KR101773339B1 - Composition for simultaneous control of both aphid, and Pythium ultimum, or Colletotrichum acutatum using Isaria fumosorosea Pf212 and its culture media - Google Patents
Composition for simultaneous control of both aphid, and Pythium ultimum, or Colletotrichum acutatum using Isaria fumosorosea Pf212 and its culture media Download PDFInfo
- Publication number
- KR101773339B1 KR101773339B1 KR1020150156251A KR20150156251A KR101773339B1 KR 101773339 B1 KR101773339 B1 KR 101773339B1 KR 1020150156251 A KR1020150156251 A KR 1020150156251A KR 20150156251 A KR20150156251 A KR 20150156251A KR 101773339 B1 KR101773339 B1 KR 101773339B1
- Authority
- KR
- South Korea
- Prior art keywords
- strain
- aphid
- isaria
- isaria fumosorosea
- aphids
- Prior art date
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/14—Fungi; Culture media therefor
-
- A01N63/04—
-
- C12R1/645—
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Health & Medical Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Genetics & Genomics (AREA)
- Biotechnology (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Microbiology (AREA)
- Biomedical Technology (AREA)
- Botany (AREA)
- Mycology (AREA)
- Virology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Agricultural Chemicals And Associated Chemicals (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
본 발명은 이사리아 푸모소로세아 Pf212 균주(Isaria fumosorosea Pf212, KACC93240P) 또는 이를 이용한 진딧물, 잘록병균 및 고추 탄저병균의 동시방제용 미생물 제제와 이의 제조방법에 관한 것으로서, 본 발명에 따른 상기 균주는 토착 미생물로서 국내 환경에 적응이 빠르고, 살충 또는 살미생물 효과를 나타내는데 신속하기 때문에, 상기 균주를 이용하여 제조된 미생물 제제는 진딧물, 잘록병균 및 고추 탄저병균의 방제용 생물농약으로서의 용도가 우수하다. 상기 균주 또는 미생물 제제는 환경 친화적이고 안정적인 방제수단으로 사용될 수 있기에, 시설하우스 재배 작물의 경제적 가치를 증대시키고, 안전 농산물 생산증대 및 미생물 제제 개발산업의 활성화에 유용하다.The present invention relates to a microorganism preparation for simultaneous control of Isaria fumosorosea Pf212 strain ( Isaria fumosorosea Pf212, KACC93240P) or aphids, Staphylococcus aureus and anthrax anthracis bacteria, and a method for producing the same, The microbial agent prepared by using the strain is excellent in its use as a pesticide for controlling aphids, athlete's foot and anthrax anthracnose, because it is an indigenous microorganism and quickly adapts to the domestic environment and exhibits an insecticidal or microbial effect. Since the strain or the microorganism preparation can be used as an environmentally friendly and stable control means, it is useful for increasing the economic value of the planthouse cultivation crops, activating the production of the safe agricultural products and the microbial agent development industry.
Description
본 발명은 이사리아 푸모소로세아 Pf212 균주(Isaria fumosorosea Pf212, KACC93240P) 또는 이를 이용한 진딧물, 잘록병균 및 고추 탄저병균의 동시방제용 미생물 제제와 이의 제조방법에 관한 것이다. The present invention relates to a microorganism preparation for simultaneous control of Isaria fumosorosea Pf212 strain ( Isaria fumosorosea Pf212, KACC93240P) or aphids, Staphylococcus aureus and anthrax anthracis bacteria using the same, and a method for producing the same.
진딧물(aphid)은 번식력이 매우 높고 빠른 유전적 약제 내성 발현에 의하여 방제하기 어려운 해충으로 알려져 있다. 진딧물은 특히 작물을 직접 흡즙하거나, 이를 통해 바이러스의 매개체가 되어 작물에 직접적인 피해를 주며, 2차적으로 그을음병까지 유발하기에, 농작물에 가장 큰 피해를 주는 해충의 하나이며, 국내외에서는 이러한 진딧물 방제를 위해 많은 연구와 노력이 이루어지고 있다. Aphids are known as insect pests that are very difficult to control due to their high fertility and rapid genetic resistance. Aphids are one of the most damaging crops because they directly feed crops or through which they directly cause damage to the crops as a viral agent and cause secondary soot diseases. In domestic and overseas markets, aphids Many studies and efforts have been made for
진딧물에 의한 피해면적은 국내 채소재배 면적의 53.8%(148,279 ha)에 이르고, 채소 재배 농가에서 살포하는 살충제의 27%가 진딧물 방제를 위해 살포되고 있는 실정으로, 특히 국내에서 진딧물 방제를 위해 이용되는 화학농약의 판매액은 2,300억원으로 추정되고 있으며, 원료의 대부분이 수입되어 막대한 외화가 지출되고 있다.Damage caused by aphids accounted for 53.8% (148,279 hectares) of domestic vegetable cultivation area, and 27% of the insecticides sprayed by vegetable growers were sprayed for the control of aphids. Especially, Sales of chemical pesticides are estimated at W230bn, and most of the raw materials are imported, and huge amounts of foreign currency are being spent.
생물학적 방제의 타겟이 되는 진딧물 중에서도 복숭아혹진딧물(Myzus persicae)은 복숭아나무, 살구나무, 자두나무, 벚나무, 귤나무 등을 기주로 하며, 5월 중순 이후에는 여름 숙주인 담배, 오이, 고추 등에서 흡즙에 의한 성장 억제 피해를 유발한다. 1년간 빠른 개체군은 23세대, 늦은 개체군은 9세대를 영위할 수 있을 정도로 번식력이 강하며, 수명이 약 28.5일로 짧은 곤충이다. 목화진딧물(Aphis gossypii)도 이와 비슷한 수명이나 번식력을 가지고 있다. 여름철에는 들깨, 오이, 호박, 수박, 가지, 토마토 등에 기생하고, 월동을 위해 늦가을에는 무궁화나무, 석류나무, 부용나무, 목화 등에 알을 낳는다. 한편, 이와 같은 흡즙성 진딧물의 방제는, 접촉에 의하여 진딧물에 침입하는 진균을 사용하는 미생물 농약의 연구가 활발하다. 그러나, 기존의 미생물 방제제는 포자가 곤충제에 접촉, 발아, 침입하는 시간이 오래 걸리고, 살충 효과를 나타내기까지는 온,습도 등 환경의 영향에 따라 방제 효과가 불균일하여 농민들이 사용을 기피하는 경향이 있어 곤충 병원성 진균의 활용기술이 아직까지는 시장에서 성공한 경우가 거의 알려져 있지 않다. Among the targeted aphids for biological control, peach aphid ( Myzus persicae ) is hosted by peach tree, apricot tree, plum tree, cherry tree, tangerine tree and after mid-May, it is used for summer jujube, cucumber, Which causes growth inhibition damage. The rapid population of 1 year is fertile enough to carry 23 generations, the late population 9 generations, and the life span is about 28.5 days. Cotton aphids ( Aphis gossypii ) have similar lifespan and fertility. In the summer, it is parasitic on perilla, cucumber, pumpkin, watermelon, eggplant, tomatoes, etc. It lays eggs on the cow tree, pomegranate tree, bamboo tree, cotton in late autumn for wintering. On the other hand, researches on microbial pesticides using fungi that invade aphids by contact are active in the control of such jujube aphids. However, existing microbial control agents take long time to contact, germinate, and invade into insecticides, and until the insecticidal effect is exhibited, the effect of control due to environmental influences such as temperature and humidity is uneven, It is hardly known that the use of insect pathogenic fungi has succeeded in the market until now.
잘록병은 작물의 발아 직후 유묘(幼苗)에 발생하는 식물병의 하나로서 유묘의 지표부가 수침상으로 연화 또는 지표부에 갈색의 병반이 생겨 도복하여 고사한다. 입고병의 1종이지만, 모종시기에만 발생하여 묘립고병, 모잘록병이라고도 한다. 많은 작물에 발생하며 피시움 울티뭄(Pythium ultimum) 등이 원인이 되어 발생한다. It is one of the plant diseases that occurs in the seedling immediately after germination of the crop, and the surface of the seedlings is softened by the needle-like shape, or brown lesion occurs on the surface of the seedlings. It is one kind of wearing disease, but it occurs only in the seedling period, and it is also called myeongryik disease, mossy mildew disease. It occurs in many crops and is caused by Pythium ultimum .
