KR101785098B1 - Composition for simultaneous control of both aphid and Pythium ultimum using Isaria javanica Pf185 and its culture media - Google Patents

Abstract

The present invention relates to a microorganism preparation for simultaneous control of Isaria javanica Pf185 (KACC93241P) or aphids and athlete's germs using the same, and a method for preparing the same, wherein the microorganism according to the present invention is an indigenous microorganism, Since the adaptation is rapid and rapid to exhibit the insecticidal or microbial effect, the microbial agent produced using the strain is excellent in its use as a biocidal pesticide for controlling aphids or alopecia. Since the strain or the microorganism preparation can be used as an environmentally friendly and stable control means, it is useful for increasing the economic value of the planthouse cultivation crops, activating the production of the safe agricultural products and the microbial agent development industry.

Description

Technical Field [0001] The present invention relates to a composition for simultaneous control of aphid and aster pathogenic fungi such as Isaria javanica Pf185 and its culture media,

The present invention relates to a microorganism preparation for simultaneous control of Isaria javanica Pf185 (Pf185, KACC93241P) or aphids and alopecia using the same, and a preparation method thereof.

Aphids are known as insect pests that are very difficult to control due to their high fertility and rapid genetic resistance. Aphids are one of the most damaging crops because they directly feed crops or through which they directly cause damage to the crops as a viral agent and cause secondary soot diseases. In domestic and overseas markets, aphids Many studies and efforts have been made for

Damage caused by aphids accounted for 53.8% (148,279 hectares) of domestic vegetable cultivation area, and 27% of the insecticides sprayed by vegetable growers were sprayed for the control of aphids. Especially, Sales of chemical pesticides are estimated at W230bn, and most of the raw materials are imported, and huge amounts of foreign currency are being spent.

Among the targeted aphids for biological control, peach aphid ( Myzus persicae ) is hosted by peach tree, apricot tree, plum tree, cherry tree, tangerine tree and after mid-May, it is used for summer jujube, cucumber, Which causes growth inhibition damage. The rapid population of 1 year is fertile enough to carry 23 generations, the late population 9 generations, and the life span is about 28.5 days. Cotton aphids ( Aphis gossypii ) have similar lifespan and fertility. In the summer, it is parasitic on perilla, cucumber, pumpkin, watermelon, eggplant, tomatoes, etc. It lays eggs on the cow tree, pomegranate tree, bamboo tree, cotton in late autumn for wintering. On the other hand, researches on microbial pesticides using fungi that invade aphids by contact are active in the control of such jujube aphids. However, existing microbial control agents take long time to contact, germinate, and invade into insecticides, and until the insecticidal effect is exhibited, the effect of control due to environmental influences such as temperature and humidity is uneven, It is hardly known that the use of insect pathogenic fungi has succeeded in the market until now.

It is one of the plant diseases that occurs in the seedling immediately after germination of the crop, and the surface of the seedlings is softened by the needle-like shape, or brown lesion occurs on the surface of the seedlings. It is one kind of wearing disease, but it occurs only in the seedling period, and it is also called myeongryik disease, mossy mildew disease. It occurs in many crops and is caused by Pythium ultimum . Domestic leukemia is difficult to control but its effect is not very high. It is also expensive to control and may cause resistance to drugs when used repeatedly. Since the vegetables that are causing the melancholy are mainly taken directly from the raw materials, the problem of safety against pesticides is continuously being raised from consumers, and the use of chemical pesticides is also avoided, which causes many difficulties in the farmhouse. In addition, the use of chemical pesticides has caused fatal disadvantages that they may become resistant to chemicals over time and environmental risks due to chemical residues have been raised.

Accordingly, the present inventors have made intensive efforts to develop a microbial pesticide that can adapt well to the domestic environment and exhibit rapid insecticidal or microbial effect, including the insect pest pathogenic fungus, and as a result, The isolate Isaria javanica Pf185 was isolated and the present invention was completed.

On the other hand, the prior art of the present invention includes Korean Patent No. 10-1330078, which discloses a strain of Tobacco Paju (KACC93122P), which has a controlling effect against a type of Lai Q, and an insecticidal effect against ticks And US Patent No. 8574566, which is related to a strain ( Isaria fumosorosea CCM 8367 - CCEFO.011.PFR).

