KR101444214B1 - COMPOSITION FOR CONTROL OF INSECT USING Beauveria bassiana Bb08 AND ITS CULTURE EXTRACTS - Google Patents
COMPOSITION FOR CONTROL OF INSECT USING Beauveria bassiana Bb08 AND ITS CULTURE EXTRACTS Download PDFInfo
- Publication number
- KR101444214B1 KR101444214B1 KR1020120140146A KR20120140146A KR101444214B1 KR 101444214 B1 KR101444214 B1 KR 101444214B1 KR 1020120140146 A KR1020120140146 A KR 1020120140146A KR 20120140146 A KR20120140146 A KR 20120140146A KR 101444214 B1 KR101444214 B1 KR 101444214B1
- Authority
- KR
- South Korea
- Prior art keywords
- beauveria bassiana
- kacc93163p
- days
- aphids
- composition
- Prior art date
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/14—Fungi; Culture media therefor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/14—Fungi; Culture media therefor
- C12N1/145—Fungal isolates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
- C12R2001/00—Microorganisms ; Processes using microorganisms
- C12R2001/645—Fungi ; Processes using fungi
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Health & Medical Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Genetics & Genomics (AREA)
- Biotechnology (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Microbiology (AREA)
- Biomedical Technology (AREA)
- Botany (AREA)
- Mycology (AREA)
- Virology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Agricultural Chemicals And Associated Chemicals (AREA)
Abstract
본 발명은 Beauveria bassiana Bb08(KACC93163P)의 배양액 또는 배양여액을 유효성분으로 하는 진딧물 방제용 조성물, 및 (a) PDB(Potato Dextrose Broth)에 Beauveria bassiana Bb08(KACC93163P)의 포자가 1x106 conidia/ml가 되도록 접종하는 단계; (b) 상기 접종액을 25℃에서 3일 내지 5일간 배양하는 단계; 및 (c) 종이필터를 사용하여 (b) 단계로 얻어진 배양물의 불순물을 제거하는 단계를 포함하는 진딧물 방제용 조성물에 관한 것이다.
본 발명에 따른 Beauveria bassiana Bb08(KACC93163P), 상기 진균을 이용한 진딧물 방제용 조성물 및 이의 제조방법은 토착 미생물로서 국내 환경에 적응이 빠르고, 살충효과를 나타내는데 신속하기 때문에, 진딧물 방제용 생물농약으로서의 용도가 우수하며, 이는 환경 친화적이고 안정적인 방제수단으로서, 시설하우스 재배 작물의 경제적 가치를 증대시키고, 안전 농산물 생산증대 및 미생물 살충제 개발 산업의 활성화에 유용하다.The invention Beauveria bassiana Bb08 (KACC93163P) or a culturing filtrate as an active ingredient, and (a) a composition for controlling aphid of Beauveria bassiana (PDB) (Potato Dextrose Broth) Inoculating the spores of Bb08 (KACC93163P) to 1x10 < 6 > conidia / ml; (b) culturing the inoculum at 25 DEG C for 3 to 5 days; And (c) removing the impurities of the culture obtained in step (b) using a paper filter.
The Beauveria bassiana Bb08 (KACC93163P), a composition for controlling aphids using the fungus, and a method for producing the same, are indigenous microorganisms that are adaptable to domestic environments quickly and rapidly exhibit an insecticidal effect. Therefore, they are excellent in use as a pesticide for controlling aphids, As a stable control means, it is useful to increase the economic value of cultivated plant-grown crops, to increase the production of safe agricultural products, and to activate the industry of microbial pesticide development.
Description
본 발명은 Beauveria bassiana Bb08(KACC93163P) 및 그 배양액을 이용한 진딧물 방제용 조성물, 및 이의 제조방법에 관한 것이다.The invention Beauveria bassiana Bb08 (KACC93163P), a composition for controlling aphids using the culture, and a method for producing the same.
진딧물은 번식력이 매우 높고 빠른 유전적 약제 내성 발현에 의하여 방제하기 어려운 해충으로 알려져 있으며, 특히 작물의 직접 흡즙과 바이러스 매개에 의한 직접적인 피해와 2차적으로 그을음병을 유발하여 농작물에 가장 큰 피해를 주는 해충의 하나로 국내외에서 진딧물 방제를 위한 많은 연구와 노력이 이루어지고 있다. Aphids are known as insect pests that are difficult to control due to their high fertility and rapid genetic resistance. Especially, they cause direct damages of crops, direct damages by virus-mediated damages and secondary soot diseases, As a pest, many researches and efforts are being made to control aphids at home and abroad.
진딧물에 의한 피해면적은 국내 채소재배 면적의 53.8% (148,279 ha)에 이르고, 채소 재배 농가에서 살포하는 살충제의 27%가 진딧물 방제를 위해 살포되고 있는 실정으로, 특히 국내에서 진딧물 방제를 위해 이용되는 화학농약의 판매액은 2,300억원으로 추정되고 있으며, 원료의 대부분이 수입되어 막대한 외화가 지출되고 있다.Damage caused by aphids accounted for 53.8% (148,279 hectares) of domestic vegetable cultivation area, and 27% of the insecticides sprayed by vegetable growers were sprayed for the control of aphids. Especially, Sales of chemical pesticides are estimated at W230bn, and most of the raw materials are imported, and huge amounts of foreign currency are being spent.
화학농약의 사용은 시간이 지나면서 화학물질에 대한 내성이 생길 수 있다는 치명적인 단점과 화학적 잔류물에 의한 환경적인 위험이 제기되어 왔기 때문에, 이에 대한 대안으로 생물학적 방제 기술개발이 잠재적으로 효과적이며, 특이적이라는 장점에 의하여 연구가 활발하게 진행되고 있다. 특히 진딧물 방제 등 해충방제에 곤충 병원성 진균의 활용기술은 미국, 유럽, 아프리카 및 러시아에서 개발되었으나, 시장에서 성공한 경우가 거의 알려져 있지 않다. Since the use of chemical pesticides has been a fatal disadvantage of being resistant to chemicals over time and environmental risks due to chemical residues have been raised, the development of biological control technology as an alternative is potentially effective, Research is being actively pursued by virtue of being an enemy. The use of insect pathogenic fungi in pest control, especially aphid control, has been developed in the US, Europe, Africa and Russia, but little is known about its success in the market.
