CN106978481B - Fluorescent PCR method, kit and system for detecting BMP3 and NDRG4 gene methylation based on ARMS-PCR method - Google Patents
Fluorescent PCR method, kit and system for detecting BMP3 and NDRG4 gene methylation based on ARMS-PCR method Download PDFInfo
- Publication number
- CN106978481B CN106978481B CN201710090789.8A CN201710090789A CN106978481B CN 106978481 B CN106978481 B CN 106978481B CN 201710090789 A CN201710090789 A CN 201710090789A CN 106978481 B CN106978481 B CN 106978481B
- Authority
- CN
- China
- Prior art keywords
- sequence
- seq
- follows
- fluorescent
- methylation
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/154—Methylation markers
Abstract
The invention discloses a fluorescence PCR method, a kit and a system for detecting BMP3 and NDRG4 gene methylation based on an ARMS-PCR method. The method comprises the following steps: (a) converting CpG sites in DNA material containing BMP3 and NDRG4 gene to UpG; (b) performing fluorescence PCR reaction by using the converted DNA material as a template, wherein a fluorescence PCR system comprises: specific primer and probe sequence for detecting BMP3 gene methylation, specific primer and probe sequence for detecting NDRG4 gene methylation, Taq enzyme, UNG enzyme, dNTPs, dUTP, Mg2+And PCR buffer solution, a first additive and a second additive, wherein the first additive comprises bovine serum albumin, and the second additive comprises dimethyl sulfoxide and NH4Cl and aqueous sorbitol solution. The method can avoid the false positive phenomenon that the methylation of 1 CpG locus represents the methylation level of the whole gene; the detection limit of methylation level is as low as 0.1-1%, and the sensitivity is high.
Description
Technical Field
The invention relates to the technical field of gene methylation level detection, in particular to a fluorescence PCR method, a kit and a system for detecting BMP3 and NDRG4 gene methylation based on an ARMS-PCR method.
Background
Stool contains both shed normal colorectal epithelial cells and free DNA, as well as a large number of cancer cells shed from colorectal cancer and free cancer DNA; and the intestinal tract is in an alkaline environment, so that the preservation of DNA is facilitated, and the quality of DNA extracted from the excrement is better. Therefore, the fecal gene methylation is used as a novel noninvasive colon and rectal tumor marker with high sensitivity and moderate specificity, can further detect suspected cases according to the positive result, and has important clinical value as an early screening means of related tumors.
The paraffin tissue section is not only used for observing the morphological structure of normal cell tissue, but also used for researching, observing and judging the main means of the morphological change of the cell tissue, because the biological tissue can completely preserve the morphological structure after being fixed and embedded by paraffin, a large amount of DNA genetic materials in cells can be perfectly preserved in the paraffin tissue, and the preserved DNA genetic materials can be released through the steps of dewaxing, cell digestion, DNA extraction and the like. Meanwhile, paraffin tissue section is an effective way to obtain a large amount of fresh human tissue specimens in a short period of time, and some studies relate to retrospective analysis, and formalin-fixed paraffin-embedded tissues stored for a long period of time by means of pathology department and the like are also needed. Therefore, the paraffin section tissue has important clinical value for early detection and research, whether serving as an early screening means of related tumors or clarifying tumor pathogenesis from the gene level.
In recent years, studies have shown that the BMP3 gene is closely related to some tumorigenesis, development and metastasis, and the expression level of the BMP3 gene is inhibited in colorectal cancer (CRC) and lung cancer, indicating that the methylation level of the BMP3 gene can be used as an important biological characteristic of early onset of colorectal cancer (CRC) and lung cancer.
The NDRG4 gene has a full length of 32kb, consists of 17 exons and l6 introns, belongs to a member of cancer suppressor NDRG gene family, is highly expressed in various normal tissues of human body, is not expressed or is under expressed in some tumor tissues, is possibly related to promoter hypermethylation in low expression, contains CpG island in the 5' end regulation region of the gene, and is often methylated in the process of colorectal cancer development. Therefore, NDRG4 gene methylation is also considered to be an important biological feature of colorectal cancer.
At present, the clinical detection method for gene methylation in DNA mainly comprises 3 methods: 1) the direct sequencing method is a detection method which is most applied at present, mainly Sanger sequencing is adopted, and after DNA of a tissue sample is treated by a methylation conversion kit, the DNA can be sequenced only through effective enrichment. 2) A fluorescent quantitative PCR method is characterized in that on a fluorescent quantitative PCR platform, a specific primer is utilized to carry out PCR amplification on a DNA methylation region, and a fluorescent labeling probe is utilized to carry out mutation detection on an amplification product, so that the detection method has strong specificity and high sensitivity, can detect the mutation with the DNA content as low as 1 percent, but is usually a single CpG site in the existing gene methylation detection, namely the single CpG site is distinguished through an MGB probe, the methylation information is not comprehensive, so that a false positive result is easily caused, meanwhile, the single detection flux of the q-PCR platform is not high, the cost of the probe is expensive, and the method is difficult to adapt to the risk prediction of a clinical large-flux sample. 3) A high-throughput sequencing technology method generally utilizes a PCR technology to enrich a methylated target region, then constructs a library suitable for NGS on-machine sequencing, and finally, on-machine sequencing and information analysis are carried out to obtain sequence information of the interested methylated target region. However, in the current enrichment process of the methylation target region, the difference between the specificity and the effectiveness of the enrichment is large on different experimental platforms, and the common library building process is complicated, long in period and high in cost, which all cause the limiting factors of the high-throughput sequencing of the methylation gene.
Therefore, a gene methylation detection method and a gene methylation detection kit which can detect the 0.1-1% low-frequency methylation level of a gene in a sample DNA, can quickly, intuitively and conveniently distinguish a detection result and have low cost are urgently needed.