A novel insect pathogenic fungus Isaiabanica Pf04 having tobacco control effect on Louis Q type and microbial insecticide for the control of Louis Q type including tobacco containing it, Applicant: Korea, Registration date : 2013.11.11) US Patent No. 8574566 entitled Strain of entomopathogenic fungus Isaria fumosorosea CCM 8367 (CCEFO.011.PFR) and the method for controlling insect and mite pests, Applicant: Biology Center As Cr, VVI et al., Registered on: 2013.11. 05)

It is an object of the present invention to provide a microorganism preparation for the simultaneous control of aphid and algae using Isaria javanica Pf185 strain ( Isaria javanica Pf185, KACC93241P), or a method for producing the same.

The present invention relates to Isaria javanica Pf185 strain (KACC93241P) having an ability to control aphid or Pythium ultimum .

The Isaria Babanica Pf185 strain is characterized in that it has the ability to simultaneously control aphids and athlete's foot.

The present invention also provides a microorganism preparation for controlling aphid or Staphylococcus aureus containing the microorganism strains of the Esaria Japonica Pf185 strain or a culture thereof as an active ingredient.

Accordingly, the present invention provides a method for culturing the Isaria babanica Pf185 strain, and a method for controlling aphid or Staphylococcus aureus by treating a plant with a microorganism preparation containing the microorganism or culture medium of the Isaria babanica Pf185 strain .

Hereinafter, the present invention will be described in detail.

The present invention relates to Isaria javanica Pf185 (KACC93241P) having an ability to control aphid or Pythium ultimum , wherein the microorganism preparation containing the strain or a culture thereof, It can be used as an agent for controlling germs.

The culture solution may preferably be a culture solution obtained by inoculating a microbial culture with Isaria Babacanza Pf185 strain. Examples of the microorganism medium include PDA (potato dextrose agar), PDA (potato dextrose broth), SDA (sabouraud dextrose agar), SDAY (sabouraud dextrose agar with yeast extract), AD adamek's media liquid medium, AD solid medium and the like can be used. Preferably, AD fluid medium or PDA can be used.

The PDA may be prepared by mixing 4 g / l potato starch, 20 g / l dextrose and 15 g / l agar, but is not limited thereto. PDB is a liquid medium prepared without mixing agar in PDA. AD liquid medium can be prepared by modifying the basic composition of Adameks media and mixing 20g / l glucose, 20g / l yeast extract and 30g / l corn steep liquor. AD solid medium can be prepared by mixing 15 g / l agar in the AD liquid medium. SDA can be prepared by mixing 40 g / lextrose, 10 g / l mycological peptone and 15 g / l agar. SDAY can be prepared by mixing SDA with 10 g / L yeast extract.

When the culture solution is used as a microorganism preparation, it may be used after cultivation of Isaiabanica Pf185 strain, or may be used in the presence of cells of Isaiabanica Pf185 strain, or in a culture filtrate from which cells are removed.

The method of culturing the isolia babaca Pf185 strain comprises the steps of: (a) inoculating a spore of Isaria babanica Pf185 in a microorganism medium; And (b) culturing the inoculum at 25 to 30 DEG C for 7 to 20 days. Preferably, the microorganism medium of step (a) may be an AD medium or a PDA. When inoculated moving Ria Java NIKA Pf185 strain in step (a) above, the initial inoculation concentration are preferably may be ^{5 ~ 5x10 6 conidia / ㎖ 5x10} , may be more preferably 1x10 ⁶ conidia / ㎖. The step (b) may further include removing the cells from the culture solution. Therefore, the microorganism preparation of the present invention containing the culture medium of the Isaiabanica Pf185 strain can be produced through the above culture method.

The aphid which can be controlled by the strain of the present invention, the culture solution thereof, and the microorganism preparation containing the same can include peach aphid, aphid, cotton aphid, mandarin aphid, Aphid or peach aphid, but the aphid is not limited thereto.

