AU2020100601A4

AU2020100601A4 - Recombinant broad-spectrum Metarhizium and production method and application thereof

Info

Publication number: AU2020100601A4
Application number: AU2020100601A
Authority: AU
Inventors: Le KANG; Xiwen TONG; Yundan WANG
Original assignee: Institute of Zoology of CAS
Current assignee: Institute of Zoology of CAS
Priority date: 2017-10-27
Filing date: 2020-04-20
Publication date: 2020-05-28
Anticipated expiration: 2025-11-08

Abstract

Recombinant Broad-Spectrum Metarhizium and Production Method and Application thereof Abstract The present invention provides a recombinant broad-spectrum Metarhizium that down-regulates the expression of monoamine oxidase or does not express monoamine oxidase, or has a content of tryptamine therein higher than that in wild-type broad-spectrum Metarhizium, and the recombinant broad-spectrum Metarhizium is the strain per se, the progenies of the strain, the conidia produced by the strain, the mycelia produced by the strain, or any combination thereof. Knocking out monoamine oxidase gene from the recombinant broad-spectrum Metarhizium significantly increases the concentration of tryptamine in broad-spectrum Metarhizium robertsii, thereby significantly increasing the pesticidal efficiency thereof, and shortening the semi-lethal time LT50 of the wild-type broad-spectrum Metarhizium from 7.33± 0.445 days to 6.136 ± 0.488 days. The recombinant broad-spectrum Metarhizium is harmless to the environment, and has good biological safety and no toxicity to human beings.

Description

Recombinant Broad-Spectrum Metarhizium and Production Method and Application thereof

Technical Filed

The present application relates to a transgenic strain and production method and application thereof, especially, relates to a recombinant broad-spectrum Metarhizium that is capable of improving the pesticidal efficiency of broad-spectrum Metarhizium, and a production method and application thereof.

Background Art

Entomopathogenic fungi have the advantages, including environmental friendliness, strong stress resistance, large amount of diffusion and high selectivity, as compared with chemical pesticides, and are a class of biological pesticides widely applied. At present, entomopathogenic fungi as biological pesticides still have a disadvantage of long lethal time. By studying the pathogenesis of fungi so as to improve the effect of fungal pesticides, genetically engineered fungi has become an important research direction. For example,

1. Overexpression of hydrolase genes secreted by fungi. Overexpression of a body wall-degrading protease such as substilisins Pr1 A can increase the penetration rate of fungi into the body wall, significantly increase the virulence of Metarhizium anisopliae, increase the lethal rate and activate the polyphenol oxidase system in blood cavity. As a result, the pest body is rapidly blackened, the lethal time for Manduca sexta is reduced by 25%, and the food intake rate of pests is also reduced by 40%. Fang et al. transferred the chitin hydrolase Bbchitl gene into the genome of Beauveria to obtain an overexpression engineered strain. The engineered strain had significantly enhanced virulence against aphids. As compared with wild strains, the lethal dose of the engineered strain for aphids was reduced by 50% and the lethal time was

2020100601 20 Apr 2020 shortened by 50%.

2. Modification of fungi metabolic genes. Xia et al constructed an overexpression vector of a fungal acidic trehalose degrading enzyme (ATM) and transformed the broad-spectrum Metarhizium with the vector, enhancing the ability of the fungi to metabolize trehalose in host hemolymph, and promoting the growth of the broad-spectrum Metarhizium in insects.

3. Introduction of exogenous genes. Androctonus australis neurotoxin AalT is a specific neurotoxin of Lepidoptera and Diptera insect. Wang et al introduced this gene into Metarhizium to specifically express neurotoxin in the host blood cavity, and the engineered fungi had an increased toxicity to Manduca sexta by 22 times.

4. Expression of immune-related genes. Yang et al. allowed that the serine inhibitive enzyme Spn43Ac recognizing the Toll signaling pathways in insect innate immunity was expressed in Beauveria, and the semi-lethal time for green peach aphids was shortened by 24% and the lethal rate was increased by 2 times. Fan et al introduced a Glucose-frustose oxidoreductase (GFOR) gene into Beauveria, wherein the constructed transgenic engineered fungi could inhibit the activity of Gram-negative bacteria binding proteins (GNBPs) in a host and inhibits an immune response in the host, reducing the lethal time of the fungus by 48 hours and improving the pesticidal effect thereof.

However, there are still some disadvantages in genetically engineered fungi at present. For example, the granted Chinese invention patent having a granted number of CN101755050 discloses that the optimized polynucleotide sequence encoding Androctonus australis neurotoxin AalT is introduced into Metarhizium anisopliae and expressed therein, improving the pesticidal effect, and effectively controlling insects. However, the toxin gene introduced into fungi is toxic to human beings and causes a certain danger to human beings.