생물학적 방제의 타겟이 되는 진딧물 중에서도 복숭아혹진딧물은 복숭아나무, 살구나무, 자두나무, 벚나무, 귤나무 등을 기주로 하며, 5월 중순 이후에는 여름 숙주인 담배, 오이, 고추 등에서 흡즙에 의한 성장 억제 피해를 유발한다. 1년간 빠른 개체군은 23세대, 늦은 개체군은 9 세대를 영위할 수 있을 정도로 번식력이 강하며, 수명이 약 28.5일로 짧은 곤충이다.Among the target aphids for biological control, peach aphid is hosted by peach tree, apricot tree, plum tree, cherry tree, tangerine tree, and after mid May, it inhibits growth by tobacco, cucumber, It causes damage. The rapid population of 1 year is fertile enough to carry 23 generations, the
국내 시판중인 친환경 농자재 매출액 중 55% (709억원)가 진딧물 방제용 약제이며, 해충방제를 위해 사용되는 미생물 농약 중 흡즙성 곤충인 진딧물 방제를 위해서는 곰팡이가 효과적인 것으로 알려져 있다. 복숭아혹진딧물을 포함하는 흡즙성 진딧물 방제는, 접촉에 의하여 진딧물에 침입하는 곰팡이를 사용하는 미생물 농약의 연구가 활발하다. 그러나, 포자가 곤충제에 접촉, 발아, 침입하는 살충성 기전에 의존하는 곰팡이를 이용한 살충제는 포자가 곤충체에 접촉하고, 살충 효과를 나타내기까지는 온,습도 등 환경의 영향에 따라 방제 효과가 불균일하고 오래 걸린다는 문제가 있어 농민들이 사용을 기피하는 경향이 있다.55% (KRW 70.9 billion) of sales of eco-friendly agricultural products sold in Korea is used for the control of aphids, and it is known that fungi are effective for the control of aphid, a jujube insect among microbial pesticides used for pest control. Studies on microbial pesticides using fungi that invade aphids by contact are active in juice aphid control, including peach lycopodium aphid. However, insecticides using fungi, which depend on the insecticidal mechanism that spores contact, germinate, and invade into insecticides, have an effect of controlling the insecticide by contact with the insect body and depending on environmental influences such as temperature and humidity There is a problem of uneven and long-lasting farmers tend to avoid use.
따라서, 미생물 유래 물질을 이용한 환경 친화적이고 안정적인 곤충 방제제의 개발을 위해서는 국내 환경에 잘 적응된 토착 곤충병원성 곰팡이 균주를 사용하며, 특히 신속한 효과를 내는 균주 개발에 대한 필요성이 대두되고 있다.
Therefore, in order to develop an environmentally friendly and stable insect control agent using microbial-derived materials, there is a need for the development of a strain that is rapidly adapted to the domestic environment using an insecticidal fungus strain native to the domestic environment.
이에 본 발명자들은, 포자를 유효성분으로 하는 통상의 미생물 농약은 미생물이 곤충에 접촉하여 생장하는데 시간이 걸리기 때문에, 이러한 살충효과를 얻는데 시간이 오래 걸린다는 단점을 해결하기 위하여, 국내 환경에 잘 적응할 수 있으며, 신속한 살충효과를 나타내는 토착 곤충병원성 곰팡이 균주를 포함하는 미생물 농약을 개발하기 위하여 예의 노력한 결과, 국내 토양에서 진딧물 방제능이 우수한 신규의 Beauveria bassiana Bb08(KACC93163P)를 분리하였으며, 상기 진균의 포자를 3일 내지 5일간 배양한 후, 균체(포자)를 포함하는 배양액을 진딧물에 분사할 경우, 2일 이내에 100%의 살충효과가 나타남을 확인하고 본 발명을 완성하였다.Therefore, the inventors of the present invention have found that a conventional microbial pesticide containing spores as an active ingredient takes a long time to grow by contacting microorganisms with insects, and therefore it takes a long time to obtain such insecticidal effect, As a result of intensive efforts to develop a microbial pesticide containing an insecticidal pathogenic fungus that exhibits a rapid insecticidal effect, a new Beauveria bassiana Bb08 (KACC93163P) was isolated. When spores of the fungus were cultured for 3 days to 5 days, when the culture solution containing the cells (spores) was sprayed on aphids, 100% insecticidal effect was observed within 2 days Thus completing the present invention.
본 발명의 목적은 Beauveria bassiana Bb08(KACC93163P)을 제공하는데 있다.An object of the present invention is Beauveria bassiana Bb08 (KACC93163P).
본 발명의 다른 목적은 상기 미생물의 배양액 또는 배양여액을 유효성분으로 하는 진딧물 방제용 조성물을 제공하는데 있다.Another object of the present invention is to provide a composition for controlling aphids, which comprises the culture broth or culture filtrate of the microorganism as an active ingredient.
본 발명의 또 다른 목적은 상기 미생물 유래 진딧물 방제용 조성물의 제조방법에 관한 것이다.It is still another object of the present invention to provide a method for preparing the microbial-derived aphid control composition.
상기 목적을 달성하기 위하여, 본 발명은 Beauveria bassiana Bb08(KACC93163P)을 제공한다.In order to achieve the above object, the present invention is Beauveria bassiana Bb08 (KACC93163P).
본 발명은 또한 미생물 배지에 상기 미생물을 25℃에서 3일 내지 5일간 배양하여 수득된 배양액을 유효성분으로 하는 진딧물 방제용 조성물을 제공한다.The present invention also provides a composition for controlling aphids, which comprises the culture medium obtained by culturing the microorganism in a microorganism medium at 25 ° C for 3 to 5 days.
본 발명은 또한 미생물 배지에 상기 미생물을 25℃에서 3일 내지 5일간 배양하여 수득된 배양액에 대해 균체를 제외한 배양여액을 유효성분으로 하는 진딧물 방제용 조성물을 제공한다.The present invention also provides a composition for controlling aphids, comprising as an active ingredient, a culture filtrate obtained by culturing the microorganism in a microorganism medium at 25 ° C for 3 days to 5 days, with respect to the obtained culture medium.
본 발명은 또한 (a) PDB(Potato Dextrose Broth)에 Beauveria bassiana Bb08(KACC93163P)의 포자가 1x106 conidia/ml가 되도록 접종하는 단계; (b) 상기 접종액을 25℃에서 3일 내지 5일간 배양하는 단계; 및 (c) 종이필터를 사용하여 (b) 단계로 얻어진 배양물의 불순물을 제거하는 단계를 포함하는 진딧물 방제용 조성물의 제조방법에 관한 것이다. The present invention also relates to a process for the preparation of (a) PDB (Potato Dextrose Broth) bassiana Inoculating the spores of Bb08 (KACC93163P) to 1x10 < 6 > conidia / ml; (b) culturing the inoculum at 25 DEG C for 3 to 5 days; And (c) removing the impurities of the culture obtained in step (b) using a paper filter.
본 발명에 따른 Beauveria bassiana Bb08(KACC93163P), 상기 진균을 이용한 진딧물 방제용 조성물, 및 이의 제조방법은 토착 미생물로서 국내 환경에 적응이 빠르고, 살충효과를 나타내는데 신속하기 때문에, 진딧물 방제용 생물농약으로서의 용도가 우수하며, 이는 환경 친화적이고 안정적인 방제수단으로서, 시설하우스 재배 작물의 경제적 가치를 증대시키고, 안전 농산물 생산증대 및 미생물 살충제 개발산업의 활성화에 유용하다.The Beauveria bassiana Bb08 (KACC93163P), a composition for controlling aphids using the fungus, and a method for producing the same are indigenous microorganisms that are adaptable to domestic environments quickly and rapidly exhibit an insecticidal effect. Therefore, they have excellent applications as a biocide for controlling aphids, It is useful as a friendly and stable control means to increase the economic value of cultivated crops, to increase the production of safe agricultural products and to activate the microbial pesticide development industry.