고추 탄저병은 주로 과실에 발생한다. 과실에는 처음에 감염부위가 수침상으로 약간 움푹 들어간 원형반점으로 나타나고, 진전되면 병반이 원형 내지 부정형의 겹무늬증상으로 확대된다. 병반부위에는 담황색 내지 황갈색의 포자덩어리가 형성되고, 심하게 병든 과실은 비틀어지고 미이라처럼 말라버린다. 성숙과의 병반은 간혹 흑색의 겹무늬증상을 띠는 것도 있으며, 수확후 건조하는 과정에서 병증상이 나타나는 것도 있다. 고추 탄저병은 콜레토트리쿰 아쿠타툼(Colletotrichum acutatum) 등이 원인이 되며, 이 균주는 종자 혹은 병든 부위에서 자낭각과 균사의 형태로 월동하여 1차전염원이 된다. 병의 전반은 주로 분생포자에 의해 이루어지며, 시설재배 포장보다는 노지포장에서 병발생이 심하다. 노지포장에서는 여름철 장마기에 분생포자가 주로 비바람에 의해 전반된다. 노지재배의 풋고추에서는 7월 초순부터 병이 발생하기 시작하여 수확기까지 계속 발생한다. Pepper anthracnose occurs mainly in fruits. In the fruit, the infected area appears as a circular spot with a slight indentation on the surface of the inflorescence, and when it develops, the lesion enlarges to circular or irregular pattern. On the lesion, pale yellow to yellowish spore mass is formed, and the severely diseased fruit is twisted and dried up like a mummy. Some of the diseased lesions of maturity are sometimes black, with symptoms of disease occurring during the drying process after harvest. The red pepper anthracnose is caused by Colletotrichum acutatum and the like, and this strain grows in the seed or the diseased part in the form of the phloem and mycelium, and becomes the first order source. The first half of the disease is mainly caused by conidial spores. In the case of paddy rice wrapping, seasonal rainfalls are mainly caused by wind and rain during summer rainy season. In the green pepper cultivated in Noji, disease starts to occur from the beginning of July and continues until the harvest time.
국내에 보고된 잘록병이나 고추탄저병은 방제가 까다로우면서도 그 효과가 그다지 높지 않다. 또한 방제비용도 비싸고 반복적으로 사용할 때는 약제에 대한 저항성도 발생할 수 있다. 잘록병이나 고추탄저병이 발생하는 채소류는 주로 생것으로 직접 섭취하기 때문에 소비자로부터 농약에 대한 안전성 문제가 계속 대두되고 있고 이로 인해 화학농약의 사용도 회피되고 있어 농가에서 많은 어려움을 겪고 있다. 게다가 화학농약을 사용하는 방제방법은 시간이 지나면서 화학물질에 대한 내성이 생길 수 있다는 치명적인 단점이 발생하는데다가 화학적 잔류물에 의한 환경적인 위험이 제기되어 왔다. Domestic anthracnose and red pepper anthracnose are difficult to control but not very effective. It is also expensive to control and may cause resistance to drugs when used repeatedly. Since the vegetables that are caused by melancholy and pepper anthracnose are mainly taken directly from raw materials, the problem of safety of pesticides from consumers is continuously increasing, and the use of chemical pesticides is also being avoided from consumers. In addition, chemical pesticide-based control methods have a fatal disadvantage that they may become resistant to chemicals over time, and environmental hazards due to chemical residues have been raised.
이에, 본 발명자들은 국내 환경에 잘 적응할 수 있으며, 신속한 살충 또는 살미생물 효과를 나타내는 토착 곤충병원성 진균 균주를 포함하는 미생물 농약을 개발하기 위하여 예의 노력한 결과, 국내 토양에서 진딧물, 잘록병균 및 고추 탄저병균 방제능이 우수한 신규 균주인 이사리아 푸모소로세아 Pf212(Isaria fumosorosea Pf212)를 분리하여 본 발명을 완성하였다.Accordingly, the present inventors have made intensive efforts to develop a microbial pesticide containing an insect pest pathogenic fungus strain which can be adapted well to the domestic environment and exhibit rapid insecticidal or microbial effect. As a result, it has been found that aphids, ( Isaria fumosorosea Pf212), which is a novel strain having excellent antifouling activity, was isolated and the present invention was completed.
한편, 본 발명에 대한 선행기술로는 진드기에 대한 살충효과가 있다고 개시된 이사리아 푸모소로세아 균주(Isaria fumosorosea CCM 8367 - CCEFO.011.PFR)에 관한 발명인 미국등록특허 8574566, 담배가루이 Q 타입에 대한 방제 효과를 갖는 이사리아 속 균주(이사리아 자바니카 Pf04, KACC93122P)가 개시된 대한민국등록특허 10-1330078, 항진딧물 효과가 개시된 이사리아 푸모소로세아 균주가 개시된 Shapiro-Ilan et al.(J Invertebr Pathol. 2008, 99(3):312-317)의 논문 등이 있다. On the other hand, as prior art to the present invention, there has been reported a Isaria US Patent No. 8574566, which is an invention on fumosorosea CCM 8367-CCEFO.011.PFR), Korean Patent No. 10-1330078, which discloses a Escherichia coli strain (Isaria Laja Nica Pf04, KACC93122P) , Shapiro-Ilan et al., In which Isaria fumorosaea strain, in which the anti-aphid effect was initiated, was disclosed . (J Invertebr Pathol. 2008, 99 (3): 312-317).
본 발명의 목적은 이사리아 푸모소로세아 Pf212 균주(Isaria fumosorosea Pf212, KACC93240P) 또는 이를 이용한 진딧물, 잘록병균 및 고추 탄저병균의 동시방제용 미생물 제제와 이의 제조방법을 제공하는데 있다.It is an object of the present invention to provide a microorganism preparation for simultaneous control of Isaria fumosorosea Pf212 strain ( Isaria fumosorosea Pf212, KACC93240P) or aphids, Streptococcus pneumoniae, and Anthrax anthracis bacteria, and a method for producing the same.
본 발명은 진딧물(aphid), 잘록병균(Pythium ultimum) 또는 고추 탄저병균(Colletotrichum acutatum)의 방제능이 있는 이사리아 푸모소로세아 Pf212 균주(Isaria fumosorosea Pf212, KACC93240P)에 관한 것이다. The present invention relates to a Isaria fumosorosea Pf212 strain (KACC93240P) which is capable of controlling aphids, Pythium ultimum or Colletotrichum acutatum .
상기 이사리아 푸모소로세아 Pf212 균주는 진딧물, 잘록병균 및 고추 탄저병균의 동시방제능이 있는 것을 특징으로 한다. The isolia fumosorosa Pf212 strain is characterized by having the ability to simultaneously control aphids, Streptococcus pyogenes and anthracnose anthracnose.
본 발명은 또한 상기 이사리아 푸모소로세아 Pf212 균주의 균체 또는 이의 배양액을 유효성분으로 함유하는 진딧물, 잘록병균 또는 고추 탄저병균의 방제용 미생물 제제를 제공한다. The present invention also provides a microorganism preparation for controlling aphid, Staphylococcus aureus or anthrax anthracnose fungi containing the microorganism strains of Isaria fuomorosaea Pf212 or a culture thereof as an active ingredient.
이에 본 발명에서는 상기 이사리아 푸모소로세아 Pf212 균주를 배양하는 방법과, 상기 이사리아 푸모소로세아 Pf212 균주의 균체나 이의 배양액을 함유한 미생물 제제를 식물에 처리하여 진딧물, 잘록병균 또는 고추 탄저병균을 방제하는 방법을 제공한다. Accordingly, the present invention provides a method for cultivating the Isaria fumorosaea Pf212 strain and a microorganism preparation containing the microbial culture of the Isaria plumosaea Pf212 strain and a plant to treat aphid, Thereby providing a method for controlling bacteria.
이하 본 발명을 상세하게 설명한다. Hereinafter, the present invention will be described in detail.
