CN106520782A

CN106520782A - Application of gene GmRAV1 related to photoperiod adjusting and controlling of soybean

Info

Publication number: CN106520782A
Application number: CN201611023119.6A
Authority: CN
Inventors: 李文滨; 赵琳; 张可欣
Original assignee: Northeast Agricultural University
Current assignee: Northeast Agricultural University
Priority date: 2016-11-20
Filing date: 2016-11-20
Publication date: 2017-03-22

Abstract

The invention discloses application of a gene GmRAV1 related to photoperiod adjusting and controlling of a soybean, and belongs to the technical field of plant genetic engineering. The nucleotide sequence of the soybean gene GmRAV1 is shown in SEQ ID NO.1, encoded protein is shown in SEQ ID NO.2. The soybean gene GmRAV1 can be used in processes of adjusting plant photoperiod sensitivity and promoting shoot regeneration in plants. By overexpressing the gene GmRAV1 of the soybean, shoot regeneration in plants is promoted; meanwhile, by silencing and interfering the expression of the gene GmRAV1 of the soybean, plant photoperiod sensitivity, plant height, bloom maturation period are changed, and the plant photoperiod sensitivity is lowered. The gene GmRAV1 of soybean can be applicable to cultivation and improvement of a new eurytopicity product with precocity and photoperiod insensitivity, solve the problem of flowering asynchronism in crossbreeding, breeding period controlling problem, photoperiod sensitivity problem and introduction problem of various crops, vegetables, fruit, and flowers.

Description

A kind of application with Semen sojae atricolor Photoperiod related gene GmRAV1

Technical field

The present invention relates to a kind of and Semen sojae atricolor Photoperiod related gene GmRAV1 application, belongs to plant genetic engineering skill Art field.

Background technology

In general, its growth promoter is very quick to photoperiodical reaction as plants such as Semen sojae atricolor, Oryza sativa L. to belong to short-day plant Sense, this characteristic seriously hinder the adaptability of soybean varieties, limit soybean planting scope, affect effective performance of yield level. Generally shorten the flowering of plant such as sunshine-duration promotion Semen sojae atricolor, Oryza sativa L., reduction in the life period.The contrary increase sunshine-duration suppresses Semen sojae atricolor to open Flower, period of duration extend.Therefore, meeting hasting of maturity is introduced a fine variety by north orientation south (sunshine-duration is shortened by length between period of duration), period of duration becomes It is short, yield reduction, the performance of character of limiting output.Conversely, introducing a fine variety from south to north, period of duration can be extended, it is impossible to normal mature.This One characteristic seriously hinders the transregional plantation of soybean varieties and other plant varieties sensitive to photoperiodical reaction, such as soybean varieties Subject range is narrower, and kind should not be significantly adjusted in north and south, and the variety type for needing numerous photoperiodical reactions different is adapted to respectively A variety of ecological conditions, therefore change the photoperiod sensitivity of the plant as Semen sojae atricolor to these plant species improvements ten Divide important.

According to blooming and maturation time at least 7 gene locus impact Semen sojae atricolor is reported, these gene locus are referred to as into E Series, in Semen sojae atricolor, most of dominant E allele are to long-day photoperiod-sensitive and suppress to bloom, under natural lighting length, Dominant allele postpones bloom (Cober et al., 1996a) to some extent.The E allele of Semen sojae atricolor seems and intends south Stable phytochrome gene phyB, the phyD and phyE functional similarity of light of suppression approach of blooming under the conditions of short-day is participated in mustard (Devlin et al.,1998).The character of the photoperiod sensitivity control flowering time and maturation of Semen sojae atricolor may be by main effect QTL Control and several minor effect QTL are modified.There are 10 soybean blossoming chronogeometries to be positioned at (Tasma and on linkage map Shoemaker, 2003), including 4 photoperiod related genes (PHYA, PHYB, CRY2 and CCA1), 5 flowering time bases Because of (FCA, DET1, COL1, COL2 and LD) and 1 floral meristem characteristic gene (AP2).

In existing conventional breeding, by cross selection early-maturing variety or late variety, or by radiation and chemical reagent Carry out longer the time required to the conventional methods such as mutation carry out breed improvement, and the degree that is mutated during offspring can not be expected or direction Weakness, it is a kind of especially effective and simple and reliable side for traditional method that breed improvement is carried out with these genes Method.

On the other hand, the Study on Genetic Transformation of Semen sojae atricolor is subject to the most attention of countries in the world, soyabean tissue's culture to have certain Difficulty, be the crop of generally acknowledged difficult conversion, its main cause be it is difficult from the cell or tissue differentiation and regeneration plant of conversion, to the greatest extent The many researcheres of pipe are devoted to the conversion system for optimizing Semen sojae atricolor, but the frequency of transformation of soybean is still very low, is limited by genotype, Repeatability is very poor.It is the prerequisite for realizing gene transformation to set up good receptor system.Therefore, identify new Semen sojae atricolor shoot regeneration Related gene, improves the transformation efficiency of different genotype soybean kind by transgenic method, formulates the soybean varieties of high regeneration, So as to the genetic transformation efficiency for improving Semen sojae atricolor is another important goal of breeding.Meanwhile, the plant type for controlling plant is also Semen sojae atricolor The key factor of yield is designed in breeding.But lack the method for being capable of effective control plant plant type in prior art.

The content of the invention

To solve the above problems, the invention provides a kind of Semen sojae atricolor GmRAV1 genes are in control plant growth period and grow The application of journey, the technical scheme taken are as follows：

Gene provided by the present invention and protein, are named as GmRAV1, from Semen sojae atricolor (Glycine max (L.) Merrill.) eastern agriculture 42.The gene order (GmRAV1) is proceeded to into Semen sojae atricolor to be improved or other dicotyledons and unifacial leaf In plant, gene silencing is carried out, plant is tall and big to go out plant performance, and branch is more, and leaf color is dark green, the increase of stem spacing, early blossoming are early It is ripe, the feature that the photoperiod is insensitive or photoperiod sensitivity is reduced；Or make gene overexpression show adventitious shoot regeneration ability Enhanced feature, and the new varieties of the eurytopicity or regeneration capacity that this method is used for cultivate and improve plant.

It is an object of the invention to provide application of the Semen sojae atricolor GmRAV1 genes in control plant growth period and growth course.

The GmRAV1 genes, nucleotide sequence as shown in SEQ ID NO.1, the aminoacid sequence of coding region encoding proteins As shown in SEQ ID NO.2.

Preferably, the application is specifically in the application during control plant photoperiod sensitivity.

Preferably, after the application is by GmRAV1 gene transferred plant cells, by the expression of silence GmRAV1 gene To adjust the photoperiod sensitivity of control plant.

The step of application, is as follows：

1) expression vector is interfered to enter with plant RNA i the fragment of the coding region containing GmRAV1 genes or promoter sequence Row connection, builds plant RNA i expression vectors；

2) by step 1) obtained by plant RNA i expression vectors be transferred in plant cell, obtain plant RNA i expression vectors Cell；

3) screen step 2) in gained plant RNA i expression vectors cell in expression silencing transformed cells, cultivate simultaneously Acquisition turns the plant of GmRAV1 genes.

Preferably, step 1) the GmRAV1 genes coding region, nucleotides sequence sequence be SEQ ID NO.1 in 270- 1421；The promoter, is CaMSV35 promoteres.

Preferably, another application process is the application during plant adventitious shoot regeneration ability is strengthened.

Preferably, above-mentioned application is, by GmRAV1 gene transferred plant cells, to be strengthened by overexpression GmRAV1 genes The adventitious bud energy for growth of plant.

