CN106399355A - Genetic transformation method of agrobacterium-mediated mustard - Google Patents
Genetic transformation method of agrobacterium-mediated mustard Download PDFInfo
- Publication number
- CN106399355A CN106399355A CN201610820962.0A CN201610820962A CN106399355A CN 106399355 A CN106399355 A CN 106399355A CN 201610820962 A CN201610820962 A CN 201610820962A CN 106399355 A CN106399355 A CN 106399355A
- Authority
- CN
- China
- Prior art keywords
- culture medium
- culture
- caulis
- explant
- folium brassicae
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
- C12N15/8202—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
- C12N15/8205—Agrobacterium mediated transformation
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Molecular Biology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Cell Biology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Physics & Mathematics (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention belongs to the technical field of transgenosis and particularly relates to a genetic transformation method of agrobacterium-mediated mustard. The specific method comprises the step of successfully obtaining transgenic positive seedlings through inducing culture callus via co-transformation by taking a mustard hypocotyl subjected to dark culture for 7 days as an explant and utilizing an agrobacterium infection hypocotyl carried with a target gene carrier, performing resistance screening, dedifferentiating and the like. The PCR authentication of the positive seedlings proves that a target gene is successfully transferred to a plant for expression. The invention establishes an efficient regeneration system of mustard, thereby providing a basis for the study on a mustard agrobacterium-mediated transgenic technology.
Description
Technical field
The invention belongs to plant tissue culture and field of transgenic technology are and in particular to be related to a kind of agriculture bacillus mediated mustard
The genetic transforming method of dish.
Technical background
Caulis et Folium Brassicae junceae, is a year in Cruciferae Brassica genus or herbaceos perennial.It is mainly as oil crop and tune
Taste kind is planted.Caulis et Folium Brassicae junceae comprises abundant germ plasm resource, has very important scientific research value and economic use value.Caulis et Folium Brassicae junceae
As eating raw and vegetable for processing, main include：Root-mustard, Stem lettuce, leaf mustard and a kind of sedge, of Caulis et Folium Brassicae junceae, mainly make in China
Vegetable is planted.Be mainly seed with Caulis et Folium Brassicae junceae as oil crop, at present oil with Caulis et Folium Brassicae junceae in India, Canada, Australia
Arid area in state is widely cultivated.
From the world in 1984 the first transgene tobacco successful after, increasing crop transformation system all obtains
Successfully set up.In Brassica Crops, the transformation system of only cabbage type rape is successfully established at present, is mainly used in training
Educate transformed variety and the gene function checking of antiweed.But at home, the transgenic of the crop such as Chinese cabbage, Caulis et Folium Brassicae capitatae and Caulis et Folium Brassicae junceae
System is not also set up well.Genetic transfoumation can be used to carry out the cultivation of transgenic resistance kind, main use
In the transformed variety cultivating antiweed and disease and insect resistance.Genetic transfoumation also can be used in important gene function and grinds simultaneously
The technological means studied carefully, including functional complementation checking, overexpression analysis, promoter Analysis, gene silencing, gene editing etc..
With the appearance of gene editing technology, the rite-directed mutagenesises to Caulis et Folium Brassicae junceae genome for the technology such as the CRISPR/Cas9 realization can be passed through, more
The good yield, quality and the resistance that improve Caulis et Folium Brassicae junceae.With the development of genomics and molecular biology, by homologous clone or
The method of map based cloning, in Caulis et Folium Brassicae junceae, the gene of the Main Agronomic Characters such as blooming control, yield, disease-resistant, pest-resistant, quality will be entered
One step research.The foundation of transformation system plays indispensable to the application of gene site-directed editing technique and the checking of gene function
Effect, be even more important in production and practice.