Disclosure of Invention
The invention provides a fluorescence PCR method, a kit and a system for detecting BMP3 and NDRG4 gene methylation based on an ARMS-PCR method, wherein a fluorescence PCR signal is detected only when 5-15 continuous CpG sites are methylated, so that a false positive phenomenon that methylation of 1 CpG site represents the methylation level of the whole gene is avoided; the detection limit of methylation level is as low as 0.1-1%, and the sensitivity is high.
According to a first aspect of the present invention, the present invention provides a fluorescent PCR method for detecting methylation of BMP3 and NDRG4 genes based on ARMS-PCR method, comprising:
(a) converting CpG sites in DNA material containing the BMP3 and NDRG4 genes to UpG;
(b) in a fluorescence PCR system, performing fluorescence PCR reaction by using the converted DNA material as a template, wherein the fluorescence PCR system comprises:
(b1) specific primers and probe sequences thereof for detecting methylation of BMP3 gene:
the sequence of the upstream primer is as follows: GAGTTAAGTTTCGGTTTCdITC (SEQ ID NO: 1),
the fluorescent probe sequence is as follows: GCAAAAAACCGACGACGAAA (SEQ ID NO: 2),
the sequence of the downstream primer is as follows: GTCGCTACGCAACACTdICG (SEQ ID NO: 3);
(b2) specific primers and probe sequences thereof for detecting methylation of NDRG4 gene:
the sequence of the upstream primer is as follows: TTTCGCGTCGCGGTTGTCGdITC (SEQ ID NO: 4),
the fluorescent probe sequence is as follows: TTTTTCGTTCGTTTATCGGGTATTTTAGT (SEQ ID NO: 5),
the sequence of the downstream primer is as follows: GTCGCTACGACACACATdICG (SEQ ID NO: 6);
wherein dI in the primer sequence represents deoxyinosinic acid; the 5 'end of the fluorescent probe sequence is provided with a fluorescent group, and the 3' end is provided with a quenching group and Minor Groove binding Molecules (MGB);
(b3) taq enzyme, UNG enzyme (Uracil-N-glycosylase ), dNTPs (including dATP, dCTP, dGTP, dTTP), dUTP, Mg2+And a PCR buffer;
(b4) a first additive and a second additive, wherein the first additive comprises bovine serum albumin, and the second additive comprises dimethyl sulfoxide and NH4Cl and aqueous sorbitol solution.
Further, the fluorescent group is FAM, and the quencher group is BHQ 1. Of course, the fluorophore may be other fluorophores such as HEX and TET, and the quencher may be other quenchers such as TAMRA.
Further, the fluorescent PCR system further comprises:
specific primers and probe sequences thereof for detecting methylation of ACTB gene as an internal standard:
the sequence of the upstream primer is as follows: AAAGGGTGTAGTGTTGGGAGGTTA (SEQ ID NO: 7),
the fluorescent probe sequence is as follows: TCTTCTAATAACCACCTCCCTCCTT (SEQ ID NO: 8),
the sequence of the downstream primer is as follows: AAAACCAACCACAAAACAA (SEQ ID NO: 9);
wherein, the 5 'end of the fluorescent probe sequence is provided with a fluorescent group VIC, and the 3' end is provided with a quenching group BHQ 1.
Further, the above fluorescent PCR system contains, per 50. mu.L:
2 units of Taq enzyme and UNG enzyme; 10mM dNTPs (including 2.5mM each of dATP, dCTP, dGTP, dTTP) and 2.5mM dUTP 0.4. mu.L; 50mM Mg2+1.5 mu L; 10 XPCR buffer 5. mu.L; mu.L of each 10. mu.M primer sequence and 1.5. mu.L of each 10. mu.M probe sequence; 20-40 ng of DNA material after conversion treatment as a template; 10mg/mL bovine serum albumin 2. mu.L, dimethyl sulfoxide, 250mM NH41.25 μ L of Cl and 60% sorbitol in water, and the balance water.
Further, the fluorescent PCR system further comprises, per 50. mu.L of the fluorescent PCR system:
mu.L of each primer sequence of 10. mu.M of the internal standard, and 0.5. mu.L of the probe sequence of 10. mu.M of the internal standard; the primer sequences and probe sequences of the internal standard comprise:
specific primers and probe sequences thereof for detecting methylation of ACTB gene as an internal standard:
the sequence of the upstream primer is as follows: AAAGGGTGTAGTGTTGGGAGGTTA (SEQ ID NO: 7),
the fluorescent probe sequence is as follows: TCTTCTAATAACCACCTCCCTCCTT (SEQ ID NO: 8),
the sequence of the downstream primer is as follows: AAAACCAACCACAAAACAA (SEQ ID NO: 9);
wherein, the 5 'end of the fluorescent probe sequence is provided with a fluorescent group VIC, and the 3' end is provided with a quenching group BHQ 1.
Further, the procedure of the fluorescence PCR reaction is as follows:
reacting at 50 ℃ for 2 min; reacting at 95 ℃ for 5 min; reacting at 95 ℃ for 15s and then at 60 ℃ for 30s for 15 cycles; reacting at 95 ℃ for 15s and then at 60 ℃ for 30s for 30 cycles and collecting fluorescence signals; the reaction was carried out at 20 ℃ for 2 min.