The step of application, is as follows：

1) coding region sequence containing GmRAV1 genes and expression vector are attached, build plant expression vector；

2) by step 1) obtained by plant expression vector be transferred in plant cell, obtain the plant containing plant expression vector Thing cell；

3) screen step 2) obtained by plant cell, cultivate and obtain the plant of overexpression GmRAV1 genes.

Preferably, the overexpression, is to add the basic element of cell division outside and promote GmRAV1 genes under long-day conditions Overexpression.

Preferably, another application process is the application during control plant plant type.

Preferably, it is as follows the step of above-mentioned application process：

1) GmRAV1 genes are transferred in plant and are obtained, turn GmRAV1 gene plants；

2) usage amount by adjusting the expression and Epibrassinolide epiBL of GmRAV1 genes adjusts the strain of plant Type.

It is highly preferred that the usage amount of the Epibrassinolide epiBL, the addition in MS solid mediums is 10mmol/L。

In the method for the invention, plant expression vector is built as genes of interest using GmRAV1 genes, wherein can With any promoter such as cauliflower mosaic viruses (CaMV) 35S promoter, Ubiquitin promoteres or other startups Son, may include enhancer, whether transcriptional enhancer or translational enhancer if necessary in the expression vector.Expression vector used Ti-plasmids, Ri plasmids, plant viral vector etc. can be used.Method for transformation may include agrobacterium-mediated transformation, particle bombardment, pollen tube Passage method or other methods.

In the method for the invention, plant RNA i carrier is built as genes of interest using GmRAV1 genes, it is used Expression vector can use Ti-plasmids, Ri plasmids, plant viral vector etc..Method for transformation may include agrobacterium-mediated transformation, particle gun Method, pollen tube passage method or other methods.

The recipient plant of the GmRAV1 genes of the present invention includes unifacial leaf and dicotyledon, such as Oryza sativa L., Semen Tritici aestivi, jade Rice, Semen sojae atricolor, Cotton Gossypii, vegetable etc., for suppressing expression to improve crop yield and accelerating crop maturity, or are used for RNAi gene silencings Reduce plant photoperiod sensitivity.

The invention provides the photoperiod control flowering time GmRAV1 gene related to the character of maturation in identification Semen sojae atricolor And while determine the method which kind of effect the gene plays in the growth and development process of Soybean Root, stem and leaf.

What the present invention was obtained has the beneficial effect that：

((network address is Plant Genome data base phytozome the GmRAV1 genes that the present invention is provided：https:// Phytozome.jgi.doe.gov/pz/portal.html accession number) is Glyma01g22260.1) and albumen not only can be with Applied in Plant Light periodic process is adjusted, while inventor also has found first, by overexpression, the gene can strengthen The shoot regeneration ability of plant, improves the division regeneration capacity of plant.GmRAV-i (GmRAV gene silencings) Semen sojae atricolor under LD and SD Plant is substantially tall and big compared with the control for plant, and stem is thin and delicate, and interval is big, and joint number is more or less the same, and root is short, and blade is little, illustrates the base Because the development to stem has inhibitory action, under LD and SD, the plant pair photoperiod is quick compared with the control for arabidopsiss rav mutant plants Perceptual substantially to reduce, under SD with LD, flowering time is similar, and arabidopsiss rav mutant plants are opened under LD and SD compared with the control Hua Zao.

The invention provides LD induces expression of the gene in soybean leaves compared with SD, so that Semen sojae atricolor is in long day Rise according to the gene abundance in lower these nutrition organs inhibits the growth of its leaf and stem so that Semen sojae atricolor present leaf dark green and Greatly, the feature of root length, reacts as the expression of GmRAV1 in blade is long to day, and the abundance of GmRAV1mRNA compares SD under LD Lower height, LD promote the expression of GmRAV1 and suppress soybean blossoming, and SD suppresses the expression of GmRAV1 and promotes soybean blossoming.

The invention provides the gene is the basic element of cell division (6-BA, 2-ip etc.) and promoting cell division, suppressing root and lower embryo Promotive factor in elongate axis approach, the basic element of cell division promote the gene expression, add the basic element of cell division, turn the plant of GmRAV1 genes The Amplitude Ratio control that strain hypocotyls and root shorten is big, and growth fraction control is slow, and leaf dark green, branch are more, show the expression of GmRAV1 The effect of the basic element of cell division is enhanced, and external source applies the basic element of cell division and GmRAV-i genetically engineered soybeans caused to the basic element of cell division Response is insensitive, and the amplitude that genetically engineered soybean plant height increases substantially less than compares the amplitude that Semen sojae atricolor plant height increases.

Description of the drawings

Fig. 1 is to carry out Multiple sequence alignments by GmRAV1 genes and homologous base in plant using ClustalX (1.83) software Because of aminoacid sequence comparative result.

Fig. 2 Real-time RT-PCR analysis GmRAV1 Tissue-specific expression changes；

(wherein, black post represents short-day, and Bai Zhu represents the long-day).

Fig. 3 Real-time RT-PCR analysis the long-day (16h/8h light darks) (LD), short-day (8h/16h light darks) (SD) under in DN42 Semen sojae atricolor GmRAV1 genes biological clock circadian rhythm expression rule；

(in figure, it is a) expression analysis of Semen sojae atricolor GmRAV1 genes gene under LD and SD, the b) LD48h of GmRAV1 genes After be transferred to LL (continuous illumination) rhythm and pace of moving things expression, c) be transferred to after the LD48h of GmRAV1 genes DD (continuous darkness) rhythm and pace of moving things expression, D) expression of LL (continuous illumination) rhythm and pace of moving things is transferred to after the SD48h of GmRAV1 genes, e) DD is transferred to after the SD48h of GmRAV1 genes (continuous darkness) rhythm and pace of moving things is expressed).

The plasmid map of Fig. 4 plant expression vector pCAMBIA3301-GmRAV1.

The plasmid map of Fig. 5 plant expression vector pJawoh18-GmRAV1.

DN50, GmRAV1-ox, GmRAV-i Semen sojae atricolor that Fig. 6 long-day (16h/8h light darks) (LD) sows in soil 45 days Seedling.

The growing state of the big bean seedlings of DN42, GmRAV-i and X DN42 under Fig. 7 difference sunshine conditions；

A () long-day (16h/8h light darks) (LD) (SD) sows 1 month in soil with short-day (8h/16h light darks) The big bean seedlings of DN50 and GmRAV-i；(b) long-day (16h/8h light darks) (LD) and short-day (8h/16h light darks) (SD) sow in The DN42 of 1 month and the big bean seedlings of GmRAV-i, X DN42 in soil.

The big bean seedlings of Northeast Agricultural University of Fig. 8 Harbin Cities transgenic base plantation.

Fig. 9 applies the regeneration situation that variable concentrations growth separates different plant cells after element；

A () is to B₅In culture medium external source apply variable concentrations basic element of cell division 6-BA after 3 kinds of Semen sojae atricolor regeneration situation； The regeneration situation of (b) to 4 kinds of arabidopsiss after the basic element of cell division 2-ip of external source applying variable concentrations in MS culture medium.

The growing state of the different cell separation extract plant roots of Figure 10 additions；

A () applies 3 kinds of Soybean Roots and hypocotylar after the basic element of cell division 6-BA of variable concentrations to external source in B5 medium Growing state；B () applies 3 kinds of Soybean Roots and hypocotylar after the basic element of cell division 6-BA of variable concentrations to external source in B5 medium Depth map；；The arabidopsiss of (c) to 4 kinds of vertical cultures after the basic element of cell division 6-BA of external source applying variable concentrations in MS culture medium The long situation of root；The plans south of (d) to 4 kinds of vertical cultures after the basic element of cell division 6-BA of external source applying variable concentrations in MS culture medium The long cartogram of root of mustard.