At present the report with regard to the genetic transfoumation of Caulis et Folium Brassicae junceae have original position vacuum to penetrate into genetic transformation and with cotyledonary embryos or
The agrobcterium-mediated transformation that person hypocotyls are carried out for explant.It is low to there is conversion ratio in current method, time-consuming takes
The unfavorable factors such as power.In order to increase substantially transformation efficiency, carry out agriculture bacillus mediated Caulis et Folium Brassicae junceae using hypocotyls as explant
Genetic transformation, is experiment material using Caulis et Folium Brassicae junceae 00-6-102B, greatly improves transformation efficiency.Therefore, set up agriculture bacillus mediated
Caulis et Folium Brassicae junceae genetic transforming method, provide reliable guarantee by verifying for the genetic research of Caulis et Folium Brassicae junceae, gene function etc..
Content of the invention
It is an object of the invention to provide a kind of genetic transforming method of agriculture bacillus mediated Caulis et Folium Brassicae junceae, set up quick, efficiently
Agrobacterium-mediated Transformation Caulis et Folium Brassicae junceae regenerating system, improve conversion ratio, be Caulis et Folium Brassicae junceae transgenic technology service.
Concrete step of converting is as follows：
A kind of genetic transforming method of agriculture bacillus mediated Caulis et Folium Brassicae junceae, comprises the steps：
1). the juncea seeds after sterilizing are placed in M0 culture medium, light culture 5-7 days, grow up to Caulis et Folium Brassicae junceae etiolated seedling.
MO culture medium：MS culture medium 2.2-2.4g/L+ agar powder 2.5g/L；
Preferably, the sterilizing of juncea seeds comprises the steps：Take juncea seeds, with 75% alcohol-pickled 1-2 minute, then
With 0.15% mercuric chloride sterilizing 8-10 minute.Cleaned at least 3 times with the distilled water of sterilizing after the completion of sterilizing, each 2-3 minute.
2). cut Caulis et Folium Brassicae junceae etiolated seedling hypocotyls as explant, it is 0.8-1.0cm segment that hypocotyls are cut into length, cuts
Ensure during taking that otch is smooth, is placed on DM culture fluid moisturizing.
The formula of DM culture fluid includes：MS culture medium 4.4-4.6g/L+ sucrose 30g/L+ acetosyringone 100mg/L；
3). using usual manner, the Agrobacterium bacterium solution containing destination gene expression carrier is infected explant；
Preferably, the preparation of the Agrobacterium bacterium solution containing destination gene expression carrier includes：Destination gene expression will be contained
The Agrobacterium bacterium solution 4000rpm centrifugation 15min of carrier, abandons supernatant.DM culture fluid with 30-35ml is resuspended, will be resuspended after bacterium
Proceed in new sterilizing triangular flask, place into 28 DEG C of shaking table cultures 30min-1h；
Infect step to include：Ready bacterium solution is poured into the plate equipped with explant, contaminates 10-15 minute, period is every
Shake once it is ensured that bacterium solution is fully contacted with explant every 2-3 minute.Infect after finishing, explant is turned tiling to being placed with sterilizing
In the empty culture dish of filter paper, unnecessary bacterium solution is allowed to be blotted；
4). the explant after being infected is gone in M1 culture medium, after dark condition co-cultures 40-48h, will be outer on M1
Implant proceeds in M2 culture medium, is cultivated under illumination condition.
The formula of M1 culture medium includes：MS 4.4g/L+ sucrose 30g/L+ Mannitol 18g/L+2,4-D 1mg/L+ kinetins
0.3mg/L+ acetosyringone 100mg/L+ agarose 6g/L；
The formula of M2 culture medium includes：MS 4.4g/L+ sucrose 30g/L+ Mannitol 18g/L+2,4- dichlorphenoxyacetic acid
1mg/L+ kinetins 0.3mg/L+ kanamycin 50mg/L+ agarose 6g/L+ sodium sulfite and the complex of silver nitrate formation
0.1mol/L+ Ticarcillin/Clavulanate Acid 100mg/L；
5). after three weeks, the explant in M2 culture medium is proceeded in M3 culture medium, the M3 culture medium that every 3-4 week more renews,
Until growing calluss and inducing and have the green bud of growing point, cut the green bud containing growing point.
The formula of M3 culture medium includes：MS 4.4g/L+ glucose 10g/L+ xylose 0.25g/L+MES 0.6g/L+ agar
Sugared 6g/L+ trans-zeatin 2mg/L+ Ticarcillin/Clavulanate Acid 100mg/L+ auxin 0.1mg/L+ kanamycin 25mg/L；
6). the green bud containing growing point is proceeded to and in M4 culture medium, carries out root culture, may move into little Hua within 25-35 days
Middle seedling exercising growth.