According to a second aspect of the present invention, the present invention provides a fluorescent PCR kit for detecting methylation of BMP3 and NDRG4 genes based on the ARMS-PCR method, comprising:
(1) specific primers and probe sequences thereof for detecting methylation of BMP3 gene:
the sequence of the upstream primer is as follows: GAGTTAAGTTTCGGTTTCdITC (SEQ ID NO: 1),
the fluorescent probe sequence is as follows: GCAAAAAACCGACGACGAAA (SEQ ID NO: 2),
the sequence of the downstream primer is as follows: GTCGCTACGCAACACTdICG (SEQ ID NO: 3);
(2) specific primers and probe sequences thereof for detecting methylation of NDRG4 gene:
the sequence of the upstream primer is as follows: TTTCGCGTCGCGGTTGTCGdITC (SEQ ID NO: 4),
the fluorescent probe sequence is as follows: TTTTTCGTTCGTTTATCGGGTATTTTAGT (SEQ ID NO: 5),
the sequence of the downstream primer is as follows: GTCGCTACGACACACATdICG (SEQ ID NO: 6);
wherein dI in the primer sequence represents deoxyinosinic acid; the 5 'end of the fluorescent probe sequence is provided with a fluorescent group, and the 3' end of the fluorescent probe sequence is provided with a quenching group and minor groove binding molecules;
(3) taq enzyme, UNG enzyme, dNTPs, dUTP, Mg2+And a PCR buffer;
(4) a first additive and a second additive, wherein the first additive comprises bovine serum albumin, and the second additive comprises dimethyl sulfoxide and NH4Cl and aqueous sorbitol solution; and
optionally, (5) specific primers and probe sequences thereof for detecting methylation of ACTB gene as an internal standard:
the sequence of the upstream primer is as follows: AAAGGGTGTAGTGTTGGGAGGTTA (SEQ ID NO: 7),
the fluorescent probe sequence is as follows: TCTTCTAATAACCACCTCCCTCCTT (SEQ ID NO: 8),
the sequence of the downstream primer is as follows: AAAACCAACCACAAAACAA (SEQ ID NO: 9);
wherein, the 5 'end of the fluorescent probe sequence is provided with a fluorescent group VIC, and the 3' end is provided with a quenching group BHQ 1.
Further, the fluorescent group is FAM, and the quencher group is BHQ 1.
According to a third aspect of the present invention, the present invention provides a fluorescent PCR reaction system for detecting methylation of BMP3 and NDRG4 genes based on ARMS-PCR method, wherein each 50. mu.L of the fluorescent PCR reaction system comprises:
(1) mu.L of each 10. mu.M primer sequence and 1.5. mu.L of each 10. mu.M probe sequence; wherein, the primer sequence and the probe sequence comprise:
(1a) specific primers and probe sequences thereof for detecting methylation of BMP3 gene:
the sequence of the upstream primer is as follows: GAGTTAAGTTTCGGTTTCdITC (SEQ ID NO: 1),
the fluorescent probe sequence is as follows: GCAAAAAACCGACGACGAAA (SEQ ID NO: 2),
the sequence of the downstream primer is as follows: GTCGCTACGCAACACTdICG (SEQ ID NO: 3);
(1b) specific primers and probe sequences thereof for detecting methylation of NDRG4 gene:
the sequence of the upstream primer is as follows: TTTCGCGTCGCGGTTGTCGdITC (SEQ ID NO: 4),
the fluorescent probe sequence is as follows: TTTTTCGTTCGTTTATCGGGTATTTTAGT (SEQ ID NO: 5),
the sequence of the downstream primer is as follows: GTCGCTACGACACACATdICG (SEQ ID NO: 6);
wherein dI in the primer sequence represents deoxyinosinic acid; the 5 'end of the fluorescent probe sequence is provided with a fluorescent group, and the 3' end of the fluorescent probe sequence is provided with a quenching group and minor groove binding molecules; preferably, the fluorescent group is FAM and the quencher group is BHQ 1;
(2) 2 units of Taq enzyme and UNG enzyme; 10mM dNTPs and 2.5mM dUTP 0.4. mu.L; 50mM Mg2+1.5 mu L; 10 XPCR buffer 5. mu.L;
(3) 2 μ L of first additive and 1.25 μ L of second additive, wherein the first additive comprises 10mg/mL bovine serum albumin, and the second additive comprises dimethyl sulfoxide and 250mM NH4Cl and 60% aqueous sorbitol solution;
(4) 20-40 ng of DNA material which is used as a template and subjected to conversion treatment, wherein the conversion is to convert CpG sites in the DNA material containing the BMP3 and NDRG4 genes so that unmethylated CpG sites are converted into UpG; and
(5) the balance of water.
Further, the fluorescent PCR system further comprises, per 50. mu.L of the fluorescent PCR system:
(6) primer sequences of 10. mu.M internal standard are 1. mu.L each, and probe sequences of 10. mu.M internal standard are 0.5. mu.L, wherein the primer sequences and probe sequences of the internal standard comprise ACTB gene methylation specific primers and probe sequences thereof:
the sequence of the upstream primer is as follows: AAAGGGTGTAGTGTTGGGAGGTTA (SEQ ID NO: 7),
the fluorescent probe sequence is as follows: TCTTCTAATAACCACCTCCCTCCTT (SEQ ID NO: 8),
the sequence of the downstream primer is as follows: AAAACCAACCACAAAACAA (SEQ ID NO: 9);
wherein, the 5 'end of the fluorescent probe sequence is provided with a fluorescent group VIC, and the 3' end is provided with a quenching group BHQ 1.
The detection method has the advantages that the detection of 0.1-1% of the low methylation level of BMP3 and NDRG4 genes is realized, the detection sensitivity is improved, the accuracy of a single CpG site to 5-15 CpG sites is improved, and the false positive result caused by the fact that a single CpG island represents the methylation level of the whole gene in the conventional detection is avoided.