Figure 11 Real-time RT-PCR analysis external sources apply 6-BA (100 μm of ol 6-BA) and do not apply 6-BA (0 μm of ol The expression rule of GmRAV1 genes in DN42 Semen sojae atricolor 6-BA).

Figure 12 applies impacts of the variable concentrations epiBL to plant plumular axis length；

(a) long-day (16h/8h light darks) (LD) under in MS culture medium apply variable concentrations epiBL after Col-0, The actual growing state of rav, GmRAV1-ox arabidopsiss；(b) long-day (16h/8h light darks) (LD) under apply in MS culture medium Plus the hypocotyl length bar diagram of Col-0, rav, GmRAV1-ox arabidopsiss after the epiBL of variable concentrations.

Specific embodiment

With reference to specific embodiment, the present invention will be further described, but the present invention should not be limited by the examples.

Material therefor, reagent, instrument and method in following examples, without specified otherwise, the routine being in this area Material, reagent, instrument and method, can be obtained by commercial channel.

Embodiment 1：The Cloned culturing of GmRAV1 genes

CDNA is obtained as template reverse transcription with soybean leaves transcription RNA, with the cDNA as PCR reaction template, total length is obtained The gene DNA sequence in ORF areas.The GmRAV1 transcription factor DNA total orders that the Semen sojae atricolor speculates are classified as 1757bp, and ORF is 1155bp, compile 384 aminoacid of code, containing AP2/B3 domains (see 270-1421 positions in sequence table SEQ ID NO.1), sequence is in plant (network address is genome database phytozome：https://phytozome.jgi.doe.gov/pz/portal.html) Accession number is Glyma01g22260.1.Sequence alignment discovery (Fig. 1), the sequence and Kidney bean (Phaseolus Vulgaris) (XM_007143739), M. truncatula (Medicago truncatula) (XM_003591774) RAV1 homologys Respectively 50.20% and 42.34%, (NM_001148270) homology is 47.07% with Semen Maydiss (Zea mays).

Embodiment 2：Day is long and shadow of the biological clock circadian rhythm to GmRAV1 gene expressions for Real-time RT-PCR analyses Ring

Semen sojae atricolor DN42 is incubated at 25 DEG C of illumination box, 250mol m^-2sec^-1White light, long-day (16h/8h light darks) (LD) grow after seedling the 20th day (being set to 0d) under the conditions of, a part be transferred to short-day (SD) under the photoperiod (8h/16h light/ Secretly) grow, it is to be transferred after 0,3,6,9,12,15,18,21,24d, while draw materials to LD and SD blades, liquid nitrogen flash freezer, -80 DEG C Preserve, extract RNA, quantitative fluorescent PCR reaction is carried out according to the program of SYBR (R) ExScriptTM RT-PCR Kit.GmRAV1 Am-plified fragments are 144bp, and Semen sojae atricolor house-keeping gene Actin4 (AF049106) am-plified fragments are 214bp, and its primer is as follows：GmRAV1 Sense primer：GGTGTAGTGGCATAGTGGC, antisense primer：

TAAGAAGGGGAGAAGCTAGA；Actin4 sense primers：GTGTCAGCCATACTGTCCCCATTT, antisense draw Thing：GTTTCAAGCTCTTGCTCGTAATCA.As a result as shown in Figures 2 and 3.

Embodiment 3：The structure of plant expression vector pCAMBIA3301-GmRAV1, Agrobacterium-mediated transformation soybean cotyledon Section and titbit infestation method arabidopsis thaliana transformation

CDNA is obtained as template reverse transcription with soybean leaves transcription RNA, with the cDNA as PCR reaction template, total length is obtained The gene DNA sequence in ORF areas.The GmRAV1 transcription factor DNA total orders that the Semen sojae atricolor speculates are classified as 1757bp, and ORF is 1155bp, with Bgl II and BstE II is restriction enzyme site, designs cloning primer, enters performing PCR reaction, and condition is 94 DEG C of 5min；38 circulations：94 DEG C 30s, 58 DEG C of 30s, 72 DEG C of 1min；72℃10min；PCR primer is carried out into 1% agarose gel electrophoresiies, according to OMEGA Gel The explanation of Extraction Kit carries out recovery DNA segment, pMD18-T carrier of the connection with TaKaRa, according to insertion during connection Gene and connection carrier mol ratio be 3：1, calculate the consumption of insertion genetic fragment and connection carrier, 16 DEG C of temperature bath 16h.Will In the E. coli competent TOP10 of connection product 5ul conversion 50ul companies, 37 DEG C are inverted culture 12-16h, picking Dan Ke It is grand, shaken bacterium, preserved strain with LB fluid mediums (50mg/L Kan), Colony Culture bacterium solution out is delivered to into Hua Da life Thing company is sequenced, and identifies positive colony.Strain Escherichia coli comprising positive colony is shaken into bacterium, with OMEGA Plasmid Mini Kit extracts plasmid, with the restricted enzyme Bgl II and BstE II of Fermentas companies according to 1:1 ratio, Digested plasmid in the environment of the Buffer O of Fermentas companies, while with the restricted enzyme Bgl of Fermentas companies II and BstE II are according to 1:1 ratio, the enzyme action pCAMBIA3301 matter in the environment of the Buffer O of Fermentas companies Endonuclease bamhi is carried out 1% agarose gel electrophoresiies, is reclaimed according to the explanation of OMEGA Gel Extraction Kit by grain DNA segment, T4 ligase and corresponding T4 connection 10X Buffer of the connection with TaKaRa, by the target fragment of insertion DNA DNA fragmentation mol ratio with carrier is 3:1 or 1:1 ratio sets up linked system, and 16 DEG C of temperature bath 16h, connection product conversion are big Enterobacteria.Connection product 5ul is converted in the E. coli competent TOP10 of 50ul companies, 37 DEG C are inverted culture 12-16h, Picking monoclonal, with LB fluid mediums (50mg/L Kan) shake bacterium, preserve strain, with Fermentas companies it is restricted in Enzyme cutting Bgl II and BstE II is according to 1:1 ratio, the double digestion identification in the environment of the Buffer O of Fermentas companies Two methods positive colony is identified with PCR.Its cloning primer is as follows：GmRAV1 sense primers： AGATCTATGGATGCAATTAGTTGCC；Antisense primer：GGTCACCCTACAAAGCACCAATAAT.Prepare Agrobacterium EHA105 Competent cell：It is inoculated in from the fresh EHA105 single bacterium colonies of picking on YEP flat boards (25mg/L Rif, 50mg/L Str) and contains In the YEP fluid mediums of 50mg/L Str and 25mg/L Rif, 28 DEG C, 220rpm shaken cultivation overnight 24～36h takes 2mL The bacterium solution of the exponential phase of activated overnight, is inoculated in 50mL liquid YEP, continues culture OD600 to 0.4～0.6 or so, turns Enter ice pre-cooling sterile centrifugation tube, ice bath 30min, 4 DEG C, 4000rpm centrifugation 10min abandon supernatant, with 10mL ice pre-cooling 0.05M CaCl₂Suspension thalline, ice bath 30 minutes, 4 DEG C, 4000rpm centrifugation 10min abandon supernatant, with 2mL ice pre-cooling 0.05M CaCl₂ Resuspended thalline, the competent cell for preparing is positioned on ice, and transformation efficiency highest is used in 24～48h, also can be by often managing 100 μ L are sub-packed in sterile tube, add glycerol to be placed in -70 DEG C of preservations after making final concentration of 15%.Freeze-thaw method converts Agrobacterium：Take The plasmid DNA of 2 μ L purification, is added in the centrifuge tube containing 100 μ L Agrobacterium tumefaciems competent cells, gently mixes, ice bath 30min, the quick-freezing 2min in liquid nitrogen, put rapidly 37 DEG C of water-bath heat shock 5min, then rapid ice bath 2min, add 500 μ L YEP without The liquid culture of antibiotic is based on 28 DEG C, 100rpm gently 3～5h of shaken cultivation recoveries, and 50-200 μ L bacterium are taken from the culture Liquid is uniformly coated on the YEP solid mediums containing appropriate antibiotic (50mg/L Str, 25mg/L Rif and 50mg/L Kan) Surface, 28 DEG C are inverted 1～2d of culture, and picking white single bacterium colony is in the YEP fluid medium (50mg/L containing appropriate antibiotic Str, 25mg/L Rif and 50mg/L Kan) middle culture, PCR identification positive colonies.The Agrobacterium pCAMBIA3301- for obtaining GmRAV1 (Fig. 4) carrier transformants can be used for the conversion of plant.