The formula of M4 culture medium includes：MS 4.4-4.6g/L+ agarose 10g/L；
Above procedure ensures that sterile working, dark condition culture and illumination condition culture are all carried out in illumination cultivation room；
The pH of all culture medium is adjusted between 5.8-6.0；
Described illumination condition culture：16h illumination, 800-1000Lux, 8h are dark, 25 DEG C of temperature.
Preferably, the expression vector described in above scheme is pCAMBIA2300 commercial carrier, agrobacterium strains
GV3101.
Preferably, described Caulis et Folium Brassicae junceae is Caulis et Folium Brassicae junceae 00-6-102B.
Compared with prior art, the present invention has advantages below:
Successfully carry out genetic transformation experiment using Caulis et Folium Brassicae junceae 00-6-102B, and the transformation efficiency of genetic transformation is up to
More than 20%.In the tissue culture stage, required grain weight is relatively fewer, and reproduction speed is fast, from the beginning of Seed sterilization, to finally completing something lost
Pass conversion to transplant, general 70-90 days, pollution rate was than relatively low.
Brief description
Fig. 1 is to obtain resistance Seedling growing state schematic diagram with mustard type rape hypocotyls for explant.
A in wherein Fig. 1:The etiolated seedling of dark culturing 5-7 days；B in Fig. 1:M2 culture medium breaks up calluss；C in Fig. 1:
Callus induction in M3 culture medium goes out the Caulis et Folium Brassicae junceae containing growing point；D in Fig. 1：Root culture is carried out on M4 culture medium.Fig. 2
Caulis et Folium Brassicae junceae hau CMS sterile gene orf288 (73-288aa) functional verification expression vector schematic diagram.
35Spro represents CaMV35S promoter；Orf288 (73-288aa) is the part of sterile gene orf288 truncate；Rf
P is the signal peptide of Brassica campestris L pol CMS Restore gene；NOS is terminator.
The PCR detection of Fig. 3 resistant plant
Arrange as PS on wherein Fig. 3：rfp28873-288aaTransgenic positive plant；Arrange as PS under Fig. 3:orf28873-288aa
Transgenic positive plant.
Fig. 4 transgenic line phenotype
Transgenic PS：rfp28873-288aaAnd PS:orf28873-288aaThe flower pesticide of positive Seedling all show as male sterility.
Specific embodiment
Embodiment 1：
The embodiment of the present invention 1 illustrates taking the genetic transformation of Caulis et Folium Brassicae junceae hau CMS cytoplasmic male sterile gene as a example：
A kind of genetic transforming method of agriculture bacillus mediated Caulis et Folium Brassicae junceae, comprises the steps：
1) structure containing genes of interest carrier：
CaMV35S promoter is connected on pCAMBIA2300 carrier, and restriction enzyme site used is HindIII and PstI；
PS：rfp28873-288aaThe structure of carrier：Using overlapping pcr by signal peptide Rfp and rfp28873-288aaCore
Nucleotide sequence carries out overlap, and restriction enzyme site used includes：PstI and BamHI.
Required primer includes：
d-Rfp-L(PstI)：AACTGCAGATGGTGTTGAGGACACAGAGAT；
d-Rfp-R：TCGTATCAAAGAGATTACCATTCTATCGCTGGTGAGACCAGA；
d-orf215-L：TCTGGTCTCACCAGCGATAGAATGGTAATCTCTTTGATACGA；
orf215R(BamHI)：CGGGATCCTCAGTCTAGATAATGCCGGG.