Drawings
FIG. 1 is a schematic representation of the conversion of normal tissue (unmethylated) CpG sites to UpG by bisulfate treatment;
FIG. 2 is a schematic diagram of the principle of CpG after a (methylated) CpG site of a tumor tissue is treated with a bisulfate salt;
FIG. 3 is a schematic diagram of tumor type fluorescence signal detection and wild type fluorescence signal detection, wherein dI (deoxyInosine) is deoxyhypoxanthine-modified 3' end penultimate 3 base with weak binding force;
FIG. 4 is a FAM fluorescence plot showing the detection signals of the target region of the BMP3 gene in 0.15ng (1%) of tumor (methylated) DNA after the conversion treatment + in 15ng (99%) of normal cell (non-methylated) DNA after the conversion treatment;
FIG. 5 is a graph of VIC fluorescence signals measured from 0.15ng (1%) of tumor (methylated) DNA after transformation + 15ng (99%) of normal cell (non-methylated) DNA after transformation;
FIG. 6 is a FAM fluorescence plot showing the detection signal of 0.15ng (100%) of tumor (methylated) DNA in the target region of BMP3 gene after transformation;
FIG. 7 is a VIC fluorescence plot of the detection signal of 0.15ng (100%) internal standard region of tumor (methylated) DNA after transformation;
FIG. 8 is a FAM fluorescence plot showing the detection signal of 15ng (100%) of DNA from normal cells (without methylation) of BMP3 gene in the target region after the transformation treatment;
FIG. 9 is a VIC fluorescence plot showing the detection signal of 15ng (100%) of DNA internal standard region in normal cells after transformation treatment (no methylation);
FIG. 10 is a FAM fluorescence plot showing detection signals of 15ng (100%) of DNA of BMP3 gene in a target region in normal cells without conversion treatment (without methylation);
FIG. 11 is a graph showing VIC fluorescence signals detected in 15ng (100%) of DNA internal standard region of normal cells without conversion treatment (no methylation);
FIG. 12 is a FAM fluorescence plot of detection signals of 15ng (100%) of BMP3 gene target regions in fecal samples after conversion treatment;
FIG. 13 is a VIC fluorescence plot of the detection signal of 15ng (100%) internal standard region of fecal sample DNA after conversion treatment;
FIG. 14 is a FAM fluorescence plot of the detection signal of the target region of the tumor (methylated) DNA 0.15ng (1%) + after conversion treatment in normal cells (non-methylated) DNA15ng (99%) NDRG4 gene after conversion treatment;
FIG. 15 is a graph of VIC fluorescence signals measured from 0.15ng (1%) of tumor (methylated) DNA after transformation + 15ng (99%) of normal cell (non-methylated) DNA after transformation;
FIG. 16 is a FAM fluorescence plot showing the detection signal of 0.15ng (100%) of NDRG4 gene in the target region after transformation treatment;
FIG. 17 is a VIC fluorescence plot of the detection signal of 0.15ng (100%) internal standard region of tumor (methylated) DNA after conversion treatment;
FIG. 18 is a FAM fluorescence plot showing detection signals of 15ng (100%) of DNA of NDRG4 gene in a target region after transformation treatment;
FIG. 19 is a graph showing VIC fluorescence signals detected in 15ng (100%) of DNA from normal cells after transformation (no methylation);
FIG. 20 is a FAM fluorescence plot showing detection signals of 15ng (100%) of NDRG4 gene target region in normal cells without transformation (no methylation);
FIG. 21 is a graph showing VIC fluorescence signals detected in 15ng (100%) of DNA internal standard region of normal cells without conversion treatment (no methylation);
FIG. 22 is a FAM fluorescence plot showing the detection signal of the target region of NDRG4 gene in 15ng (100%) of fecal sample DNA after conversion treatment;
FIG. 23 is a graph showing VIC fluorescence signals of the detection signal of the internal standard region of the fecal sample DNA15ng (100%) after the conversion treatment.
Detailed Description
The present invention will be described in further detail with reference to the following detailed description and accompanying drawings.
The present inventors have conducted a series of studies and have found a novel ARMS-based (mutant amplification line) in the study of methylation detection of BMP3 and NDRG4 genes in human fecal DNA and paraffin section DNAThe detection method and the kit for detecting the methylation level of BMP3 and NDRG4 genes by the conventional-PCR method have non-diagnostic application. The detection method provided by the invention is used for designing ARMS-PCR primers and probes thereof aiming at 5-15 CpG sites in a region from 81952348 to 81952402 of human chromosome 4 BMP3 gene (chromosome 4, GRCh37.p13) and a region from 58497395 to 58497451 of human chromosome 16 NDRG4 gene (chromosome 16, GRCh37.p13), and realizes the low-frequency 0.1-1% methylation level of 3 and NDRG4 genes in sample DNA after methylation conversion reagent treatment by combining optimized PCR reaction liquid and high-efficiency Taq enzyme, the detection region comprises 5-15 CpG sites, and the detection result is rapid, visual and convenient to distinguish. The detection method comprises the following steps: after a methylation conversion reagent is used for converting biological sample DNA (the principle of the methylation conversion reagent is shown in figures 1 and 2), the methylation level of 5-15 CpG sites in a specific CpG island region of BMP3 and NDRG4 genes in the converted DNA is detected, the upstream CpG site specific ARMS primer design and base modification, the downstream CpG site specific ARMS primer design and base modification and the design of a Taq-man MGB probe primer in a middle CpG site region (the principle of the methylation conversion reagent is shown in figure 3) of the gene segment are carried out, and dNTPs, Mg ions, NH ions in a PCR amplification system are further carried out4Cl, Bovine Serum Albumin (BSA), dimethyl sulfoxide (DMSO), sorbitol and other chemical reagents are added in a specific proportion to achieve the optimal reaction system condition of ARMS-PCR primer work, the PCR amplification step is optimized, a q-PCR platform is combined, the detection of 0.1-1% of the low methylation level of BMP3 and NDRG4 genes is realized, meanwhile, no amplification signal exists in the background of 200 ng/wild type human DNA of reaction after conversion, the false positive condition does not occur, and the detection result is rapid, visual and convenient to distinguish.
The specific primer and the probe sequence thereof used by the invention comprise:
(b1) specific primers and probe sequences thereof for detecting methylation of BMP3 gene:
the sequence of the upstream primer is as follows: GAGTTAAGTTTCGGTTTCdITC (SEQ ID NO: 1),
the fluorescent probe sequence is as follows: GCAAAAAACCGACGACGAAA (SEQ ID NO: 2),
the sequence of the downstream primer is as follows: GTCGCTACGCAACACTdICG (SEQ ID NO: 3);
(b2) specific primers and probe sequences thereof for detecting methylation of NDRG4 gene:
the sequence of the upstream primer is as follows: TTTCGCGTCGCGGTTGTCGdITC (SEQ ID NO: 4),
the fluorescent probe sequence is as follows: TTTTTCGTTCGTTTATCGGGTATTTTAGT (SEQ ID NO: 5),
the sequence of the downstream primer is as follows: GTCGCTACGACACACATdICG (SEQ ID NO: 6);
wherein dI in the primer sequence represents deoxyinosinic acid; the 5 'end of the fluorescent probe sequence is provided with a fluorescent group, and the 3' end is provided with a quenching group and minor groove binding molecules.