도 1은 국내 토양 유래 곰팡이의 3일 배양여액을 처리에 의하여 죽은 진딧물 사진이다.
도 2은 국내 토양 유래 곰팡이의 3일 배양여액을 진딧물에 처리한 다음, 3일 후에 관찰된 진딧물 살충율을 나타낸 그래프이다.
도 3은 국내 토양 유래 곰팡이의 5일 배양여액을 진딧물에 처리한 다음, 3일 후에 관찰된 진딧물 살충율을 나타낸 그래프이다.
도 4은 국내 토양 유래 곰팡이의 7일 배양여액을 진딧물에 처리한 다음, 3일 후에 관찰된 진딧물 살충율을 나타낸 그래프이다.
도 5은 국내 토양 유래 곰팡이의 10일 배양여액을 진딧물에 처리한 다음, 3일 후에 관찰된 진딧물 살충율을 나타낸 그래프이다.
도 6은 국내 토양 유래 곰팡이의 3일 배양여액을 진딧물에 처리에 의한 반수치사시간(LT50)을 분석한 표이다.
도 7은 국내 토양 유래 곰팡이의 5일 배양여액을 진딧물에 처리에 의한 반수치사시간(LT50)을 분석한 표이다.
도 8은 Beauveria bassiana Bb08균 배양액 또는 배양여액에 대한 처리 방법별 살충율을 나타낸 그래프이다.FIG. 1 is a photograph of aphids dead by treatment with a 3-day culture filtrate of domestic soil-derived fungi.
FIG. 2 is a graph showing the rate of aphid insect mortality observed after 3 days after a 3 days culture filtrate of domestic soil-derived fungi was treated with aphids.
FIG. 3 is a graph showing the rate of aphid insect mortality observed after 3 days after a 5-day culture filtrate of domestic soil-derived fungi was treated with aphids.
FIG. 4 is a graph showing the rate of aphid insect mortality observed after 3 days after a 7 days culture filtrate of domestic soil-derived fungi was treated with aphids.
FIG. 5 is a graph showing the rate of aphid insect mortality observed after 3 days after a 10-day culture filtrate of a domestic soil-derived fungus was treated with aphids.
FIG. 6 is a table showing the half-life (LT50) of a three-day culture filtrate of a domestic soil-derived fungus by treatment with aphids.
FIG. 7 is a table showing the half-life (LT50) of a 5-day culture filtrate of a domestic soil-derived fungus by treatment with aphids.
8 is Beauveria bassiana Bb08 culture medium or culture filtrate.
이하, 본 발명을 상세히 설명한다.Hereinafter, the present invention will be described in detail.
진딧물은 번식력이 매우 높고 빠른 약제 내성에 의하여 방제하기 어려운 해충으로 알려져 있으며, 특히 국내 채소 재배 농가에서 살포하는 화학 살충제의 27%가 진딧물 방제를 위해 살포되고 있는 실정이기 때문에, 화학농약의 폐해를 극복할 수 있는 미생물 농약의 개발에 대한 요구가 점점 커지고 있다. 그러나, 미생물 농약은 포자가 곤충체에 접촉하고, 살충 효과를 나타내기까지는 온,습도 등 환경에 영향에 따라 방제 효과가 불균일하고 오래 걸린다는 문제가 있어, 농민들이 사용을 기피하는 경향이 있다.Aphids are known as insect pests that are difficult to control due to their high fertility and rapid drug resistance. Especially, 27% of chemical insecticides sprayed by domestic farmers are sprayed for the control of aphids. There is a growing demand for the development of microbial pesticides that can be used. However, the microbial pesticides have a problem that the effect of controlling the microbial pesticide is uneven and takes a long time depending on the influence of the environment such as temperature and humidity until the spores contact the insect body and exhibit insecticidal effect, and farmers tend to avoid use.
이에 본 발명자들은, 포자를 유효성분으로 하는 통상의 미생물 농약이 가진 문제를 해결하기 위하여 국내 환경에 잘 적응할 수 있으며, 신속한 살충효과를 나타내는 토착 곤충병원성 곰팡이 균주를 포함하는 미생물 농약을 개발하기 위하여 예의 노력한 결과, 진딧물 방제능의 토착 진균인 Beauveria bassiana Bb08(KACC93163P)를 분리하였으며, 상기 진균의 포자를 3일 내지 5일간 배양한 후, 균체(포자)를 포함하는 배양액을 진딧물에 분사할 경우, 2일 이내에 100%의 살충효과가 나타남을 확인하고 본 발명을 완성하였다.
Therefore, in order to solve the problem of conventional microbial pesticides containing spores as active ingredients, the inventors of the present invention have developed a microbial pesticide containing an insect pest pathogenic fungus strain that can adapt well to the domestic environment and exhibit rapid insecticidal effect, As a result of efforts, we found that the native fungus of aphid control ability, Beauveria bassiana Bb08 (KACC93163P) was isolated. When spores of the fungus were cultured for 3 days to 5 days, when the culture solution containing the cells (spores) was sprayed on aphids, 100% insecticidal effect was observed within 2 days Thus completing the present invention.
본 발명은 일 관점에서, 진딧물 방제능의 Beauveria bassiana Bb08(KACC93163P)에 관한 것이다.The invention in one aspect, of aphid control function Beauveria bassiana Bb08 (KACC93163P).
본 발명의 Beauveria bassiana Bb08(KACC93163P)은 토양에 존재하는 신규 미생물로서, 꿀벌부채명나방 유충과 토양을 혼합하여 10 ~ 14일간 방치하여, 토양에 존재할 수 있는 진균에 감염되도록 한 후, 감염된 유충으로부터 인공배지(PDA)를 이용하여 순수 분리하였으며, PDA 배지 상에서 나타난 포자의 형태 및 유전자의 ITS 분석 결과를 통해 동정하였다.The beauveria of the present invention bassiana Bb08 (KACC93163P) is a new microorganism existing in soil. It is mixed with bee moth larvae and soil for 10 ~ 14 days to allow them to infect fungi that may be present in the soil, ), And were identified by the ITS analysis of spore morphology and gene expression on the PDA medium.
본 발명은 다른 관점에서, 미생물 배지에 Beauveria bassiana Bb08(KACC93163P)을 25℃에서 3일 내지 5일간 배양하여 수득된 배양액을 유효성분으로 하는 진딧물 방제용 조성물에 관한 것이다. The invention in another aspect, the microbial culture medium Beauveria bassiana Bb08 (KACC93163P) at 25 占 폚 for 3 days to 5 days as an active ingredient.
본 발명은 또 다른 관점에서, 미생물 배지에 Beauveria bassiana Bb08(KACC93163P)을 25℃에서 3일 내지 5일간 배양하여 수득된 배양액에 대해 균체를 제외한 배양여액을 유효성분으로 하는 진딧물 방제용 조성물에 관한 것이다.The invention yet further aspect, the microbial culture medium Beauveria bassiana Bb08 (KACC93163P) at 25 占 폚 for 3 days to 5 days. The present invention relates to a composition for controlling aphids, which contains as an active ingredient a culture filtrate excluding the cells.