본 발명은 진딧물(aphid), 잘록병균(Pythium ultimum) 또는 고추 탄저병균(Colletotrichum acutatum)의 방제능이 있는 이사리아 푸모소로세아 Pf212 균주(Isaria fumosorosea Pf212, KACC93240P)에 관한 것으로서, 상기 균주 또는 이의 배양액, 이들이 포함된 미생물 제제를 진딧물, 잘록병균 또는 고추 탄저병균의 방제제로서 이용할 수 있다. The present invention relates to Isaria fumosorosea Pf212 (KACC93240P), which is capable of controlling aphid, Pythium ultimum or Colletotrichum acutatum , and is characterized in that the strain or its culture , And the microorganism preparation containing them can be used as a controlling agent for aphids, aspergillus or pepper anthracnose.
상기 배양액은 바람직하게는 이사리아 푸모소로세아 Pf212 균주를 미생물 배지에 접종한 것의 배양액일 수 있다. 상기 미생물 배지로는 이사리아 푸모소로세아 Pf212가 생장할 수 있는, PDA(potato dextrose agar), PDB(Potato Dextrose Broth), SDA(sabouraud dextrose agar), SDAY(sabouraud dextrose agar with yeast extract), AD(Modified adamek's media) 액체배지, AD 고체배지 등의 배지를 사용할 수 있으며, 바람직하게는 AD 액체 배지 또는 PDA를 사용할 수 있다. The culture solution may preferably be a culture solution obtained by inoculating a microorganism culture with Isaria fumorosaea Pf212 strain. Examples of the microorganism medium include PDA (potato dextrose agar), PDA (potato dextrose broth), SDA (sabouraud dextrose agar), SDAY (sabouraud dextrose agar with yeast extract), AD (Modified adamek's media) liquid medium, AD solid medium and the like can be used. Preferably, AD fluid medium or PDA can be used.
상기 PDA는 4g/ℓ potato starch, 20g/ℓ dextrose, 15g/ℓ agar를 혼합하여 제조할 수 있으나, 이에 한정되는 것은 아니다. PDB는 PDA에서 agar를 혼합하지 않고 제조한 액체배지이다. AD 액체배지는 Adameks media의 기본 조성을 변형하여 20g/ℓ glucose, 20g/ℓ yeast extract, 30g/ℓ corn steep liquor를 혼합하여 제조할 수 있다. AD 고체배지는 상기 AD 액체배지에 15g/ℓ agar를 혼합하여 제조할 수 있다. SDA는 40g/ℓdextrose, 10g/ℓ mycological peptone, 15g/ℓ agar를 혼합하여 제조할 수 있다. SDAY는 SDA에 10g/ℓ yeast extract를 혼합하여 제조할 수 있다. The PDA may be prepared by mixing 4 g / l potato starch, 20 g / l dextrose and 15 g / l agar, but is not limited thereto. PDB is a liquid medium prepared without mixing agar in PDA. AD liquid medium can be prepared by modifying the basic composition of Adameks media and mixing 20g / l glucose, 20g / l yeast extract and 30g / l corn steep liquor. AD solid medium can be prepared by mixing 15 g / l agar in the AD liquid medium. SDA can be prepared by mixing 40 g / lextrose, 10 g / l mycological peptone and 15 g / l agar. SDAY can be prepared by mixing SDA with 10 g / L yeast extract.
상기 배양액을 미생물 제제로 사용할 때는, 이사리아 푸모소로세아 Pf212 균주 배양 후, 이사리아 푸모소로세아 Pf212 균주의 균체를 함유한 채로 사용할 수도 있으며, 균체를 제거한 배양여액 상태로 사용할 수 있다. When the above culture medium is used as a microorganism preparation, it may be used in the form of a culture filtrate obtained by removing microbial cells after cultivation of Isaria fumorosaea Pf212 strain, or cells of Isaria fumorosaea Pf212.
상기 이사리아 푸모소로세아 Pf212 균주의 배양방법은, (a) 미생물 배지에 이사리아 푸모소로세아 Pf212의 포자를 접종하는 단계; 및 (b) 상기 접종액을 25~30℃에서 7~20일간 배양하는 단계;를 포함할 수 있다. 상기 (a) 단계의 미생물 배지는 바람직하게는 AD 배지 또는 PDA를 사용할 수 있다. 상기 (a) 단계에서 이사리아 푸모소로세아 Pf212 균주를 접종할 때, 초기 접종 농도는 바람직하게는 5x105 ~ 5x106 conidia/㎖일 수 있으며, 더 바람직하게는 1x106 conidia/㎖일 수 있다. 상기 (b) 단계의 배양액에 대해 균체를 제거하는 단계를 추가로 포함할 수 있다. 따라서, 이사리아 푸모소로세아 Pf212의 배양액을 함유하는 본 발명의 미생물 제제는 상기 배양방법을 통해 제조될 수 있다. The method for culturing the isolia fumosorosa Pf212 strain comprises the steps of: (a) inoculating a microorganism medium with a spore of Isaria fumosorosa Pf212; And (b) culturing the inoculum at 25 to 30 DEG C for 7 to 20 days. Preferably, the microorganism medium of step (a) may be an AD medium or a PDA. When inoculated Seah Pf212 strain on the board Liao Fu moso in step (a) above, the initial inoculation concentration are preferably may be 5 ~ 5x10 6 conidia / ㎖ 5x10 , may be more preferably 1x10 6 conidia / ㎖ . The step (b) may further include removing the cells from the culture solution. Therefore, the microorganism preparation of the present invention containing the culture medium of Isaria fumorosae Pf212 can be produced through the above culture method.
본 발명의 균주 및 이의 배양액, 이를 함유하는 미생물 제제가 방제할 수 있는 진딧물은 복숭아혹진딧물, 조팝나무진딧물, 목화진딧물, 귤소리진딧물, 딱총나무수염진딧물 등을 포함할 수 있고, 바람직하게는 목화진딧물 또는 복숭아진딧물일 수 있으나, 상기 진딧물이 이에 제한된 것은 아니다.The aphid which can be controlled by the strain of the present invention, the culture solution thereof, and the microorganism preparation containing the same can include peach aphid, aphid, cotton aphid, mandarin aphid, Aphid or peach aphid, but the aphid is not limited thereto.
본 발명에 있어서의 용어 '배양액'은 미생물 생장에 적절한 배지에 일정 농도의 균주 포자를 접종하여 배양기에서 일정 기간 동안 미생물이 생장하도록 유도한 후 수득된 균체, 균체가 생장하면서 분비한 물질 및 생장에 필요한 영양성분이 혼합된 액이며, 추가로 여과과정을 이용하여 불순물을 걸러내는 과정을 거쳐 제조할 수 있다. 또한 '배양여액'은 상기 배양액에서 균체를 원심분리 또는 여과 과정(filtration) 통해 제거하고, 균체가 생장하면서 분비한 물질 및 생장에 필요한 영양성분만을 포함한 것일 수 있다. 상기 여과과정에 사용되는 것은 종이필터를 사용하는 것이 바람직하며, 바람직하게는 종이필터로서 와트만 No.2 필터페이퍼(Whatman No.2 filter paper)를 사용할 수 있지만, 이에 한정된 것은 아니다. The term " culture broth " in the present invention refers to a culture broth obtained by inoculating a spore of a certain concentration into a medium suitable for microorganism growth, inducing the microorganism to grow for a predetermined period of time in an incubator, It is a liquid mixed with necessary nutrients and can be produced by further filtering the impurities using a filtration process. In addition, the 'culture filtrate' may be one which contains the nutrients necessary for growth and the secreted substances by removing the cells through centrifugation or filtration in the culture broth. A paper filter is preferably used for the filtration process, and a Whatman No. 2 filter paper may be used as the paper filter, but the present invention is not limited thereto.
본 발명의 용어 '방제'는 일반적으로 식물 병원체 감염을 예방, 감소 또는 근절시키는 것을 포함하며, 감염에 있어서의 예방 또는 감소는 비처리된 기주식물에 대하여 통계적으로 현저한 차이가 있음을 의미한다.The term " control " of the present invention generally includes preventing, reducing or eradicating plant pathogenic infections, wherein the prevention or reduction in infection means that there is a statistically significant difference for untreated host plants.
본 발명의 진딧물, 잘록병균 또는 고추 탄저병균의 방제용 미생물 제제는 식물의 생리적 상태, 곤충의 종류, 병원체 감염 정도 및 농도, 계절, 습도, 식물의 연령 및 성장단계, 식물 처리방법에 따라 조성물의 사용량 및 살포방법을 결정하는데 고려할 수 있다.The microorganism preparation for controlling aphids, allium germs or red pepper anthracnose of the present invention can be used for controlling the composition of the composition according to the physiological condition of the plant, the kind of the insect, the degree and the concentration of the pathogen infection, the season, the humidity, Can be considered in determining the amount and method of application.