The specific primer and the probe sequence thereof are specially designed, and are characterized in that a fluorescent PCR signal is detected only when 5-15 continuous CpG sites are methylated, and the fluorescent PCR signal cannot be detected when less than 5 continuous CpG sites are methylated, so that a false positive phenomenon that methylation of 1 CpG site represents the methylation level of the whole gene is avoided, and the false positive phenomenon is difficult to avoid by the conventional method for detecting the methylation of BMP3 and NDRG4 genes. When the fluorescent probe sequence of the present invention is bound to the target region, the entire fluorescent probe sequence is bound as long as at least 3 sites (preferably 3 to 5 sites) are not bound, and these sites are sites where there is a difference between methylated and unmethylated CpG sites after conversion by the methylation conversion reagent. The fluorescent probe sequence has a fluorescent group at the 5 'end, and has a small groove binding molecule at the 3' end besides a quenching group, so that the fluorescent probe sequence can be further flicked under the condition that sites are not bound, and the fluorescent PCR signal can be detected only when 5-15 continuous CpG sites are methylated. Meanwhile, dI in the primer sequence is positioned at the 3 rd base from the 3 ' end, and the existence of the base weakens the binding force with the target region, so that once the base at the 3 ' end of the primer sequence cannot be paired with the target region, the amplification reaction is difficult to occur, namely, under the condition that the normal tissue (unmethylated) CpG site is converted into UpG through the bisulfate treatment, the base at the 3 ' end cannot be paired, and the amplification reaction cannot occur; and after the methylated CpG sites are treated by heavy sulfate, the base at the 3' end can still be paired to generate an amplification reaction. Therefore, the ingenious design of the specific primers and the probe sequences thereof ensures that the fluorescent PCR signals are detected only when 5-15 continuous CpG sites are methylated.
The present invention also uses UNG enzyme, which selectively hydrolytically cleaves uracil glycosidic bonds in dU-containing double-stranded or single-stranded DNA, forming DNA strands with missing bases that are further hydrolytically cleaved in alkaline medium and at elevated temperatures. Therefore, in the system in which UNG enzyme and dUTP exist, pollution can be eliminated and prevented. For example, a step of reacting at 50 ℃ for 2min is provided before the PCR reaction, and UNG enzyme is made to act on amplification products possibly existing in the U base cutting environment so as to eliminate false positive results possibly caused by the reaction and make the detection result more accurate.
The invention uses bovine serum albumin as a first additive, and the additive contains dimethyl sulfoxide and NH4A second additive of Cl and aqueous sorbitol solution allows sensitive binding or non-binding of the target region for probes and primers with different methylation at CpG sites. That is, the presence of the first additive and the second additive provides a favorable environment for the binding of the probe and the primer, so that a positive fluorescent PCR signal is generated under the condition of methylation of 5-15 continuous CpG sites; whereas in the case of only 1 CpG site methylation, a positive fluorescent PCR signal is not generated.
In addition, a methylation specific internal standard (human ACTB gene conserved region) is set for control, different fluorescence labeling probes are adopted for the control and the target gene, the amount of effective DNA of a sample treated by a methylation conversion reagent to be detected is monitored by detecting whether the internal standard is normal, and meanwhile, whether a PCR inhibitor exists in the sample treated by conversion is monitored, so that PCR false negative is avoided.
The inventor also optimizes the fluorescent PCR reaction system and realizes the optimal amplification effect. The inventor obtains an optimal fluorescent PCR reaction system, wherein each 50 mu L of the fluorescent PCR reaction system comprises: 2 units of Taq enzyme and UNG enzyme; 10mM dNTPs (including 2.5mM each of dATP, dCTP, dGTP, dTTP) and 2.5mM dUTP 0.4. mu.L; 50mM Mg2+1.5μL(ii) a 10 XPCR buffer 5. mu.L; mu.L each of 10. mu.M primer sequences (SEQ ID NOS: 1, 3, 4, 6) and 1.5. mu.L each of 10. mu.M probe sequences (SEQ ID NOS: 2, 5); 20-40 ng of DNA material after conversion treatment as a template; 10mg/mL bovine serum albumin 2. mu.L, dimethyl sulfoxide, 250mM NH41.25 μ L of Cl and 60% sorbitol in water, and the balance water.
The technical solutions and technical effects of the present invention are described in detail below by examples, and it should be understood that the examples are only illustrative and should not be construed as limiting the scope of the present invention.
In the following examples, the sample DNA conversion process used EZ-96 DNAlgorion-Gold from ZYMO RESEARCHTMMagPre kit according to the instructions for operation.
The specific primers and probe sequences used were as follows:
(1) specific primers and probe sequences thereof for detecting methylation of BMP3 gene:
the sequence of the upstream primer is as follows: GAGTTAAGTTTCGGTTTCdITC (SEQ ID NO: 1),
the fluorescent probe sequence is as follows: FAM-GCAAAAAACCGACGACGAAA-BHQ1-MGB (SEQ ID NO: 2),
the sequence of the downstream primer is as follows: GTCGCTACGCAACACTdICG (SEQ ID NO: 3);
(2) specific primers and probe sequences thereof for detecting methylation of NDRG4 gene:
the sequence of the upstream primer is as follows: TTTCGCGTCGCGGTTGTCGdITC (SEQ ID NO: 4),
the fluorescent probe sequence is as follows:
FAM-TTTTTCGTTCGTTTATCGGGTATTTTAGT-BHQ1-MGB(SEQ ID NO：5)，
the sequence of the downstream primer is as follows: GTCGCTACGACACACATdICG (SEQ ID NO: 6);
(3) specific primers and probe sequences thereof for detecting methylation of ACTB gene as an internal standard:
the sequence of the upstream primer is as follows: AAAGGGTGTAGTGTTGGGAGGTTA (SEQ ID NO: 7),
the fluorescent probe sequence is as follows: VIC-TCTTCTAATAACCACCTCCCTCCTT-BHQ1(SEQ ID NO: 8),
the sequence of the downstream primer is as follows: AAAACCAACCACAAAACAA (SEQ ID NO: 9).