With the DNA of hau CMS sterile line 00-6-102A for template amplification 28873-288aaFragment, (primer is d-
Orf215-L and orf 215R (BamHI)), R is expanded for masterplate with the DNA of the cabbage type rape B409 of pol CMS Restore gene
(primer is d-Rfp-L (PstI) and d-Rfp-R to the fragment of fp, and the fragment of amplification comprises sequence shown in SEQ ID NO.2, amino
Acid sequence is shown in SEQ ID NO.1), using thermal starting high-fidelity long segment polymerase Phusion High-Fidelity DN
A Polymerase (Thermo Scientific,http://www.thermoscientificbio.com) enter performing PCR expansion
Increase.PC R amplification program：98 DEG C of total degeneration 30S；98 DEG C of degeneration 10S, 55 DEG C of annealing 15S, 72 DEG C extend 30S, 34circles；
72 DEG C of overall elongation 10min.
After after amplification, product is detected by agarose gel electrophoresiies, using Tiangeng (http://www.tiangen.com/)
Agarose gel QIAquick Gel Extraction Kit reclaimed.Recovery product 1 with two fragments:1 (mol ratio) mixing is as masterplate, first
It is not added with left and right primer and enters performing PCR amplification according to program above, after 5 circulations of amplification, add d-Rfp-L (PstI) and orf
215R (Ba mHI) proceeds PCR reaction, and product digs glue reclaim.Recovery product directly uses Fermentas (Thermo
Scientific,http://www.thermoscientificbio.com) quick restricted enzyme carry out double digestion, double
Enzyme action 50ul system is as follows：
Fastdigestion buffer：5ul；PstI:2.5u；BamHI:2.5u；Recovery product/plasmid:25ul；
ddH2O 15ul.Endonuclease reaction is carried out in 37 DEG C of water-baths, time 45min.Digestion products are carried out reclaiming, connect final conversion
Escherichia coli TOP10, screening positive clone sample presentation sequencing.Extract plasmid conversion Agrobacterium GV1301 after sequencing is errorless, select
Positive colony is stand-by in -70 DEG C of Excised Embryos.
PS:orf28873-288aaThe structure of carrier：
Amplification purpose fragment orf28873-288aa：Required masterplate is hau CMS sterile line 00-6-102A, and primer is：
orf215L(PstI)：AACTGCAGATGGTAATCTCTTTGATACGA；
orf215R(BamHI)：CGGGATCCTCAGTCTAGATAATGCCGGG.
The target fragment amplifying (is comprised nucleotide sequence shown in SEQ ID NO.1, aminoacid sequence is SEQ ID
Shown in NO.3) carry out, after double digestion, being connected to the pC containing CaMV35S promoter using two kinds of enzymes of PstI and BamHI
On AMBIA2300 carrier.The carrier connecting finally is converted escherichia coli TOP10, screening positive clone sample presentation sequencing.Survey
Extract plasmid conversion Agrobacterium GV1301 after sequence is errorless, select positive colony in -70 DEG C of Excised Embryos.
2) genetic transformation of agriculture bacillus mediated Caulis et Folium Brassicae junceae：
(1) by Caulis et Folium Brassicae junceae hau CMS maintainer 00-6-102B (Wan et al., 2008) with 75% alcohol-pickled 1 minute,
Sterilized 8 minutes with 0.15% mercuric chloride again, then clean 3 times with the distilled water sterilizing, 3 minutes every time.Aseptic seed is swung to
In dark 7 days (Fig. 1 a) that germinate in M0 culture medium, grow up to Caulis et Folium Brassicae junceae etiolated seedling.
MO culture medium：MS culture medium 2.2g/L+ agar powder 2.5g/L；
(2) Caulis et Folium Brassicae junceae etiolated seedling hypocotyls are cut as explant, it is 0.8-1.0cm segment that hypocotyls are cut into length, cuts
Ensure during taking that otch is smooth, is placed on DM culture fluid moisturizing.
