CN116064905A - Primer combination for detecting verticillium dahliae, kit and application - Google Patents

Primer combination for detecting verticillium dahliae, kit and application Download PDF

Info

Publication number
CN116064905A
CN116064905A CN202211203289.8A CN202211203289A CN116064905A CN 116064905 A CN116064905 A CN 116064905A CN 202211203289 A CN202211203289 A CN 202211203289A CN 116064905 A CN116064905 A CN 116064905A
Authority
CN
China
Prior art keywords
seq
rpa
primer
verticillium dahliae
sequence
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202211203289.8A
Other languages
Chinese (zh)
Inventor
王永林
陈琦
唐晨
黄建东
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Beijing Changhui Linhai Ecological Technology Co ltd
Beijing Forestry University
Original Assignee
Beijing Changhui Linhai Ecological Technology Co ltd
Beijing Forestry University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Beijing Changhui Linhai Ecological Technology Co ltd, Beijing Forestry University filed Critical Beijing Changhui Linhai Ecological Technology Co ltd
Priority to CN202211203289.8A priority Critical patent/CN116064905A/en
Publication of CN116064905A publication Critical patent/CN116064905A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/645—Fungi ; Processes using fungi
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Immunology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Botany (AREA)
  • Mycology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention relates to a primer combination, a kit and application for detecting verticillium dahliae. The primer combination comprises an RPA primer pair and crRNA; the target genes of the RPA primer pair comprise Verticillium dahliae ITS genes; the target gene of the crRNA comprises an ITS gene of verticillium dahliae. The primer combination and the kit provided by the invention combine the RPA amplification technology and the CRISPR detection technology, realize the rapid detection of the Verticillium dahliae, and have the advantages of high sensitivity, strong specificity and high detection efficiency. The primer combination and the kit are applied to the detection of the verticillium dahliae, and have important significance for the prevention and treatment of the cotinus coggygria wilt caused by the verticillium dahliae infection.