Metarhizium fungi are widely used for the control of pests. At present, more

2020100601 20 Apr 2020 than 200 agricultural and forestry pests can be controlled by using formulations of Metarhizium. The control targets are focused on locusts of Orthoptera, Blattaria, aphids, whiteflies and leafhoppers of Homoptera, and white grubs of Coleoptera. Representative species of the Metarhizium include Metarhizium anisopliae, Metarhizium robertsii, and Metarhizium acridum, and different species show different pesticidal scopes. For example, Metarhizium anisopliae and Metarhizium robertsii are broad-spectrum pesticidal fungi. At present, the wild type broad-spectrum Metarhizium generally has a long lethal time and effect thereof is not satisfactory, and genetically engineered strains have potential danger to the environment or human beings.

Contents of the Invention

The inventors of the present invention have found through long-term unremitting efforts that the fact pesticidal efficiency of the obligate fungus, Metarhizium acridum, is higher than that of broad-spectrum Metarhizium, may be resulted from the reason that the obligate bacteria, Metarhizium acridum, lacks monoamine oxidase (EC 1.4.3.4) in the metabolism of tryptamine, as compared with the broad-spectrum Metarhizium, and thus tryptamine cannot be metabolized in the obligate bacteria. Tryptamine can regulate the transcription factors in a host cell through the ARH receptor to cause metabolic disturbance in the host, thereby improving the pesticidal effect of the fungus.

Accordingly, the present invention provides a recombinant broad-spectrum Metarhizium, which down-regulates the expression of monoamine oxidase or does not express monoamine oxidase, or has a content of tryptamine therein higher than that in wild-type broad-spectrum Metarhizium. The recombinant broad-spectrum Metarhizium is the strain per se, the progenies of the strain, the conidia produced by the strain, the mycelia produced by the strain, or any combination thereof.

In an exemplary embodiment, the expression of monoamine oxidase in the

2020100601 20 Apr 2020 recombinant broad-spectrum Metarhizium provided by the present invention is down-regulated by more than 50%.

In an exemplary embodiment, the expression of monoamine oxidase in the recombinant broad-spectrum Metarhizium provided by the present invention is down-regulated by more than 60%, 70%, 80%, 90% or 95%, or 100%.

In an exemplary embodiment, the recombinant broad-spectrum Metarhizium according to the present invention is a recombinant broad-spectrum Metarhizium robertsii or a broad-spectrum Metarhizium anisopliae.

In an exemplary embodiment, the recombinant broad-spectrum Metarhizium according to the present invention is a recombinant broad-spectrum Metarhizium robertsii which has the deposit number of CGMCC No. 14152, is systemically named as Metarhizium robertsii, and deposited in the China General Microbiological Culture Collection Center, CGMCC (Address: No.1-3, Beichen West Road, Chaoyang District, Beijing) on August 29, 2017.

In an exemplary embodiment, as compared to wild-type broad-spectrum Metarhizium, the recombinant broad-spectrum Metarhizium according to the present invention down-regulates the expression of monoamine oxidase or does not express monoamine oxidase, thereby increasing the concentration of tryptamine to cause metabolic disturbance in the host. Tryptamine regulates transcription factors in a host cell through the ARH receptor to cause metabolic disturbance in the host, increasing ROS in the host, and increasing mortality after host is infected.

In the present invention, the concentration of tryptamine in a host can be directly increased by other methods, and thus the metabolism in the host is disturbed to increase the mortality after the host is infected.

Another aspect of the present invention provides a pesticide comprising

2020100601 20 Apr 2020 the recombinant broad-spectrum Metarhizium according to the present invention, and optionally a pesticidally acceptable carrier. The pharmaceutically acceptable carrier may be one or more of mica powder, light calcium carbonate, clay, talc, kaolin, diatomaceous earth, attapulgite, bentonite, sepiolite, urea, potassium chloride, sodium sulfate, ammonium sulfate, sodium nitrate, ammonium nitrate and ammonium chloride.

The recombinant broad-spectrum Metarhizium may be the strain per se, the progenies of the strain, the conidia produced by the strain, the mycelia produced by the strain, or any combination thereof.

In a particular embodiment provided by the present invention, the pesticide is used for controlling one or more of the following pests: pine caterpillars, corn borers, white grubs, locusts, Leptinotarsa deeomlineata, Monochamus alternatus, ants, tea lesser leafhoppers, peach fruit borers, aphids and mosquitoes.

Another aspect of the present invention provides use of the recombinant broad-spectrum Metarhizium according to the present invention, the progenies of the strain, the conidia produced by the strain, the mycelia produced by the strain, or any combination thereof, in the manufacture of a pesticide.

Preferably, the pesticide according to the present invention is for use in killing locusts.

Optionally, the pesticide according to the present invention may further comprise other active ingredient(s) capable of killing locusts. In an exemplary embodiment, the active ingredient is one or more of such as destruxins, pyrethroids, carbamates, neonicotinoids, neuro-sodium channel blockers, pesticidal macrolides, gamma-aminobutyric acid (GABA) antagonists, diflubenzurons and juvenile hormone mimics.

The present invention also provides a method of producing a recombinant broad-spectrum Metarhizium, comprising upregulating and/or increasing the

2020100601 20 Apr 2020 tryptamine in the recombinant broad-spectrum Metarhizium.

In an exemplary embodiment, the expression of monoamine oxidase is down-regulated or monoamine oxidase is not expressed by knocking out or engineering a relevant nucleotide sequence that expresses monoamine oxidase through genetic recombination.

In a specific embodiment of the present invention, a relevant nucleotide sequence that expresses monoamine oxidase is knocked out so that the recombinant broad-spectrum Metarhizium does not express monoamine oxidase, which knocking out specifically comprises the following steps of: amplifying the upstream sequence and the downstream sequence of the nucleotide sequence of monoamine oxidase of a wild-type broad-spectrum Metarhizium anisopliae (MAA), respectively, and seamlessly ligating the amplified upstream sequence and the downstream sequence, preferably, seamlessly ligating the amplified upstream and downstream sequences to the Bar gene or the Ben gene.

In a specific embodiment of the present invention, the type of plasmid is not limited as long as it contains the Bar gene (i.e., herbicide glufosinate ammonium-resistant gene) and/or the Ben gene (benomyl-resistant gene).

In a specific embodiment of the present invention, PDHt-Bar plasmid containing the Bar gene is selected, and a method for producing the recombinant broad-spectrum Metarhizium comprises:

The primers, MAA_03753Fs and MAA_03753Rs, and MAA_03753Fx and MAA_03753Rx are designed, and the upstream and downstream sequences of the genomic DNA of MAA as a template are amplified by using theprimers. The amplified upstream and downstream sequences are digested and seamlessly ligated to the upstream and downstream of the Bar in the PDHt-Bar plasmid, respectively, to form a recombinant plasmid. The recombinant plasmid is transferred into the MAA by an Agrobacterium

2020100601 20 Apr 2020 tumefaciens-mediated transformation.

The present invention also provides a method for killing locusts comprising the step of applying the recombinant broad-spectrum Metarhizium of the present invention or a recombinant broad-spectrum Metarhizium produced by the above-described producing method.

Wherein, the recombinant broad-spectrum Metarhizium includes the recombinant broad-spectrum Metarhizium strain per se, the progenies of the strain, the conidia produced by the strain, the mycelia produced by the strain, or any combination thereof.

Preferably, said applying comprises spraying the recombinant broad-spectrum Metarhizium of the present invention to a crop, such as corn, wheat, and the like.

In an exemplary embodiment or preferably, the present invention has one of the following advantages:

the recombinant broad-spectrum Metarhizium of the present invention can significantly increase the concentration of tryptamine in broad-spectrum Metarhizium robertsii, thereby significantly increasing the pesticidal efficiency. For example, the recombinant broad-spectrum Metarhizium of the present invention can shorten the semi-lethal time LT50 of the broad-spectrum Metarhizium robertsii from 7.33 ± 0.445 days to 6.136 ± 0.488 days, and is harmless to the environment, and has good biological safety and not toxicity to human beings.

Description of Figures

Figure 1 is a schematic diagram of a recombinant plasmid according to an example of the present invention;

Figure 2 is an agarose gel electrophoresis pattern of the recombinant broad-spectrum Metarhizium robertsii in an example of the present invention;

2020100601 20 Apr 2020

Figure 3A shows the contents of the tryptamine in the hyphae of the recombinant broad-spectrum Metarhizium robertsii in an example of the present invention;

Figure 3B shows the contents of tryptamine in migratory locusts infected by the broad-spectrum Metarhizium robertsii in an example of the present invention;

Figure 4 is a diagram showing experimental results of ROS in the hemolymph of the migratory locusts detected by a flow cytometry in an example of the present invention; and

Figure 5 is a diagram showing experimental results of the semi-lethal time of the recombinant broad-spectrum Metarhizium robertsiiagainst the migratory locusts in an example of the present invention.

Specific Mode for Carrying Out the Invention

The technical solutions in the examples of the present invention are clearly and completely described below. Obviously, the described examples are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments obtained by a person skilled in the art based on the examples of the present invention without exerting any inventive skill are within the scope of the present invention.

The experimental methods used in the following examples are conventional methods unless otherwise specified.

The materials and reagents etc. used in the following examples are commercially available unless otherwise specified.

The present invention is described in detail below with reference to the specific examples, and these examples are for the purpose of understanding instead of limiting the present invention.

Example 1 Production of the recombinant broad-spectrum

2020100601 20 Apr 2020

Metarhizium robertsii

In this example, the monoamine oxidase gene (namely, MAA_03753) was knocked out from a broad-spectrum Metarhizium robertsii (namely, MAA) as an example for the illustration, wherein the gene bank accession number of the MAA_03753 was NW_011942171.1, and the monoamine oxidase was [EC: 1.4. 3.4] having a specific sequence as shown in SEQ ID NO: 1. The example was not limited to the broad-spectrum Metarhizium robertsii, and other broad-spectrum Metarhizium fungi having the monoamine oxidase gene, such as Metarhizium anisopliae, might be used therein. The type of plasmid was not limited in this example as long as it contained the Bar gene and/or the Ben gene. For example, the plasmid could be a pDHt-Bar plasmid or a pDHt-Ben plasmid. The pDHt-Bar plasmid was used as an example for the illustration below.

1. Construction of MAA_03753-knock-out plasmid

The primers, MAA_03753Fs and MAA_03753Rs, and MAA_03753Fx and MAA_03753Rx, were designed, and the upstream and downstream sequences of the genomic DNA of a wild-type MAA as a template were amplified by the primers, respectively. The Smal and Spel cleavage sites were added to the termini of the products. The sequences of the particular primers were as follows:

MAA_03753Fs (as shown in SEQ ID NO: 2):

ATTCCTGCAGCCCGGGATGGCGACAACCCAAATC

MAA_03753Rs (as shown in SEQ ID NO: 3):

CGACGGATCCCCCGGGGTGTCAACCCTCGTTCTATT

MAA_03753Fx (as shown in SEQ ID NO: 4):

GATCTGATGA3ACTAGTGTTTCGGAACATTCACTTTG

2020100601 20 Apr 2020

MAA_03753Rx (as shown in SEQ ID NO: 5):

CCGCTCTAGAACTAGTCGGGCAAGATTCCGTTCGT.

The upstream sequence of the monoamine oxidase gene was amplified with the MAA_03753Fs and MAA_03753Rs primer pairs, and a 880 bp fragment (namely, MAO-S) was obtained by the amplification. The MAO-S was seamlessly ligated into the upstream of Bar in the PDHt-Bar plasmid after Smal single cleavage (as shown in Figure 1).

The downstream sequence of the monoamine oxidase gene was amplified with the MAA_03753Fx and MAA_03753Rx primer pairs, and a 646 bp fragment (namely, MAO-X) was obtained by the amplification. The MAO-X was seamlessly ligated into the downstream of Bar in the PDHt-Bar plasmid after Spel single cleavage (which PDHt-Bar plasmid was provided by the Shanghai Institute of Plant Physiology and Biochemistry, please refer to: Yixiong Chen, Zhibing Duan, Peilin Chen, Yanfang Shang & Chengshu Wang, The Bax inhibitor MrBI-1 regulates heat tolerance, apoptotic-like cell death, and virulence in Metarhizium robertsii, Scientific Reports 5, Article number: 10625 (2015), and Wei Huang, Yanfang Shang, Peilin Chen, Kai Cen and Chengshu Wang, Basic Leucine Zipper (bZIP) Domain Transcription Factor MBZ1 Regulates Cell Wall Integrity, Spore Adherence, and Virulence in Metarhizium robertsii*, Journal of Biological Chemistry 290(13): 8218-8231) (as shown in Figure 1). Thus, the 580 bp fragment in the middle of MAA-03753 was replaced by a 938 bp Bar sequence.

The PCR reaction mixture was: 2.5 pL of 10 χ Ex Taq Buffer polymerase buffer, 2 pL of 2.5 mM dNTP, 1 pL of 10 μΜ upstream and downstream primers, respectively, 1 pL of template, 0.25 pL of Takara Ex Taq DNA polymerase, and ultrapure water added to a total volume of 25 pL;

The PCR reaction conditions: pre-denaturation was carried out at 95°C for 5 min, 94°C for 30 sec, 54°C for 30 sec, and 72°C for 1 min (35 cycles), and io

2020100601 20 Apr 2020 finally extended at 72°C for 10 min. The PCR reaction product was electrophoresed on an agarose gel having a mass fraction of 1.0%, and the product was recovered using a gel recovery kit.