The formula of DM culture fluid includes：MS 4.4g/L+ sucrose 30g/L+ acetosyringone 100mg/L；
(3) using usual manner, the Agrobacterium bacterium solution containing destination gene expression carrier is infected explant；
PS will be included：rfp28873-288aaThe GV1301 Agrobacterium bacterium solution of carrier (Fig. 2) carries out bacterium liquid activation, and 28 ° are shaken bacterium
Overnight, treat that the OD value of bacterium solution reaches 0.6-0.8 and stops shaking bacterium.Bacterium solution is poured in centrifuge tube, falls after 4000rpm centrifugation 15min
Fall supernatant bacterium solution is resuspended with DM.Bacterium solution after resuspended is added to and infects 10 minutes containing cutting in the big ware of hypocotylar glass,
Period shakes once it is ensured that bacterium solution is fully contacted with explant every 2-3 minute.Infect after finishing, explant is turned tiling to putting
Have in the empty culture dish of sterilizing filter paper, allow unnecessary bacterium solution to be blotted；
(4) explant after being infected is gone in M1 culture medium, after dark condition co-cultures 8h, by M1 culture medium
Explant proceeds in M2 culture medium, carries out cultivating 3 weeks under illumination condition.
The formula of M1 culture medium includes：MS 4.4g/L+ sucrose 30g/L+ Mannitol 18g/L+2,4-D 1mg/L+ kinetins
0.3mg/L+ acetosyringone 100mg/L+ agarose 6g/L；
The formula of M2 culture medium includes：MS 4.4g/L+ sucrose 30g/L+ Mannitol 18g/L+2,4- dichlorphenoxyacetic acid
1mg/L+ kinetins 0.3mg/L+ kanamycin 50mg/L+ agarose 6g/L+ sodium sulfite and the complex of silver nitrate formation
0.1mol/L+ Ticarcillin/Clavulanate Acid 100mg/L；
After (5) three weeks, the explant (Fig. 1 b) in M2 is proceeded in M3 culture medium, the M3 culture medium more renewing for every 3 weeks, directly
To growing calluss and inducing and have the green bud of growing point (Fig. 1 c), cut the green bud containing growing point.
The formula of M3 culture medium includes：MS 4.4g/L+ glucose 10g/L+ xylose 0.25g/L+MES 0.6g/L+ agar
Sugared 6g/L+ trans-zeatin 2mg/L+ Ticarcillin/Clavulanate Acid 100mg/L+ auxin 0.1mg/L+ kanamycin 25mg/L；
(6) the green bud containing growing point is proceeded to and in M4 culture medium, carry out root culture (Fig. 1 d), may move within 30 days little
Spend middle seedling exercising growth.
The formula of M4 culture medium includes：MS 4.4g/L+ agarose 10g/L；
Above procedure ensures that sterile working, dark condition culture and illumination condition culture are all carried out in illumination cultivation room；
The pH of all culture medium is adjusted between 5.8-6.0；
Described illumination condition culture：16h illumination, 800-1000Lux, 8h are dark, 25 DEG C of temperature.
PS:orf28873-288aaThe method for transformation of carrier is ibid.
The transgenic B. juncea Seedling growing is carried out with sample of tissue simultaneously, after CTAB method extracts DNA, using sterile gene specially
Labelling carry out the detection of positive Seedling, partial detection such as Fig. 3, PS：rfp28873-288aaThe transformation efficiency of carrier is 26%；
PS:orf28873-288aaTransformation efficiency be 29%.
Plant to be planted Post flowering carries out Phenotypic Observation, wherein PS to the stamen of transgenic positive plant：rfp28873-288aaSun
Property Seedling and PS:orf28873-288aaTransgenic positive Seedling all show as male sterility (Fig. 4).
