KR101773339B1 - Composition for simultaneous control of both aphid, and Pythium ultimum, or Colletotrichum acutatum using Isaria fumosorosea Pf212 and its culture media - Google Patents

Abstract

The present invention relates to a microorganism preparation for simultaneous control of Isaria fumosorosea Pf212 strain ( Isaria fumosorosea Pf212, KACC93240P) or aphids, Staphylococcus aureus and anthrax anthracis bacteria, and a method for producing the same, The microbial agent prepared by using the strain is excellent in its use as a pesticide for controlling aphids, athlete's foot and anthrax anthracnose, because it is an indigenous microorganism and quickly adapts to the domestic environment and exhibits an insecticidal or microbial effect. Since the strain or the microorganism preparation can be used as an environmentally friendly and stable control means, it is useful for increasing the economic value of the planthouse cultivation crops, activating the production of the safe agricultural products and the microbial agent development industry.

Description

TECHNICAL FIELD [0001] The present invention relates to a composition for simultaneous control of aphid, aphid, and anthrax of anthracnose, Pf212, or Isletia fumosorosea Pf212,

The present invention relates to a microorganism preparation for simultaneous control of Isaria fumosorosea Pf212 strain ( Isaria fumosorosea Pf212, KACC93240P) or aphids, Staphylococcus aureus and anthrax anthracis bacteria using the same, and a method for producing the same.

Aphids are known as insect pests that are very difficult to control due to their high fertility and rapid genetic resistance. Aphids are one of the most damaging crops because they directly feed crops or through which they directly cause damage to the crops as a viral agent and cause secondary soot diseases. In domestic and overseas markets, aphids Many studies and efforts have been made for

Damage caused by aphids accounted for 53.8% (148,279 hectares) of domestic vegetable cultivation area, and 27% of the insecticides sprayed by vegetable growers were sprayed for the control of aphids. Especially, Sales of chemical pesticides are estimated at W230bn, and most of the raw materials are imported, and huge amounts of foreign currency are being spent.

Among the targeted aphids for biological control, peach aphid ( Myzus persicae ) is hosted by peach tree, apricot tree, plum tree, cherry tree, tangerine tree and after mid-May, it is used for summer jujube, cucumber, Which causes growth inhibition damage. The rapid population of 1 year is fertile enough to carry 23 generations, the late population 9 generations, and the life span is about 28.5 days. Cotton aphids ( Aphis gossypii ) have similar lifespan and fertility. In the summer, it is parasitic on perilla, cucumber, pumpkin, watermelon, eggplant, tomatoes, etc. It lays eggs on the cow tree, pomegranate tree, bamboo tree, cotton in late autumn for wintering. On the other hand, researches on microbial pesticides using fungi that invade aphids by contact are active in the control of such jujube aphids. However, existing microbial control agents take long time to contact, germinate, and invade into insecticides, and until the insecticidal effect is exhibited, the effect of control due to environmental influences such as temperature and humidity is uneven, It is hardly known that the use of insect pathogenic fungi has succeeded in the market until now.

It is one of the plant diseases that occurs in the seedling immediately after germination of the crop, and the surface of the seedlings is softened by the needle-like shape, or brown lesion occurs on the surface of the seedlings. It is one kind of wearing disease, but it occurs only in the seedling period, and it is also called myeongryik disease, mossy mildew disease. It occurs in many crops and is caused by Pythium ultimum .

Pepper anthracnose occurs mainly in fruits. In the fruit, the infected area appears as a circular spot with a slight indentation on the surface of the inflorescence, and when it develops, the lesion enlarges to circular or irregular pattern. On the lesion, pale yellow to yellowish spore mass is formed, and the severely diseased fruit is twisted and dried up like a mummy. Some of the diseased lesions of maturity are sometimes black, with symptoms of disease occurring during the drying process after harvest. The red pepper anthracnose is caused by Colletotrichum acutatum and the like, and this strain grows in the seed or the diseased part in the form of the phloem and mycelium, and becomes the first order source. The first half of the disease is mainly caused by conidial spores. In the case of paddy rice wrapping, seasonal rainfalls are mainly caused by wind and rain during summer rainy season. In the green pepper cultivated in Noji, disease starts to occur from the beginning of July and continues until the harvest time.