The single-tube reaction liquid for detecting the methylation of BMP3 and NDRG4 genes comprises the following components in the following table 1:
TABLE 1
The procedure for the fluorescent PCR reaction was: reacting at 50 ℃ for 2 min; reacting at 95 ℃ for 5 min; reacting at 95 ℃ for 15s and then at 60 ℃ for 30s for 15 cycles; reacting at 95 ℃ for 15s and then at 60 ℃ for 30s for 30 cycles and collecting fluorescence signals; the reaction was carried out at 20 ℃ for 2 min.
FIG. 4 shows a FAM fluorescence plot of the detection signal of the target region of the BMP3 gene at 0.15ng (1%) of tumor (methylated) DNA after the conversion treatment + at 15ng (99%) of normal cell (non-methylated) DNA after the conversion treatment, and a fluorescence signal is observed; FIG. 5 shows the VIC fluorescence plot of the signal detected from the internal standard region of 0.15ng (1%) of tumor (methylated) DNA after the conversion treatment + 15ng (99%) of normal cell (non-methylated) DNA after the conversion treatment, with a visible fluorescence signal; FIG. 6 shows a FAM fluorescence plot of the detection signal of 0.15ng (100%) of BMP3 gene target region after transformation treatment, with a visible fluorescence signal; FIG. 7 shows a VIC fluorescence plot of the detection signal of 0.15ng (100%) internal standard region of tumor (methylated) DNA after conversion treatment, with a visible fluorescence signal; FIG. 8 shows a FAM fluorescence plot showing the detection signal of 15ng (100%) of DNA of normal cells (without methylation) of BMP3 gene in the target region after conversion treatment, and no fluorescence signal can be seen; FIG. 9 shows a VIC fluorescence plot of the detection signal of 15ng (100%) of the internal standard region of DNA from normal cells after conversion treatment, with a visible fluorescence signal; FIG. 10 shows a FAM fluorescence plot showing detection signals of 15ng (100%) of BMP3 gene target region in normal cells without conversion treatment (no methylation), and no fluorescence signals are visible; FIG. 11 shows a VIC fluorescence plot of the detection signal from a15ng (100%) internal standard region of DNA from normal cells without conversion treatment (no methylation), with no fluorescence signal visible; FIG. 12 shows a FAM fluorescence plot showing the detection signal of the target region of BMP3 gene in feces sample DNA15ng (100%) after conversion treatment, and no fluorescence signal can be seen; FIG. 13 shows a VIC fluorescence plot of the detection signal of 15ng (100%) of the internal standard region of the fecal sample DNA after conversion treatment, with a visible fluorescence signal; FIG. 14 shows a FAM fluorescence plot of the detection signal of the target region of the tumor (methylated) DNA 0.15ng (1%) + after the conversion treatment of the normal cell (non-methylated) DNA15ng (99%) NDRG4 gene after the conversion treatment, with a visible fluorescence signal; FIG. 15 shows the VIC fluorescence plot of the detection signal from 0.15ng (1%) of tumor (methylated) DNA after conversion treatment + 15ng (99%) of normal cell (non-methylated) DNA after conversion treatment in the internal standard region, with a visible fluorescence signal; FIG. 16 shows a FAM fluorescence plot of the detection signal of 0.15ng (100%) NDRG4 gene target region after transformation treatment with fluorescence signal visible; FIG. 17 shows a VIC fluorescence plot of the detection signal of 0.15ng (100%) internal standard region of tumor (methylated) DNA after conversion treatment, with a visible fluorescence signal; FIG. 18 shows a FAM fluorescence plot showing detection signals of 15ng (100%) of DNA of NDRG4 gene in a target region after transformation treatment, showing no fluorescence signal; FIG. 19 shows a VIC fluorescence plot of the detection signal of 15ng (100%) of the internal standard region of DNA from normal cells after conversion treatment, with a visible fluorescence signal; FIG. 20 shows a FAM fluorescence plot showing detection signals of 15ng (100%) of NDRG4 gene target region in normal cells without switch processing (no methylation), and no fluorescence signals are visible; FIG. 21 shows a VIC fluorescence plot of the detection signal from a15ng (100%) internal standard region of DNA from normal cells without conversion treatment (no methylation), with a visible fluorescence signal; FIG. 22 shows a FAM fluorescence plot showing the detection signal of the target region of the DNA15ng (100%) NDRG4 gene in feces samples after conversion treatment, showing no fluorescence signal; FIG. 23 shows a VIC fluorescence plot of the detection signal of the internal standard region of the fecal sample DNA15ng (100%) after conversion treatment, with a visible fluorescence signal.
The foregoing is a more detailed description of the present invention that is presented in conjunction with specific embodiments, and the practice of the invention is not to be considered limited to those descriptions. For those skilled in the art to which the invention pertains, several simple deductions or substitutions can be made without departing from the spirit of the invention, and all shall be considered as belonging to the protection scope of the invention.