It is prepared by Agrobacterium bacterium solution：The Agrobacterium single bacterium colony that picking contains pCAMBIA3301-GmRAV1 recombiant plasmid is inoculated in 50mg/L containing rifampicin, streptomycin 25mg/L, card receive mycin 50mg/L 5mL YEB fluid mediums in, 28 DEG C, 180rpm training Foster 48h.It is 0.6-0.8 to OD600 to draw concussion and cultivate during 1ml bacterium solutions are inoculated in the fresh above-mentioned YEB fluid mediums of 50ml, Bacterium solution is centrifuged into 15min in the centrifuge of 5000rpm, after being enriched with thalline, uses the liquid CCM culture medium of equivalent resuspended.

Soybean seed sterilizes：Chlorination method.The full seed without bacterial plaque is chosen, is put in the exsiccator of ventilating kitchen, Pour 96ml sodium hypochlorite in the small beaker of exsiccator into, covered tightly after rapidly joining 4ml concentrated hydrochloric acid rapidly.Semen sojae atricolor is produced in its reflection Chlorine in sterilize and be placed in ventilation 30min in super-clean bench after 16h, seal standby.

Germination of Soybean Seed：By the seed hilum after sterilizing to sowing in germination medium (GM), per bottle of kind 8-10 grain, Sprout 4-5 days under 23 DEG C, 16h illumination/8h dark conditions.

The preparation of soybean cotyledon node：Aseptic seedling is taken out, is chosen and is sprouted sufficient plant, remove kind of a skin, in cotyledon lower end 5mm Hypocotyls are cut away by place, cut two panels midnight along hypocotyls center line, remove true leaf, obtain cotyledonary node explant., use dissecting knife 3-5 knives are drawn in the range of cotyledon with plumular axis junction diameter about 3mm.Operate through this time, every aseptic seedling is obtained 2 use In the cotyledonary node explant of conversion.

Semen sojae atricolor is infected and co-cultivation：The explant for preparing is put into and infects 100rpm in liquid, taken after concussion and cultivate 30min Go out and the liquid that infects of explant excess surface is blotted with aseptic paper, be inverted in co-cultivation culture medium, light culture 3 days.

The induction and screening of Semen sojae atricolor Multiple Buds：By light culture complete cotyledonary node explant clear water and liquid bud inducement cultivation The liquid on cotyledonary node surface is blotted by base respectively cleaning 3 times with aseptic paper, with 45 degree of angle oblique cuttings of media surface in renewal cultivation Bud induction is carried out on base.The induction Multiple Buds of 7 days are transferred in the screening culture medium containing 8mg/LPPT, per 7 days subcultures one It is secondary, screen 20 days.

The preparation of Semen sojae atricolor stock：50 kinds of eastern agriculture was treated into that its cotyledon launched true leaf slightly in Vermiculitum in 5 days in advance, choose true Its true leaf is removed with dissecting knife and then hypocotyls is cut out one along caulom line by the seedling of leaf less than cotyledon 2/3 completely The wound of 0.8mm-10mm.

The preparation of Semen sojae atricolor scion：Through the Multiple Buds for screening, remove tissue of around dying, cut perpendicular to Multiple Buds surface Under, it is 3-7mm that Multiple Buds are cut into top, and bottom is about 5-8mm and has complete fascicular Wedge-shaped.

The grafting of Semen sojae atricolor：Scion is vertically put in stock otch, Multiple Buds face is flushed with cotyledonary node, uses sealed membrane bag Good, cultivation is moved on in polypots.The plant for grafting is put in a deeper box, overcoat preservative film, it is appropriate to seal, keep low temperature The growing environment of high humidity, treats after one week that seedling recovers to take off film seedling exercising completely.

The identification of transformation of soybean：The seed that grafting Semen sojae atricolor is collected is planted in soil, observe its growth conditions with it is right Whether photograph is more variant than, and using the little mensuration DNA for extracting its fresh blade, according to the DNA sequence of recombiant plasmid, finally selects The 35S promoter sequence and GmRAV1 gene orders on the recombiant plasmid is taken, specific primer is designed, with DNA as template, according to EasyTaq DNA Polymerase description enters performing PCR amplification, and primer sequence is as follows：Sense primer：5' TATCCTTCGCAAGACCCTTCCTC 3', antisense primer：5'ACGACGAAGCCATAGTGGTTTGC3', primer size is 740bp。

It is prepared by Agrobacterium bacterium solution：The Agrobacterium single bacterium colony that picking contains pCAMBIA3301-GmRAV1 recombiant plasmid is inoculated in 50mg/L containing rifampicin, streptomycin 25mg/L, card receive mycin 50mg/L 5mL YEB fluid mediums in, 28 DEG C, 180rpm training Foster 48h.It is 0.6-0.8 to OD600 to draw concussion and cultivate during 1ml bacterium solutions are inoculated in the fresh above-mentioned YEB fluid mediums of 50ml, Bacterium solution is centrifuged into 10min in the centrifuge of 5000rpm, supernatant is abandoned, precipitation is suspended in the osmotic medium of 1/2nd volumes In (0.22%MS, 5% sucrose, 0.02%silwet L-77).

Arabidopsiss Seed sterilization：10%NaClO sterilizations：After choosing full 4 DEG C of vernalization 3d of arabidopsiss seed, it is put in In 1.5EP pipes, 10% NaClO solution is added thereto to, be vortexed concussion 7-10min, seed is fully contacted with solution, fully Sterilization, then with aseptic water washing 3～4 times.

Seed Germination of Arabidopsis Pumila：By the seed kind after sterilizing in the germination medium (MS) containing 2% sucrose, per plate kind about 100 seeds, sprout 7 days under 22 DEG C, 8h illumination/16h dark conditions.

Arabidopsiss are transplanted seedlings：By soil with Vermiculitum according to 1:After 1 mixing, basin is filled, watering from below makes which fully soak, will training Seedling in foster base is moved into wherein, is careful not to hinder root.Arabidopsiss Seedling is encased with preservative film, is placed in 22 DEG C, 16h illumination/8h Grow 7 days under dark condition, throw off preservative film.

Arabidopsiss infect and conversion：Titbit infestation method：By resuspended containing pCAMBIA3301-GmRAV1 recombiant plasmid Agrobacterium bacterium solution be poured in little porcelain dish.The bowl of culture arabidopsiss is laid across on porcelain dish side, has just been showed money or valuables one carries unintentionally and unopened flower 30s is soaked in being immersed in suspension.Take out plant, traverse on the plastic film, with preservative film cover above to keep humidity, and Cover one layer of lighttight paper on preservative film again.It is placed on thermostatic chamber light culture 24h.Open paper and preservative film within second day, vertically train Support.After 4～5d, dip-dye one is continued according to the growing state of arabidopsiss and arrives secondary.Culture 3～4 weeks, after seed maturity, collects Seed, deposits in exsiccator.

The identification of transformation of Arabidopsis thaliana：Plant after 4 DEG C of vernalization 3d of the seed that arabidopsiss after infecting are collected in sprouting training In foster base MS (5mg/L Kan), after 22 DEG C of ± 2 DEG C of illumination cultivation 7d-10d, growth conditions are chosen well, the dark green plan south of leaf color Mustard, moves in soil, 22 DEG C of ± 2 DEG C of long-day illumination cultivation, after which is grown up, using the little mensuration DNA for extracting its fresh blade, According to the DNA sequence of recombiant plasmid, the 35S promoter sequence and GmRAV1 gene orders on the recombiant plasmid is finally chosen, if Meter specific primer, with DNA as template, enters performing PCR amplification, primer sequence according to EasyTaq DNA Polymerase description It is as follows：Sense primer：5'TATCCTTCGCAAGACCCTTCCTC 3', antisense primer：5'ACGACGAAGCCATAGTGGTTTGC 3', primer size are 740bp.Selected part genetically engineered soybean carries out semi-quantitative RT-PCR analysis, as a result shows GmRAV1-ox strains In system, exogenous gene GmRAV1 genes have been incorporated in soybean gene group, turn on transcriptional level GmRAV1 transgenic soybeans with it is non- Genetically engineered soybean compares GmRAV1 overexpressions, and signal is very strong.

Embodiment 4：The structure of plant RNA i expression vector pJawoh l8-GmRAV1 and Agrobacterium-mediated transformation Semen sojae atricolor Cotyledonary node

According to the GmRAV1 gene orders announced on NCBI, the gene order design in ORF is selected to interfere purpose fragment, with The full length sequence of GmRAV1 genes is template, designs primer.According to Gateway technical instructions, the specificity for expanding 333bp is done Relate to fragment, by BP react, recombination to construct entry vector (entry clone), then entry vector again with RNAi expression vector PJawohl8 is reacted by LR, obtains the RNAi carrier containing genes of interest (destination vector).Pcr amplified fragment Condition be 94 DEG C of 5min；38 circulations：94 DEG C of 30s, 55 DEG C of 30s, 72 DEG C of 1min；72℃10min；PCR primer is carried out into 1% Agarose gel electrophoresiies, carry out recovery DNA segment according to the explanation of OMEGA Gel Extraction Kit, according to Gateway Technical instruction determines BP reaction systems, carries out BP reactions, takes 2 μ L BP product into a centrifuge tube, is placed on ice, little The heart is added thereto to 100 μ L competent cells, flicks ttom of pipe and mixes, ice bath 30min, 42 DEG C of water-bath heat shock 90s (should not shake), 2min on ice is immediately placed on, 200 μ L LB liquid is added in centrifuge tube, 37 DEG C, 150rpm shaken cultivation 45min is placed on ice, Bacterium solution is taken respectively to coat on the LB flat boards containing Amp (100mg/L), is just being put 1h for 37 DEG C and is being fallen after bacterium solution is completely by flat board absorption Put incubated overnight 12h-16h, picking white single bacterium colony is inoculated in the LB fluid mediums that 5mL contains Amp (100mg/L), 37 DEG C, 220rpm shaken cultivation 12-16h, after culture medium substantially becomes cloudy, takes 0.5mL bacterium solutions and adds aseptic 30% glycerol of 0.5mL extremely Final concentration of 15%, -80 DEG C of preservation strains.Take 2 μ L bacterium solutions and do PCR amplifications, will have amplified production and correct gram of clip size It is grand to be sequenced.Take the correct positive colony bacterium solution of sequencing result plasmid is extracted as entry vector clone, uv-spectrophotometric Meter and agarose gel electrophoresiies detect the concentration and purity of plasmid.With GmRAV-attB-Fi and GmRAV-attB-Ri as primer, It is template through the reacted transformed bacteria solutions of BP, enters performing PCR reaction. taking 5 μ L amplified productions carries out sepharose electrophoresis detection.Root LR reaction systems are determined according to Gateway technical instructions, carry out LR reactions, by product according to conversion large intestine bar after BP reactions The method conversion of bacterium, will be totally converted cell and is uniformly coated on the LB solid mediums containing 50mg/mL ampicillin, and 37 DEG C culture 12-16h after, picking single bacterium colony is inoculated in the LB fluid medium overnight incubations containing 50mg/mL ampicillin, so After take 2 μ L bacterium solutions and do PCR amplifications, correctly clone is sequenced will amplified production and clip size.And carry out the inspection of bacterium solution PCR Survey.By plant entry vector pDONR201-GmRAV plasmids SmaI single endonuclease digestions, plant expression vector pJawoh18-GmRAV matter Grain (Fig. 5) uses HindIII single endonuclease digestions, takes 6-10 μ L product electrophoresis detection.Detection positive colony delivers the sequencing of Shanghai Ying Jun companies. Amplification interferes the primer sequence of fragment as follows：Sense primer：GmRAV-attB-Fi 5’- GGGGACAAGTTTGTACAAAAAAGCAGGCTACGCCGTCACCAACTTCA-3 ', antisense primer：GmRAV-attB-Ri

5’-GGGGACCACTTTGTACAAGAAAGCTGGGTGTGCTGCTTCGGTATCACTAA-3’.Prepare Agrobacterium EHA105 competent cells：Connect from the fresh EHA105 single bacterium colonies of picking on YEP flat boards (50mg/L Str and 25mg/L Rif) Kind in the YEP fluid mediums of Str containing 50mg/L and 25mg/L Rif, 28 DEG C, 220rpm shaken cultivation overnight 24～36h, The bacterium solution of the exponential phase of 2mL activated overnights is taken, is inoculated in 50mL liquid YEP, continue culture OD600 left to 0.4～0.6 The right side, proceeds to ice pre-cooling sterile centrifugation tube, ice bath 30min, 4 DEG C, 4000rpm centrifugation 10min, abandons supernatant, with 10mL ice pre-coolings 0.05M CaCl2 suspension thallines, ice bath 30 minutes, 4 DEG C, 4000rpm centrifugation 10min abandon supernatant, with 2mL ice pre-cooling 0.05M The resuspended thalline of CaCl2, the competent cell for preparing is positioned on ice, uses transformation efficiency highest, can also press in 24～48h Often 100 μ L of pipe are sub-packed in sterile tube, add glycerol to be placed in -70 DEG C of preservations after making final concentration of 15%.Freeze-thaw method converts agriculture bar Bacterium：The plasmid DNA of 2 μ L purification is taken, is added in the centrifuge tube containing 100 μ L Agrobacterium tumefaciems competent cells, is gently mixed, Ice bath 30min, the quick-freezing 2min in liquid nitrogen, put rapidly 37 DEG C of water-bath heat shock 5min, then rapid ice bath 2min, add 500 μ L The liquid culture of YEP antibiotic-frees is based on 28 DEG C, 100rpm gently 3～5h of shaken cultivation recoveries, from the culture takes 50- 200 μ L bacterium solutions be uniformly coated on the YEP solid mediums containing appropriate antibiotic (50mg/L Str, 25mg/L Rif and 100mg/L Amp) surface, 28 DEG C are inverted 1～2d of culture, and picking white single bacterium colony is trained in the YEP liquid containing appropriate antibiotic Culture in foster base (50mg/L Str, 25mg/L Rif and 100mg/L Amp), PCR identification positive colonies.The Agrobacterium for obtaining PJawoh18-GmRAV1 carriers transformant can be used for the conversion of plant.

It is prepared by Agrobacterium bacterium solution：:The Agrobacterium single bacterium colony that picking contains pJawoh18-GmRAV1 recombiant plasmid is inoculated in and contains In rifampicin 50mg/L, streptomycin 25mg/L, the 5mL YEB fluid mediums of ammonia benzyl mycin 100mg/L, 28 DEG C, 180rpm trainings Foster 48h.It is 0.6-0.8 to OD600 to draw concussion and cultivate during 1ml bacterium solutions are inoculated in the fresh above-mentioned YEB fluid mediums of 50ml, Bacterium solution is centrifuged into 15min in the centrifuge of 5000rpm, after being enriched with thalline, uses the liquid CCM culture medium of equivalent resuspended.

Transformation of soybean method is specifically shown in embodiment 3

The identification of transformation of soybean：The seed that grafting Semen sojae atricolor is collected is planted in soil, observe its growth conditions with it is right Whether photograph is more variant than, and using the little mensuration DNA for extracting its fresh blade, according to the DNA sequence of recombiant plasmid, design is special Specific primer, with DNA as template, enters performing PCR amplification according to EasyTaq DNA Polymerase description, and primer sequence is such as Under：Pat sense primers：5 '-GCACCATCGTCAACCACTAC-3 ', antisense primer：5′-TGAAGTCCAGCTGCCAGAAAC- 3 ', primer size is 440bp.Selected part genetically engineered soybean carries out semi-quantitative RT-PCR analysis, as a result shows GmRAV-i strains Middle exogenous gene GmRAV1 has been incorporated in soybean gene group, RNAi transgenic and Non-transgenic soybean phase on transcriptional level It is suppressed than GmRAV1 expression, signal is very weak.

Embodiment 5：Turn GmRAV1 gene overexpressions Semen sojae atricolor and turn the Phenotypic Observation and function point that GmRAV-i interferes Semen sojae atricolor Analysis

Vermiculitum and soil 1:After 1 mixing, GmRAV1 gene overexpression Semen sojae atricolor will be turned, turn GmRAV-i interference Semen sojae atricolor and control Semen sojae atricolor DN50 kinds are planted in wherein, and 16h light/8h is dark, grow under the conditions of 25 DEG C, and observation genetically engineered soybean is planted compared with control Semen sojae atricolor The difference (Fig. 6) of the plant height of strain, leaf color, joint number, pod number, interval and flowering time.

Embodiment 6：Turn GmRAV1 gene arabidopsiss, mutant arabidopsiss rav, GmRAV1 gene and recover arabidopsiss GmRAV1-ox rav T4 are for functional analyses

The 1GmRAV1 genes amplifications effect of the basic element of cell division (2-ip)

The sterilization of seed and sprouting：4 kinds of arabidopsiss seeds of Columbia-0, rav, GmRAV1-ox, GmRAV1-ox rav After 4 DEG C of vernalization 3d, with 10%NaClO vortex oscillations sterilization 6-8min after, with it is aseptic washing 5 times, plant containing 2% sucrose MS In culture medium, each plate about plants 100, vertically cultivates, wait germination under 22 DEG C and 16h illumination/8h dark photoperiods.

The culture of calluss：Addition 2.2 μm of ol/L, 2,4-D, 0.2 μm of ol/L KT in the culture medium containing B5,2% Sucrose, 0.59g/L MES, 0.8% agar, pH5.5.The root of 4 kinds of arabidopsiss of seedling age 8d is removed into head respectively and afterbody is big Remainder is cut into the section of about 5mm by the region of about 5mm, is inoculated in callus culture base, and each plate accesses more 40 Section explant, 3 repetitions of every kind of arabidopsiss cultivate 3d under 22 DEG C and 16h illumination/8h dark photoperiods.

The induction of adventitious bud：Calluss are transferred in the adventitious bud induction culture base containing B5 after 3d, wherein adding The 2-ip (0,1,5,10 μm of ol/L) of variable concentrations, 0.75 μm of ol/L IAA, 2% sucrose, 0.59g/L MES, 0.8% agar, pH5.6.Every kind of arabidopsiss are inoculated with 10 explants in each plate, and the explant of 4 kinds of arabidopsiss is inoculated in each simultaneously In plate, each processes 5 repetitions, cultivates, wait the germination of explant under 22 DEG C and 16h illumination/8h dark photoperiods, Its differentiation situation is observed, it is determined that the regeneration efficiency of most suitable 2-ip concentration statistics 4 kinds of arabidopsiss under optimum concentration.When bud is induced When not containing 2-ip in culture medium, calluss will not break up generation bud tissue, have adventitious bud when 2-ip concentration is 1 μm of ol/L Occur, when 2-ip concentration is less than 5 μm of ol/L, the adventitious bud number of arabidopsiss WT increases, color with the increase of 2-ip concentration Gradually plus green, when 2-ip concentration is 5 μm of ol/L, the induction situation of adventitious bud preferably, intends south when 2-ip concentration is 10 μm of ol/L Mustard WT adventitious bud growing states are on a declining curve, it is determined that the 2-ip concentration of 5 μm of ol/L is the most suitable dense of evoking adventive bud generation Degree.Choosing 4 kinds of difference 2-ip concentration carries out testing with explant adventitious shoot regeneration for arabidopsiss, observes the regeneration figure of adventitious bud 9a, and count its regeneration rate (table 1).

Table 1 is to B₅In culture medium external source apply variable concentrations basic element of cell division 6-BA after 3 kinds of Semen sojae atricolor regeneration rate

The 2.GmRAV1 genes amplifications effect of the basic element of cell division (6-BA)

4 kinds of arabidopsiss seeds of Columbia-0, rav, GmRAV1-ox, GmRAV1-ox rav are used after 4 DEG C of vernalization 3d After 10%NaClO vortex oscillations sterilization 6-8min, with aseptic washing 5 times, plant in the MS culture medium containing 2% sucrose, each is put down Ware about plants 100, vertically cultivates, wait germination under 22 DEG C and 16h illumination/8h dark photoperiods.By arabidopsiss after germination Move on containing 0,0.5, the MS solid mediums of 1mg/L 6-BA, vertically train under 22 DEG C and 16h illumination/8h dark photoperiods Support, after 6d, statistics root is long, and takes a picture (Figure 10 a and b).0.5mg/L and 1.0mg/L 6-BA process under, rav roots suppress with it is right Than, not significantly, RAV1ox roots suppress compared with the control significantly for photograph, and GmRAV1-ox rav roots suppress not show compared with the control Write；Illustrate that mutant rav suppresses root elongation insensitive to 6-BA, it is that 6-BA suppresses root just to extend to further relate to GmRAV1 genes Regulatory factor.