Description

Primer combination for detecting verticillium dahliae, kit and application
Technical Field
The invention relates to the technical field of biological detection, in particular to a primer combination, a kit and application for detecting verticillium dahliae.
Background
The Cotinus coggygria (Cotinus coggygria) is a Cotinus coggygria (Cotinus) plant of the Anacardiaceae (Anaardiaceae), fallen leaves, shrubs or small trees, has reddish autumn leaves, has great ornamental value and economic value, and is a main tree species of the red leaf landscape in the autumn of the Beijing aromatic mountain park. Since the discovery of cotinus coggygria in the 80 s of the last century, it has a tendency to develop more serious year by year. The disease causes the cotinus coggygria leaves to wilt while yellowing inward from the leaf edges, or to desiccation curls, but generally does not fall off; the vascular bundles of the root and the stem are necrotized, brown color lines appear at the junction of the xylem and the cortex, part of crotch dies rapidly, and the whole plant can be weakened or die when the disease is serious.
The pathogenic bacteria of the cotinus coggygria wilt is Verticillium dahliae (Verticillium dahliae), the asexual generation belongs to the genus Verticillium (Verticillium) of the class Cellulare (Hyphomycetes) of the phylum Deuteromycetes, and black microsclerotia are often formed on the colony surface, so that the temperature application range is wider, and the plant has high temperature resistance. The verticillium dahliae is typical soil-dwelling bacteria, hyphae generated by germination of microsclerotia in soil invade a vascular bundle through wounds on the surface of a cotinus coggygria root system, and then generate conidium which expands upwards along the vascular bundle along with transpiration flow. The verticillium dahliae has slow expansion and long incubation period in the host body, and when obvious wilting symptoms appear on the leaves, a large number of pathogenic bacteria exist in the roots and stems of the verticillium dahliae, so that the optimal control period is easy to miss, and the large-area outbreak of diseases is caused.
The detection method for cotinus coggygria wilt mainly comprises pathogen separation and identification. However, the traditional pathogen separation and identification methods are time-consuming and labor-consuming, have large defects in detection time and operation level, and are difficult to rapidly detect a large number of seedlings. Therefore, the rapid and high-sensitivity smoke tree wilt germ detection technology is established and has important significance for the control of the smoke tree wilt.
Disclosure of Invention
Aiming at the problems existing in the prior art, the invention provides a primer combination, a kit and application for detecting verticillium dahliae. The primer combination provided by the invention can be used for rapidly detecting target genes, has high sensitivity and strong specificity, and has important significance for preventing and treating the smoke tree wilt caused by verticillium dahliae infection.
The invention provides a primer combination for detecting verticillium dahliae, which comprises an RPA primer pair and crRNA; the target genes of the RPA primer pair comprise Verticillium dahliae ITS genes; the target gene of the crRNA comprises an ITS gene of verticillium dahliae.
Preferably, the RPA primer pair comprises an upstream primer and a downstream primer; the sequence of the upstream primer comprises one of seq_1, seq_2, seq_3 and seq_4; the sequence of the downstream primer includes one of seq_5, seq_6, seq_7 and seq_8.
Preferably, the sequence of the upstream primer comprises seq_1; the sequence of the downstream primer includes seq_6.
Preferably, the crRNA comprises a framework nucleic acid fragment sequence and a guide sequence; the guide sequence includes one of seq_14, seq_15 and seq_16.
Preferably, the framework nucleic acid fragment sequence comprises seq_13; the guide sequence includes seq_15.
Preferably, the RPA primer pair comprises seq_1 and seq_6; the crRNA comprises a framework nucleic acid fragment sequence seq_13 and a guide sequence seq_15.
The invention provides a kit for detecting verticillium dahliae, which comprises a primer combination, DEPC water, lwaCas13a buffer, lwaCas13a protein, NTP buffer mix, T7 RNA polymerase mix, RNase inhibitor, RNA Reporter and verticillium dahliae plasmid standard.
The invention also provides application of the primer combination or the kit in detecting verticillium dahliae.
Preferably, the application comprises the steps of:
s1, extracting genome DNA of a sample to be detected, and carrying out RPA amplification by taking the genome DNA of the sample to be detected as a template to obtain an RPA product;
s2, constructing a Verticillium dahliae CRISPR/Cas13 detection system by taking the RPA product as a template.
Preferably, the CRISPR/Cas13 detection system of step S2 is: DEPC water 8.4 μl, lwaCas13a buffer 2 μl, lwaCas13a protein 1 μl, crRNA2 μl, NTP buffer mix 1 μl, T7 RNA polymerase mix 0.6 μl, RNase inhibitor 0.5 μl, RNA Reporter 2.5 μl and Verticillium dahliae RPA product 2 μl.
The beneficial effects are that:
the invention provides a primer combination, a kit and application for detecting verticillium dahliae. The primer combination and the kit comprise an RPA primer pair and crRNA; wherein, both the RPA primer pair and the crRNA can specifically detect the TIS gene in the Verticillium dahliae. The primer combination and the kit provided by the invention combine the RPA amplification technology and the CRISPR detection technology, realize the rapid detection of the Verticillium dahliae, and have the advantages of high sensitivity, strong specificity and high detection efficiency. The primer combination and the kit are applied to the detection of the verticillium dahliae, and have important significance for the prevention and treatment of the cotinus coggygria wilt caused by verticillium dahliae infection.