SEQUENCE LISTING
<110> human and future Biotechnology (Changsha) Ltd
<120> ARMS-PCR-based fluorescence PCR method, kit and system for detecting BMP3 and NDRG4 gene methylation
<130>17I23924
<160>9
<170>PatentIn version 3.3
<210>1
<211>22
<212>DNA
<213> Artificial sequence
<220>
<221>misc_feature
<222>(20)..(20)
<223> n is deoxyhypoxanthine
<400>1
gagtttaagt ttcggtttcn tc 22
<210>2
<211>20
<212>DNA
<213> Artificial sequence
<400>2
<210>3
<211>19
<212>DNA
<213> Artificial sequence
<220>
<221>misc_feature
<222>(17)..(17)
<223> n is deoxyhypoxanthine
<400>3
gtcgctacgc aacactncg 19
<210>4
<211>22
<212>DNA
<213> Artificial sequence
<220>
<221>misc_feature
<222>(20)..(20)
<223> n is deoxyhypoxanthine
<400>4
tttcgcgtcg cggttgtcgn tc 22
<210>5
<211>29
<212>DNA
<213> Artificial sequence
<400>5
tttttcgttc gtttatcggg tattttagt 29
<210>6
<211>19
<212>DNA
<213> Artificial sequence
<220>
<221>misc_feature
<222>(17)..(17)
<223> n is deoxyhypoxanthine
<400>6
gtcgctacga cacactncg 19
<210>7
<211>24
<212>DNA
<213> Artificial sequence
<400>7
aaagggtgta gtgttgggag gtta 24
<210>8
<211>25
<212>DNA
<213> Artificial sequence
<400>8
tcttctaata accacctccc tcctt 25
<210>9
<211>19
<212>DNA
<213> Artificial sequence
<400>9
aaaaccaacc acaaaacaa 19
Claims (5)
1. A fluorescence PCR kit for detecting BMP3 and NDRG4 gene methylation based on ARMS-PCR method is characterized by comprising:
(1) specific primers and probe sequences thereof for detecting methylation of BMP3 gene:
the sequence of the upstream primer is as follows: GAGTTAAGTTTCGGTTTCdITC (SEQ ID NO: 1),
the fluorescent probe sequence is as follows: GCAAAAAACCGACGACGAAA (SEQ ID NO: 2),
the sequence of the downstream primer is as follows: GTCGCTACGCAACACTdICG (SEQ ID NO: 3);
(2) specific primers and probe sequences thereof for detecting methylation of NDRG4 gene:
the sequence of the upstream primer is as follows: TTTCGCGTCGCGGTTGTCGdITC (SEQID NO: 4),
the fluorescent probe sequence is as follows: TTTTTCGTTCGTTTATCGGGTATTTTAGT (SEQ ID NO: 5),
the sequence of the downstream primer is as follows: GTCGCTACGACACACATdICG (SEQ ID NO: 6);
wherein dI in the primer sequence represents deoxyinosinic acid; the 5 'end of the fluorescent probe sequence is provided with a fluorescent group, and the 3' end of the fluorescent probe sequence is provided with a quenching group and minor groove binding molecules;
(3) taq enzyme, UNG enzyme, dNTPs, dUTP, Mg2+And a PCR buffer;
(4) a first additive and a second additive, wherein the first additive comprises bovine serum albumin, and the second additive comprises dimethyl sulfoxide and NH4Cl and aqueous sorbitol solution.
2. The kit according to claim 1, wherein the fluorescent group of the fluorescent probe sequence in (1) and (2) is FAM and the quencher group of the fluorescent probe sequence in (1) and (2) is BHQ 1.
3. The kit of claim 2, further comprising
(5) Specific primers and probe sequences thereof for detecting methylation of ACTB gene as an internal standard:
the sequence of the upstream primer is as follows: AAAGGGTGTAGTGTTGGGAGGTTA (SEQ ID NO: 7),
the fluorescent probe sequence is as follows: TCTTCTAATAACCACCTCCCTCCTT (SEQ ID NO: 8),
the sequence of the downstream primer is as follows: AAAACCAACCACAAAACAA (SEQ ID NO: 9);
wherein, the 5 'end of the fluorescent probe sequence has a fluorescent group VIC, and the 3' end has a quenching group BHQ 1.
4. A fluorescence PCR reaction system for detecting BMP3 and NDRG4 gene methylation based on ARMS-PCR method is characterized in that every 50 mu L of the fluorescence PCR reaction system comprises:
(1) mu.L of each 10. mu.M primer sequence and 1.5. mu.L of each 10. mu.M probe sequence; wherein the primer sequence and the probe sequence comprise:
(1a) specific primers and probe sequences thereof for detecting methylation of BMP3 gene:
the sequence of the upstream primer is as follows: GAGTTAAGTTTCGGTTTCdITC (SEQ ID NO: 1),
the fluorescent probe sequence is as follows: GCAAAAAACCGACGACGAAA (SEQ ID NO: 2),
the sequence of the downstream primer is as follows: GTCGCTACGCAACACTdICG (SEQ ID NO: 3);
(1b) specific primers and probe sequences thereof for detecting methylation of NDRG4 gene:
the sequence of the upstream primer is as follows: TTTCGCGTCGCGGTTGTCGdITC (SEQ ID NO: 4),
the fluorescent probe sequence is as follows: TTTTTCGTTCGTTTATCGGGTATTTTAGT (SEQ ID NO: 5),
the sequence of the downstream primer is as follows: GTCGCTACGACACACATdICG (SEQ ID NO: 6);
wherein dI in the primer sequence represents deoxyinosinic acid; the 5 'end of the fluorescent probe sequence is provided with a fluorescent group, and the 3' end of the fluorescent probe sequence is provided with a quenching group and minor groove binding molecules; the fluorescent group is FAM, and the quenching group is BHQ 1;
(2) 2 units of Taq enzyme and UNG enzyme; 10mM dNTPs and 2.5mM dUTP 0.4. mu.L; 50mM Mg2+1.5 mu L; 10 XPCR buffer 5. mu.L;
(3) 2 μ L of first additive and 1.25 μ L of second additive, wherein the first additive comprises 10mg/mL bovine serum albumin, and the second additive comprises dimethyl sulfoxide and 250mM NH4Cl and 60% aqueous sorbitol solution;
(4) 20-40 ng of DNA material which is used as a template and subjected to conversion treatment, wherein the conversion is to convert CpG sites in the DNA material containing the BMP3 and NDRG4 genes so that unmethylated CpG sites are converted into UpG; and
(5) the balance of water.