SEQUENCE LISTING
<110>Hua Zhong Agriculture University
<120>A kind of genetic transforming method of agriculture bacillus mediated Caulis et Folium Brassicae junceae
<130>A kind of genetic transforming method of agriculture bacillus mediated Caulis et Folium Brassicae junceae
<160> 4
<170> PatentIn version 3.1
<210> 1
<211> 648
<212> DNA
<213>Artificial sequence
<400> 1
atggtaatct ctttgatacg aatcaaagtc atttacctag tgagtccggc tttgcccctg 60
ttggggccct ttctatggta tgctttctcg ggttcgtctg gggagatagt gaatcaccaa 120
accgaggcct cttctgaagg gtttacgtat acttcggaca tgctggaaga ttcggccagt 180
tctgggcgta gctcgtcggt caatcaaccg attcagaggg aacaggctgg gccatccaat 240
gcctttcccg ccccccaacc caccgctgcc ccagcagctc aacagcagaa tcacctagat 300
caaccagctg gggaaaggga ggctagggcg caagagcacg cccgcatctc tgcggagatc 360
gaaaggatta tggcggcctg cgagaatgag gaggccgcca tgatacgcaa agcccacagc 420
ctcttgcatc aacttggcat aactctcgag gatgcagagg atgtcaagcg tgctctccag 480
ttggctctcc atgacgactg ggagcacgat atcgatgacc gtaagaggca tttcaccgtg 540
ctcaggcgaa acttcggaac agctcgctgt gagaaatgga attctttcat tgaggagctt 600
cggggtttag gcaaccatca ggtaaatgcc cggcattatc tagactga 648
<210> 2
<211> 159
<212> DNA
<213>Artificial sequence
<400> 2
atggtgttga ggacacagag atggaatcgt cttactactt tgagattggt tcatctccgt 60
tcaactgaga caggtactct gagaaatgct gctttcttcc aaagcccata cgaattcttc 120
ttctgcgtac aaggcttctc tggtctcacc agcgataga 159
<210> 3
<211> 215
<212> PRT
<213>Artificial sequence
<400> 3
Met Val Ile Ser Leu Ile Arg Ile Lys Val Ile Tyr Leu Val Ser Pro
1 5 10 15
Ala Leu Pro Leu Leu Gly Pro Phe Leu Trp Tyr Ala Phe Ser Gly Ser
20 25 30
Ser Gly Glu Ile Val Asn His Gln Thr Glu Ala Ser Ser Glu Gly Phe
35 40 45
Thr Tyr Thr Ser Asp Met Leu Glu Asp Ser Ala Ser Ser Gly Arg Ser
50 55 60
Ser Ser Val Asn Gln Pro Ile Gln Arg Glu Gln Ala Gly Pro Ser Asn
65 70 75 80
Ala Phe Pro Ala Pro Gln Pro Thr Ala Ala Pro Ala Ala Gln Gln Gln
85 90 95
Asn His Leu Asp Gln Pro Ala Gly Glu Arg Glu Ala Arg Ala Gln Glu
100 105 110
His Ala Arg Ile Ser Ala Glu Ile Glu Arg Ile Met Ala Ala Cys Glu
115 120 125
Asn Glu Glu Ala Ala Met Ile Arg Lys Ala His Ser Leu Leu His Gln
130 135 140
Leu Gly Ile Thr Leu Glu Asp Ala Glu Asp Val Lys Arg Ala Leu Gln
145 150 155 160
Leu Ala Leu His Asp Asp Trp Glu His Asp Ile Asp Asp Arg Lys Arg
165 170 175
His Phe Thr Val Leu Arg Arg Asn Phe Gly Thr Ala Arg Cys Glu Lys
180 185 190
Trp Asn Ser Phe Ile Glu Glu Leu Arg Gly Leu Gly Asn His Gln Val
195 200 205
Asn Ala Arg His Tyr Leu Asp
210 215
<210> 4
<211> 53
<212> PRT
<213>Artificial sequence
<400> 4
Met Val Leu Arg Thr Gln Arg Trp Asn Arg Leu Thr Thr Leu Arg Leu
1 5 10 15
Val His Leu Arg Ser Thr Glu Thr Gly Thr Leu Arg Asn Ala Ala Phe
20 25 30
Phe Gln Ser Pro Tyr Glu Phe Phe Phe Cys Val Gln Gly Phe Ser Gly
35 40 45
Leu Thr Ser Asp Arg
50
Claims (3)
1. a kind of genetic transforming method of agriculture bacillus mediated Caulis et Folium Brassicae junceae, comprises the steps：
1）. the juncea seeds after sterilizing are placed in M0 culture medium, light culture 5-7 days, grow up to Caulis et Folium Brassicae junceae etiolated seedling；
MO culture medium：MS culture medium 2.2-2.4 g/L+agar powder 2.5g/L；
2）. cut Caulis et Folium Brassicae junceae etiolated seedling hypocotyls as explant, it is 0.8-1.0cm segment that hypocotyls are cut into length, cuts
Ensure in journey that otch is smooth, is placed on DM culture fluid moisturizing；
The formula of DM culture fluid includes：MS culture medium 4.4-4.6 g/L+sucrose 30 g/L+acetosyringone 100mg/L；
3）. using usual manner, the Agrobacterium bacterium solution containing destination gene expression carrier is infected explant；
4）. the explant after being infected is gone in M1 culture medium, after dark condition co-cultures 40-48h, by the explant on M1