The enzyme digestion system was: 5 μΙ_ of 10 χ cutsmart buffer, 1 pg of plasmid DNA, and 1 μΙ_ of endonuclease (NEB), and supplemented with ddH₂O to 50 μΙ_.

Seamless ligation: Clone Express® HOne Step Cloning Kit (Vazyme) μΙ_ of 5 χ buffer, 2 μΙ_ of Exnase II, the amount of vector = [0.02 χ the base pair number of vector] ng, and the amount of the inserted fragment = [0.04 χ the base pair number of inserted fragment] ng, and supplemented with 20 μΙ_ of H2O, then cultivation at 37°C for 30 min, and transformation.

2. Construction of engineered strain

The amplified upstream and downstream sequences were inserted into the vector PDHt-Bar, respectively, and it was confirmed that a knock-out vector was successfully constructed (as shown in Figure 1) upon sequencing identification. The knock-out plasmid was then transferred into the MAA by Agrobacterium tumefaciens mediated transformation.

Agrobacterium tumefaciens mediated transformation (ATMT) was used to construct a fungal genetic transformation system: the obtained vector was transformed into Agrobacterium AGL-1; a positively transformed Agrobacterium AGL-1 strain was selected after PCR identification, and then subjected to expanded cultivation in the YEB medium (containing 50 mg/mL Carb and 50 mg/mL Kan). The cells were collected, suspended in an appropriate amount of an IM liquid medium to have an ODeeo of 0.15, and cultured at 28°C in the dark to a concentration of ODeeo of 0.5-0.8.

At the same time, a conidia suspension of wild type broad-spectrum Metarhizium robertsii (namely, MAA) was prepared. The wild-type MAA was

2020100601 20 Apr 2020 inoculated on a PDA plate and cultured. After 14 days of culture, an appropriate amount of conidia of wild-type broad-spectrum Metarhizium robertsii MAA was scraped from the PDA plate into 1 mL sterile water comprising 0.05% Tween-20, subjected to vortex oscillation, and filtered with a glass wool to remove hyphae. The filtrate was collected, centrifuged at 12,000 rpm for 3 min, washed with the sterile water comprising Tween-20 for twice, resuspended, and counted with a hemocytometer. The spore suspension of the wild type bligate Metarhizium acridum MAA was adjusted to contain about 1.0 x 10⁶ conidia per mL of suspension, for ready for use.

100 pL of the AGL-1 bacterial solution cultured in the IM medium was mixed with 100pL of the conidia suspensionof the wild-type broad-spectrum Metarhizium robertsii MAA, and the mixture was uniformly coated on the IM medium plate. After co-cultivation for 48 hours, the co-culture was washed with sterile water, and cultured in the dark in the M-100 medium containing cephalothin and glufosinate for 7-10 days until the emergence of resistant colonies. After monospores were separated, resistant fungal tissue was preserved for ready for use. The genome of the resistant fungal tissue was extracted and the transformants were verified by PCR with specific primers.

3. Validation of the fungal genome

The genome of the transformants was validated by using a kit from TransGen Biotech, i.e., the Plant Tissue PCR Kit (AD301).

The above-mentioned resistant fungal tissue selected was added with 40 μί of PD1 Buffer, then blown out uniformly by a vortex mixer or a pipette, incubated in a metal bath for 10 min at 95°C (the device was preheated in advance), added with 40 μί PD2 Buffer, and mixed uniformly to be used as a template for PCR validation. It was confirmed that the knock-out plasmid was successfully transferred into the fungal tissue upon sequencing identification.

2020100601 20 Apr 2020

The fungal tissue into which the knock-out plasmid was successfully transferred was inoculated onto the PDA medium and cultured until conidia grew. The spores were transferred into SDB medium and cultured in the dark at 28°C and 180 rpm for 3 days. After the hypha collected by suction filtration, the mycelium was ground with liquid nitrogen, and Trizol was added to extract RNA. After the RNA was reverse-transcribed into a cDNA template, PCR was performed. In this experiment, the expression of Tublin was used as a reference. The specific primers used were as follows:

MAA_03753-ORF-F: CAAGCTGGGCTACTACTCA (as shown in SEQ ID NO: 6);

MAA_03753-ORF-R: AAGCATCAATAACCTCCCTC (as shown in SEQ ID NO: 7);

Tublin-F: GATCTTGAACCTGGCACCAT (shown as SEQ ID NO: 8);

Tublin-R: CCATGAAGAAGTGCAGACGA (shown as SEQ ID NO: 9);

The PCR system was as follows:

Tissue Extract	1.2μΙ_
Forward Primer ( 10μΜ )	0.4μΙ_
Reverse Primer ( 10μΜ )	0.4μΙ_
2xTansDirect PCR SuperMix	10μΙ_
ddH₂O	8μΙ
Total amount	20μΙ

The obtained PCR product was electrophoresed on a 1% agarose gel, and the results of the experiment were shown in Figure 2. In Figure 2, the first lane was the marker, the second lane was the tubulin expressed in the wild-type MAA, the third lane was the tubulin expressed in the MAA_03753-knock-out plasmid, the fourth lane was the monoamine oxidase expressed by the wild-type MAA-03753, and the fifth lane was the monoamine oxidase expressed by the MAA_03753-knock-out plasmid. As could be seen from

2020100601 20 Apr 2020

Figure 2, the MAA_03753-knock-out plasmid did not express monoamine oxidase, indicating that the gene sequence of monoamine oxidase had been knocked out, and the above-mentioned resistant fungus was recombinant broad-spectrum Metarhizium robertsii MAA (hereafter referred to as MAA-KO, abbreviated KO). The KO was deposited in the China General Microbiological Culture Collection Center, and has an accession number of CGMCC No. 14152.

Example 2 Determination of tryptamine Content in the recombinant broad-spectrum Metarhizium robertsii

The wild type MAA, the recombinant MAA-KO screened in Example 1, and the wild type obligate Metarhizium acridum (namely, MAC) were separately cultured on PDA plates. After 15 days of culture, spores of wild-type MAA, recombinant MAA-KO and MAC were inoculated into the L15 medium containing the hemolymph of migratory locusts (the preparation of the hemolymph of migratory locust: 200 μ L of fresh hemolymph was added to per 1 mL of L15 medium, filtered through a 0.22 μιτι filter; when the hyphae were cultured, 100 μΙ_ of the prepared hemolymph solution was added per ml of L15 medium), and cultured in a dark box at 28°C for 6 days; after the hyphae were collected, then the medium was washed twice with ddhkO, and freeze-dried at -20°C. 1 mg of dried hyphae was lysed with 100 μΙ_ of 0.1 M perchloric acid, ground, centrifuged at 5200 g and 4°C for 30 min, then the supernatant was neutralized with Na2COs to make the pH of about 6, and filtered through a 0.22 μιτι microporous filter for ready for use. The tryptamine content in the supernatant was determined by HPLC.

HPLC detection:

Agilent 1100, G1315A fluorescence detector (FLD), and chromatographic column: C18 column;

Mobile phase A: [0.05M acetic acid solution/tetrahydrofuran (96/4)]:

2020100601 20 Apr 2020 methanol (V: V) at 60 : 40. Mobile phase B: methanol.

Injection procedure:

A (in%): 75.00 (0 min), 75.00 (8 min), 66.67 (12 min), 50.00 (25 min), 0 (30 min), 66.67 (35 min), 75.00 (40 min);

B (in%): 25.00 (0 min), 25.00 (8 min), 33.33 (12 min), 50.00 (25 min), 100 (30 min), 33.33 (35 min), 25.00 (40 min).

Preparation of sample

Formulation of a 0.4N boric acid buffer (pH 10.2);

mg of the derivatization reagent o-phthalaldehyde (OPA) was dissolved in 100 μΙ_ of methanol, to which 900 μΙ_ of the 0.4 N boric acid buffer was added after complete dissolution, and then to which 10 μΙ_ of 3-mercaptopropionic acid (3-MPA) was added to formulate a mixture H.

The mixture H was uniformly mixed with the supernatant of the wild type MAA, the recombinant MAA-KO or the MAC, respectively, and injected. The injection volume was 0.5 pl_. The experimental results were shown in Figure 3A.

As could be seen from Figure 3A, the concentration of tryptamine in wild-type MAA was of 34.47 ng/mg, the concentration of tryptamine in MAC was of 85.07 ng/mg, and the concentration of tryptamine in recombinant MAA-KO was of 84.53 ng/mg. The concentration of tryptamine in the recombinant MAA-KO was not significantly different from that in the MAC (both were a), but was significantly different from that in the wild type MAA (they were a and b, respectively), from which it could be seen that the monoamine oxidase gene had been knocked-out from the recombinant MAA-KO screened in Example 1, significantly increasing the concentration of tryptamine.