Drawings
In order to more clearly illustrate the technical solutions of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be described below.
FIG. 1 is a graph showing the results of crRNA screening according to example 1 of the present invention; wherein 1 represents a crRNA1 experimental group, 2 represents a crRNA2 experimental group, 3 represents a crRNA3 experimental group, and N represents a negative control; a is expressed as the result of cleavage of crRNA at high concentration (1 ng/. Mu.L) of substrate, B is expressed as the result of cleavage of crRNA at low concentration (1 pg/. Mu.L) of substrate, crRNA-N is expressed as the negative of crRNA, i.e. no RPA reaction product is added, and DEPC water is substituted; RPA-N represents the negative of the RPA reaction, i.e. the negative product of the addition of RPA;
FIG. 2 is a graph showing the results of the specific assay of example 2 of the present invention; wherein 1 represents Verticillium dahliae, 2 represents Verticillium meliloti No. 1, 3 represents Verticillium meliloti No. 2, 4 represents Verticillium meliloti, and N represents negative control;
FIG. 3 is a sensitivity test of example 2 of the present inventionA result graph; wherein the concentration of the electrophoresis bands 1 to 6 was 2.33X10 in order 5 copies/μL、2.33×10 4 copies/μL、2.33×10 3 copies/μL、2.33×10 2 copies/μL、2.33×10 1 COPIES/. Mu.L, 2.33X100 COPIES/. Mu.L; N-C is a negative control group of crRNA, namely, no RPA reaction product is added, DEPC water is used for replacing the crRNA, and N-R is RPA negative, namely, the negative product of the RPA reaction is added.
Detailed Description
The invention provides a primer combination for detecting verticillium dahliae.
In the present invention, the primer combination includes an RPA primer pair and crRNA; the target genes of the RPA primer pair comprise Verticillium dahliae ITS genes; the target gene of the crRNA comprises an ITS gene of verticillium dahliae. The primer combination provided by the invention can realize rapid detection of the verticillium dahliae by jointly utilizing the RPA amplification technology and the CRISPR detection technology, and has the advantages of high sensitivity, strong specificity and high detection efficiency.
In the present invention, the RPA primer pair includes an upstream primer and a downstream primer; according to the invention, an upstream primer and a downstream primer for specifically detecting the verticillium dahliae are designed according to a conserved verticillium dahliae ITS gene sequence, the designed upstream primer and downstream primer are blasted in NCBI, the specific verticillium dahliae sequence is displayed, and an optimal primer group is screened. In the present invention, the sequence of the upstream primer preferably includes one of seq_1, seq_2, seq_3 and seq_4, more preferably includes seq_1; the sequence of the downstream primer preferably comprises one of seq_5, seq_6, seq_7 and seq_8, more preferably comprises seq_6. When the upstream primer of the RPA primer pair is seq_1 and the downstream primer is seq_6, the RPA amplification effect is optimal.
According to the characteristics of Cas13a protein, the crRNA which specifically recognizes the verticillium dahliae is directly designed in the amplified gene fragment sequence, blast is carried out in NCBI, and the specificity of the verticillium dahliae sequence is shown. In the present invention, the crRNA includes a framework nucleic acid fragment sequence and a guide sequence; the framework nucleic acid fragment sequence preferably comprises seq_13; the guide sequence preferably comprises one of seq_14, seq_15 and seq_16, more preferably comprises seq_15. When the frame nucleic acid fragment sequence of the crRNA is seq_13 and the guide sequence is seq_15, the sequence of the crRNA is seq_10; the seq_10 is used for a CRISPR-Cas13a rapid detection system of the verticillium dahliae, and the detection effect is optimal.
The primer combination provided by the invention uses the ITS gene of the verticillium dahliae as a target gene, combines the RPA amplification technology and the CRISPR detection technology, realizes the rapid detection of the verticillium dahliae, and has the advantages of high sensitivity, strong specificity and high detection efficiency.
The invention provides a kit for detecting verticillium dahliae, which comprises the primer combination, DEPC water, lwaCas13a buffer, lwaCas13a protein, NTP buffer mix, T7 RNA polymerase mix, RNase inhibitor, RNA Reporter and verticillium dahliae plasmid standard.
In the present invention, the Cas13a protein is preferably LwCas13a; the RNA Reporter is preferably designed according to the characteristics of Cas13a protein, and the molecular structure of the RNA Reporter is preferably FAM-RNA-biotin.
The invention designs and constructs positive plasmid of verticillium dahliae, and the specific method comprises the following steps: the nucleic acid target fragment of the Verticillium dahliae ITS gene is connected with a p MD-19T cloning vector and transformed into escherichia coli DH5 alpha competent cells, positive cloning strains are screened, shaking is carried out overnight, plasmids are extracted, and sequencing is carried out. The positive plasmid with correct sequence identification is named as pMD-19 Tvd-ITS and is preserved at-20 ℃ for standby.
The DH5 alpha bacterial liquid containing the recombinant plasmid is inoculated into LB culture medium containing 100 mug/m of ampicillin, and cultured overnight at 37 ℃ and 120rpm in a shaking table; sucking bacterial liquid, adopting a root plasmid extraction kit, and extracting plasmids according to the operation steps of the specification; measuring the concentration by using Nanodrop 2000, calculating the copy number, and performing serial gradient dilution to obtain the verticillium dahliae plasmid standard substance for subsequent use; corresponding reaction systems can be prepared according to the required detection quantity, and each component is sequentially added for reaction.