3.GmRAV1-ox the effect of gene pairss epi-brassinolide epiBL is insensitive

3 kinds of arabidopsiss seeds of Columbia-0, rav, GmRAV1-ox after 4 DEG C of vernalization 3d are vortexed with 10%NaClO and are shaken After swinging sterilization 6-8min, with aseptic washing 5 times, plant in the MS culture medium containing 2% sucrose, each plate about plants 100,22 DEG C and 16h illumination/8h dark photoperiod under cultivate, wait germination.By arabidopsiss after germination move in containing 0,5,10, On the MS solid mediums of 50mmol/L epiBL, half is placed under 22 DEG C and 16h illumination/8h dark photoperiods and vertically trains Support, second half is placed on dark lower growth, counts hypocotyls, and take a picture (Figure 12 (a)) after 10d.With the appropriate increasing of epiBL concentration Plus, the hypocotyl elongation of WT arabidopsiss is longer compared with BR is not added with, and 10mmol/L reaches optimum concentration, reaches when concentration is raised again When 50mmol/L, the elongation effect of arabidopsiss is deteriorated (Figure 12 (b)).In the case where the epiBL of 10mmol/L is processed, rav hypocotyls Promote compared with the control significantly, GmRAV1-ox hypocotyls promote not notable compared with the control；Illustrate that mutant rav presses down to 6-BA Root elongation processed is sensitive and overexpression GmRAV1-ox is then super insensitive.Expression GmRAV1 can be passed through makes the plant type of plant to short and small Direction grows, by the expression for suppressing or disturbing GmRAV1 genes, while the epi-brassinolide epiBL using 10mmol/L promotees The plant type for entering plant is grown to high general orientation.

Embodiment 7：Turn T2 for GmRAV1 transgenic soybeans, turn GmRAV-i gene interference Semen sojae atricolor, DN50 compare Semen sojae atricolor function Analysis

The 1GmRAV1 genes amplifications basic element of cell division (6-BA) promotes the effect of regeneration

Soybean seed sterilizes, by the seed hilum after sterilizing to sowing in germination medium (GM), per bottle of kind 8-10 grain, Sprout 4-5 days under 23 DEG C, 16h illumination/8h dark conditions.

The culture of adventitious bud：The soybean cotyledon node after sprouting 7d is cut, which is directly gone on bud inducement cultivation base, is given birth to Bud culture, observes its differentiation situation.Bud inducement cultivation base with B5 as minimal medium, add 5 kinds of variable concentrations 6-BA (0, 0.0835、0.167、1.67、3.34mg·L^-1), 3% sucrose, 0.59g L-1MES, 8% agar, pH 5.6.Each processes 3 Secondary repetition, 10 pieces of calluss of each repeated inoculation.The soybean callus after regenerating 7-10 days are taken, its adventitious shoot regeneration is observed Situation, and count its regeneration efficiency (Fig. 9 (b) and table 2).

Regeneration rate of the table 2 to 4 kinds of arabidopsiss after the basic element of cell division 2-ip of external source applying variable concentrations in MS culture medium

The 2GmRAV1 genes amplifications basic element of cell division (6-BA) suppresses root and hypocotylar effect

The sterilization of seed and sowing：The full seed without bacterial plaque is chosen, is put in the exsiccator of ventilating kitchen, in exsiccator Pour 96ml sodium hypochlorite in small beaker into, covered tightly after rapidly joining 4ml concentrated hydrochloric acid rapidly.Semen sojae atricolor is in the chlorine that its reflection is produced Ventilation 30min in super-clean bench is placed in after sterilizing 16h, is sealed standby.By the seed hilum after sterilizing to sowing in germination medium (GM), in, per bottle of kind 8-10 grain is sprouted 1-2 days under 23 DEG C, 16h illumination/8h dark conditions.

Sprout Semen sojae atricolor to move to containing in variable concentrations 6-BA culture medium：Aseptic seedling is taken out, is chosen and is sprouted sufficient plant, turned Move in the culture medium of the 6-BA containing variable concentrations, observe its growing state.Culture medium adds 3 with B5 as minimal medium The 6-BA (0,0.5,1.0mg L-1) of kind of variable concentrations, 3% sucrose, 0.59g L-1MES, 8% agar, pH 5.6.Each Process 3 repetitions, 20 Semen sojae atricolor of each repeated inoculation.

The observation of root and hypocotyl growth situation：Soybean Root and hypocotyl growth situation after observation growth 7d, counts which Hypocotyls and root length (Figure 10 (c), (d) with (e).

Embodiment 8：Real-time RT-PCR analysis external sources apply 6-BA (100 μm of ol 6-BA) and do not apply 6-BA (0 μ Mol 6-BA) DN42 Semen sojae atricolor in GmRAV1 genes expression rule

Semen sojae atricolor DN42 is incubated at 25 DEG C of illumination box, 250 μm of ol m-2sec-1 white lights, long-day (16h/8h light darks) (LD) grow in Vermiculitum under the conditions of, processed when the full exhibition of its first trifoliolate leaf, it is quick to remove the residual of soybean root Vermiculitum is stayed, the root of a part of Semen sojae atricolor is placed in the 1/4MS aqueous solutions containing 100 μm of ol 6-BA, the root of another part Semen sojae atricolor Be placed in the 1/4MS aqueous solutions for not containing 6-BA, it is to be transferred after 0,0.5,1,2,4,6,8,12,24,48h, while to which Blade is drawn materials, liquid nitrogen flash freezer, -80 DEG C of preservations, extracts RNA, according to the journey of SYBR (R) ExScriptTM RT-PCR Kit Sequence carries out quantitative fluorescent PCR reaction.GmRAV1 am-plified fragments length be 144bp, Semen sojae atricolor house-keeping gene Actin4 (AF049106) Am-plified fragments length is 214bp, and its primer is as follows：GmRAV1 sense primers：GGTGTAGTGGCATAGTGGC, antisense primer： TAAGAAGGGGAGAAGCTAGA；Actin4 sense primers：GTGTCAGCCATACTGTCCCCATTT, antisense primer： GTTTCAAGCTCTTGCTCGTAATCA。

Real-time RT-PCR analysis external sources apply 6-BA (100 μm of ol 6-BA) and do not apply 6-BA (0 μm of ol 6- BA in DN42 Semen sojae atricolor), the expression rule of GmRAV1 genes is as shown in figure 11.

Although the present invention is disclosed as above with preferred embodiment, which is not limited to the present invention, any to be familiar with this The people of technology, in without departing from spirit and scope of the invention, can do various changes and modification, therefore, the guarantor of the present invention Shield scope should be by being defined that claims are defined.

Sequence table

<110>Northeast Agricultural University

<120>A kind of application with Semen sojae atricolor Photoperiod related gene GmRAV1