Domestic anthracnose and red pepper anthracnose are difficult to control but not very effective. It is also expensive to control and may cause resistance to drugs when used repeatedly. Since the vegetables that are caused by melancholy and pepper anthracnose are mainly taken directly from raw materials, the problem of safety of pesticides from consumers is continuously increasing, and the use of chemical pesticides is also being avoided from consumers. In addition, chemical pesticide-based control methods have a fatal disadvantage that they may become resistant to chemicals over time, and environmental hazards due to chemical residues have been raised.

Accordingly, the present inventors have made intensive efforts to develop a microbial pesticide containing an insect pest pathogenic fungus strain which can be adapted well to the domestic environment and exhibit rapid insecticidal or microbial effect. As a result, it has been found that aphids, ( Isaria fumosorosea Pf212), which is a novel strain having excellent antifouling activity, was isolated and the present invention was completed.

On the other hand, as prior art to the present invention, there has been reported a Isaria US Patent No. 8574566, which is an invention on fumosorosea CCM 8367-CCEFO.011.PFR), Korean Patent No. 10-1330078, which discloses a Escherichia coli strain (Isaria Laja Nica Pf04, KACC93122P) , Shapiro-Ilan et al., In which Isaria fumorosaea strain, in which the anti-aphid effect was initiated, was disclosed . (J Invertebr Pathol. 2008, 99 (3): 312-317).

US Patent No. 8574566 entitled Strain of entomopathogenic fungus Isaria fumosorosea CCM 8367 (CCEFO.011.PFR) and the method for controlling insect and mite pests, Applicant: Biology Center As Cr, VVI et al., Registered on: 2013.11. 05) A novel insect pathogenic fungus Isaiabanica Pf04 having tobacco control effect on Louis Q type and microbial insecticide for the control of Louis Q type including tobacco containing it, Applicant: Korea, Registration date : 2013.11.11.)

Shapiro-Ilan DI, Cottrell TE, Jackson MA, Wood BW. Virulence of Hypocreales fungi to pecan aphids (Hemiptera: Aphididae) in the laboratory. J Invertebr Pathol. 2008, 99 (3): 312-317.

It is an object of the present invention to provide a microorganism preparation for simultaneous control of Isaria fumosorosea Pf212 strain ( Isaria fumosorosea Pf212, KACC93240P) or aphids, Streptococcus pneumoniae, and Anthrax anthracis bacteria, and a method for producing the same.

The present invention relates to a Isaria fumosorosea Pf212 strain (KACC93240P) which is capable of controlling aphids, Pythium ultimum or Colletotrichum acutatum .

The isolia fumosorosa Pf212 strain is characterized by having the ability to simultaneously control aphids, Streptococcus pyogenes and anthracnose anthracnose.

The present invention also provides a microorganism preparation for controlling aphid, Staphylococcus aureus or anthrax anthracnose fungi containing the microorganism strains of Isaria fuomorosaea Pf212 or a culture thereof as an active ingredient.

Accordingly, the present invention provides a method for cultivating the Isaria fumorosaea Pf212 strain and a microorganism preparation containing the microbial culture of the Isaria plumosaea Pf212 strain and a plant to treat aphid, Thereby providing a method for controlling bacteria.

Hereinafter, the present invention will be described in detail.

The present invention relates to Isaria fumosorosea Pf212 (KACC93240P), which is capable of controlling aphid, Pythium ultimum or Colletotrichum acutatum , and is characterized in that the strain or its culture , And the microorganism preparation containing them can be used as a controlling agent for aphids, aspergillus or pepper anthracnose.

The culture solution may preferably be a culture solution obtained by inoculating a microorganism culture with Isaria fumorosaea Pf212 strain. Examples of the microorganism medium include PDA (potato dextrose agar), PDA (potato dextrose broth), SDA (sabouraud dextrose agar), SDAY (sabouraud dextrose agar with yeast extract), AD (Modified adamek's media) liquid medium, AD solid medium and the like can be used. Preferably, AD fluid medium or PDA can be used.