The invention also provides the primer combination and application of the kit in detecting verticillium dahliae.
In the present invention, the application preferably includes the steps of:
s1, extracting genome DNA of a sample to be detected, and carrying out RPA amplification by taking the genome DNA of the sample to be detected as a template to obtain an RPA product;
s2, constructing a Verticillium dahliae CRISPR/Cas13 detection system by taking the RPA product as a template.
In the present invention, the reaction system for RPA amplification in step S1 is preferably: buffer V25.0. Mu.L, purified water 16.5. Mu.L, upstream primer (10. Mu.M) 2.0. Mu.L, downstream primer (10. Mu.M) 2.0. Mu. L, DNA template 2. Mu.L and MgAc 2.5. Mu.L. The reaction system is preferably placed in a reaction tube containing freeze-dried enzyme powder, and vortex mixing is carried out uniformly. Placing in a temperature box at 37 ℃ for reaction for 15min.
The RPA amplification of the invention is preferably provided with a negative control: 2.0. Mu.L of DNA template was replaced with 2.0. Mu.L of purified water.
The RPA amplification of the invention is preferably provided with a positive reaction control: 2.0. Mu.L of DNA template was replaced with a positive control template (the positive control in the RPA reaction kit was used to confirm whether the RPA reaction process was normal, and the positive control system was used mainly to evaluate whether the reagents in the kit were effective).
In the present invention, the CRISPR/Cas13 detection system of step S2 is preferably: DEPC water 8.4. Mu.l, lwaCas13a buffer 2. Mu.l, lwaCas13a protein 1. Mu.l, crRNA2. Mu.l, NTP buffer mix 1. Mu.l, T7 RNA polymerase mix 0.6. Mu.l, RNase inhibitor 0.5. Mu.l, RNA Reporter 2.5. Mu.l and Verticillium dahliae RPA product 2. Mu.l total 20. Mu.l.
The application method provided by the invention is based on a CRISPR-Cas13a nucleic acid detection platform SHERLOCK, utilizes the nonspecific shearing activity of LwaCas13a, combines with RPA (recombinant polymerase amplification technology) capable of efficiently amplifying target fragments, realizes rapid detection of trace nucleic acid of Verticillium dahliae, has high sensitivity and strong specificity, and has important significance for preventing and treating cotinus coggygria wilt caused by Verticillium dahliae infection.
The primer combinations, kits and applications for detecting verticillium dahliae provided by the present invention are described in detail below with reference to examples, but they should not be construed as limiting the scope of the present invention.
Unless otherwise indicated, all the experimental procedures used in the examples were conventional; the materials, reagents and the like used are all commercially available.
The invention relates to a material: the verticillium dahliae sample is provided by a Beijing university forest pathology laboratory; the black and white verticillium sample and the alfalfa verticillium sample are provided by a Chinese microorganism strain library; the RPA primer, crRNA and ssDNA signal report probe are synthesized by Shanghai biological limited company, and other biochemical reagents are imported split-charging or domestic analysis pure.
Example 1 establishment of CRISPR-Cas13 a-bound RPA visibility detection reaction System
1. Experimental method
1.1, designing an RPA primer specifically targeting the Verticillium dahliae ITS gene.
Principle of designing RPA primer: the length of the RPA primer is 30-35 bases, and the GC content is 30-70%; the 3-5 nucleotides at the 5 'end should avoid polyguanines (cytosine is beneficial here to promote recombination of fragments; the 3 nucleotide position at the 3' end, guanine and cytosine contribute to stable binding by the polymerase and can enhance the amplification properties of the primer).
Four upstream primers and four downstream primers are designed, and the specific steps are as follows:
the nucleotide sequence of the upstream primer is:
RPA-F1:5’-CCATATTGTTGCTTCGGCGGCTCGTTCTGC-3’(Seq_1)；
RPA-F2:5’-CCCGCCGGTCCATCAGTCTCTCTGTTTATACC-3’(Seq_2)；
RPA-F3:5’-CCATCAGTCTCTCTGTTTATACCAACGATAC-3’(Seq_3)；
RPA-F4:5’-GTTCTGCGAGCCCGCCGGTCCATCAGTCTCTCTG-3’(Seq_4)；
the nucleotide sequence of the downstream primer is:
RPA-R1:5’-CCACTGCTTTTAAGGGCCTACAGACGTAGA-3’(Seq_5)；
RPA-R2:5’-CGCAAGGAAGGGCCACGCGGGTCCGCCAC-3’(Seq_6)；
RPA-R3:5'-CCACGCGGGTCCGCCACTGCTTTTAAGGGCC-3'(Seq_7)；
RPA-R4:5'-AAGCGCCTGCGGGACTCCGATGCGAGCTGTAAC-3'(Seq_8)。
the pairs are 16 pairs in total.
In the process of RPA reaction, a T7 promoter needs to be added to the 5' end of an upstream primer of an RPA primer group, and the sequence is as follows: GAAATTAATACGACTCACTATAGGG (seq_12).
The optimal primer pair is selected as the combination of RPA-F1 and RPA-R2.
And taking the combination of RPA-F1 and RPA-R2 as a primer pair of an RPA reaction system, and carrying out subsequent experimental operation.
1.2, design crRNA specifically targeting the Verticillium dahliae ITS gene
Design of lwaca 13a crRNA targeting ITS genes follows the following five principles:
(1) The crRNA sequence format is: 5 '-framework nucleic acid fragment-guide sequence-3' interacting with LwaCas13a nuclease. The frame nucleic acid fragment sequence for LwaCas13a nuclease interaction is GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAAC (seq_13);
(2) Ligating the framework nucleic acid fragment that interacts with the LwaCas13a nuclease with a guide sequence to produce an intact crRNA;
(3) The guide sequence of crRNA should be reverse complementary to the target site in the target RNA;