본 발명에서, 방제의 대상이 되는 진딧물은 복숭아혹진딧물, 조팝나무진딧물, 목화진딧물, 귤소리진딧물, 딱총나무수염진딧물 등을 포함할 수 있으며, 이에 제한된 것은 아니다.In the present invention, the aphids to be controlled include, but are not limited to, peach aphid, aphid, aphid, orange aphid, and aphid aphid.
본 발명에 있어서의 용어 '배양액'은 미생물 생장에 적절한 배지에 일정 농도의 포자를 접종하여 배양기에서 일정 기간 동안 미생물이 생장하도록 유도한 후 수득된, 균체, 균체가 생장하면서 분비한 물질, 및 생장에 필요한 영양성분이 혼합된 액으로서, 종이필터를 이용하여 불순물을 걸러내는 과정을 거쳐 제조할 수 있으며, '배양여액'은 상기 배양액에서 균체를 원심분리 또는 여과 과정(filtration) 통해 제거하고, 균체가 생장하면서 분비한 물질 및 생장에 필요한 영양성분만을 포함한 것이다.The term " culture medium " in the present invention refers to a culture medium obtained by inoculating a spore with a certain concentration in a medium suitable for microorganism growth, inducing the microorganism to grow for a certain period in an incubator, , Which can be prepared by filtering out impurities using a paper filter. The 'culture filtrate' can be prepared by removing cells through centrifugation or filtration in the culture broth, And the nutrients necessary for growth and growth.
본 발명의 용어 '방제'는 일반적으로 식물 병원체 감염을 예방, 감소 또는 근절시키는 것을 포함하며, 감염에 있어서의 예방 또는 감소는 비처리된 기주식물에 대하여 통계적으로 현저한 차이가 있음을 의미한다.The term " control " of the present invention generally includes preventing, reducing or eradicating plant pathogenic infections, wherein the prevention or reduction in infection means that there is a statistically significant difference for untreated host plants.
본 발명에서 있어서, 미생물 배지는 Beauveria bassiana Bb08이 생장할 수 있는, PDA(potato dextrose agar) 또는 SDA(sabouraud dextrose agar) 배지를 사용할 수 있으며, 상기 PDA는 4 g/L potato starch, 20 g/L dextrose, 15g/L agar를 혼합하여 제조할 수 있고, 바람직하게는 PDA에서 agar를 혼합하지 않고 제조한 액체배지인 PDB(Potato Dextrose Broth)이며, 이에 한정되는 것은 아니다.In the present invention, the microorganism medium may be a PDA (potato dextrose agar) or a SDA (sabouraud dextrose agar) medium in which Beauveria bassiana Bb08 can grow. The PDA may be a 4 g / L potato starch, 20 g / L dextrose, and 15 g / L agar, preferably PDA (Potato Dextrose Broth), which is a liquid medium prepared without mixing agar in a PDA, but is not limited thereto.
본 발명에 있어서, Beauveria bassiana Bb08(KACC93163P)의 초기 접종 농도는 1x106 conidia/ml인 것을 특징으로 한다.In the present invention, Beauveria bassiana The initial inoculation concentration of Bb08 (KACC93163P) is 1x10 < 6 > conidia / ml.
본 발명의 진딧물 방제용 조성물은 식물의 생리적 상태, 곤충의 종류, 병원체 감염 정도 및 농도, 계절, 습도, 식물의 연령 및 성장단계, 식물 처리방법에 따라 조성물의 사용량 및 살포방법을 결정하는데 고려할 수 있다.The composition for controlling aphids of the present invention can be considered in determining the amount of the composition used and the method of spraying according to the physiological condition of the plant, the kind of insect, the degree and concentration of pathogen infection, season, humidity, have.
본 발명의 진딧물 방제용 조성물에 포함된 Beauveria bassiana Bb08는 생육가능한 상태이어야 하며, 이는 균사(mycelial) 및 포자(spore) 형태일 수 있다.In the composition for controlling aphids of the present invention, Beauveria bassiana Bb08 should be in viable state, which may be in the form of mycelial and spores.
본 발명에서의 용어 '곤충 병원성'은 진균류 즉 곰팡이의 포자가 숙주 곤충의 외피에 부착하여 발아하게 되면, 키티나아제(chitinase), 프로테아제(protease), 리파아제(lipase), 에스테라아제(esterase) 등을 생성하여 곤충의 큐티클 층을 뚫은 후 침입하게 되고, 이어 곤충의 체내에 증식하면서 독성 물질을 생산하여 숙주곤충을 사멸케하는 효과를 의미하며, '살충효과'와 혼용하여 사용될 수 있다.The term " insect pathogenicity " in the present invention means that when fungi, that is, spores of the fungus adhere to the outer shell of a host insect and germinate, they are chitinase, protease, lipase, esterase, It means the effect of penetrating the cuticle layer of insects and then invading the insects, and then producing a toxic substance by propagating in the body of the insects, thereby killing the host insect, and can be used in combination with the insecticidal effect.
본 발명의 진딧물 방제용 조성물은 액체 발효기술을 사용하여 배양온도는 10-30℃ 또는 25-30℃, 바람직하게는 25℃가 적정온도이며, 배양시간은 3 내지 5일간 배양하여 수득하며, 0~6℃에서 생육능이 유지될 수 있으므로, 보관이 가능하다.The composition for controlling aphids of the present invention is obtained by culturing the cultured aphid using a liquid fermentation technique at a suitable temperature of 10-30 ° C or 25-30 ° C, preferably 25 ° C, for 3 to 5 days, It is possible to keep the growth ability at ~ 6 ℃.
본 발명의 진딧물 방제용 조성물에서 배양여액을 제조하는 방법은 종래의 여과(filtering) 또는 원심분리에 의하여 균체를 제거할 수 있다.The method for producing a culture filtrate in the composition for controlling aphids of the present invention can remove the cells by conventional filtering or centrifugation.
본 발명의 진딧물 방제용 조성물은 농업적으로 허용 가능한 담체를 포함할 수 있으며, 충전제(fillers), 용매, 부형제, 계면활성제(surfactants), 현탁제(suspending agents), 스프래더(spreaders), 부착제(adhesives), 소포제, 분산제, 습윤제, 드리프트 감소제(drift reducitng agents), 보조제(suxiliaries), 보강제(adjuvants) 또는 이의 혼합물을 포함할 수 있다. The composition for controlling aphids of the present invention may comprise an agriculturally acceptable carrier and may contain fillers, solvents, excipients, surfactants, suspending agents, spreaders, adhesives adhesives, defoamers, dispersants, wetting agents, drift reducitng agents, suxiliaries, adjuvants or mixtures thereof.
본 발명의 조성물은 농축물, 용액, 스프레이, 에어로졸, 침수용(immersion baths), 침지(dips), 에멀젼(emulsions), 현탁 농축액, 겔, 과립(granules) 등의 타입으로 제제화 할 수 있다.The composition of the present invention can be formulated into concentrate, solution, spray, aerosol, immersion baths, dips, emulsions, suspension concentrates, gels, granules and the like.