Body proceeds in M2 culture medium, is cultivated under illumination condition；
The formula of M1 culture medium includes：MS 4.4g/L+ sucrose 30 g/L+ Mannitol 18g/L+2,4-D 1mg/L+ kinetins
0.3mg/L+acetosyringone 100mg/L+ agarose 6g/L；
The formula of M2 culture medium includes：MS 4.4g/L+ sucrose 30g/L+ Mannitol 18g/L+ 2,4 dichlorophenoxyacetic acid
1mg/L+ kinetins 0.3mg/L+ kanamycin 50mg/L+agarose 6g/L+ sodium sulfite and the complex of silver nitrate formation
0.1mol/L+ Ticarcillin/Clavulanate Acid 100mg/L；
5）. after three weeks, the explant in M2 culture medium is proceeded in M3 culture medium, the M3 culture medium that every 3-4 week more renews, until
Grow calluss and induce and have the green bud of growing point, cut the green bud containing growing point；
The formula of M3 culture medium includes：MS 4.4g/L+ glucose 10g/L+ xylose 0.25g/L+MES 0.6g/L+ agarose
6g/L+ trans-zeatin 2mg/L+ Ticarcillin/Clavulanate Acid 100mg/L+ auxin 0.1mg/L+ kanamycin 25mg/L；
6）. the green bud containing growing point is proceeded to and in M4 culture medium, carries out root culture, may move in little Hua within 25-35 days
Seedling exercising grows；
The formula of M4 culture medium includes：MS 4.4-4.6 g/L+agarose 10g/L；
Above procedure ensures that sterile working, dark condition culture and illumination condition culture are all carried out in illumination cultivation room；All
The pH of culture medium is adjusted between 5.8-6.0；
Described illumination condition culture：16h illumination, 800-1000 Lux, 8h are dark, 25 DEG C of temperature.
2. the carrier in claim 1 methods described is pCAMBIA2300, and described Agrobacterium is GV3101.
3. the Caulis et Folium Brassicae junceae in claim 1 methods described is Caulis et Folium Brassicae junceae 00-6-102B.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610820962.0A CN106399355A (en) | 2016-09-13 | 2016-09-13 | Genetic transformation method of agrobacterium-mediated mustard |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610820962.0A CN106399355A (en) | 2016-09-13 | 2016-09-13 | Genetic transformation method of agrobacterium-mediated mustard |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106399355A true CN106399355A (en) | 2017-02-15 |
Family
ID=57999905
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610820962.0A Pending CN106399355A (en) | 2016-09-13 | 2016-09-13 | Genetic transformation method of agrobacterium-mediated mustard |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106399355A (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111100872A (en) * | 2020-01-14 | 2020-05-05 | 青海省农林科学院 | Agrobacterium-mediated genetic transformation method for brassica juncea type multi-chamber rape |
| CN112695055A (en) * | 2021-01-26 | 2021-04-23 | 安徽农业大学 | Agrobacterium tumefaciens-mediated genetic transformation method for peaches |
| CN114836468A (en) * | 2022-05-25 | 2022-08-02 | 东北林业大学 | High-efficiency white birch root transgenic method |
| CN115820726A (en) * | 2022-11-25 | 2023-03-21 | 常州市祝庄园艺有限公司 | Method for creating luminous dendrocalamus latiflorus by utilizing biotechnology |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102492721A (en) * | 2011-12-12 | 2012-06-13 | 河南省农业科学院 | Sesame genetic transformation method mediated by agrobacterium |
| CN103421840A (en) * | 2013-08-01 | 2013-12-04 | 华中农业大学 | Method for improving resistance of rape to Lepidoptera pests by transgenic technology |
-
2016
- 2016-09-13 CN CN201610820962.0A patent/CN106399355A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102492721A (en) * | 2011-12-12 | 2012-06-13 | 河南省农业科学院 | Sesame genetic transformation method mediated by agrobacterium |