(4) The guide sequence of crRNA is 28 base sequences in length, can be arranged at any position in the RPA amplification product, but can not overlap with the RPA primer;
(5) The guide sequence of crRNA allows for a mismatch of only one base when there is a difference of only a single base.
Based on the fragments amplified by the ITS gene RPA primers, 3 guide sequences and crRNA which are reversely complementary with the target RNA sequence are respectively designed according to the design principle, and the specific steps are as follows:
the guide sequence is as follows:
UCGUUGGUAUAAACAGAGAGACUGAUGG(Seq_14)；
GUAUCGUUGGUAUAAACAGAGAGACUGA(Seq_15)；
CAGAAGUAUCGUUGGUAUAAACAGAGAG(Seq_16)。
the corresponding crRNA sequences are:
crRNA1:GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAACUCGUUGGUAUAAACAGAGAGACUGAUGG(Seq_9)；
crRNA2:GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAACGUAUCGUUGGUAUAAACAGAGAGACUGA(Seq_10)；
crRNA3:GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAACCAGAAGUAUCGUUGGUAUAAACAGAGAG(Seq_11)。
and screening the optimal crRNA as crRNA2 through optimization of subsequent experimental conditions and visual effect judgment.
1.3 preparation of crRNA
For the convenience of preservation and the requirement of amplification in the subsequent experiments, the crRNA is synthesized into DNA, and is transcribed into crRNA in vitro when in use, and a T7 promoter sequence GAAATTAATACGACTCACTATAGGG (seq_12) needs to be added at the 5' end. The DNA sequence was synthesized by Shanghai Biotechnology Co. The DNA sequences for transcription into crRNA are specifically as follows:
DNA sequences for transcription into crRNA:
CCATCAGTCTCTCTGTTTATACCAACGAGTTTTAGTCCCCTTCGTTTTTGGGGTAGTCTAAATCcccTATAGTGAGTCGTATTAatttc(Seq_17)；
TCAGTCTCTCTGTTTATACCAACGATACGTTTTAGTCCCCTTCGTTTTTGGGGTAGTCTAAATCcccTATAGTGAGTCGTATTAatttc(Seq_18)；
CTCTCTGTTTATACCAACGATACTTCTGGTTTTAGTCCCCTTCGTTTTTGGGGTAGTCTAAATCcccTATAGTGAGTCGTATTAatttc(Seq_19)。
the DNA template of crRNA was annealed to double-stranded DNA using taq10 x PCR buffer (TaKaRa) with the annealing system: crRNAs IVT tempaltes (10. Mu.M) 1. Mu.L, T7-3GIVT (10. Mu.M) 1ul,10 XPCR buffer 1. Mu.L, DEPCH2O make up to the total line of 10ul.
And (3) carrying out an annealing reaction, wherein the annealing process comprises the following steps: 95 ℃ for 5min;94℃to 25℃C (0.1℃C/s).
According to Hi Scribe T7 Quick High Yield RNA Synthesis Kit (New England Biolabs), 10ul rNTP buffer mix was added to the annealed product obtained in the previous step,2ul T7 RNA polymerase mix and 8 μl DEPC H 2 O. Double stranded DNA was transcribed into crRNA by incubation overnight at 37 ℃; then 20. Mu.l DEPC H was added 2 O, 2. Mu.l DNase I,37℃for 15min. Then according to the manufacturer's instructions, RNA Clean was used&The crRNA was purified using the Concentrator Kit (APEx BIO) using DEPC H 2 The concentration of O was adjusted to 10ng/ul (split into 50ul per tube, stored at-80 ℃).
1.4 construction of Standard (Positive control)
Extracting the verticillium dahliae genome DNA by a CTAB method, and keeping at-20 ℃ for later use. And performing conventional PCR reaction on the ITS gene fragment by taking the obtained genomic DNA as a template.
The reaction system: 2 Xsan Taq PCR Mix 25. Mu.L, upstream primer (10. Mu.M) 2. Mu.L, downstream primer (10. Mu.M) 2. Mu.L, DNA template 1. Mu.L, ddH 2 O was replenished to 50 μl;
reaction conditions: 94 ℃ for 5min;94℃for 30s,55℃for 30s,72℃for 20s,30cycles;72 ℃ for 10min;4 ℃ is infinity.
And (3) carrying out gel electrophoresis on the obtained product, cutting gel, recovering and purifying the target fragment.
The target fragment is connected with a p MD-19T cloning vector and is transformed into escherichia coli DH5 alpha competent cells, positive cloning strains are screened, shaking is carried out overnight, plasmids are extracted and sequenced, and the positive plasmids with correct sequence identification are named pMD-19T Vd-ITS and are preserved at the temperature of minus 20 ℃ for standby. The plasmid concentration was determined and 10-fold gradient dilution was performed and used as a standard for CRISPR-Cas13a visual detection methods.
1.5 Recombinant Polymerase Amplification (RPA)
The procedure was as per the (RPA) kit instructions, with each tube of dry reaction powder water added with the 47.5. Mu.L system shown in Table 1, to allow adequate re-dissolution of the lyophilized powder. 2.5 mu L of 280mM magnesium acetate solution is added to the tube cover of each reaction tube, the tube cover is covered, the reagent in the tube is fully mixed by flicking with fingers, and the reaction is carried out for 15min at 37 ℃ after low-speed centrifugation for 3-5 s.
TABLE 1 RPA reaction System
Reagent name Volume of
Buffer V 25.0μL
Purified water 16.5μL
Upstream primer RPA-F1 (10. Mu.M) 2.0μL
Downstream primer RPA-R2 (10. Mu.M) 2.0μL
Template DNA 2.0μL
MgAc 2.5μL
Totals to 50μL
1.7 CRISPR-Cas13a detection
Detection of verticillium dahliae DNA reactions based on the CRISPR-Cas13a system, the CRISPR-Cas13a detection system is shown in table 2.
Table 2 CRISPR-Cas13a detection system
Reagent name Volume of
DEPC water 8.4μL
LwaCas13a buffer 2μL
crRNA(10ng/μL) 2μL
Lwa Cas13a protein (10. Mu.M) 1μL
rNTP Mix 1μL
T7 RNA polymerase mix 0.6μL
Rnase inhibitors 0.5μL
Signal reporter RNA molecules 2.5μL
RPA products 2μL
Totals to 20μL
Setting an experimental group A, an experimental group B, a negative control group crRNA-N and a negative control group RPA-N; wherein the concentration of the RPA amplification product of the experimental group A is 1 ng/. Mu.LThe method comprises the steps of carrying out a first treatment on the surface of the RPA amplification product concentration in experimental group B was 1 pg/. Mu.L; no RPA amplification product was added to crRNA-N in the negative control group, and DEPC H was used 2 O is replaced; substitution of RPA amplification substrate template DNA of negative control group RPA-N with DEPC H 2 After the O, RPA reaction, the negative product of the RPA reaction is added to the CRISPR-Cas13a detection system. The other reagent components of each experimental group and the negative control group were unchanged.