Migratory locusts were infected with the spores of the wild type MAA, the recombinant MAA-KO screened in Example 1 or the wild-type obligate

2020100601 20 Apr 2020

Metarhizium acridum (namely, MAC), respectively. After 4 days, the hemolymph of the migratory locusts was taken, and the content of tryptamine was determined and recorded as MAA-4d, MAC-4d, KO-4d, respectively. The hemolymph of normal migratory loctusts which were not infected was used as a control and was recorded as CK. The experimental results were shown in Figure 3B.

As could be seen from Figure 3B, the concentration of tryptamine in the control CK was of 32.11 pg/μΙ, the concentration of tryptamine in the wild-type MAA was of 152.67 pg/μΙ, the concentration of tryptamine in the MAC was of 266.89 pg/μΙ, and the concentration of tryptamine in the recombinant MAA-KO was of 247.02 pg/μΙ. The concentration of tryptamine in the recombinant MAA-KO was not significantly different from that in the MAC (both were a), but was significantly different from that in the wild type MAA (they were a and b, respectively), and was significantly different from that in the control (they were a and c, respectively). It could be concluded that: after migratory locusts were infected with the recombinant MAA-KO from which the monoamine oxidase gene had been knocked-out screened in Example 1, the concentration of tryptamine was significantly increased in the migratory locusts, which was equivalent to that in the migratory locusts infected with the obligate MAC, and significantly higher than that in the migratory locusts infected with the wild-type MAA and that in the control group.

Example 3 Detection of ROS production affected by tryptamine

After three days of emergence, the scattered male migratory locusts were randomly divided into three groups, which were labeled as the control group Ck-4d, wild type group MAA-4d and recombinant mutant group KO-4d, respectively. The control group was not treated, the wild type group was infected with wild-type MAA, and the recombinant mutant group was infected with the MAA-KO screened in Example 1. After 4 days, the hemolymph of the migratory locusts was taken into 500 μΙ_ of the L15 medium, centrifuged rapidly

2020100601 20 Apr 2020 at 300 rpm and 4°C for 10 minutes, then the supernatant was discarded, and 500 μΙ_ of L15 medium containing 0.1 μΜ of Mitosox Red (red fluorescent probes) was added thereto. After incubation was carried out for 10 min at 37°C in the dark, the supernatant was removed by centrifugation, and the cells were suspended in the L15 medium and then placed on the machine.

Detector: Beckman CytoFLEX;

Detection channel: PE;

8000 cells were collected and the proportion of fluorescent cells was counted. The experimental results were shown in Figure 4.

As could be seen from Figure 4, the number of fluorescently labeled cells in the blank control Ck-4d was of 52.02%, the number of fluorescently labeled cells in the MAA-4d was of 68.38%, the number of fluorescently labeled cells in the recombinant KO-4d was of 78.99%, and the ROS cells in the migratory locusts infected with the recombinant MAA-KO from which the monoamine oxidase gene had been knocked-out were significantly higher than those in the migratory locusts infected with the wild-type MAA.

Example 4 Determination of pesticidal efficiency of the recombinant broad-spectrum Metarhizium robertsii

The wild-type obligate Metarhizium acridum MAA and the recombinant broad-spectrum Metarhizium robertsii (MAA-KO) were inoculated on PDA medium and cultured, respectively. The spores of MAA and MAA-KO were scraped separately, suspended by adding an appropriate amount of peanut oil respectively, subjected to vortex oscillation, filtered with a glass wool, collected, then resuspended with peanut oil, counted with a cell count plate under a microscope, and resuspended and counted for several time to obtain a final concentration of 1 χ 10⁶ spores/ml. 2 pl_ of the suspension of spores was pipetted and spotted on the back decks of scattered male oriental migratory locusts after 3 days of emergence, and oriental migratory locusts treated with

2020100601 20 Apr 2020 peanut oil and infected with the spores of the wild-type broad-spectrum Metarhizium robertsii (MAA) were used as controls. The number of dead insects was recorded every 12 hours. Finally, the semi-lethal time (LT50) was calculated by the SPSS 20.0 software, and the pesticidal virulence of the wild-type strain was compared with that of the transformed strain. The experimental results were shown in Figure 5.

The semi-lethal time of the wild-type broad-spectrum Metarhizium robertsii (MAA) against the migratory locusts was 7.33 ± 0.445 days, and the semi-lethal time of the recombinant broad-spectrum Metarhizium robertsii (MAA-KO) from which the monoamine oxidase gene had been knocked out against the migratory locusts was of 6.136 ± 0.488 days, demonstrating the virulence of the broad-spectrum Metarhizium robertsii was increased by knocking out the monoamine oxidase gene therefrom.