본 발명의 조성물은 또한 조성물 단독 또는 다른 농업용 제제, 농약(pesticides), 살충제(insecticides), 살응애제(acaracides), 살진균제(본 발명의 진균에 무해한 진균제), 살박테리아제, 제초제, 항생제, 항균제, 살선충제(nematocides), 쥐약(rodenticides), 곤충병원체(entomopathogens), 페로몬(pheromones), 유인제(attractants), 식물성장조절제(plant growth regulators), 식물 호르몬(plant hormones), 곤충성장 조절제(insect growth regulators), 화학불임제(chemosterilants), 미생물 작물보호제(microbial pest control agents), 방충제(repellents), 바이러스, 식자극제(phagostimulents), 식물 영양제, 식물비료 및 생물학적 방제제와 함께 배합하거나, 순차적으로 사용될 수 있으며, 상기 농업적 제제의 특정 예는 당업계의 통상의 지식을 가진 사람에게는 자명한 것으로, 용이하게 입수할 수 있다.
The composition of the present invention may also be used as a composition alone or in combination with other agricultural preparations, pesticides, insecticides, acaracides, fungicides (fungicides harmless to the fungi of the present invention), fungicides, herbicides, (S), antimicrobial agents, nematocides, rodenticides, entomopathogens, pheromones, attractants, plant growth regulators, plant hormones, insect growth regulators insect growth regulators, chemosterilants, microbial pest control agents, repellents, viruses, phagostimulents, plant nutrients, plant fertilizers and biological control agents, And specific examples of agricultural preparations thereof are obvious to those of ordinary skill in the art and are readily available.
발명은 또 다른 관점에서, (a) PDB(Potato Dextrose Broth)에 Beauveria bassiana Bb08(기탁번호)의 포자가 1x106 conidia/ml가 되도록 접종하는 단계; (b) 상기 접종액을 25℃에서 3일 내지 5일간 배양하는 단계; 및 (c) 종이필터를 사용하여 (b) 단계로 얻어진 배양물의 불순물을 제거하는 단계를 포함하는 진딧물 방제용 조성물의 제조 방법에 관한 것이다.In another aspect, the present invention provides a method of producing a cell line, comprising: (a) inoculating a spore of Beauveria bassiana Bb08 (accession number) to PDB (Potato Dextrose Broth) to 1x10 6 conidia / ml; (b) culturing the inoculum at 25 DEG C for 3 to 5 days; And (c) removing the impurities of the culture obtained in step (b) using a paper filter.
본 발명의 진딧물 방제용 조성물의 제조방법에 있어서, (c) 단계 이후에 (d) 배양액에 대해 균체를 제거하는 단계를 추가로 포함하는 것을 특징으로 하며, 이 경우 배양여액이 수득된다.In the method for producing aphid control composition of the present invention, the step (c) is further followed by (d) a step of removing cells from the culture solution. In this case, a culture filtrate is obtained.
본 발명의 진딧물 방제용 조성물의 제조방법에 있어서, (c)단계의 종이필터는 와트만 NO.2 필터페이퍼(Whatman No.2 filter paper)를 사용하는 것으로 특징으로 하며, 이에 한정된 것은 아니다.
In the method for producing aphid control composition of the present invention, the paper filter in step (c) is characterized by using Whatman No.2 filter paper, but not limited thereto.
본 발명은 하기의 실시 예에 의하여 더욱 구체적으로 설명한다. 그러나, 하기 실시 예는 본 발명의 이해를 돕기 위한 것일 뿐, 어떤 의미로든 본 발명의 범위가 이러한 실시 예에 의하여 한정되는 것은 아니다. The present invention will be described in more detail with reference to the following examples. However, the following examples are provided to aid understanding of the present invention, and the scope of the present invention is not limited by these examples in any sense.
이때, 사용되는 기술 용어 및 과학 용어에 있어서 다른 정의가 없다면, 이 발명이 속하는 기술 분야에서 통상의 지식을 가진 자가 통상적으로 이해하고 있는 의미를 가지며, 하기의 설명 및 첨부 도면에서 본 발명의 요지를 불필요하게 흐릴 수 있는 공지기능 및 구성에 대한 설명은 생략한다.
Hereinafter, the technical and scientific terms used herein will be understood by those skilled in the art without departing from the scope of the present invention. Descriptions of known functions and configurations that may be unnecessarily blurred are omitted.
실시 예Example 1: One: 토양으로부터 균주의 분리 및 배양물의 제조Isolation of the strain from the soil and preparation of the culture
농경지 주변 야산에서 수집된 토양에 꿀벌부채명나방 유충을 넣어, 토양에 존재하는 진균에 감염되도록 10-14일 방치 한 다음, 감염된 유충을 선별하여, 이에 대해 인공배지 (PDA)를 이용하여 얻어진 균주 48 종을 순수 분리하였다. 순수분리된 균은 동결건조 방법을 이용하여 균을 보존하고, 포자현탁액은 분리 균을 PDA 배지에 접종하여 25℃에서 10-14일 배양하여 형성된 포자를 멸균된 0.05% Tween 80 용액에 넣어 제조하였다. 포자농도는 헤모사이토메터를 이용하여 포자수를 계수하고 적정 농도로 희석하였다.In order to infect the fungi present in the soil, the larvae of the honeybee moth larvae were placed in the soil collected from the farms surrounding the farmland, and the infected larvae were selected for 10-14 days, and the strains obtained using the artificial medium (PDA) 48 species were separated pure. The spore suspension was prepared by inoculating the isolated bacterium into the PDA medium and culturing at 25 ° C for 10-14 days. The spores formed were sterilized in 0.05% Tween 80 solution . The spore concentration was counted using a hemocytometer and diluted to the appropriate concentration.
상기의 방법으로 분리한 균주 48종의 배양물은 100ml의 PDB(Potato Dextrose Broth)에 포자현탁액 1x106 conidia/ml을 접종하여, 25℃, 200rpm의 조건으로 배양으로 수득하였다.
The culture of 48 strains isolated by the above method was obtained by inoculating 1x10 6 conidia / ml of spore suspension into 100 ml of PDB (Potato Dextrose Broth) and culturing at 25 ° C and 200 rpm.
실시 예Example 2: 진딧물 방제효과가 우수한 균주의 선별 2: Screening of strains with excellent aphid control effect
1. 배양 시간별 진딧물 1. Aphid 살충율의Insecticidal 확인 Confirm
실시 예 1의 미생물 배양 개시 후, 3, 5, 7, 10일에 각각 20ml의 배양액을 취하여 와트만 NO.2 필터페이퍼(Whatman No.2 filter paper)로 여과한 다음, 0.20㎛ 시린지 필터(syringe filter(Advantec))로 균체를 제거하여 진딧물 방제능 검정에 사용할 배양여액을 수득하였으며, 상기 배양여액은 생물 검정 전까지 4℃에 보관하였다.After the initiation of the microbial culture in Example 1, 20 ml of the culture was taken on each of 3, 5, 7, and 10 days, filtered through Whatman No.2 filter paper, and then passed through a 0.20 占 퐉 syringe filter filter (Advantec)) to obtain a culture filtrate to be used for assaying aphid control ability, and the culture filtrate was stored at 4 ° C. until bioassay.