The PCR tube containing 20. Mu.L of the system of Table 2 was placed in a 37℃incubator for 40min. To the PCR tube after the reaction was added 30. Mu.L of DEPC H 2 O, a test strip (Tiosbio Cas13/12 special nucleic acid detection test strip of Beijing Baozhen Biotechnology Co., ltd., product number: JY 0301) is inserted into the tube and left for 2-3 minutes, and the result is read. Wherein the signal reporter RNA molecule is FAM-RNA-biotin. The detection area of the test strip is fixedly coated with colloidal gold, and anti-FAM antibodies are marked on the colloidal gold; the quality inspection area is fixedly coated with biotin ligand.
And (3) result judgment: for a negative sample, the colloidal gold particle anti-FAM antibody is fully coupled with the FAM-RNA-biotin reporter molecule, the conjugate is intercepted by a biotin ligand in a quality testing area, only the strip of the quality testing area is colored, and the strip of the testing area is not colored; for positive samples, the FAM-RNA-biotin reporter is cleaved by Cas13a, the colloidal gold particle-anti-FAM antibody-FAM conjugate accumulates at the detection zone band, color develops at the detection zone band, and color decreases or even does not develop at the quality control zone band.
2. Test results
Screening of crRNA: the foregoing experiments 1.2-1.3 provided 3 different crrnas. Applying 3 different crrnas to detection of verticillium dahliae; the extracted verticillium dahliae genome DNA is added into an RPA reaction unit for pre-amplification, and then an amplification product is placed into a CRISPR-Cas13a detection system, reacted through a lateral flow test strip and the result is observed. The reaction temperature was 37℃and the reaction time was 40 minutes, and the detection results are shown in FIG. 1.
As can be seen from fig. 1: the test lines of the lateral flow test strip all have color development strips under high concentration substrates; at low concentration of substrate, the color development effect of crRNA2 is optimal; and negative control is established, and false positive is not present. The results also demonstrate that CRISPR-Cas13a lateral flow detection methods can directly detect verticillium dahliae by visual inspection.
From FIG. 1, it can be derived that the optimal crRNA is crRNA2. The subsequent experiments used crRNA2 as the common crRNA sequence.
Example 2 specificity and sensitivity assays
1. Test method
1.1 specificity test
Extracting the genome DNA of Verticillium dahliae, verticillium black and white and Verticillium alfalfa by CTAB method. RPA pre-amplification (RPA-F1 and RPA-R2 are selected) is carried out by taking the genomic DNA as a template, CRISPR-Cas13a lateral flow test strip detection (crRNA 2 is selected) is carried out by applying the system established in the embodiment 1, and meanwhile, negative control is set, so that the specificity of the method is verified.
1.2 sensitivity test
Construction of plasmid standard: conventional PCR reaction is carried out on the verticillium dahliae genome DNA to obtain a single band with the length of 392 bp. The product was cloned and sequenced after gel recovery and purification, and the results were completely consistent with expectations. The positive plasmid constructed successfully was named pMD-19T Vd-ITS and stored at-20deg.C for further use. The OD of the plasmid standard was determined using a spectrophotometer and diluted to 100ng/ul. Calculation of the copy number of 100 ng/. Mu.l of pMD-19T Vd-ITS Standard to 2.33X10 11 copies/ul。
pMD-19 TVd-ITS standard plasmid diluted in 10-fold gradient (2.X10) 5 copies/μl～2.33×10 0 copies/. Mu.L) as a template, DEPC water as a negative control, and the lowest concentration of the test line without obvious bands as the sensitivity of the detection method.
2. Test results.
2.1 specificity detection results
The specificity of CRISPR-Cas13a lateral flow assay was assessed for detection of verticillium dahliae, verticillium black and white and verticillium alfalfa, respectively, and for negative controls.
The detection results are shown in FIG. 2. As can be seen from fig. 2: the invention only shows the color development of the detection zone strip on the test strip for detecting the verticillium dahliae, and the test strip for detecting the verticillium dahliae, the verticillium medicago and the negative control are judged to be negative, which proves that the specificity of the detection method established by the invention is good.
2.2 sensitivity test results
The standard plasmid was subjected to 10-fold gradient dilution for detecting the sensitivity of the method, and the concentrations of the electrophoresis bands 1 to 6 were 2.33X10 in order 5 copies/μL、2.33×10 4 copies/μL、2.33×10 3 copies/μL、2.33×10 2 copies/μL、2.33×10 1 copies/μL、2.33×10 0 copies/μL。
The detection results are shown in FIG. 3. As can be seen from fig. 3: the minimum detection limit of the invention can reach 2.33 multiplied by 10 1 The copies/. Mu.L shows that the detection method established by the invention has better sensitivity.
The above examples merely represent a few embodiments of the present invention, which facilitate a specific and detailed understanding of the technical solutions of the present invention, but are not to be construed as limiting the scope of the invention. It should be noted that it will be apparent to those skilled in the art that several variations and modifications can be made without departing from the spirit of the invention, which are all within the scope of the invention.