본 발명의 진딧물, 잘록병균 또는 고추탄저병균의 방제용 미생물 제제에 포함된 이사리아 푸모소로세아 Pf212는 생육가능한 상태이어야 하며, 이는 균사(mycelial) 및 포자(spore) 형태의 균체일 수 있다.The Isaria plumosaea Pf212 contained in the microorganism preparation for controlling aphids, allium germs or pepper anthracis of the present invention should be in a viable state and may be cells in the form of mycelial and spores.
본 발명의 이사리아 푸모소로세아 Pf212 균주는 곤충 병원성 균주로서, 상기 용어 '곤충 병원성'은 진균류 즉 곰팡이의 포자가 숙주 곤충의 외피에 부착하여 발아하게 되면, 키티나아제(chitinase), 프로테아제(protease), 리파아제(lipase), 에스테라아제(esterase) 등을 생성하여 곤충의 큐티클 층을 뚫은 후 침입하게 되고, 이어 곤충의 체내에 증식하면서 독성 물질을 생산하여 숙주곤충을 사멸케하는 효과를 의미하며, '살충효과'와 혼용하여 사용될 수 있다.As used herein, the term " insect pathogenic " means that the fungus, that is, the spore of the fungus, adheres to the outer surface of the host insect and germinates, the chitinase, the protease protease, lipase, esterase and the like, penetrating the cuticle layer of the insect, penetrating into the insect, and then producing a toxic substance by propagating in the body of the insect, thereby killing the host insect. Can be used in combination with the " insecticidal effect ".
본 발명의 이사리아 푸모소로세아 Pf212 균주를 배양하여 제조한 미생물 제제는 고체 또는 액체 배양기술을 사용하여 제조가능하며, 상기 이사리아 푸모소로세아 Pf212 균주의 배양온도는 10~30℃, 더 바람직하게는 25~30℃이다. 또한 바람직하게는 7~20일간, 더 바람직하게는 10~15일간, 가장 바람직하게는 15일간 배양하여 배양액 또는 배양물을 수득할 수 있다. The microorganism preparation prepared by culturing the Isaria fumorosaea Pf212 strain of the present invention can be produced using a solid or liquid culture technique. The culture temperature of the Isaria fumosorosa Pf212 strain is 10 to 30 ° C, And preferably 25 to 30 ° C. More preferably 7 to 20 days, more preferably 10 to 15 days, and most preferably 15 days to obtain a culture medium or culture.
본 발명의 미생물 제제는 농업적으로 허용 가능한 담체를 포함할 수 있으며, 충전제(fillers), 용매, 부형제, 계면활성제(surfactants), 현탁제(suspending agents), 스프래더(spreaders), 부착제(adhesives), 소포제, 분산제, 습윤제, 드리프트 감소제(drift reducitng agents), 보조제(suxiliaries), 보강제(adjuvants) 또는 이의 혼합물을 포함할 수 있다. The microbial formulations of the present invention may comprise an agriculturally acceptable carrier and may be formulated as fillers, solvents, excipients, surfactants, suspending agents, spreaders, adhesives, ), Defoamers, dispersants, wetting agents, drift reducitng agents, suxiliaries, adjuvants or mixtures thereof.
본 발명의 미생물 제제는 농축물, 용액, 스프레이, 에어로졸, 침수용(immersion baths), 침지(dips), 에멀젼(emulsions), 현탁 농축액, 겔, 과립(granules) 등의 타입으로 제제화 할 수 있다.The microbial formulation of the present invention can be formulated into concentrate, solution, spray, aerosol, immersion baths, dips, emulsions, suspension concentrates, gels, granules and the like.
본 발명의 미생물 제제는, 상기 미생물 제제 단독 또는 다른 농업용 제제, 농약(pesticides), 살충제(insecticides), 살응애제(acaracides), 살진균제(본 발명의 진균에 무해한 진균제), 살박테리아제, 제초제, 항생제, 항균제, 살선충제(nematocides), 쥐약(rodenticides), 곤충병원체(entomopathogens), 페로몬(pheromones), 유인제(attractants), 식물성장조절제(plant growth regulators), 식물 호르몬(plant hormones), 곤충성장 조절제(insect growth regulators), 화학불임제(chemosterilants), 미생물 작물보호제(microbial pest control agents), 방충제(repellents), 바이러스, 식자극제(phagostimulents), 식물 영양제, 식물비료 및 생물학적 방제제와 함께 배합하거나, 순차적으로 사용될 수 있으며, 이들의 특정 예는 당업계의 통상의 지식을 가진 사람에게는 자명한 것으로, 용이하게 입수할 수 있다.The microbial formulation of the present invention can be used as a microbial agent for the treatment or prevention of diseases caused by the above-mentioned microbial agent or other agricultural agent, pesticides, insecticides, acaracides, fungicides (fungicides harmless to the fungi of the present invention) Antimicrobials, nematocides, rodenticides, entomopathogens, pheromones, attractants, plant growth regulators, plant hormones, plant growth regulators, In combination with insect growth regulators, chemosterilants, microbial pest control agents, repellents, viruses, phagostimulents, plant nutrients, plant fertilizers, and biological control agents And specific examples thereof are obvious to those of ordinary skill in the art and can be easily obtained.
본 발명은 이사리아 푸모소로세아 Pf212 균주(Isaria fumosorosea Pf212, KACC93240P) 또는 이를 이용한 진딧물, 잘록병균 또는 고추탄저병균의 동시방제용 미생물 제제와 이의 제조방법에 관한 것으로서, 본 발명에 따른 상기 균주는 토착 미생물로서 국내 환경에 적응이 빠르고, 신속한 살충 또는 살진균 효과를 나타낸다. 따라서 상기 균주를 이용하여 제조된 미생물 제제는 진딧물, 잘록병균 또는 고추탄저병균의 방제 효과가 우수한 생물농약으로 사용가능하다. 또한 상기 균주 또는 미생물 제제는 환경 친화적이고 안정적인 방제수단으로 사용될 수 있기에, 시설하우스 재배 작물의 경제적 가치를 증대시키고, 안전 농산물 생산증대 및 미생물 제제의 개발산업의 활성화에도 유용하다. 선행문헌인 미국등록특허 8574566에 이사리아 푸모소로세아 균주(Isaria fumosorosea CCM 8367 - CCEFO.011.PFR)가 진드기 등에 대한 살충효과가 있다고 개시되어 있지만, 상기 균주는 본 발명의 균주와는 16S rRNA의 유전자 서열이 전혀 다른 균주인데다가, 상기 선행문헌의 균주가 역시 본 발명에서와 같이 진딧물이나 잘록병균, 고추 탄저병균의 방제효과가 있음에 관해서도 미국등록특허 8574566의 상세한 설명에 개시된 바 없다. 대한민국등록특허 10-1330078에도 담배가루이 Q 타입에 대한 방제 효과를 갖는 이사리아 속 균주(이사리아 자바니카 Pf04, KACC93122P)가 개시되어 있지만, 상기 균주는 본 발명의 균주와 균종 및 16S rRNA의 유전자 서열이 다를 뿐만 아니라 상기 이사리아 속 균주가 진딧물, 잘록병균 또는 고추 탄저병균의 방제효과가 있다는 것도 대한민국등록특허 10-1330078의 상세한 설명에 전혀 개시되어 있지 않다. 선행기술 Shapiro-Ilan et al.(J Invertebr Pathol. 2008, 99(3):312-317)의 이사리아 푸모소로세아 균주 역시 본 발명의 균주와는 전혀 다른 균주라고 할 수 있다. The present invention relates to a microorganism preparation for simultaneous control of Isaria fumosorosea Pf212 strain ( Isaria fumosorosea Pf212, KACC93240P) or aphids, Staphylococcus aureus or anthrax anthracis bacteria and a method for producing the same, and the strain according to the present invention As an indigenous microorganism, adaptation to the domestic environment is rapid and exhibits rapid insecticidal or fungicidal effect. Therefore, the microorganism preparation prepared using the strain can be used as a biological pesticide excellent in the control effect of aphids, stigma germs or anthrax anthracnose. In addition, since the strain or the microorganism preparation can be used as an environmentally friendly and stable control means, it is useful for enhancing the economic value of a planthouse cultivated crop, increasing the production of safe agricultural products, and activating the development industry of a microbial agent. In the prior art U.S. Patent No. 8574566, Isaria strains ( Isaria fumosorosea CCM 8367-CCEFO.011.PFR) has an insecticidal effect against mites. However, the above strain is a strain completely different in gene sequence of 16S rRNA from the strain of the present invention, and the strain of the above- As described in the present invention, the effect of controlling aphids, Alzheimer's disease, and red pepper anthracnose is not disclosed in the detailed description of USP 8574566. [ Korean Patent No. 10-1330078 discloses a genus Escherichia (Isaria javanica Pf04, KACC93122P) in which tobacco has a controlling effect on the Louis Q type. However, the strain is a strain of the present invention, a strain of the present invention and a gene of 16S rRNA It is not disclosed in the detailed description of Korean Patent No. 10-1330078 that the above-mentioned Isaria genus strain has an effect of controlling aphid, Staphylococcus aureus or anthrax anthracnose. Prior art Shapiro-Ilan et al. (J Invertebr Pathol. 2008, 99 (3): 312-317) is also a completely different strain from the strain of the present invention.