The PDA may be prepared by mixing 4 g / l potato starch, 20 g / l dextrose and 15 g / l agar, but is not limited thereto. PDB is a liquid medium prepared without mixing agar in PDA. AD liquid medium can be prepared by modifying the basic composition of Adameks media and mixing 20g / l glucose, 20g / l yeast extract and 30g / l corn steep liquor. AD solid medium can be prepared by mixing 15 g / l agar in the AD liquid medium. SDA can be prepared by mixing 40 g / lextrose, 10 g / l mycological peptone and 15 g / l agar. SDAY can be prepared by mixing SDA with 10 g / L yeast extract.

When the above culture medium is used as a microorganism preparation, it may be used in the form of a culture filtrate obtained by removing microbial cells after cultivation of Isaria fumorosaea Pf212 strain, or cells of Isaria fumorosaea Pf212.

The method for culturing the isolia fumosorosa Pf212 strain comprises the steps of: (a) inoculating a microorganism medium with a spore of Isaria fumosorosa Pf212; And (b) culturing the inoculum at 25 to 30 DEG C for 7 to 20 days. Preferably, the microorganism medium of step (a) may be an AD medium or a PDA. When inoculated Seah Pf212 strain on the board Liao Fu moso in step (a) above, the initial inoculation concentration are preferably may be ^{5 ~ 5x10 6 conidia / ㎖ 5x10} , may be more preferably 1x10 ⁶ conidia / ㎖ . The step (b) may further include removing the cells from the culture solution. Therefore, the microorganism preparation of the present invention containing the culture medium of Isaria fumorosae Pf212 can be produced through the above culture method.

The aphid which can be controlled by the strain of the present invention, the culture solution thereof, and the microorganism preparation containing the same can include peach aphid, aphid, cotton aphid, mandarin aphid, Aphid or peach aphid, but the aphid is not limited thereto.

The term " culture broth " in the present invention refers to a culture broth obtained by inoculating a spore of a certain concentration into a medium suitable for microorganism growth, inducing the microorganism to grow for a predetermined period of time in an incubator, It is a liquid mixed with necessary nutrients and can be produced by further filtering the impurities using a filtration process. In addition, the 'culture filtrate' may be one which contains the nutrients necessary for growth and the secreted substances by removing the cells through centrifugation or filtration in the culture broth. A paper filter is preferably used for the filtration process, and a Whatman No. 2 filter paper may be used as the paper filter, but the present invention is not limited thereto.

The term " control " of the present invention generally includes preventing, reducing or eradicating plant pathogenic infections, wherein the prevention or reduction in infection means that there is a statistically significant difference for untreated host plants.

The microorganism preparation for controlling aphids, allium germs or red pepper anthracnose of the present invention can be used for controlling the composition of the composition according to the physiological condition of the plant, the kind of the insect, the degree and the concentration of the pathogen infection, the season, the humidity, Can be considered in determining the amount and method of application.

The Isaria plumosaea Pf212 contained in the microorganism preparation for controlling aphids, allium germs or pepper anthracis of the present invention should be in a viable state and may be cells in the form of mycelial and spores.

As used herein, the term " insect pathogenic " means that the fungus, that is, the spore of the fungus, adheres to the outer surface of the host insect and germinates, the chitinase, the protease protease, lipase, esterase and the like, penetrating the cuticle layer of the insect, penetrating into the insect, and then producing a toxic substance by propagating in the body of the insect, thereby killing the host insect. Can be used in combination with the " insecticidal effect ".

The microorganism preparation prepared by culturing the Isaria fumorosaea Pf212 strain of the present invention can be produced using a solid or liquid culture technique. The culture temperature of the Isaria fumosorosa Pf212 strain is 10 to 30 ° C, And preferably 25 to 30 ° C. More preferably 7 to 20 days, more preferably 10 to 15 days, and most preferably 15 days to obtain a culture medium or culture.

The microbial formulations of the present invention may comprise an agriculturally acceptable carrier and may be formulated as fillers, solvents, excipients, surfactants, suspending agents, spreaders, adhesives, ), Defoamers, dispersants, wetting agents, drift reducitng agents, suxiliaries, adjuvants or mixtures thereof.

The microbial formulation of the present invention can be formulated into concentrate, solution, spray, aerosol, immersion baths, dips, emulsions, suspension concentrates, gels, granules and the like.

The microbial formulation of the present invention can be used as a microbial agent for the treatment or prevention of diseases caused by the above-mentioned microbial agent or other agricultural agent, pesticides, insecticides, acaracides, fungicides (fungicides harmless to the fungi of the present invention) Antimicrobials, nematocides, rodenticides, entomopathogens, pheromones, attractants, plant growth regulators, plant hormones, plant growth regulators, In combination with insect growth regulators, chemosterilants, microbial pest control agents, repellents, viruses, phagostimulents, plant nutrients, plant fertilizers, and biological control agents And specific examples thereof are obvious to those of ordinary skill in the art and can be easily obtained.

The present invention relates to a microorganism preparation for simultaneous control of Isaria fumosorosea Pf212 strain ( Isaria fumosorosea Pf212, KACC93240P) or aphids, Staphylococcus aureus or anthrax anthracis bacteria and a method for producing the same, and the strain according to the present invention As an indigenous microorganism, adaptation to the domestic environment is rapid and exhibits rapid insecticidal or fungicidal effect. Therefore, the microorganism preparation prepared using the strain can be used as a biological pesticide excellent in the control effect of aphids, stigma germs or anthrax anthracnose. In addition, since the strain or the microorganism preparation can be used as an environmentally friendly and stable control means, it is useful for enhancing the economic value of a planthouse cultivated crop, increasing the production of safe agricultural products, and activating the development industry of a microbial agent. In the prior art U.S. Patent No. 8574566, Isaria strains ( Isaria fumosorosea CCM 8367-CCEFO.011.PFR) has an insecticidal effect against mites. However, the above strain is a strain completely different in gene sequence of 16S rRNA from the strain of the present invention, and the strain of the above- As described in the present invention, the effect of controlling aphids, Alzheimer's disease, and red pepper anthracnose is not disclosed in the detailed description of USP 8574566. [ Korean Patent No. 10-1330078 discloses a genus Escherichia (Isaria javanica Pf04, KACC93122P) in which tobacco has a controlling effect on the Louis Q type. However, the strain is a strain of the present invention, a strain of the present invention and a gene of 16S rRNA It is not disclosed in the detailed description of Korean Patent No. 10-1330078 that the above-mentioned Isaria genus strain has an effect of controlling aphid, Staphylococcus aureus or anthrax anthracnose. Prior art Shapiro-Ilan et al. (J Invertebr Pathol. 2008, 99 (3): 312-317) is also a completely different strain from the strain of the present invention.

BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 is a graph showing the aphid kill rate of Isaria fumosorosea Pf212 (KACC93240P) spore suspension dilution of Isaria fumosorosea Pf212 of the present invention. In the sample display of FIG. 1, 'Pf212 (10 * 8)' represents 1 × 10 ⁸ conidia / ml of spore suspension diluted with Isaiahia fumorosaea Pf212, 'Pf212 (10 * spore suspension diluted Pf212 strain 1x10 ⁷ conidia / ㎖ group, 'Pf212 (10 * 6) ' denotes a spore suspension dilutions 1x10 ⁶ conidia / ㎖ group of Seah Pf212 strain on the board Liao Fu moso, D1 ~ D5 are each insecticidal rate Date of 1 to 5 days. 1A also shows the insecticidal rate against peach aphid, and Fig. 1B shows the insecticidal rate against cotton aphid.
FIG. 2 is a graph showing the aphid kill rate of Isaria fumosorosea Pf212 (KACC93240P) liquid culture medium of Isaria fumosorosa Pf212 of the present invention. In the sample display of FIG. 2, 'Pf212 (10 * 8)' represents 1 × 10 ⁸ conidia / ml of culture solution diluted with Isaiahia fumorosaea Pf212, 'Pf212 (10 * 7)' represents Isaria fumosorosa Pf212 (1 × 10 ⁷ conidia / ㎖), and 'Pf212 (10 * 6)' represents 1 × 10 ⁶ conidia / ㎖ of culture solution of Isaiahia fumorosaea Pf212 strain. Represents the date of ~ 5 days. Fig. 2A also shows the insecticidal rate against peach aphid, and Fig. 2B shows the insecticidal rate against cotton aphid.
FIG. 3 is a photograph showing the antimicrobial effect of Isaria fumosorosea Pf212 (KACC93240P) against Colletotrichum acutatum and Pythium ultimum of Isaria fumosorosea Pf212 of the present invention The culture medium of the AD liquid medium of the strain Liafosomosoa Pf212 was confirmed by culturing in a PDA medium containing pepper anthracnose (Fig. 3A) and erythroblast (Fig. 3B).