Tryptamine could regulate the behavior and metabolism of insects such as migratory locusts. In this example, by modifying metabolic genes, the monoamine metabolic enzyme gene in the broad-spectrum Metarhizium robertsii was knocked out, thereby reducing the expression of the enzyme, destroying the metabolic pathway of the tryptamine, and accumulating the tryptamine in the strain, whereby the pesticidal efficiency of the broad-spectrum Metarhizium robertsii was significantly increased.

In this example, the semi-lethal time LT50 of the recombinant broad-spectrum Metarhizium robertsii was shortened from 7.33 ± 0.445 days to 6.136 ± 0.488 days, which significantly improved the pesticidal efficiency of the broad-spectrum Metarhizium robertsii. Without the introduction of any exogenous gene, the recombinant broad-spectrum Metarhizium robertsii was environmentally friendly and had good biological safety.

The present invention provided a method of improving the pesticidal efficiency of a fungal pesticide by knocking out the monoamine oxidase gene

2020100601 20 Apr 2020 for tryptamine metabolism in a fungus (e.g., broad-spectrum Metarhizium robertsii in the embodiment of the present invention) to increase the concentration of tryptamine in the fungus. According to this principle, pesticidal efficiency could also be improved by increasing the concentration of tryptamine in insects (e.g., migratory locusts) by other means.

The above examples are only the preferred embodiments of the present invention, and are not intended to limit the present invention. Any modifications, equivalent substitutions, etc., which are within the spirits and principles of the present invention, should be included in the scope of the present invention.

Claims

1. A recombinant broad-spectrum Metarhizium, which down-regulates the expression of monoamine oxidase or does not express monoamine oxidase, or has a content of tryptamine therein higher than that in wild-type broad-spectrum Metarhizium, wherein the recombinant broad-spectrum Metarhizium is the strain per se, the progenies of the strain, the conidia produced by the strain, the mycelia produced by the strain, or any combination thereof.

2. The recombinant broad-spectrum Metarhizium according to claim 1, which is a recombinant broad-spectrum Metarhizium robertsiior a recombinant broad-spectrum Metarhizium anisopliae.

3. The recombinant broad-spectrum Metarhizium according to claim 1 or 2, which is a recombinant broad-spectrum Metarhizium robertsii having an accession number of CGMCC No. 14152.

4. A pesticide comprising the recombinant broad-spectrum Metarhizium according to any one of claims 1 to 3, the progenies of the strain, the conidia produced by the strain, the mycelia produced by the strain, or any combination thereof, and optionally a pesticidally acceptable carrier.

5. The pesticide according to claim 4, wherein the pesticide is used for controlling one or more of the following pests: pine caterpillars, corn borers, white grubs, locusts, Leptinotarsa deeomlineata, Monochamus alternatus, ants, tea lesser leafhoppers, peach fruit borers, mosquitoes and aphids.

6. Use of the recombinant broad-spectrum Metarhizium according to any one of claims 1 to 3, the progenies of the strain, the conidia produced by the strain, the mycelia produced by the strain, or any combination thereof, in the manufacture of a pesticide (preferably, a pesticide for killing locusts).

7. The use according to claim 6, wherein the pesticide further comprises

2020100601 20 Apr 2020 additional active ingredient(s) capable of killing locusts, preferably, the additional active ingredient is selected from the group consisting of destruxins, pyrethroids, carbamates, neonicotinoids, neuro-sodium channel blockers, pesticidal macrolides, gamma-aminobutyric acid (GABA) antagonists, diflubenzurons and chlorbenzuron.

8. A method of producing a recombinant broad-spectrum Metarhizium, comprising the step of upregulating and/or increasing the tryptamine in the recombinant broad-spectrum Metarhizium, preferably, knocking out or engineering a relevant nucleotide sequence that expresses monoamine oxidase through genetic recombination so that the expression of monoamine oxidase is down-regulated or monoamine oxidase is not expressed.

9. The method according to claim 8, wherein a relevant nucleotide sequence that expresses monoamine oxidase is knocked out so that the recombinant broad-spectrum Metarhizium does not express monoamine oxidase, wherein said knocking out specifically comprises the following steps: amplifying the upstream sequence and the downstream sequence of the nucleotide sequence of monoamine oxidase of a wild-type broad-spectrum Metarhizium, respectively, and seamlessly ligating the amplified upstream sequence and the downstream sequence, preferably, seamlessly ligating the amplified upstream and downstream sequences to the Bar gene.

10. A method for killing locusts, comprising the step of applying the recombinant broad-spectrum Metarhizium according to any one of claims 1 to 3, the progenies of said broad-spectrum Metarhizium, the conidia produced by broad-spectrum Metarhizium or the mycelia produced by broad-spectrum Metarhizium, or the pesticide according to claim 4 or 5.