도 1은 본 발명의 이사리아 푸모소로세아 Pf212 균주(Isaria fumosorosea Pf212)(KACC93240P) 포자 현탁액 희석액의 진딧물 살충율을 나타낸 그래프이다. 도 1의 샘플 표시에서, 'Pf212(10*8)'은 이사리아 푸모소로세아 Pf212 균주의 포자 현탁액 희석액 1x108 conidia/㎖ 투여군, 'Pf212(10*7)'은 이사리아 푸모소로세아 Pf212 균주의 포자 현탁액 희석액 1x107 conidia/㎖ 투여군, 'Pf212(10*6)'은 이사리아 푸모소로세아 Pf212 균주의 포자 현탁액 희석액 1x106 conidia/㎖ 투여군을 나타내고, D1~D5는 각각 살충률을 확인한 1~5일의 날짜를 나타낸다. 또한 도 1A는 복숭아혹진딧물에 대한 살충율, 도 1B는 목화진딧물에 대한 살충율을 나타낸다.
도 2는 본 발명의 이사리아 푸모소로세아 Pf212 균주(Isaria fumosorosea Pf212)(KACC93240P) 액체배양액의 진딧물 살충율을 나타낸 그래프이다. 도 2의 샘플 표시에서, 'Pf212(10*8)'은 이사리아 푸모소로세아 Pf212 균주의 배양액 희석액 1x108 conidia/㎖ 투여군, 'Pf212(10*7)'은 이사리아 푸모소로세아 Pf212 균주의 배양액 희석액 1x107 conidia/㎖ 투여군, 'Pf212(10*6)'은 이사리아 푸모소로세아 Pf212 균주의 배양액 희석액 1x106 conidia/㎖ 투여군을 나타내고, D1~D5는 각각 살충률을 확인한 1~5일의 날짜를 나타낸다. 또한 도 2A는 복숭아혹진딧물에 대한 살충율, 도 2B는 목화진딧물에 대한 살충율을 나타낸다.
도 3은 본 발명의 이사리아 푸모소로세아 Pf212 균주(Isaria fumosorosea Pf212)(KACC93240P)의 고추 탄저병균(Colletotrichum acutatum) 및 잘록병균(Pythium ultimum)에 대한 항균 효과를 확인한 결과를 나타내는 사진이다(이사리아 푸모소로세아 Pf212 균주의 AD 액체배지 배양액을 고추 탄저병균[도 3A] 및 잘록병균[도 3B]이 있는 PDA 배지에 배양하여 확인).BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 is a graph showing the aphid kill rate of Isaria fumosorosea Pf212 (KACC93240P) spore suspension dilution of Isaria fumosorosea Pf212 of the present invention. In the sample display of FIG. 1, 'Pf212 (10 * 8)' represents 1 × 10 8 conidia / ml of spore suspension diluted with Isaiahia fumorosaea Pf212, 'Pf212 (10 * spore suspension diluted Pf212 strain 1x10 7 conidia / ㎖ group, 'Pf212 (10 * 6) ' denotes a spore suspension dilutions 1x10 6 conidia / ㎖ group of Seah Pf212 strain on the board Liao Fu moso, D1 ~ D5 are each insecticidal rate Date of 1 to 5 days. 1A also shows the insecticidal rate against peach aphid, and Fig. 1B shows the insecticidal rate against cotton aphid.
FIG. 2 is a graph showing the aphid kill rate of Isaria fumosorosea Pf212 (KACC93240P) liquid culture medium of Isaria fumosorosa Pf212 of the present invention. In the sample display of FIG. 2, 'Pf212 (10 * 8)' represents 1 × 10 8 conidia / ml of culture solution diluted with Isaiahia fumorosaea Pf212, 'Pf212 (10 * 7)' represents Isaria fumosorosa Pf212 (1 × 10 7 conidia / ㎖), and 'Pf212 (10 * 6)' represents 1 × 10 6 conidia / ㎖ of culture solution of Isaiahia fumorosaea Pf212 strain. Represents the date of ~ 5 days. Fig. 2A also shows the insecticidal rate against peach aphid, and Fig. 2B shows the insecticidal rate against cotton aphid.
FIG. 3 is a photograph showing the antimicrobial effect of Isaria fumosorosea Pf212 (KACC93240P) against Colletotrichum acutatum and Pythium ultimum of Isaria fumosorosea Pf212 of the present invention The culture medium of the AD liquid medium of the strain Liafosomosoa Pf212 was confirmed by culturing in a PDA medium containing pepper anthracnose (Fig. 3A) and erythroblast (Fig. 3B).
본 발명을 하기의 실시예를 통해 더욱 구체적으로 설명한다. 그러나, 하기 실시예는 본 발명의 이해를 돕기 위한 것일 뿐, 어떤 의미로든 본 발명의 범위가 이러한 실시예에 의하여 한정되는 것은 아니다. 이때, 사용되는 기술 용어 및 과학 용어에 있어서 다른 정의가 없다면, 이 발명이 속하는 기술 분야에서 통상의 지식을 가진 자가 통상적으로 이해하고 있는 의미를 가지며, 하기의 설명 및 첨부 도면에서 본 발명의 요지를 불필요하게 흐릴 수 있는 공지기능 및 구성에 대한 설명은 생략한다. The present invention will be described more specifically with reference to the following examples. However, the following examples are provided to aid understanding of the present invention, and the scope of the present invention is not limited by these examples in any sense. Hereinafter, the technical and scientific terms used herein will be understood by those skilled in the art without departing from the scope of the present invention. Descriptions of known functions and configurations that may be unnecessarily blurred are omitted.
<실시예 1.≪ Example 1 > 토양으로부터 이사리아 푸모소로세아From the soil Isaia fuomos rosaa Pf212 균주의 분리 및 동정>Isolation and Identification of Pf212 Strain>
실시예 1-1. 토양으로부터 균주의 분리Example 1-1. Isolation of strain from soil
농경지 주변 야산에서 수집된 토양에 꿀벌부채명나방(Galleria mellonella) 유충을 넣어, 토양에 존재하는 진균에 감염되도록 14일 동안 방치한 다음, 감염된 유충을 선별하여, 이에 대해 인공배지인 PDA(Potato Dextrose Agar)를 이용하여 얻어진 균주들을 순수 분리하였다. 순수분리된 균은 동결건조 방법을 이용하여 균을 보존하고, 이 균들 중, 항균활성이 큰 균주들을 선별하여(실시예 2 및 3의 방법으로 검정) 통상적인 균주의 분리 동정법에 따라 균주의 종류를 확인하였다. Galleria mellonella larvae were placed in the soil collected from the hills around the farmland and allowed to remain in the soil for 14 days to infect the fungi present in the soil. The infected larvae were selected, and an artificial medium, PDA (Potato Dextrose Agar) were used to isolate pure strains. The strains of pure isolates were preserved using the freeze-drying method, and strains having a large antimicrobial activity among the strains were selected (assayed by the methods of Examples 2 and 3) Type.