5. The fluorescent PCR reaction system of claim 4, wherein each 50 μ L of the fluorescent PCR reaction system further comprises:
(6)1 μ L of each primer sequence of 10 μ M internal standard, and 0.5 μ L of probe sequence of 10 μ M internal standard, wherein the primer sequences and probe sequences of internal standard comprise ACTB gene methylation specific primers and probe sequences thereof:
the sequence of the upstream primer is as follows: AAAGGGTGTAGTGTTGGGAGGTTA (SEQ ID NO: 7),
the fluorescent probe sequence is as follows: TCTTCTAATAACCACCTCCCTCCTT (SEQ ID NO: 8),
the sequence of the downstream primer is as follows: AAAACCAACCACAAAACAA (SEQ ID NO: 9);
wherein, the 5 'end of the fluorescent probe sequence has a fluorescent group VIC, and the 3' end has a quenching group BHQ 1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710090789.8A CN106978481B (en) | 2017-02-20 | 2017-02-20 | Fluorescent PCR method, kit and system for detecting BMP3 and NDRG4 gene methylation based on ARMS-PCR method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710090789.8A CN106978481B (en) | 2017-02-20 | 2017-02-20 | Fluorescent PCR method, kit and system for detecting BMP3 and NDRG4 gene methylation based on ARMS-PCR method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106978481A CN106978481A (en) | 2017-07-25 |
| CN106978481B true CN106978481B (en) | 2020-06-16 |
Family
ID=59338020
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710090789.8A Active CN106978481B (en) | 2017-02-20 | 2017-02-20 | Fluorescent PCR method, kit and system for detecting BMP3 and NDRG4 gene methylation based on ARMS-PCR method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106978481B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2021112127A (en) * | 2018-04-26 | 2021-08-05 | 暁生 黒田 | METHOD FOR EXAMINING PANCREATIC β-CELL INJURY |
| CN109811056A (en) * | 2019-02-28 | 2019-05-28 | 苏州唯善生物科技有限公司 | For colorectal cancer and its primed probe group and kit of precancerous lesion early diagnosis, detection or screening |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105506133A (en) * | 2016-01-15 | 2016-04-20 | 武汉艾米森生命科技有限公司 | Composition, kit and method for detecting SEPT9 gene methylation |
| CN105567837A (en) * | 2016-02-02 | 2016-05-11 | 河南中医学院第一附属医院 | Primer and probe system, method and kit for detecting K-ras gene mutation |
| CN106399570A (en) * | 2016-11-30 | 2017-02-15 | 杭州诺辉健康科技有限公司 | Kit for early stage colorectal cancer auxiliary diagnosis and use method and detection system thereof |
-
2017
- 2017-02-20 CN CN201710090789.8A patent/CN106978481B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105506133A (en) * | 2016-01-15 | 2016-04-20 | 武汉艾米森生命科技有限公司 | Composition, kit and method for detecting SEPT9 gene methylation |
| CN105567837A (en) * | 2016-02-02 | 2016-05-11 | 河南中医学院第一附属医院 | Primer and probe system, method and kit for detecting K-ras gene mutation |
| CN106399570A (en) * | 2016-11-30 | 2017-02-15 | 杭州诺辉健康科技有限公司 | Kit for early stage colorectal cancer auxiliary diagnosis and use method and detection system thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106978481A (en) | 2017-07-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109952381B (en) | Method for multiplex detection of methylated DNA | |
| EP3800273A1 (en) | Use of detection reagent for detecting methylation of genes associated with colorectal cancer, and kit | |
| CN107475366B (en) | Composition for detecting diseases and kit and application thereof | |
| CN106834426B (en) | Composition for detecting pancreatic cancer and use thereof | |
| EP2885427A1 (en) | Colorectal cancer markers | |
| CN108103206B (en) | Intramuscular fat related lncRNA and application thereof | |
| CN104024427A (en) | Dna methylation in colorectal and breast cancer diagnostic methods | |
| CN106947805B (en) | Fluorescent PCR kit and system based on septin9 gene methylation in ARMS-PCR method detection human peripheral dissociative DNA | |
| KR101573467B1 (en) | Method for Detecting Bladder Cancer Using Bladder Cancer Specific Epigenetic Marker Gene | |
| CN110964823A (en) | DNA methylation kit for colorectal cancer detection and detection method | |
| KR102275752B1 (en) | Method and kit for determining the genome integrity and/or the quality of a library of dna sequences obtained by deterministic restriction site whole genome amplification | |
| CN106978481B (en) | Fluorescent PCR method, kit and system for detecting BMP3 and NDRG4 gene methylation based on ARMS-PCR method | |
| CN113493835A (en) | Method and kit for screening large intestine tumor by detecting methylation state of BCAN gene region | |
| WO2011135058A2 (en) | Methods for detecting epigenetic modifications | |
| CN116219020B (en) | Methylation reference gene and application thereof | |
| CA3029842A1 (en) | Methylated control dna | |
| CN114891886B (en) | Nucleic acid product, kit and application for diagnosing bladder cancer | |
| EP1918711A2 (en) | Prostate cancer field effect analysis methods and kits | |
| CN115851973A (en) | Method and kit for rapidly detecting human InDel genetic polymorphism by real-time fluorescent PCR (polymerase chain reaction) and application | |
| CN111088351A (en) | Composition for detecting lung cancer and application thereof | |
| WO2005021743A1 (en) | Primers for nucleic acid amplification and method of examining colon cancer using the same | |
| JP4836710B2 (en) | Method and kit for detecting microsatellite unstable cells | |
| CN109868320B (en) | Composition for detecting esophageal cancer and application thereof | |
| CN115094139B (en) | Application of reagent for detecting methylation level in preparation of bladder cancer diagnosis product and bladder cancer diagnosis kit | |
| CN111826440B (en) | Composition for detecting esophageal cancer and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |