) as the first additive, and contains dimethyl sulfoxide, NH₄Cl and sorb The Second addition of sugar alcohol aqueous solution can be probe and primer in the case where the site CpG methylates different, delicately combine Or not combining target region.That is, the presence of the first additive and Second addition, the combination for probe and primer is provided Advantageous environment, so that generating positive fluorescent PCR signal in the case where no less than 10 sites CpG methylate；And only In the case where having 1 site CpG methylation, positive fluorescent PCR signal cannot be generated.

In addition, setting methylation specific internal standard (gene conserved regions mankind ACTB) controls, from target gene using different Fluorescence labeling probe, whether sample effective dna after methylation transferring reagent to be measured is handled normally is monitored by detection internal standard Amount, while monitoring after conversion process whether there is PCR mortifier in sample, avoid PCR false negative.

Inventor is also optimized Fluorescence PCR system, realizes optimal expanding effect.Inventor obtains one A optimal Fluorescence PCR system contains in every 50 μ L Fluorescence PCR system: 2 Taq enzyme, UNG enzyme units；10mM DNTPs (including each 2.5mM of dATP, dCTP, dGTP, dTTP) and 2.5mM 0.4 μ L of dUTP；The Mg of 50mM²⁺1.5μL；10 5 μ L of × PCR buffer；10 μM of primer sequence (SEQ ID NO:1,3) respective 1 μ L, 10 μM of probe sequence (SEQ ID NO:2) respective 1.5 μ L；As 20~40ng of human peripheral dissociative DNA after the conversion process of template；10mg/mL cow's serum 2 μ L of albumin, dimethyl sulfoxide, 250mM NH₄The water of Cl and 60% aqueous sorbitol solution, 1.25 μ L and surplus.

The technical solution and technical effect that the present invention will be described in detail by the following examples, it should be understood that embodiment is only Illustratively, it should not be understood as limiting the scope of the invention.

In following embodiment, sample DNA conversion process, which uses, derives from ZYMO RESEARCH company EZ-96DNA Methylation-GoldTMMagPre kit is carried out according to operational manual.

The specific primer and its probe sequence used is as follows:

Fluorescence probe sequence are as follows: ATTTCGCGGTGACCGCGTA (SEQ ID NO:2),

(2) for detecting specific primer and its probe sequence as interior target ACTB gene methylation:

Fluorescence probe sequence are as follows: VIC-TCTTCTAATAACCACCTCCCTCCTT-BHQ1 (SEQ ID NO:5),

Downstream primer sequence are as follows: AAAACCAACCACAAAACAA (SEQ ID NO:6).

The constituent for detecting the single tube reaction solution of septin9 gene methylation is as shown in table 1 below:

Table 1

The program of Fluorescence PCR are as follows: 50 DEG C of reaction 2min；95 DEG C of reaction 5min；95 DEG C of reaction 15s then 60 DEG C it is anti- 30s is answered to carry out 15 circulations；Then 60 DEG C of reaction 30s progress 30 recycle and collect fluorescence signal 95 DEG C of reaction 15s；20 DEG C anti- Answer 2min.

Fig. 4 shows after conversion process normal cell (nothing after tumour (methylation) DNA 0.15ng (1%)+conversion process Methylation) DNA 15ng (99%) septin9 gene target region detection signal FAM fluorescence curve figure, it is seen that there is fluorescence signal； Fig. 5 shows after conversion process normal cell (no methylation) after tumour (methylation) DNA 0.15ng (1%)+conversion process DNA 15ng (99%) internal standard region detection signal VIC fluorescence curve figure, it is seen that have fluorescence signal；Fig. 6 shows conversion process Tumour (methylation) DNA0.15ng (100%) septin9 gene target region detection signal FAM fluorescence curve figure afterwards, it is seen that There is fluorescence signal；Fig. 7 shows tumour (methylation) DNA0.15ng (100%) internal standard region detection signal VIC after conversion process Fluorescence curve figure, it is seen that have fluorescence signal；Fig. 8 shows normal cell (no methylation) DNA 15ng after conversion process (100%) septin9 gene target region detection signal FAM fluorescence curve figure, it is seen that unstressed configuration signal；Fig. 9 shows conversion Normal cell (no methylation) DNA 15ng (100%) internal standard region detection signal VIC fluorescence curve figure after processing, it is seen that have Fluorescence signal；Figure 10 shows no conversion process normal cell (no methylation) DNA 15ng (100%) septin9 gene target Region detection signal FAM fluorescence curve figure, it is seen that unstressed configuration signal；Figure 11 shows no conversion process normal cell (no methyl Change) DNA 15ng (100%) internal standard region detection signal VIC fluorescence curve figure, it is seen that unstressed configuration signal；Figure 12 shows conversion Dissociate plasma dna 15ng (100%) septin9 gene target region detection signal FAM fluorescence curve figure after processing, it is seen that nothing Fluorescence signal；Free plasma dna 15ng (100%) internal standard region detection signal VIC fluorescence is bent after Figure 13 shows conversion process Line chart, it is seen that have fluorescence signal.

The above content is specific embodiment is combined, further detailed description of the invention, and it cannot be said that this hair Bright specific implementation is only limited to these instructions.For those of ordinary skill in the art to which the present invention belongs, it is not taking off Under the premise of from present inventive concept, a number of simple deductions or replacements can also be made, all shall be regarded as belonging to protection of the invention Range.

SEQUENCE LISTING

<110>people and scientific and technological (Changsha) Co., Ltd of future biological

<120>the fluorescent PCR side based on septin9 gene methylation in ARMS-PCR method detection human peripheral dissociative DNA Method

, kit and system

<130> 17I23925

<160> 6

<170> PatentIn version 3.3

<210> 1

<211> 26

<212> DNA

<213>artificial sequence

<220>

<221> misc_feature

<222> (24)..(24)

<223>n is deoxyinosine

<400> 1

attcgttgtg tattagttat tatntc 26

<210> 2

<211> 19

<212> DNA

<213>artificial sequence

<400> 2

atttcgcggt gaccgcgta 19

<210> 3

<211> 20

<212> DNA

<213>artificial sequence

<220>

<221> misc_feature

<222> (18)..(18)

<223>n is deoxyinosine

<400> 3

gcaacaacca acccaacncc 20

<210> 4

<211> 24

<212> DNA

<213>artificial sequence

<400> 4

aaagggtgta gtgttgggag gtta 24

<210> 5

<211> 25

<212> DNA

<213>artificial sequence

<400> 5

tcttctaata accacctccc tcctt 25

<210> 6

<211> 19

<212> DNA

<213>artificial sequence

<400> 6

aaaaccaacc acaaaacaa 19

Claims

1. a kind of fluorescent PCR reagent based on septin9 gene methylation in ARMS-PCR method detection human peripheral dissociative DNA Box characterized by comprising

Upstream primer sequence are as follows: ATTCGTTGTGTATTAGTTATTATdITC(SEQ ID NO:1),

Fluorescence probe sequence are as follows: ATTTCGCGGTGACCGCGTA(SEQ ID NO:2),

Downstream primer sequence are as follows: GCAACAACCAACCCAACdICC(SEQ ID NO:3)；

Wherein, the dI in the primer sequence indicates deoxyinosine nucleotide；5 ' ends of the fluorescence probe sequence have Fluorophor, 3 ' ends have quenching group and minor groove binding molecule；

(2) Taq enzyme, UNG enzyme, dNTPs, dUTP, Mg²⁺With PCR buffer；

(3) first additives and Second addition, first additive includes bovine serum albumin(BSA), the Second addition packet Include dimethyl sulfoxide, NH₄Cl and aqueous sorbitol solution.

2. kit according to claim 1, which is characterized in that the kit further include: (4) for detecting in conduct The specific primer and its probe sequence of target ACTB gene methylation:

Upstream primer sequence are as follows: AAAGGGTGTAGTGTTGGGAGGTTA(SEQ ID NO:4),

Fluorescence probe sequence are as follows: TCTTCTAATAACCACCTCCCTCCTT(SEQ ID NO:5),

Downstream primer sequence are as follows: AAAACCAACCACAAAACAA(SEQ ID NO:6)；

Wherein, 5 ' ends of the fluorescence probe sequence have fluorophor VIC, and 3 ' ends have quenching group BHQ1.

3. kit according to claim 1, which is characterized in that the fluorophor is FAM, and the quenching group is BHQ1。

4. a kind of Fluorescence PCR body based on septin9 gene methylation in ARMS-PCR method detection human peripheral dissociative DNA System, which is characterized in that Fluorescence PCR system described in every 50 μ L includes:

Each 1 μ L of (1) 10 μM of primer sequence, each 1.5 μ L of 10 μM of probe sequence；Wherein, the primer sequence and probe sequence Include:

Fluorescence probe sequence are as follows: ATTTCGCGGTGACCGCGTA(SEQ ID NO:2),

(2) Taq enzyme, UNG enzyme totally 2 units；The 0.4 μ L of dUTP of the dNTPs and 2.5mM of 10mM；The Mg of 50mM²⁺1.5μL；10 5 μ L of × PCR buffer；

2 μ L of (3) first additive, 1.25 μ L of Second addition, first additive includes 10mg/mL bovine serum albumin(BSA), The Second addition includes dimethyl sulfoxide, 250mM NH₄Cl and 60% aqueous sorbitol solution；

(4) as 20 ~ 40ng of human peripheral dissociative DNA after the conversion process of template, wherein the conversion is to containing The site CpG stated in the human peripheral dissociative DNA of septin9 gene carries out conversion process, so that the unmethylated site CpG turns It is changed to UpG；And

(5) water of surplus.

5. Fluorescence PCR system according to claim 4, which is characterized in that fluorescent PCR system described in every 50 μ L In also contain:

(6) 10 μM of each 1 μ L of interior target primer sequence and 10 μM of 0.5 μ L of interior target probe sequence, wherein the internal standard Primer sequence and probe sequence include the specific primer and its probe sequence of ACTB gene methylation:

Upstream primer sequence are as follows: AAAGGGTGTAGTGTTGGGAGGTTA(SEQ ID NO:4),

Downstream primer sequence are as follows: AAAACCAACCACAAAACAA(SEQ ID NO:6)；