| CN103421840A (en) * | 2013-08-01 | 2013-12-04 | 华中农业大学 | Method for improving resistance of rape to Lepidoptera pests by transgenic technology |
Non-Patent Citations (1)
| Title |
|---|
| 张燕: "农杆菌介导的抗虫基因cry2A*、Cry1C*对甘蓝型油菜的转化研究", 《中国优秀硕士学位论文全文数据库农业科技辑》 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111100872A (en) * | 2020-01-14 | 2020-05-05 | 青海省农林科学院 | Agrobacterium-mediated genetic transformation method for brassica juncea type multi-chamber rape |
| CN112695055A (en) * | 2021-01-26 | 2021-04-23 | 安徽农业大学 | Agrobacterium tumefaciens-mediated genetic transformation method for peaches |
| CN114836468A (en) * | 2022-05-25 | 2022-08-02 | 东北林业大学 | High-efficiency white birch root transgenic method |
| CN114836468B (en) * | 2022-05-25 | 2023-07-28 | 东北林业大学 | Betula alba root transgenic method |
| CN115820726A (en) * | 2022-11-25 | 2023-03-21 | 常州市祝庄园艺有限公司 | Method for creating luminous dendrocalamus latiflorus by utilizing biotechnology |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109575111B (en) | Ornithogalum caudatum QtHIPP37 gene and application thereof | |
| CN106399355A (en) | Genetic transformation method of agrobacterium-mediated mustard | |
| CN110643618A (en) | Jatropha curcas MYB transcription factor JcMYB16 gene and application thereof in improving drought resistance of plants | |
| CN106520782A (en) | Application of gene GmRAV1 related to photoperiod adjusting and controlling of soybean | |
| CN110885844B (en) | Alfalfa gene MsCYP20-3B and application thereof | |
| CN107641627A (en) | H gene, H protein and its application that a kind of regulation and control tomato I types glandular hairs are formed | |
| JPH03103127A (en) | Trans-genic plant belonging to cucumis melo species | |
| CN113150098A (en) | Application of GmEID1 protein in regulation and control of soybean flowering and main stem node number | |
| CN110760526B (en) | Sweet orange CsMYB120 gene and application thereof | |
| CN116497042B (en) | ANR gene clone of swallow flower and application thereof | |
| CN104404043A (en) | Promoter of gene Me094 related to bacterial-blight resistance of Oryza meyeriana | |
| CN111944844A (en) | Method for increasing tropane alkaloid content in belladonna | |
| CN111118028A (en) | White-spotted tiger eye evergreen dwarfing multi-tillering OtDWARF53 gene and application thereof | |
| CN113943740B (en) | NtCHA1 gene capable of regulating and controlling potassium content of tobacco leaves and application thereof | |
| CN115058433B (en) | Tobacco leaf yellowing regulatory gene NtMYB2, protein and application thereof | |
| CN111690679B (en) | Recombinant expression vector for cultivating cucumber male sterile line and construction method and application thereof | |
| CN110790831B (en) | Plant salt-tolerant drought-tolerant protein and coding gene and application thereof | |
| CN114085854A (en) | Rice drought-resistant and salt-tolerant gene OsSKL2 and application thereof | |
| CN109207487B (en) | Rape stain-resistant gene BnalPP1, and preparation method and application thereof | |
| CN116004647B (en) | Tobacco NtSWEET gene and application thereof | |
| CN116004646B (en) | Tobacco NtSWEET gene and application thereof | |
| CN116179588B (en) | Application of rice scaffold protein coding gene OsRACK1A in rice false smut resistance improvement | |
| CN113789308B (en) | Expression vector and application thereof in improving soybean biomass | |
| CN115704035B (en) | Tobacco NtDSR2 gene and application thereof | |
| CN115704036B (en) | Tobacco NtDSR1 gene and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20170215 |
|
| RJ01 | Rejection of invention patent application after publication |