실시예 1-2. 토양에서 분리된 균주의 동정 Examples 1-2. Identification of strains isolated from soil
실시예 1-1의 방법대로 토양에서 순수 분리된 진균 중, 항균활성이 가장 큰 균주를 현미경 관찰에 의해 형태학적 특징을 파악하고, 이 균주의 DNA를 추출하여 ITS 분석을 수행하였다([주]제노셀). 그 결과, 최종적으로 상기 균주가 Isaria fumosorosea와 유전학적 정보가 100% 일치하고, 하기의 서열번호 1의 16S rRNA 유전자의 DNA 염기서열을 갖는 것을 확인하여, 이사리아 푸모소로세아 Pf212(Isaria fumosorosea Pf212, KACC93240P)라 명명하여 기탁하였다. The morphological characteristics of the strains having the greatest antimicrobial activity among the pure fungi isolated from soil in accordance with the method of Example 1-1 were observed by a microscope and ITS analysis was carried out by extracting the DNA of the strains (Note: Xenocell). As a result, it was finally confirmed that the strain had 100% of the genetic information with Isaria fumosorosea and had the DNA sequence of the 16S rRNA gene of SEQ ID NO: 1 below. Thus, Isaria fumosorosea Pf212 , KACC93240P).
16S rRNA 유전자의 DNA 염기서열 - 서열번호 1: DNA sequence of 16S rRNA gene - SEQ ID NO: 1:
GCGGAGGGATCATTAACGAGTTTTTTCAACTCCCTAACCCTTTGTGAACATACCTATCGTTGCTTCGGCGGACTCGCCCCGGCGTCCGGACGGCCCTGCGCCGCCCGCGACCCGGACCCAGGCGGCCGCCGGAGACCCACAAATTCTGTTTCTATCAGTCTTTCTGAATCCGCCGCAAGGCAAAACAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGACACCCCTTCGGGGGAGTCGGCGTTGGGGACCGGCAGCATACCGCCGGCCCCGAAATACAGTGGCGGCCCGTCCGCGGCGACCTCTGCGTAGTACTCCAACGCGCACCGGGAACCCGACGCGGCCACGCCGTAAAACACCCAACTTCTGAACGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCGCGGAGGGATCATTAACGAGTTTTTTCAACTCCCTAACCCTTTGTGAACATACCTATCGTTGCTTCGGCGGACTCGCCCCGGCGTCCGGACGGCCCTGCGCCGCCCGCGACCCGGACCCAGGCGGCCGCCGGAGACCCACAAATTCTGTTTCTATCAGTCTTTCTGAATCCGCCGCAAGGCAAAACAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGACACCCCTTCGGGGGAGTCGGCGTTGGGGACCGGCAGCATACCGCCGGCCCCGAAATACAGTGGCGGCCCGTCCGCGGCGACCTCTGCGTAGTACTCCAACGCGCACCGGGAACCCGACGCGGCCACGCCGTAAAACACCCAACTTCTGAACGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATC
한편, 상기 이사리아 푸모소로세아 Pf212 균주는 하기와 같은 생물학적 특성을 갖는 것으로 확인된다. On the other hand, it was confirmed that the isolia fumosorosa Pf212 strain has the following biological characteristics.
이사리아 푸모소로세아 Pf212 균주의 최소생육온도는 5℃이고, 최대생육온도는 38℃이다. 바람직한 생육 또는 배양온도는 10~30℃, 더 바람직하게는 25~30℃가 적절하다. 균주의 활성을 가장 잘 유지할 수 있는 바람직한 배양시간은 7~20일간, 더 바람직하게는 10~15일간, 가장 바람직하게는 15일간이다. 또한, pH 4~13 범위에서 생육이 가능하고 최적 pH는 5~6이다. 상기 균주는 PDA에 접종하여 10~15일간 배양시, 흰색을 보이다 점차 유백색을 띈다. The minimum growth temperature of the isolia fumosorosa Pf212 strain is 5 ° C, and the maximum growth temperature is 38 ° C. The preferable growth or culture temperature is 10 to 30 캜, more preferably 25 to 30 캜. The preferred incubation time for best maintaining the activity of the strain is 7 to 20 days, more preferably 10 to 15 days, and most preferably 15 days. Also, it is possible to grow in the range of pH 4 ~ 13, and optimum pH is 5 ~ 6. The strain is inoculated into a PDA, and when cultured for 10 to 15 days, it becomes white, gradually becoming milky white.
<실시예 2. 이사리아 푸모소로세아 Pf212 균주의 진딧물 방제효과 확인>Example 2: Identification of aphid control effect of Isaria puromosoa Pf212 strain>
실시예 2-1. PDA 배양 포자의 복숭아혹진딧물과 목화진딧물의 살충율Example 2-1. Insecticidal rate of peach aphid and cotton aphid in PDA cultured spores
실시예 1에서 확인된 이사리아 푸모소로세아 Pf212 균주를 PDA 배지에 접종하고 25℃에서 14일 동안 배양하여 형성된 포자를 멸균된 0.05% Tween 80 용액에 넣어 포자 현탁액을 제조하였다. 상기 포자 현탁액을 헤모사이토메터를 이용하여 포자수를 계수하고 포자농도가 각각 1x106, 1x107, 1x108 conidia/㎖이 되도록 희석하였다. 다음으로는 복숭아혹진딧물(Myzus persicae)과 목화진딧물(Aphis gossypii)의 2~4령 약충을 페트리디쉬(직경 5.5cm)에 담겨있는 직경 5cm의 배추와 오이 잎 조각에 붓을 이용하여 각각 옮긴 후, 상기 포자 현탁액의 희석액 1㎖을 분무기를 이용하여 살포하였다. 이 후, 25℃, 80~90%의 습도를 유지하는 플라스틱 케이지에 상기 약충이 들어있는 페트리디쉬를 유지하면서 각 날짜별로 진딧물 생존 여부를 조사하여 도 1에 나타내었다. 도 1의 샘플 표시에서, 'Pf212(10*8)'은 이사리아 푸모소로세아 Pf212 균주의 포자 현탁액 희석액 1x108 conidia/㎖ 투여군, 'Pf212(10*7)'은 이사리아 푸모소로세아 Pf212 균주의 포자 현탁액 희석액 1x107 conidia/㎖ 투여군, 'Pf212(10*6)'은 이사리아 푸모소로세아 Pf212 균주의 포자 현탁액 희석액 1x106 conidia/㎖ 투여군을 나타내고, D1~D5는 각각 살충률을 확인한 1~5일의 날짜를 나타낸다. 또한 도 1A는 복숭아혹진딧물에 대한 살충율, 도 1B는 목화진딧물에 대한 살충율을 나타낸다. As shown in Example 1, The Pf212 strain was inoculated into the PDA medium and cultured at 25 DEG C for 14 days. The spores thus formed were put into a sterilized 0.05% Tween 80 solution to prepare a spore suspension. The spore suspension was counted using a hemocytometer to dilute the spores to a concentration of 1 × 10 6 , 1 × 10 7 , and 1 × 10 8 conidia / ml, respectively. Next, the 2nd and 4th instar larvae of Myzus persicae and Aphis gossypii were transferred to a 5 cm diameter Chinese cabbage and cucumber leaves in a Petri dish (diameter 5.5 cm) using a brush , And 1 ml of the diluted solution of the spore suspension was sprayed using an atomizer. Thereafter, the viability of the aphid by the respective dates was investigated while keeping the petridish containing the nymph on a plastic cage maintaining the humidity of 80 to 90% at 25 DEG C, and the result is shown in FIG. In the sample display of FIG. 1, 'Pf212 (10 * 8)' represents 1 × 10 8 conidia / ml of spore suspension diluted with Isaiahia fumorosaea Pf212, 'Pf212 (10 * spore suspension diluted Pf212 strain 1x10 7 conidia / ㎖ group, 'Pf212 (10 * 6) ' denotes a spore suspension dilutions 1x10 6 conidia / ㎖ group of Seah Pf212 strain on the board Liao Fu moso, D1 ~ D5 are each insecticidal rate Date of 1 to 5 days. 1A also shows the insecticidal rate against peach aphid, and Fig. 1B shows the insecticidal rate against cotton aphid.