The present invention will be described more specifically with reference to the following examples. However, the following examples are provided to aid understanding of the present invention, and the scope of the present invention is not limited by these examples in any sense. Hereinafter, the technical and scientific terms used herein will be understood by those skilled in the art without departing from the scope of the present invention. Descriptions of known functions and configurations that may be unnecessarily blurred are omitted.

≪ Example 1 > From the soil Isaia fuomos rosaa Isolation and Identification of Pf212 Strain>

Example 1-1. Isolation of strain from soil

Galleria mellonella larvae were placed in the soil collected from the hills around the farmland and allowed to remain in the soil for 14 days to infect the fungi present in the soil. The infected larvae were selected, and an artificial medium, PDA (Potato Dextrose Agar) were used to isolate pure strains. The strains of pure isolates were preserved using the freeze-drying method, and strains having a large antimicrobial activity among the strains were selected (assayed by the methods of Examples 2 and 3) Type.

Examples 1-2. Identification of strains isolated from soil

The morphological characteristics of the strains having the greatest antimicrobial activity among the pure fungi isolated from soil in accordance with the method of Example 1-1 were observed by a microscope and ITS analysis was carried out by extracting the DNA of the strains (Note: Xenocell). As a result, it was finally confirmed that the strain had 100% of the genetic information with Isaria fumosorosea and had the DNA sequence of the 16S rRNA gene of SEQ ID NO: 1 below. Thus, Isaria fumosorosea Pf212 , KACC93240P).

DNA sequence of 16S rRNA gene - SEQ ID NO: 1:

GCGGAGGGATCATTAACGAGTTTTTTCAACTCCCTAACCCTTTGTGAACATACCTATCGTTGCTTCGGCGGACTCGCCCCGGCGTCCGGACGGCCCTGCGCCGCCCGCGACCCGGACCCAGGCGGCCGCCGGAGACCCACAAATTCTGTTTCTATCAGTCTTTCTGAATCCGCCGCAAGGCAAAACAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGACACCCCTTCGGGGGAGTCGGCGTTGGGGACCGGCAGCATACCGCCGGCCCCGAAATACAGTGGCGGCCCGTCCGCGGCGACCTCTGCGTAGTACTCCAACGCGCACCGGGAACCCGACGCGGCCACGCCGTAAAACACCCAACTTCTGAACGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATC

On the other hand, it was confirmed that the isolia fumosorosa Pf212 strain has the following biological characteristics.

The minimum growth temperature of the isolia fumosorosa Pf212 strain is 5 ° C, and the maximum growth temperature is 38 ° C. The preferable growth or culture temperature is 10 to 30 캜, more preferably 25 to 30 캜. The preferred incubation time for best maintaining the activity of the strain is 7 to 20 days, more preferably 10 to 15 days, and most preferably 15 days. Also, it is possible to grow in the range of pH 4 ~ 13, and optimum pH is 5 ~ 6. The strain is inoculated into a PDA, and when cultured for 10 to 15 days, it becomes white, gradually becoming milky white.