각 진딧물의 2-4령 약충을 배양여액 500 ㎕가 들어있는 E-tube에 15초간 침지하고, 직경 5.5 cm 페트리디쉬에 각각 직경 5cm의 배추와 오이 잎 조각에 붓을 이용하여 옮겨 준 후, 25℃, 80~90%의 습도를 유지하는 플라스틱 케이지에 충이 들어있는 페트리디쉬를 유지하면서 24 시간 간격으로 진딧물 생존 여부를 조사하여, 배양여액 중 진딧물에 살충효과가 높은 물질을 생산하는 균주를 선발하였다(도 1).The second-fourth instar larvae of each aphid were immersed in an E-tube containing 500 μl of culture filtrate for 15 seconds, transferred to a 5 cm-diameter petri dish with a diameter of 5 cm by using a brush, C. for 80-90% humidity, the survival of aphids was investigated at intervals of 24 hours while maintaining a petri dish filled in a plastic cage, and a strain producing a substance having a high insecticidal effect on aphids in the culture filtrate was selected (Fig. 1).
그 결과, Bb08 균주의 배양액으로부터 수득된 3일 배양여액을 처리 시, 5일, 7일 또는 10일 배양여액을 사용한 것보다, 처리 후 3일 뒤 복숭아혹진딧물에 대한 살충율이 100%로, 다른 균주에 비하여 매우 신속하고 우수한 살충효과를 나타내는 것으로 확인되었다(도 2, 3, 4 및 5).
As a result, it was found that the 3-day culture filtrate obtained from the culture broth of Bb08 strain had a killing rate of 100% against the peach aphid 3 days after the treatment by using the culture solution for 5 days, 7 days or 10 days, (Fig. 2, Fig. 3, Fig. 4 and Fig. 5).
2. 균주 배양 시간별 진딧물 반수치사 시간의 확인 2 . Identification of half-life mortality of aphids by culture time
각 진딧물의 2-4령 약충에 대해 상기 실시 예 2-1에서 기술한 바와 동일한 조건으로 하여, 3일 및 5일의 배양시간에 따른 각 균주별 배양여액을 처리한 진딧물에 대해 24 시간 간격으로 시험 진딧물의 반수가 살충된 시간을 리치필드-ㅇ우위윌콕슨(ield-Wilcoxon법(吉村, 1992))에 따른 '프로비트분석'(probit analysis software)를 이용하여 반수치사시간(LT50)을 산출하였다.Under the same conditions as described in Example 2-1 above for each of the second and fourth instar aphids of each aphid, the culture filtrate of each strain according to the incubation time of 3 days and 5 days was applied to the aphids treated at intervals of 24 hours Calculate the half-life (LT50) using the probit analysis software according to the Richfield-Wilcoxon method (吉 村, 1992)) for half of the test aphids. Respectively.
그 결과, Bb08 균주의 반수치사시간(LT50)이 3일 배양여액을 처리한 경우 각각 2.7일과 2.9일, 및 5일 배양액에서 각각 2.7일과 2.0일로 계산되었으며, 따라서 상기 균주 유래의 배양여액의 살충효과가 매우 신속하며, 상당히 지속적인 것으로 판명되었다(도 6 및 도 7).
As a result, the half-life (LT50) of the strain Bb08 was calculated to be 2.7 days and 2.0 days for the 2.7 day and 2.9 day and 5 day culture respectively when the culture filtrate was treated for 3 days. Thus, the insecticidal effect (Figure 6 and Figure 7).
실시 예Example 3: Bb08 균주의 동정 및 살충방법별 효율 3: Identification and isolation of Bb08 strain
1. Bb08 균주의 동정 1 . Identification of Bb08 strain
토양에서 순수 분리된 48종의 진균 가운데, 살충 효과가 가장 우수한 Bb08 균주를 동정하기 위하여, 현미경 관찰에 의한 형태학적 특징을 파악하고, 또한 균의 유전자(서열번호 1)을 추출하여 ITS 분석을 수행한 결과, 최종적으로 Bb08은 Beauveria bassiana임을 확인하고, Beauveria bassiana Bb08(KACC93163P)라 명명하고 기탁하였다.
In order to identify the Bb08 strain with the highest insecticidal effect among 48 fungi isolated from the soil, we analyzed the morphological characteristics by microscopic observation and extracted the bacterial gene (SEQ ID NO: 1) and performed ITS analysis As a result, finally, Bb08 was confirmed as Beauveria bassiana , and Beauveria bassiana Bb08 (KACC93163P).
서열번호 1:SEQ ID NO: 1:
tttccgttag ggggtactgc ggagggatca ttaccgagtt ttcaactccc taacccttcttttccgttag ggggtactgc ggagggatca ttaccgagtt ttcaactccc taacccttct
gtgaacctac ctatcgttgc ttcggcggac tcgccccagc ccggacgcgg actggaccaggtgaacctac ctatcgttgc ttcggcggac tcgccccagc ccggacgcgg actggaccag
cggcccgccg gggacctcaa actcttgtat tccagcatct tctgaatacg ccgcaaggcacggcccgccg gggacctcaa actcttgtat tccagcatct tctgaatacg ccgcaaggca
aaacaaatga atcaaaactt tcaacaacgg atctcttggc tctggcatcg atgaagaacgaaacaaatga atcaaaactt tcaacaacgg atctcttggc tctggcatcg atgaagaacg
cagcgaaatg cgataagtaa tgtgaattgc agaatccagt gaatcatcga atctttgaaccagcgaaatg cgataagtaa tgtgaattgc agaatccagt gaatcatcga atctttgaac
gcacattgcg cccgccagca ttctggcggg catgcctgtt cgagcgtcat ttcaaccctcgcacattgcg cccgccagca ttctggcggg catgcctgtt cgagcgtcat ttcaaccctc
gacctcccct tggggaggtc ggcgttgggg accggcagca caccgccggc cctgaaatgggacctcccct tggggaggtc ggcgttgggg accggcagca caccgccggc cctgaaatgg
agtggcggcc cgtccgcggc gacctctgcg tagtaataca gctcgcaccg gaaccccgacagtggcggcc cgtccgcggc gacctctgcg tagtaataca gctcgcaccg gaaccccgac
gcggccacgc cgtaaaacac ccaacttctg aacgttgacc tcgaatcagg taggactaccgcggccacgc cgtaaaacac ccaacttctg aacgttgacc tcgaatcagg taggactacc
cgctgaactt aagcatatca tagnccggag gaa
cgctgaactt aagcatatca tagnccggag gaa
2. 균주 배양액 처리 방법별 살충율의 확인 2. Identification of the insecticidal rate of each culture medium treatment method
Bb08 균주임이 확인된 Beauveria bassiana(KACC93163P)에 대하여, 100ml의 PDB(Potato Dextrose Broth)에 포자현탁액 1x106 conidia/ml을 접종하여, 25℃, 200rpm의 조건으로 배양한 다음, 와트만 NO.2 필터페이퍼(Whatman No.2 filter paper)로 여과하여 얻어진 균체를 포함하는 배양액을 수득하였으며, 또한 이에 대해 균 배양액을 12,000 rpm에 10분 간 원심분리하여 균체를 침지시킨후 상층액을 얻어 추출물을 제조한 다음, 이에 사용하여 처리방법에 대한 살충 효과를 확인하고자 하였다.To 100 ml of PDB (Potato Dextrose Broth), 1 × 10 6 conidia / ml of spore suspension was inoculated on Beauveria bassiana (KACC93163P) which was confirmed to be Bb08 strain and cultured under conditions of 25 ° C. and 200 rpm. The obtained culture was centrifuged at 12,000 rpm for 10 minutes to immerse the cells, and the supernatant was obtained to obtain an extract. Next, we tried to confirm the insecticidal effect on the treatment method.