도 1을 참고하면, 본 발명의 이사리아 푸모소로세아 Pf212 균주의 포자 현탁액 희석액을 처리했을 때, 무처리군(control) 대비 복숭아혹진딧물과 목화진딧물의 살충율이 매우 우수한 것으로 확인된다. Referring to FIG. 1, when the spore suspension diluted with the Isaria fumorosaea Pf212 strain of the present invention was treated, it was confirmed that the insecticidal rate of the peach aphid and cotton aphid was significantly superior to that of the control.
실시예 2-2. AD 배양액의 복숭아혹진딧물과 목화진딧물의 살충율Example 2-2. Insecticidal rate of peach aphid and cotton aphid in AD medium
실시예 1에서 확인된 이사리아 푸모소로세아 Pf212 균주를 PDA 배지에 접종하고 25℃에서 14일 동안 배양하여 형성된 포자를 100㎖(1x106 conidia/㎖)의 AD 액체배지에 접종하였다. 이 후, 25℃, 200rpm의 조건으로 배양하면서 배양시작일로부터 3일에 배양액을 수거하여 실험에 사용하였다. 상기 수거된 균주 배양액의 균주 농도가 1x106, 1x107, 1x108 conidia/㎖이 되도록 배양전의 배지로 희석하고, 이 희석액을 각각 1㎖씩 취하여 진딧물 방제능 검정에 사용하였다. 다음으로는 복숭아혹진딧물과 목화진딧물의 2~4령 약충을 페트리디쉬(직경 5.5cm)에 담겨있는 직경 5cm의 배추와 오이 잎 조각에 붓을 이용하여 각각 옮겨 주고, 각 배양액의 희석액 1㎖을 살포하였다. 이 후, 25℃, 80~90%의 습도를 유지하는 플라스틱 케이지에 상기 약충이 들어있는 페트리디쉬를 유지하면서 각 날짜별로 진딧물 생존 여부를 조사하여 도 2에 나타내었다. 도 2의 샘플 표시에서, 'Pf212(10*8)'은 이사리아 푸모소로세아 Pf212 균주의 배양액 희석액 1x108 conidia/㎖ 투여군, 'Pf212(10*7)'은 이사리아 푸모소로세아 Pf212 균주의 배양액 희석액 1x107 conidia/㎖ 투여군, 'Pf212(10*6)'은 이사리아 푸모소로세아 Pf212 균주의 배양액 희석액 1x106 conidia/㎖ 투여군을 나타내고, D1~D5는 각각 살충률을 확인한 1~5일의 날짜를 나타낸다. 또한 도 2A는 복숭아혹진딧물에 대한 살충율, 도 2B는 목화진딧물에 대한 살충율을 나타낸다. As shown in Example 1, Inoculated Pf212 strain on PDA medium were inoculated with spore formed by incubation at 25 ℃ for 14 days in a liquid medium of AD 100㎖ (1x10 6 conidia / ㎖) . Thereafter, the culture solution was collected at 3 days from the start date of the culture while being cultured under conditions of 25 캜 and 200 rpm, and used for the experiment. The collected strains were diluted with the medium before culturing to give a concentration of 1 × 10 6 , 1 × 10 7 , and 1 × 10 8 conidia / ml, and 1 ml of each of these dilutions was used for testing aphid control ability. Next, the 2nd and 4th instar larvae of the peach aphid and cotton aphid were transferred to a 5cm diameter Chinese cabbage and cucumber leaf slices in a Petri dish (5.5 cm in diameter) using a brush and 1 ml of the diluted solution of each culture Lt; / RTI > Thereafter, viability of the aphid by the respective dates was investigated while keeping the petridish containing the above-mentioned nymph on a plastic cage maintaining the humidity of 80 to 90% at 25 캜, and it is shown in Fig. In the sample display of FIG. 2, 'Pf212 (10 * 8)' represents 1 × 10 8 conidia / ml of culture solution diluted with Isaiahia fumorosaea Pf212, 'Pf212 (10 * 7)' represents Isaria fumosorosa Pf212 (1 × 10 7 conidia / ㎖), and 'Pf212 (10 * 6)' represents 1 × 10 6 conidia / ㎖ of culture solution of Isaiahia fumorosaea Pf212 strain. Represents the date of ~ 5 days. Fig. 2A also shows the insecticidal rate against peach aphid, and Fig. 2B shows the insecticidal rate against cotton aphid.
도 2를 참고하면, 본 발명의 이사리아 푸모소로세아 Pf212 균주 배양액을 처리했을 때, 배양액을 처리한 것 모두에서 무처리군(control) 대비 복숭아혹진딧물과 목화진딧물의 살충율이 매우 우수한 것으로 확인된다. Referring to Figure 2, the Isaria fumosorosa When the culture of Pf212 strain was treated, the insecticidal rate of peach aphid and cotton aphid was significantly higher than that of the control.
<실시예 3. 이사리아 푸모소로세아 Pf212 균주의 고추탄저병균 및 잘록병균 방제효과>≪ Example 3: Effect of Pf212 strain of Isaria puromosacea on the control of pepper anthracnose &
본 발명의 이사리아 푸모소로세아 Pf212 균주가 고추 탄저병균(Colletotrichum acutatum) 및 잘록병균(Pythium ultimum)에 대한 방제효과가 있는지를 확인하였다. The Isaria fusomorossea of the present invention Pf212 strains were found to be effective in controlling the pepper anthracnose colitis ( Colletotrichum acutatum ) and Pyrus ultimum .
PDA 배지에서 3일간 배양한 이사리아 푸모소로세아 Pf212 균주 조각과 잘록병균 및 고추 탄저병균 및 잘록병균 조각(직경 0.7cm)을 새로운 PDA 배지에 2cm 간격으로 두고 7일간 배양하여 항균력을 조사하였다. 또, AD 액체배지에서 3일 간 배양한 이사리아 푸모소로세아 Pf212 균주의 배양액 10㎕(1x106 conidia/㎖)를 떨어뜨린 페이퍼 디스크와 PDA에서 3일 배양한 고추 탄저병균 및 잘록병균 조각(직경 0.7cm)을 새로운 PDA 배지에 2cm 간격으로 두고 7일간 배양하여 항균력을 조사하였다. The cells were cultured in PDA medium for 3 days, The antimicrobial activity of Pf212 strains, S. aureus, and P. anthracis and S. aureus (0.7 cm in diameter) were cultured for 7 days at 2 cm intervals in a new PDA medium. In addition, in the case of Isaria fumorosaea cultured in the AD liquid medium for 3 days To the culture liquid of the
상기 실험을 통해 하기 표 1 및 도 3(고추 탄저병균에 대한 항균실험결과-[도 3A], 잘록병균에 대한 항균실험결과-[도 3B])에 개시된 바와 같이 본 발명의 이사리아 푸모소로세아 Pf212 균주가 고추 탄저병균 및 잘록병균에 대한 방제효과가 매우 우수함을 알 수 있다.As described in the following Tables 1 and 3 (results of antibacterial experiments on pepper anthracnose - [Figure 3A] and results of antibacterial tests against gut bacillus - [Figure 3B]), Seah The Pf212 strain showed excellent control effect against anthracnose and anthracnose of pepper.
항균 균주
Antimicrobial strain
본 발명의
이사리아 푸모소로세아 Pf212
The
Isaria Phosphorusae Pf212
4.8 ± 0.5
4.8 ± 0.5
[도 3A]5.4 ± 0.4
[Figure 3A]
(Pythium ultimum)Acerbaceous germ
( Pythium ultimum )
[도 3B]5.5 ± 0.4
[Figure 3B]
<110> REPUBLIC OF KOREA(MANAGEMENT : RURAL DEVELOPMENT ADMINISTRATION) <120> Composition for simultaneous control of both aphid, and Pythium ultimum, or Colletotrichum acutatum using Isaria fumosorosea Pf212 and its culture media <130> P2015-0235 <160> 1 <170> KopatentIn 2.0 <210> 1 <211> 561 <212> DNA <213> Isaria fumosorosea <400> 1 gcggagggat cattaacgag ttttttcaac tccctaaccc tttgtgaaca tacctatcgt 60 tgcttcggcg gactcgcccc ggcgtccgga cggccctgcg ccgcccgcga cccggaccca 120 ggcggccgcc ggagacccac aaattctgtt tctatcagtc tttctgaatc cgccgcaagg 180 caaaacaaat gaatcaaaac tttcaacaac ggatctcttg gttctggcat cgatgaagaa 240 cgcagcgaaa tgcgataagt aatgtgaatt gcagaattca gtgaatcatc gaatctttga 300 acgcacattg cgcccgccag cattctggcg ggcatgcctg ttcgagcgtc atttcaaccc 360 tcgacacccc ttcgggggag tcggcgttgg ggaccggcag cataccgccg gccccgaaat 420 acagtggcgg cccgtccgcg gcgacctctg cgtagtactc caacgcgcac cgggaacccg 480 acgcggccac gccgtaaaac acccaacttc tgaacgttga cctcggatca ggtaggacta 540 cccgctgaac ttaagcatat c 561 <110> REPUBLIC OF KOREA (MANAGEMENT: RURAL DEVELOPMENT ADMINISTRATION) <120> Composition for simultaneous control of both aphid, and Pythium ultimum, or Colletotrichum acutatum using Isaria fumosorosea Pf212 and its culture media <130> P2015-0235 <160> 1 <170> Kopatentin 2.0 <210> 1 <211> 561 <212> DNA <213> Isaria fumosorosea <400> 1 gcggagggat cattaacgag ttttttcaac tccctaaccc tttgtgaaca tacctatcgt 60 tgcttcggcg gactcgcccc ggcgtccgga cggccctgcg ccgcccgcga cccggaccca 120 ggcggccgcc ggagacccac aaattctgtt tctatcagtc tttctgaatc cgccgcaagg 180 caaaacaaat gaatcaaaac tttcaacaac ggatctcttg gttctggcat cgatgaagaa 240 cgcagcgaaa tgcgataagt aatgtgaatt gcagaattca gtgaatcatc gaatctttga 300 acgcacattg cgcccgccag cattctggcg ggcatgcctg ttcgagcgtc atttcaaccc 360 tcgacacccc ttcgggggag tcggcgttgg ggaccggcag cataccgccg gccccgaaat 420 acagtggcgg cccgtccgcg gcgacctctg cgtagtactc caacgcgcac cgggaacccg 480 acgcggccac gccgtaaaac acccaacttc tgaacgttga cctcggatca ggtaggacta 540 cccgctgaac ttaagcatat c 561
Claims (5)
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020150156251A KR101773339B1 (en) | 2015-11-07 | 2015-11-07 | Composition for simultaneous control of both aphid, and Pythium ultimum, or Colletotrichum acutatum using Isaria fumosorosea Pf212 and its culture media |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020150156251A KR101773339B1 (en) | 2015-11-07 | 2015-11-07 | Composition for simultaneous control of both aphid, and Pythium ultimum, or Colletotrichum acutatum using Isaria fumosorosea Pf212 and its culture media |
Publications (2)
Publication Number | Publication Date |
---|---|
KR20170053862A KR20170053862A (en) | 2017-05-17 |
KR101773339B1 true KR101773339B1 (en) | 2017-09-01 |
Family
ID=59048797
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
KR1020150156251A KR101773339B1 (en) | 2015-11-07 | 2015-11-07 | Composition for simultaneous control of both aphid, and Pythium ultimum, or Colletotrichum acutatum using Isaria fumosorosea Pf212 and its culture media |
Country Status (1)
Country | Link |
---|---|
KR (1) | KR101773339B1 (en) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR20200071459A (en) | 2018-12-11 | 2020-06-19 | 대한민국(농촌진흥청장) | Microbial agent for simultaneous control of both Colletotrichum acutatum and Thrips spp. using Isaria javanica FT333 and its culture media |
Families Citing this family (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN108342329A (en) * | 2018-04-18 | 2018-07-31 | 吕梁学院 | Fumosorosea IF-1106 strain liquid fermentation optimization techniques |
KR102145620B1 (en) * | 2018-12-11 | 2020-08-20 | 대한민국 | Microbial agent for control of Plutella xylostella larva using Isaria fumosorosea FT337 and its culture media |
-
2015
- 2015-11-07 KR KR1020150156251A patent/KR101773339B1/en active IP Right Grant
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR20200071459A (en) | 2018-12-11 | 2020-06-19 | 대한민국(농촌진흥청장) | Microbial agent for simultaneous control of both Colletotrichum acutatum and Thrips spp. using Isaria javanica FT333 and its culture media |
KR102126582B1 (en) | 2018-12-11 | 2020-06-25 | 대한민국 | Microbial agent for simultaneous control of both Colletotrichum acutatum and Thrips spp. using Isaria javanica FT333 and its culture media |
Also Published As
Publication number | Publication date |
---|---|
KR20170053862A (en) | 2017-05-17 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
KR101785098B1 (en) | Composition for simultaneous control of both aphid and Pythium ultimum using Isaria javanica Pf185 and its culture media | |
KR101974265B1 (en) | Microbial pesticides against thrips | |
KR20160140560A (en) | Entomopathogenic fungi Metarhizium anisopliae SD4-2 and Beauveria bassiana SD15 having antimicrobial activities and insectcide | |
Tang et al. | Evaluation of Metarhizium anisopliae for rice planthopper control and its synergy with selected insecticides | |
Gustianingtyas et al. | Toxicity of entomopathogenic fungal culture filtrate of lowland and highland soil of South Sumatra (Indonesia) against Spodoptera litura larvae | |
EP1774854A1 (en) | Microbial pesticide inhibiting the outbreak of plant disease damage | |
KR101680638B1 (en) | New microorganism Beauveria bassiana FG274 and Microbial control agent for the prevention of Spodoptera exigua larva | |
JP2014508803A (en) | Insecticides and their use | |
KR101773339B1 (en) | Composition for simultaneous control of both aphid, and Pythium ultimum, or Colletotrichum acutatum using Isaria fumosorosea Pf212 and its culture media | |
KR102162105B1 (en) | Composition for controlling bemisia tabaci using Beauveria bassiana JEF-462 or Beauveria bassiana JEF-507, and method for preventing bemisia tabaci using the same | |
KR100914451B1 (en) | Entomopathogenic Lecanicillium attenuatum CNU-23, and agents and methods for controling green peach aphid using the same | |
JP7425884B2 (en) | Bacillus subtilis JCK-1398 strain that induces resistance in various plants, composition and method for controlling pine wood nematode disease using the same | |
KR102126582B1 (en) | Microbial agent for simultaneous control of both Colletotrichum acutatum and Thrips spp. using Isaria javanica FT333 and its culture media | |
KR101444214B1 (en) | COMPOSITION FOR CONTROL OF INSECT USING Beauveria bassiana Bb08 AND ITS CULTURE EXTRACTS | |
Maniania | Evaluation of three formulations of Beauveria bassiana (Bals.) Vuill. for control of the stem borer Chilo partellus (Swinhoe)(Lep., Pyralidae) | |
KR101896932B1 (en) | New microorganism Beauveria bassiana FG317 or microbial control agent comprising for the prevention of Spodoptera litura larva | |
Sivasundaram et al. | Effect of talc-formulated entomopathogenic fungus Beauveria against leaffolder (Cnaphalocrosis medinalis) in rice | |
KR102162104B1 (en) | Composition for controlling thrips using Beauveria bassiana JEF-350 and method for preventing thrips using the same | |
KR20000038895A (en) | Antagonistic microorganism strain for preventing blight of crops, microorganism preparation comprising the same and the use thereof | |
JP2003531603A (en) | Microbial preparation for biological control using novel Trichoderma microorganism strain and method for producing the same | |
KR102207732B1 (en) | Microbial agent for control of Plutella xylostella larva using Metarhizium anisopliae FT319 and its culture media | |
KR101680639B1 (en) | New microorganism Isaria fumosorosea FG340 and Microbial control agent for the prevention of Spodoptera exigua larva | |
KR100791983B1 (en) | Microorganism of arthrobotrys sp. and microbial agent for preventing plant-parasitic nematodes comprising the same | |
KR101785099B1 (en) | Composition for simultaneous control of both aphid and Sclerotinia sclerotiorum using Beauveria bassiana Bb18 and its culture media | |
RU2692655C2 (en) | Bacillus thuringiensis var. darmstadiensis 56 strain as polyfunctional agent for plant growing |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
A201 | Request for examination | ||
E701 | Decision to grant or registration of patent right | ||
GRNT | Written decision to grant |