Example 2: Identification of aphid control effect of Isaria puromosoa Pf212 strain>

Example 2-1. Insecticidal rate of peach aphid and cotton aphid in PDA cultured spores

As shown in Example 1, The Pf212 strain was inoculated into the PDA medium and cultured at 25 DEG C for 14 days. The spores thus formed were put into a sterilized 0.05% Tween 80 solution to prepare a spore suspension. The spore suspension was counted using a hemocytometer to dilute the spores to a concentration of 1 × 10 ⁶ , 1 × 10 ⁷ , and 1 × ^{10 8} conidia / ml, respectively. Next, the 2nd and 4th instar larvae of Myzus persicae and Aphis gossypii were transferred to a 5 cm diameter Chinese cabbage and cucumber leaves in a Petri dish (diameter 5.5 cm) using a brush , And 1 ml of the diluted solution of the spore suspension was sprayed using an atomizer. Thereafter, the viability of the aphid by the respective dates was investigated while keeping the petridish containing the nymph on a plastic cage maintaining the humidity of 80 to 90% at 25 DEG C, and the result is shown in FIG. In the sample display of FIG. 1, 'Pf212 (10 * 8)' represents 1 × 10 ⁸ conidia / ml of spore suspension diluted with Isaiahia fumorosaea Pf212, 'Pf212 (10 * spore suspension diluted Pf212 strain 1x10 ⁷ conidia / ㎖ group, 'Pf212 (10 * 6) ' denotes a spore suspension dilutions 1x10 ⁶ conidia / ㎖ group of Seah Pf212 strain on the board Liao Fu moso, D1 ~ D5 are each insecticidal rate Date of 1 to 5 days. 1A also shows the insecticidal rate against peach aphid, and Fig. 1B shows the insecticidal rate against cotton aphid.

Referring to FIG. 1, when the spore suspension diluted with the Isaria fumorosaea Pf212 strain of the present invention was treated, it was confirmed that the insecticidal rate of the peach aphid and cotton aphid was significantly superior to that of the control.

Example 2-2. Insecticidal rate of peach aphid and cotton aphid in AD medium

As shown in Example 1, Inoculated Pf212 strain on PDA medium were inoculated with spore formed by incubation at 25 ℃ for 14 days in a liquid medium of AD ^{100㎖ (1x10 6 conidia / ㎖)} . Thereafter, the culture solution was collected at 3 days from the start date of the culture while being cultured under conditions of 25 캜 and 200 rpm, and used for the experiment. The collected strains were diluted with the medium before culturing to give a concentration of 1 × 10 ⁶ , 1 × 10 ⁷ , and 1 × ^{10 8} conidia / ml, and 1 ml of each of these dilutions was used for testing aphid control ability. Next, the 2nd and 4th instar larvae of the peach aphid and cotton aphid were transferred to a 5cm diameter Chinese cabbage and cucumber leaf slices in a Petri dish (5.5 cm in diameter) using a brush and 1 ml of the diluted solution of each culture Lt; / RTI > Thereafter, viability of the aphid by the respective dates was investigated while keeping the petridish containing the above-mentioned nymph on a plastic cage maintaining the humidity of 80 to 90% at 25 캜, and it is shown in Fig. In the sample display of FIG. 2, 'Pf212 (10 * 8)' represents 1 × 10 ⁸ conidia / ml of culture solution diluted with Isaiahia fumorosaea Pf212, 'Pf212 (10 * 7)' represents Isaria fumosorosa Pf212 (1 × 10 ⁷ conidia / ㎖), and 'Pf212 (10 * 6)' represents 1 × 10 ⁶ conidia / ㎖ of culture solution of Isaiahia fumorosaea Pf212 strain. Represents the date of ~ 5 days. Fig. 2A also shows the insecticidal rate against peach aphid, and Fig. 2B shows the insecticidal rate against cotton aphid.

Referring to Figure 2, the Isaria fumosorosa When the culture of Pf212 strain was treated, the insecticidal rate of peach aphid and cotton aphid was significantly higher than that of the control.

≪ Example 3: Effect of Pf212 strain of Isaria puromosacea on the control of pepper anthracnose &

The Isaria fusomorossea of the present invention Pf212 strains were found to be effective in controlling the pepper anthracnose colitis ( Colletotrichum acutatum ) and Pyrus ultimum .

The cells were cultured in PDA medium for 3 days, The antimicrobial activity of Pf212 strains, S. aureus, and P. anthracis and S. aureus (0.7 cm in diameter) were cultured for 7 days at 2 cm intervals in a new PDA medium. In addition, in the case of Isaria fumorosaea cultured in the AD liquid medium for 3 days To the culture liquid of the strain Pf212 10㎕ (1x10 ⁶ conidia / ㎖) knocking down the paper disks and 3 days incubation red pepper anthracnose fungus and germs constricted piece (diameter 0.7cm) at a PDA with a 2cm distance to a new PDA medium incubated 7 days The antibacterial activity was examined.

As described in the following Tables 1 and 3 (results of antibacterial experiments on pepper anthracnose - [Figure 3A] and results of antibacterial tests against gut bacillus - [Figure 3B]), Seah The Pf212 strain showed excellent control effect against anthracnose and anthracnose of pepper.

Antimicrobial strain Test strains Zone of inhibition (mm) Cultured in a PDA medium, and the antimicrobial activity was confirmed in the PDA medium It was cultured in AD liquid medium and the antimicrobial activity was confirmed in the PDA medium
The
Isaria Phosphorusae Pf212 Red pepper anthracis ( Colletotrichum acutatum )
4.8 ± 0.5 5.4 ± 0.4
[Figure 3A] Acerbaceous germ
( Pythium ultimum ) 4.8 ± 0.5 5.5 ± 0.4
[Figure 3B]

National Institute of Agricultural Science KACC93240P 20151102

<110> REPUBLIC OF KOREA (MANAGEMENT: RURAL DEVELOPMENT ADMINISTRATION) <120> Composition for simultaneous control of both aphid, and Pythium          ultimum, or Colletotrichum acutatum using Isaria fumosorosea          Pf212 and its culture media <130> P2015-0235 <160> 1 <170> Kopatentin 2.0 <210> 1 <211> 561 <212> DNA <213> Isaria fumosorosea <400> 1 gcggagggat cattaacgag ttttttcaac tccctaaccc tttgtgaaca tacctatcgt 60 tgcttcggcg gactcgcccc ggcgtccgga cggccctgcg ccgcccgcga cccggaccca 120 ggcggccgcc ggagacccac aaattctgtt tctatcagtc tttctgaatc cgccgcaagg 180 caaaacaaat gaatcaaaac tttcaacaac ggatctcttg gttctggcat cgatgaagaa 240 cgcagcgaaa tgcgataagt aatgtgaatt gcagaattca gtgaatcatc gaatctttga 300 acgcacattg cgcccgccag cattctggcg ggcatgcctg ttcgagcgtc atttcaaccc 360 tcgacacccc ttcgggggag tcggcgttgg ggaccggcag cataccgccg gccccgaaat 420 acagtggcgg cccgtccgcg gcgacctctg cgtagtactc caacgcgcac cgggaacccg 480 acgcggccac gccgtaaaac acccaacttc tgaacgttga cctcggatca ggtaggacta 540 cccgctgaac ttaagcatat c 561

Claims (5)

Isaria fumosorosea Pf212, KACC93240P, which has the ability to simultaneously control aphids, Pythium ultimum and Colletotrichum acutatum . delete Aphid, Pythium ultimum , and Colletotrichum anthracis, which are characterized by containing the cells of Isaria fumosorosea Pf212, KACC93240P or the culture thereof as an active ingredient of claim 1, microbial agent for the simultaneous control of acutatum). A method for culturing Isaria fumosorosea Pf212, KACC93240P) of claim 1. A method for treating aphid, Pythium ultimum and Colletotrichum acutatum simultaneously by treating the microorganism preparation of claim 3 with a plant.

Images