목화 진딧물에 (a) 균체(포자)를 포함하는 배양액(culture solution), (b) 20㎛ 시린지 필터(syringe filter(Advantec))로 균체를 제거한 배양여액(culture supernatant) 및 (c) 균체 유래 추출물(Extract)을 분무 처리한 결과, 균체를 포함하는 배양액 및 배양여액에 의한 살충효과가 매우 높은 것으로 나타났으며, 특히 균체를 포함하는 배양액의 경우에는 살충효과가 2일 이내 100% 인 것으로 분석되었다(도 8).
(B) a culture supernatant obtained by removing the microbial cells with a 20 탆 syringe filter (Advantec), and (c) a microbial cell extract (Extract) was sprayed, the insecticidal effect was remarkably enhanced by the culture solution containing the cells and the culture filtrate. In particular, in the case of the culture solution containing the cells, the insecticidal effect was found to be 100% within 2 days (Fig. 8).
<110> REPUBLIC OF KOREA(MANAGEMENT : RURAL DEVELOPMENT ADMINISTRATION <120> Composition for Control of Insect Using Beauveria bassiana Bb08 and Its Culture Extracts <130> P2012-0220 <160> 1 <170> KopatentIn 2.0 <210> 1 <211> 573 <212> DNA <213> Beauveria bassiana Bb08 <400> 1 tttccgttag ggggtactgc ggagggatca ttaccgagtt ttcaactccc taacccttct 60 gtgaacctac ctatcgttgc ttcggcggac tcgccccagc ccggacgcgg actggaccag 120 cggcccgccg gggacctcaa actcttgtat tccagcatct tctgaatacg ccgcaaggca 180 aaacaaatga atcaaaactt tcaacaacgg atctcttggc tctggcatcg atgaagaacg 240 cagcgaaatg cgataagtaa tgtgaattgc agaatccagt gaatcatcga atctttgaac 300 gcacattgcg cccgccagca ttctggcggg catgcctgtt cgagcgtcat ttcaaccctc 360 gacctcccct tggggaggtc ggcgttgggg accggcagca caccgccggc cctgaaatgg 420 agtggcggcc cgtccgcggc gacctctgcg tagtaataca gctcgcaccg gaaccccgac 480 gcggccacgc cgtaaaacac ccaacttctg aacgttgacc tcgaatcagg taggactacc 540 cgctgaactt aagcatatca tagnccggag gaa 573 <110> REPUBLIC OF KOREA (MANAGEMENT: RURAL DEVELOPMENT ADMINISTRATION <120> Composition for Control of Insect Using Beauveria bassiana Bb08 and Its Culture Extracts <130> P2012-0220 <160> 1 <170> Kopatentin 2.0 <210> 1 <211> 573 <212> DNA <213> Beauveria bassiana Bb08 <400> 1 tttccgttag ggggtactgc ggagggatca ttaccgagtt ttcaactccc taacccttct 60 gtgaacctac ctatcgttgc ttcggcggac tcgccccagc ccggacgcgg actggaccag 120 cggcccgccg gggacctcaa actcttgtat tccagcatct tctgaatacg ccgcaaggca 180 aaacaaatga atcaaaactt tcaacaacgg atctcttggc tctggcatcg atgaagaacg 240 cagcgaaatg cgataagtaa tgtgaattgc agaatccagt gaatcatcga atctttgaac 300 gcacattgcg cccgccagca ttctggcggg catgcctgtt cgagcgtcat ttcaaccctc 360 gacctcccct tggggaggtc ggcgttgggg accggcagca caccgccggc cctgaaatgg 420 agtggcggcc cgtccgcggc gacctctgcg tagtaataca gctcgcaccg gaaccccgac 480 gcggccacgc cgtaaaacac ccaacttctg aacgttgacc tcgaatcagg taggactacc 540 cgctgaactt aagcatatca tagnccggag gaa 573
Claims (7)
뷰베리아 바시아나(Beauveria bassiana) Bb08(KACC93163P)의 대량배양 방법.
Characterized in that a new microorganism Beauveria bassiana Bb08 (KACC93163P) having a nucleotide sequence of SEQ ID NO: 1 and having an aphid control effect is inoculated in a liquid medium and cultured at 25 DEG C for 3 to 5 days.
Method for mass culture of Beauveria bassiana Bb08 (KACC93163P).
상기 액체배지는 PDB(Potato Dextrose Broth) 배지인 것을 특징으로 하는,
뷰베리아 바시아나(Beauveria bassiana) Bb08(KACC93163P)의 대량배양 방법.
The method according to claim 1,
Characterized in that the liquid medium is a PDB (Potato Dextrose Broth)
Method for mass culture of Beauveria bassiana Bb08 (KACC93163P).
상기 신규 미생물은 꿀벌부채명나방 유충과 토양을 혼합한 다음 10 ~ 14일간 방치하여 토양에 존재할 수 있는 진균에 상기 유충이 감염되도록 한 후, 이 감염된 유충으로부터 분리된 것을 특징으로 하는,
뷰베리아 바시아나(Beauveria bassiana) Bb08(KACC93163P)의 대량배양 방법.The method according to claim 1,
Characterized in that the new microorganism is isolated from the infected larva after allowing the larva to infect fungi that may be present in the soil after 10 to 14 days of mixing with the honeybee larva and the soil,
Method for mass culture of Beauveria bassiana Bb08 (KACC93163P).
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020120140146A KR101444214B1 (en) | 2012-12-05 | 2012-12-05 | COMPOSITION FOR CONTROL OF INSECT USING Beauveria bassiana Bb08 AND ITS CULTURE EXTRACTS |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020120140146A KR101444214B1 (en) | 2012-12-05 | 2012-12-05 | COMPOSITION FOR CONTROL OF INSECT USING Beauveria bassiana Bb08 AND ITS CULTURE EXTRACTS |
Publications (2)
Publication Number | Publication Date |
---|---|
KR20140072528A KR20140072528A (en) | 2014-06-13 |
KR101444214B1 true KR101444214B1 (en) | 2014-11-03 |
Family
ID=51126366
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
KR1020120140146A KR101444214B1 (en) | 2012-12-05 | 2012-12-05 | COMPOSITION FOR CONTROL OF INSECT USING Beauveria bassiana Bb08 AND ITS CULTURE EXTRACTS |
Country Status (1)
Country | Link |
---|---|
KR (1) | KR101444214B1 (en) |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR20200057643A (en) | 2018-11-16 | 2020-05-26 | 경북대학교 산학협력단 | Novel Beauveria bassiana KNU-101 Strain with Improved Insecticidal Effect and Spore Production and Uses thereof |
KR20230097412A (en) | 2021-12-24 | 2023-07-03 | 전북대학교산학협력단 | Composition for controlling sucking pests comprising Beauveria JEF-232 or Beauveria JEF-544 strain |
Families Citing this family (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR101680638B1 (en) * | 2014-06-24 | 2016-12-14 | 대한민국 | New microorganism Beauveria bassiana FG274 and Microbial control agent for the prevention of Spodoptera exigua larva |
KR102342702B1 (en) * | 2020-05-21 | 2021-12-22 | 충북대학교 산학협력단 | Beauveria bassiana JN5R1W1 strain with insecticidal activity of mosquito adults and uses thereof |
CN114015583B (en) * | 2021-11-09 | 2023-08-29 | 吉林省林业科学研究院(吉林省林业生物防治中心站) | Beauveria bassiana and application thereof |
Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR19980026946A (en) * | 1996-10-12 | 1998-07-15 | 박원훈 | Granules for Control of Pine Needle Lump Fly Containing Beauveria sp. |
KR20110084516A (en) * | 2008-10-14 | 2011-07-25 | 그린타이드 리미티드 | Entomopathogenic fungi and uses thereof |
KR101161368B1 (en) * | 2008-12-31 | 2012-07-02 | 수원대학교산학협력단 | Beauveria bassiana KK5 strain and a method for controlling aphid using the same strain |
-
2012
- 2012-12-05 KR KR1020120140146A patent/KR101444214B1/en active IP Right Grant
Patent Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR19980026946A (en) * | 1996-10-12 | 1998-07-15 | 박원훈 | Granules for Control of Pine Needle Lump Fly Containing Beauveria sp. |
KR20110084516A (en) * | 2008-10-14 | 2011-07-25 | 그린타이드 리미티드 | Entomopathogenic fungi and uses thereof |
KR101161368B1 (en) * | 2008-12-31 | 2012-07-02 | 수원대학교산학협력단 | Beauveria bassiana KK5 strain and a method for controlling aphid using the same strain |
Non-Patent Citations (1)
Title |
---|
Journal of Biopesticides (2012) 5, 140-143 * |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR20200057643A (en) | 2018-11-16 | 2020-05-26 | 경북대학교 산학협력단 | Novel Beauveria bassiana KNU-101 Strain with Improved Insecticidal Effect and Spore Production and Uses thereof |
KR20230097412A (en) | 2021-12-24 | 2023-07-03 | 전북대학교산학협력단 | Composition for controlling sucking pests comprising Beauveria JEF-232 or Beauveria JEF-544 strain |
Also Published As
Publication number | Publication date |
---|---|
KR20140072528A (en) | 2014-06-13 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Prabhukarthikeyan et al. | Combination of endophytic Bacillus and Beauveria for the management of Fusarium wilt and fruit borer in tomato | |
KR101836007B1 (en) | Entomopathogenic fungi Metarhizium anisopliae SD4-2 having antimicrobial activities and insectcide | |
KR101785098B1 (en) | Composition for simultaneous control of both aphid and Pythium ultimum using Isaria javanica Pf185 and its culture media | |
MudronÄ ekovà et al. | Entomopathogenic fungus species Beauveria bassiana (Bals.) and Metarhizium anisopliae (Metsch.) used as mycoinsecticide effective in biological control of Ips typographus (L.) | |
KR101974265B1 (en) | Microbial pesticides against thrips | |
KR20160084968A (en) | Beauveria bassiana having insect pathogenicityand agent for prevention of rice vermin using the same | |
KR101444214B1 (en) | COMPOSITION FOR CONTROL OF INSECT USING Beauveria bassiana Bb08 AND ITS CULTURE EXTRACTS | |
KR101680638B1 (en) | New microorganism Beauveria bassiana FG274 and Microbial control agent for the prevention of Spodoptera exigua larva | |
KR100914451B1 (en) | Entomopathogenic Lecanicillium attenuatum CNU-23, and agents and methods for controling green peach aphid using the same | |
KR20180033774A (en) | Entomopathogenic fungus, Beauveria bassiana ANU1 and microbial agent for controlling Spodoptera exigua, Plutella xylostella, Helicoverpa assulta or Phaedon brassicae using it | |
KR101626801B1 (en) | Beauveria bassiana having insect pathogenicityand agent for prevention of rice vermin using the same | |
WO2018194199A1 (en) | Microbial insecticide for control of mulberry thrips | |
WO2014193162A1 (en) | Preparation method for biopesticide using paecilomyces sp. strain | |
KR101773339B1 (en) | Composition for simultaneous control of both aphid, and Pythium ultimum, or Colletotrichum acutatum using Isaria fumosorosea Pf212 and its culture media | |
KR101896932B1 (en) | New microorganism Beauveria bassiana FG317 or microbial control agent comprising for the prevention of Spodoptera litura larva | |
Maniania | Evaluation of three formulations of Beauveria bassiana (Bals.) Vuill. for control of the stem borer Chilo partellus (Swinhoe)(Lep., Pyralidae) | |
US20140212376A1 (en) | Bionematicide composition and method for controlling phytopathogenic nematodes using the same | |
KR102162104B1 (en) | Composition for controlling thrips using Beauveria bassiana JEF-350 and method for preventing thrips using the same | |
KR102126582B1 (en) | Microbial agent for simultaneous control of both Colletotrichum acutatum and Thrips spp. using Isaria javanica FT333 and its culture media | |
Chartier FitzGerald et al. | Screening of entomopathogenic fungi against citrus mealybug, Plannococcus citri (Hemiptera: Pseudococcidae) | |
CN104754945A (en) | Composition comprising nucleic acids of parasitic, pathogenic or weed biological systems for inhibiting and/or controlling the growth of said systems | |
CN107267424B (en) | A kind of process for preparing microbial insecticide | |
KR102207732B1 (en) | Microbial agent for control of Plutella xylostella larva using Metarhizium anisopliae FT319 and its culture media | |
Annamalai et al. | Pathogenicity of Beauveria bassiana (Balsamo) Vuillemin and Lecanicillium lecanii Zimmerman against onion thrips, Thrips tabaci Lindeman | |
KR101680639B1 (en) | New microorganism Isaria fumosorosea FG340 and Microbial control agent for the prevention of Spodoptera exigua larva |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
A201 | Request for examination | ||
E902 | Notification of reason for refusal | ||
E701 | Decision to grant or registration of patent right | ||
GRNT | Written decision to grant |