The term " culture broth " in the present invention refers to a culture broth obtained by inoculating a spore of a certain concentration into a medium suitable for microorganism growth, inducing the microorganism to grow for a predetermined period of time in an incubator, It is a liquid mixed with necessary nutrients and can be produced by further filtering the impurities using a filtration process. In addition, the 'culture filtrate' may be one which contains the nutrients necessary for growth and the secreted substances by removing the cells through centrifugation or filtration in the culture broth. A paper filter is preferably used for the filtration process, and a Whatman No. 2 filter paper may be used as the paper filter, but the present invention is not limited thereto.

The term " control " of the present invention generally includes preventing, reducing or eradicating plant pathogenic infections, wherein the prevention or reduction in infection means that there is a statistically significant difference for untreated host plants.

The microorganism preparation for controlling aphid or Staphylococcus aureus according to the present invention can be used for controlling a physiological condition of a plant, an insect species, an infection level and concentration of a pathogen, season, humidity, age and growth stage of a plant, Can be considered.

Isaria babanica Pf185 contained in the microorganism preparation for controlling aphid or Staphylococcus aureus of the present invention should be in a viable state, and may be a mycelial and spore-shaped microorganism.

The term "insect pathogenicity" of the present invention is an insect pathogenic strain. When the fungus, that is, the spore of the fungus attaches to the outer surface of the host insect and germinates, the chitinase, the protease, Lipase, esterase and the like to penetrate the cuticle layer of the insect and penetrate the insect, and then to propagate in the insect body to produce a toxic substance to kill the host insect. Effect '.

The microorganism preparation prepared by cultivating Isaiabanica Pf185 strain of the present invention can be prepared using solid or liquid culture techniques. The incubation temperature of the Isaiabanica Pf185 strain is 10 to 30 ° C, preferably 25 to 30 ° C, 30 ° C. More preferably 7 to 20 days, more preferably 10 to 15 days, and most preferably 15 days to obtain a culture medium or culture.

The microbial formulations of the present invention may comprise an agriculturally acceptable carrier and may be formulated as fillers, solvents, excipients, surfactants, suspending agents, spreaders, adhesives, ), Defoamers, dispersants, wetting agents, drift reducitng agents, suxiliaries, adjuvants or mixtures thereof.

The microbial formulation of the present invention can be formulated into concentrate, solution, spray, aerosol, immersion baths, dips, emulsions, suspension concentrates, gels, granules and the like.

The microbial formulation of the present invention can be used as a microbial agent for the treatment or prevention of diseases caused by the above-mentioned microbial agent or other agricultural agent, pesticides, insecticides, acaracides, fungicides (fungicides harmless to the fungi of the present invention) Antimicrobials, nematocides, rodenticides, entomopathogens, pheromones, attractants, plant growth regulators, plant hormones, plant growth regulators, In combination with insect growth regulators, chemosterilants, microbial pest control agents, repellents, viruses, phagostimulents, plant nutrients, plant fertilizers, and biological control agents And specific examples thereof are obvious to those of ordinary skill in the art and can be easily obtained.

The present invention relates to a microorganism preparation for simultaneous control of Isaria javanica Pf185 (KACC93241P) or aphids and athlete's germs using the same, and a method for preparing the same, wherein the microorganism according to the present invention is an indigenous microorganism, Adaptation is fast and exhibits rapid insecticidal or fungicidal effects. Therefore, the microorganism preparation prepared using the strain can be used as a biocidal pesticide having an excellent control effect against aphid or melancholic disease. In addition, since the strain or the microorganism preparation can be used as an environmentally friendly and stable control means, it is useful for enhancing the economic value of a planthouse cultivated crop, increasing the production of safe agricultural products, and activating the development industry of a microbial agent. Korean Patent No. 10-1330078, which is a prior art document, discloses a Esaria Japonica Pf04 strain (KACC93122P) in which tobacco has a controlling effect on the Louis Q type. However, the strain of the above prior art is a strain of 16S rRNA The gene sequence is completely different, and the detailed description of the preceding literature does not disclose that the strain of Isaria javanica species has the controlling effect of aphids and glazes. In addition, although it has been disclosed that the insecticidal effect of Isaria fumosorosea CCM 8367 - CCEFO.011.PFR on the mites is disclosed in U.S. Patent No. 8574566, the above strain is not only different from the strain of the present invention, It is not disclosed in the detailed description of U.S. Patent No. 8574566 as to the effect of controlling the strain of L. genus in the control of aphid or Staphylococcus aureus as in the present invention.

Brief Description of the Drawings Fig. 1 is a graph showing the aphid kill rate of a spore suspension diluted with Isaria javanica Pf185 (KACC93241P) of the Isaria javanica Pf185 strain of the present invention. In the sample display of FIG. 1, 'Pf185 (10 * 8)' represents 1 × 10 ⁸ conidia / ml of spore suspension diluted with Isaiah Babanica Pf185 strain, 'Pf185 (10 * 7)' is a spore suspension of Isaria babanica Pf185 ¹ × 10 ⁷ conidia / ㎖ of suspensions diluted solution, and 'Pf185 (10 * 6)' represents 1 × 10 ⁶ conidia / ㎖ of spore suspension diluted with Isaiahabanica Pf185, and D1 to D5 were 1 to 5 days Lt; / RTI > 1A also shows the insecticidal rate against peach aphid, and Fig. 1B shows the insecticidal rate against cotton aphid.
FIG. 2 is a graph showing the aphid kill rate of liquid cultures of Isaria javanica Pf185 (KACC93241P), Isaria javanica Pf185 according to the present invention. In the sample display of FIG. 2, 'Pf185 (10 * 8)' represents 1x10 ⁸ conidia / ml of culture solution diluted with Isaiabanica Pf185 strain and 'Pf185 (10x7)' represents a culture dilution solution of Isaiabanica Pf185 1 × 10 ⁷ conidia / ㎖ administration group, and 'Pf185 (10 * 6)' represents 1 × 10 ⁶ conidia / ㎖ of culture solution of Isaiah Babanica Pf185 strain and D1 to D5 are the days of 1 to 5 days . Fig. 2A also shows the insecticidal rate against peach aphid, and Fig. 2B shows the insecticidal rate against cotton aphid.
3 is a photograph showing the antimicrobial effect of Isaria javanica Pf185, KACC93241P against Pythium ultimum of the present invention (the AD liquid medium of Isaria javanica Pf185 strain) Confirmed by culturing on PDA medium with gill gills).

The present invention will be described more specifically with reference to the following examples. However, the following examples are provided to aid understanding of the present invention, and the scope of the present invention is not limited by these examples in any sense. Hereinafter, the technical and scientific terms used herein will be understood by those skilled in the art without departing from the scope of the present invention. Descriptions of known functions and configurations that may be unnecessarily blurred are omitted.

≪ Example 1 > From the soil Isaiah Jacanica Isolation and Identification of Pf185 Strain>

Example 1-1. Isolation of strain from soil

Galleria mellonella larvae were placed in the soil collected from the hills around the farmland and allowed to remain in the soil for 14 days to infect the fungi present in the soil. The infected larvae were selected, and an artificial medium, PDA (Potato Dextrose Agar) were used to isolate pure strains. The strains of pure isolates were preserved using the freeze-drying method, and strains having a large antimicrobial activity among the strains were selected (assayed by the methods of Examples 2 and 3) Type.

Examples 1-2. Identification of strains isolated from soil

The morphological characteristics of the strains having the greatest antimicrobial activity among the pure fungi isolated from soil in accordance with the method of Example 1-1 were observed by a microscope and ITS analysis was carried out by extracting the DNA of the strains (Note: Xenocell). As a result, it was finally confirmed that the strain had 100% of the genetic information with Isaria javanica and had the DNA sequence of the 16S rRNA gene of SEQ ID NO: 1 below. Thus, Isaria javanica Pf185 (KACC93241P ).

DNA sequence of 16S rRNA gene - SEQ ID NO: 1:

CTGCGGAGGGATCATTAACGAGTTTTTTCAACTCCCTAACCCTTTGTGAACATACCTATCGTTGCTTCGGCGGACTCGCCCCGGCGTCCGGACGGCCCTGCGCCGCCCGCGACCCGGACCCAGGCGGCCGCCGGAGACCCACAAATTCTGTTTCTATCAGTCTTTCTGAATCCGCCGCAAGGCAAAACAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGACACCCCTTCGGGGGAGTCGGCGTTGGGGACCGGCAGCATACCGCCGGCCCCGAAATACAGTGGCGGCCCGTCCGCGGCGACCTCTGCGTAGTACTCCAACGCGCACCGGGAACCCGACGCGGCCACGCCGTAAAACACCCAACTTCTGAACGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATAT

On the other hand, it is confirmed that the Esaria babanica Pf185 strain has the following biological properties.

The minimum growth temperature of Isaiabanica Pf185 strain is 5 ° C, and the maximum growth temperature is 38 ° C. The preferable growth or culture temperature is 10 to 30 캜, more preferably 25 to 30 캜. The preferred incubation time for best maintaining the activity of the strain is 7 to 20 days, more preferably 10 to 15 days, and most preferably 15 days. Also, it is possible to grow in the range of pH 4 ~ 13, and optimum pH is 5 ~ 6. The strain is inoculated into a PDA, and when cultured for 10 to 15 days, it becomes white, gradually becoming milky white.

Example 2. Identification of aphid control effect of Isaia babanica Pf185 strain < RTI ID = 0.0 >

Example 2-1. Insecticidal rate of peach aphid and cotton aphid in PDA cultured spores

As shown in Example 1, The Pf185 strain was inoculated into the PDA medium and cultured at 25 DEG C for 14 days. The spores formed were cultured in sterilized 0.05% Tween 80 solution to prepare spore suspension. The spore suspension was counted using a hemocytometer to dilute the spores to a concentration of 1 × 10 ⁶ , 1 × 10 ⁷ , and 1 × ^{10 8} conidia / ml, respectively. Next, the 2nd and 4th instar larvae of Myzus persicae and Aphis gossypii were transferred to a 5 cm diameter Chinese cabbage and cucumber leaves in a Petri dish (diameter 5.5 cm) using a brush , And 1 ml of the diluted solution of the spore suspension was sprayed using an atomizer. Thereafter, the viability of the aphid by the respective dates was investigated while keeping the petridish containing the nymph on a plastic cage maintaining the humidity of 80 to 90% at 25 DEG C, and the result is shown in FIG. In the sample display of FIG. 1, 'Pf185 (10 * 8)' represents 1 × 10 ⁸ conidia / ml of spore suspension diluted with Isaiah Babanica Pf185 strain, 'Pf185 (10 * 7)' is a spore suspension of Isaria babanica Pf185 ¹ × 10 ⁷ conidia / ㎖ of suspensions diluted solution, and 'Pf185 (10 * 6)' represents 1 × 10 ⁶ conidia / ㎖ of spore suspension diluted with Isaiahabanica Pf185, and D1 to D5 were 1 to 5 days Lt; / RTI &gt; 1A also shows the insecticidal rate against peach aphid, and Fig. 1B shows the insecticidal rate against cotton aphid.

Referring to FIG. 1, when the spore suspension diluted with Isaiabanica Pf185 strain of the present invention was treated, it was confirmed that the insecticidal rate of peach aphid and cotton aphid was very excellent as compared to the control.

Example 2-2. Insecticidal rate of peach aphid and cotton aphid in AD medium

As shown in Example 1, The Pf185 strain was inoculated into the PDA medium and cultured at 25 ° C for 14 days. The spores formed were inoculated into 100 ml (1x10 ⁶ conidia / ml) of the AD liquid medium. Thereafter, the culture solution was collected at 3 days from the start date of the culture while being cultured under conditions of 25 캜 and 200 rpm, and used for the experiment. The collected strains were diluted with the medium before culturing to give a concentration of 1 × 10 ⁶ , 1 × 10 ⁷ , and 1 × ^{10 8} conidia / ml, and 1 ml of each of these dilutions was used for testing aphid control ability. Next, the 2nd and 4th instar larvae of the peach aphid and cotton aphid were transferred to a 5cm diameter Chinese cabbage and cucumber leaf slices in a Petri dish (5.5 cm in diameter) using a brush and 1 ml of the diluted solution of each culture Lt; / RTI &gt; Thereafter, viability of the aphid by the respective dates was investigated while keeping the petridish containing the above-mentioned nymph on a plastic cage maintaining the humidity of 80 to 90% at 25 캜, and it is shown in Fig. In the sample display of FIG. 2, 'Pf185 (10 * 8)' represents 1x10 ⁸ conidia / ml of culture solution diluted with Isaiabanica Pf185 strain and 'Pf185 (10x7)' represents a culture dilution solution of Isaiabanica Pf185 1 × 10 ⁷ conidia / ㎖ administration group, and 'Pf185 (10 * 6)' represents 1 × 10 ⁶ conidia / ㎖ of culture solution of Isaiah Babanica Pf185 strain and D1 to D5 are the days of 1 to 5 days . Fig. 2A also shows the insecticidal rate against peach aphid, and Fig. 2B shows the insecticidal rate against cotton aphid.

Referring to FIG. 2, When the culture of Pf185 strain was treated, the insecticidal rate of peach aphid and cotton aphid was significantly higher than that of control.

&Lt; Example 3: Effect of controlling Escherichia japonica Pf185 strains &lt; RTI ID = 0.0 &gt;

In the present invention, Pf185 strains were found to be effective against Pythium ultimum .

Isaria babanica incubated in PDA medium for 3 days The antimicrobial activity of the strain Pf185 and the fungus (diameter 0.7 cm) were observed at 2 cm intervals in a new PDA medium for 7 days. In addition, Isaiazabanica incubated in AD liquid medium for 3 days The antimicrobial activity of Pf185 strain (1x10 ⁶ conidia / ㎖) was examined by incubating for 7 days at 2 cm intervals in a new PDA medium. .

As shown in the following Table 1 and FIG. 3 through the above experiment, It can be seen that the Pf185 strain has a very excellent control effect against glazed germs.

Antimicrobial strain Zone of inhibition (mm) Cultured in PDA medium
The antimicrobial activity was confirmed on the PDA medium It was cultured in AD liquid medium and the antimicrobial activity was confirmed in the PDA medium The
Isaiah Babanika Pf185 4.9 ± 0.4 5.4 ± 0.3
[Figure 3]

National Institute of Agricultural Science KACC93241P 20151102

<110> REPUBLIC OF KOREA (MANAGEMENT: RURAL DEVELOPMENT ADMINISTRATION) <120> Composition for simultaneous control of both aphid and Pythium          ultimum using Isaria javanica Pf185 and its culture media <130> P2015-0236 <160> 1 <170> Kopatentin 2.0 <210> 1 <211> 562 <212> DNA <213> Isaria javanica <400> 1 ctgcggaggg atcattaacg agttttttca actccctaac cctttgtgaa catacctatc 60 gttgcttcgg cggactcgcc ccggcgtccg gacggccctg cgccgcccgc gacccggacc 120 caggcggccg ccggagaccc acaaattctg tttctatcag tctttctgaa tccgccgcaa 180 ggcaaaacaa atgaatcaaa actttcaaca acggatctct tggttctggc atcgatgaag 240 aacgcagcga aatgcgataa gtaatgtgaa ttgcagaatt cagtgaatca tcgaatcttt 300 gaacgcacat tgcgcccgcc agcattctgg cgggcatgcc tgttcgagcg tcatttcaac 360 cctcgacacc ccttcggggg agtcggcgtt ggggaccggc agcataccgc cggccccgaa 420 atacagtggc ggcccgtccg cggcgacctc tgcgtagtac tccaacgcgc accgggaacc 480 cgacgcggcc acgccgtaaa acacccaact tctgaacgtt gacctcggat caggtaggac 540 tacccgctga acttaagcat at 562

Claims (5)

Isaria javanica Pf185 (KACC93241P) with simultaneous control ability of aphid and Pythium ultimum . delete A microorganism preparation for simultaneous control of aphid and Pythium ultimum , which comprises the cells of Isaria javanica Pf185, KACC93241P or the culture thereof as an active ingredient. (a) inoculating the microorganism medium with the spores of the strain of Isaria javanica Pf185 (KACC93241P) of claim 1; And (b) culturing the inoculating liquid at 25 to 30 DEG C for 7 to 20 days, wherein the strain of Isaria babanica Pf185 is cultured. A method for treating aphid and Pythium ultimum simultaneously by treating the microorganism preparation of claim 3 with a plant.

Images