Claims (10)

1. A primer combination for detecting verticillium dahliae, characterized in that the primer combination comprises an RPA primer pair and crRNA; the target genes of the RPA primer pair comprise Verticillium dahliae ITS genes; the target gene of the crRNA comprises an ITS gene of verticillium dahliae.
2. The primer combination of claim 1, wherein the RPA primer pair comprises an upstream primer and a downstream primer; the sequence of the upstream primer comprises one of seq_1, seq_2, seq_3 and seq_4; the sequence of the downstream primer includes one of seq_5, seq_6, seq_7 and seq_8.
3. The primer combination of claim 2, wherein the sequence of the upstream primer comprises seq_1; the sequence of the downstream primer includes seq_6.
4. The primer combination of claim 1, wherein the crRNA comprises a framework nucleic acid fragment sequence and a guide sequence; the guide sequence includes one of seq_14, seq_15 and seq_16.
5. The primer combination of claim 4 wherein the framework nucleic acid fragment sequence comprises seq_13; the guide sequence includes seq_15.
6. The primer combination of any one of claims 1-5, wherein the RPA primer pair comprises seq_1 and seq_6; the crRNA comprises a framework nucleic acid fragment sequence seq_13 and a guide sequence seq_15.
7. A kit for detecting verticillium dahliae, comprising the primer combination of any one of claims 1-6, further comprising DEPC water, lwaCas13a buffer, lwaCas13a protein, NTP buffer mix, T7 RNA polymerase mix, RNase inhibitor, RNA Reporter, and verticillium dahliae plasmid standard.
8. Use of a primer combination according to any one of claims 1-6 or a kit according to claim 7 for the detection of verticillium dahliae.
9. The use according to claim 8, characterized by the steps of:
s1, extracting genome DNA of a sample to be detected, and carrying out RPA amplification by taking the genome DNA of the sample to be detected as a template to obtain an RPA product;
s2, constructing a Verticillium dahliae CRISPR/Cas13 detection system by taking the RPA product as a template.
10. The use of claim 9, wherein the CRISPR/Cas13 detection system of step S2 is: DEPC water 8.4 μl, lwaCas13a buffer 2 μl, lwaCas13a protein 1 μl, crRNA2 μl, NTP buffer mix 1 μl, T7 RNA polymerase mix 0.6 μl, RNase inhibitor 0.5 μl, RNA Reporter 2.5 μl and Verticillium dahliae RPA product 2 μl.
CN202211203289.8A 2022-09-29 2022-09-29 Primer combination for detecting verticillium dahliae, kit and application Pending CN116064905A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202211203289.8A CN116064905A (en) 2022-09-29 2022-09-29 Primer combination for detecting verticillium dahliae, kit and application