<130> 1

<160> 2

<170> PatentIn version 3.5

<210> 1

<211> 1757

<212> DNA

<213> GmRAV1

<400> 1

tcacctcatc attaataaat tgtcccaact aagcatattt ccttttccac ttaggataat 60

attaaaataa cacatttact agggactgtt tccttctata tatattccct cctcaaacaa 120

cccctattcc cacccaaact catctatctt tgcttcccct tagtcaaaca aagtaacaca 180

ccatccatcc tctctctctt ctcttcttct gttctctagt ttcctgctct tgtttcttag 240

aatccgtacg gtctaatcaa cacaacaaaa tggatgcaat tagttgcctg gatgagagca 300

ccaccaccga gtcactctcc ataagtcagg cgaagccttc ttcgacgatt atgtcgtccg 360

agaaggcttc tccttccccg ccgccgccga acaggctgtg ccgcgtcggt agcggtgcta 420

gcgcagtcgt ggattccgac ggcggcggcg ggggtggcag caccgaggtg gagtcgcgga 480

agctcccctc gtccaagtat aagggcgtcg tgccccagcc caacggccgc tggggctcgc 540

agatttacga gaagcaccag cgcgtgtggc tgggaacgtt caacgaggaa gacgaggcgg 600

cgcgtgcgta cgacgtcgcc gtgcagcgat tccgcggcaa ggacgccgtc acaaacttca 660

agccgctctc cggcaccgac gacgacgacg gggaatcgga gtttctcaac tcgcattcga 720

aatccgagat cgtcgacatg ctgcgtaagc atacgtacaa tgacgagctg gaacaaagca 780

agcgcagccg cggcttcgta cgtcggcgcg gctccgccgc cggcgccgga aacggaaact 840

caatctccgg cgcgtgtgtt atgaaggcgc gtgagcagct attccagaag gccgttacgc 900

cgagcgacgt tgggaaactg aaccgtttgg tgataccgaa gcagcacgcg gagaagcact 960

ttcctttaca gagcgctgct aacggcgtta gcgcgacggc gacggcggcg aagggcgttt 1020

tgttgaactt cgaagacgtt ggagggaaag tgtggcggtt tcgttactcg tattggaaca 1080

gtagccagag ttacgtcttg accaaaggtt ggagccggtt cgttaaggag aagaatctga 1140

aagccggtga cacggtttgt tttcaacggt ccactggacc ggacaggcag ctttacatcg 1200

attggaagac gaggaatgtt gttaacgagg tcgcgttgtt cggaccggtt gtcgaaccga 1260

tccagatggt tcggctcttt ggtgttaaca ttttgaaact acccggttca gattctatcg 1320

ccaataacaa taatgcaagt gggtgctgca atggcaagag aagagaaatg gaactctttt 1380

cattagagtg tagcaagaaa cctaagatta ttggtgcttt gtagcgttac gttacttttt 1440

ttgagttttt tttttttttg agttttgtga ctgatgaaag aaagaaggta caagaagaac 1500

ggcggtgtag tggcatagtg gcatcgcaag ttgctgcaaa aggtgaattg tatattactt 1560

aatattagat gctgaaatat taggtgtaat gtaacaaaaa actgtacaag gagaagaaaa 1620

aaggttctaa gaaggggaga agctagaaga aaaaaaatga tgtcatcatg ggataactgt 1680

ttaattgtat atgttgataa tattgttgaa tgttgattat tatgttcacg gcatctgatg 1740

ttttttttct gtttttt 1757

<210> 2

<211> 384

<212> PRT

<213>GmRAV1 coding regions albumen

<400> 2

Met Asp Ala Ile Ser Cys Leu Asp Glu Ser Thr Thr Thr Glu Ser Leu

1 5 10 15

Ser Ile Ser Gln Ala Lys Pro Ser Ser Thr Ile Met Ser Ser Glu Lys

20 25 30

Ala Ser Pro Ser Pro Pro Pro Pro Asn Arg Leu Cys Arg Val Gly Ser

35 40 45

Gly Ala Ser Ala Val Val Asp Ser Asp Gly Gly Gly Gly Gly Gly Ser

50 55 60

Thr Glu Val Glu Ser Arg Lys Leu Pro Ser Ser Lys Tyr Lys Gly Val

65 70 75 80

Val Pro Gln Pro Asn Gly Arg Trp Gly Ser Gln Ile Tyr Glu Lys His

85 90 95

Gln Arg Val Trp Leu Gly Thr Phe Asn Glu Glu Asp Glu Ala Ala Arg

100 105 110

Ala Tyr Asp Val Ala Val Gln Arg Phe Arg Gly Lys Asp Ala Val Thr

115 120 125

Asn Phe Lys Pro Leu Ser Gly Thr Asp Asp Asp Asp Gly Glu Ser Glu

130 135 140

Phe Leu Asn Ser His Ser Lys Ser Glu Ile Val Asp Met Leu Arg Lys

145 150 155 160

His Thr Tyr Asn Asp Glu Leu Glu Gln Ser Lys Arg Ser Arg Gly Phe

165 170 175

Val Arg Arg Arg Gly Ser Ala Ala Gly Ala Gly Asn Gly Asn Ser Ile

180 185 190

Ser Gly Ala Cys Val Met Lys Ala Arg Glu Gln Leu Phe Gln Lys Ala

195 200 205

Val Thr Pro Ser Asp Val Gly Lys Leu Asn Arg Leu Val Ile Pro Lys

210 215 220

Gln His Ala Glu Lys His Phe Pro Leu Gln Ser Ala Ala Asn Gly Val

225 230 235 240

Ser Ala Thr Ala Thr Ala Ala Lys Gly Val Leu Leu Asn Phe Glu Asp

245 250 255

Val Gly Gly Lys Val Trp Arg Phe Arg Tyr Ser Tyr Trp Asn Ser Ser

260 265 270

Gln Ser Tyr Val Leu Thr Lys Gly Trp Ser Arg Phe Val Lys Glu Lys

275 280 285

Asn Leu Lys Ala Gly Asp Thr Val Cys Phe Gln Arg Ser Thr Gly Pro

290 295 300

Asp Arg Gln Leu Tyr Ile Asp Trp Lys Thr Arg Asn Val Val Asn Glu

305 310 315 320

Val Ala Leu Phe Gly Pro Val Val Glu Pro Ile Gln Met Val Arg Leu

325 330 335

Phe Gly Val Asn Ile Leu Lys Leu Pro Gly Ser Asp Ser Ile Ala Asn

340 345 350

Asn Asn Asn Ala Ser Gly Cys Cys Asn Gly Lys Arg Arg Glu Met Glu

355 360 365

Leu Phe Ser Leu Glu Cys Ser Lys Lys Pro Lys Ile Ile Gly Ala Leu

370 375 380

Claims

1. application of the Semen sojae atricolor GmRAV1 genes in control plant growth period and growth course；The GmRAV1 genes, nucleotide Sequence is as shown in SEQ ID NO.1.

2. apply according to claim 1, it is characterised in that the application during control plant photoperiod sensitivity.

3. apply according to claim 2, it is characterised in that be by GmRAV1 gene transferred plant cells after, by silence The photoperiod sensitivity expressed to adjust control plant of GmRAV1 genes.

4. apply according to claim 3, it is characterised in that step is as follows：

1) expression vector is interfered to be connected with plant RNA i the fragment of the coding region containing GmRAV1 genes or promoter sequence Connect, build plant RNA i expression vectors；

2) by step 1) obtained by plant RNA i expression vectors be transferred in plant cell, obtain plant RNA i expression vectors it is thin Born of the same parents；

3) screen step 2) in gained plant RNA i expression vectors cell in expression silencing transformed cells, cultivate and obtain Turn the plant of GmRAV1 genes.

5. apply according to claim 4, it is characterised in that the coding region of the GmRAV1 genes, nucleotides sequence sequence is 270-1421 positions in SEQ ID NO.1；The promoter, is CaMSV35 promoteres.

6. apply according to claim 1, it is characterised in that the application during plant adventitious shoot regeneration ability is strengthened.

7. apply according to claim 6, it is characterised in that by GmRAV1 gene transferred plant cells, by overexpression GmRAV1 genes are strengthening the adventitious bud energy for growth of plant.

8. apply according to claim 7, it is characterised in that step is as follows：

2) by step 1) obtained by plant expression vector be transferred in plant cell, obtain the plant containing plant expression vector it is thin Born of the same parents；

9. apply according to claim 1, it is characterised in that the application during control plant plant type.

10. apply according to claim 9, it is characterised in that step is as follows：

1) GmRAV1 genes are transferred to obtain in plant and turn GmRAV1 gene plants；

2) usage amount by adjusting the expression and Epibrassinolide epiBL of GmRAV1 genes adjusts the plant type of plant.