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202211203289.8A CN116064905A (en) 2022-09-29 2022-09-29 Primer combination for detecting verticillium dahliae, kit and application

Publications (1)

Publication Number Publication Date
CN116064905A true CN116064905A (en) 2023-05-05

Family

ID=86175814

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202211203289.8A Pending CN116064905A (en) 2022-09-29 2022-09-29 Primer combination for detecting verticillium dahliae, kit and application

Country Status (1)

Country Link
CN (1) CN116064905A (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN117363792A (en) * 2023-12-08 2024-01-09 北京林业大学 Method for dual detection of verticillium dahliae based on RPA-CRISPR and application

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN117363792A (en) * 2023-12-08 2024-01-09 北京林业大学 Method for dual detection of verticillium dahliae based on RPA-CRISPR and application

Similar Documents

Publication Publication Date Title
Zhu et al. PAM-free loop-mediated isothermal amplification coupled with CRISPR/Cas12a cleavage (Cas-PfLAMP) for rapid detection of rice pathogens
CN110863058B (en) RPA primer for identifying potato rot stem nematode and application thereof
CN115852052A (en) Real-time fluorescent quantitative PCR primer probe combination for detecting CymRSV and method thereof
CN116064905A (en) Primer combination for detecting verticillium dahliae, kit and application
CN111690759B (en) Specific primer, kit and method for detecting RPA of citrus canker pathogen
Wang et al. Mining new microsatellite markers for Siberian apricot (Prunus sibirica L.) from SSR-enriched genomic library
US20150292003A1 (en) Methods and kits for detection of a pathogen in sugarcane
CN109680087B (en) A kind of dual PCR detection method and its primer sets of Sugarcane white leaf phytoplasma and informal voucher Xanthomonas campestris
CN107326088B (en) Method for detecting insect-resistant herbicide-tolerant corn GH5112E-117C
CN114410802B (en) RPA primer, probe, kit and application for detecting heterodera avenae wollenweber
CN111996274B (en) Large-scale quantitative detection method for plant pathogenic fungi by high-throughput sequencing
Xiujie et al. Comparison of five endogenous reference genes for specific PCR detection and quantification of rice
CN111334597B (en) SNP (Single nucleotide polymorphism) site and KASP (Kaempferi protein) marker for detecting powdery mildew resistance of watermelon and application thereof
KR101024493B1 (en) Primer for Diagnosis of Apple Scar Skin Viroid Infection and Method for Diagnosis using the same
Ozkilinc et al. Development, characterization and linkage analysis of microsatellite loci for the Ascochyta blight pathogen of faba bean, Didymella fabae
WO2022102726A1 (en) Method of diagnosing fusarium oxysporum soil by pathogen genomics
CN117904355A (en) Rapid detection method of plant stem-based rot pathogen based on RPA-CRISPR/Cas12a
CN113897456B (en) Real-time fluorescence PCR detection primer probe combination and detection kit for four fir anthracnose pathogens and application of kit
CN113322353B (en) RPA kit for detecting sweet potato pinnate mottle virus and sweet potato chlorotic stunt virus
CN113637804B (en) Kit for detecting RB-N1 genotype citrus tristeza virus based on RT-PCR technology and detection method thereof
CN110438212B (en) Enzyme digestion PCR kit and method for enrichment detection of specific gene fragment
JP2009278865A (en) Method for amplification of dna fragment
US7659067B2 (en) Method for identification of medically relevant fungi
De et al. Molecular taxonomy: an approach based on molecular markers
Junaid et al. Genomic DNA Analysis from cereals: Isolation and Quantification

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination