CN110885844B

CN110885844B - Alfalfa gene MsCYP20-3B and application thereof

Info

Publication number: CN110885844B
Application number: CN201911207060.XA
Authority: CN
Inventors: 马西青; 葛玲巧; 翁银银; 曹晓会; 毛培胜
Original assignee: China Agricultural University
Current assignee: China Agricultural University
Priority date: 2019-11-29
Filing date: 2019-11-29
Publication date: 2021-07-13
Anticipated expiration: 2039-11-29
Also published as: CN110885844A

Abstract

The invention provides an alfalfa gene MsCYP20-3B and application thereof. The gene MsCYP20-3B provided by the invention can effectively improve the flowering time of alfalfa. The gene MsCYP20-3B and the sequence of the protein coded by the gene MsCYP20-3B are respectively shown as SEQ ID NO 1 and SEQ ID NO 2. The molecular mechanism of the gene in regulating and controlling the flowering time of the alfalfa is further determined by applying the gene, and the gene has important guiding significance for cultivating the early-maturing variety of the alfalfa, and is beneficial to improving the quality of the alfalfa.

Description

Alfalfa gene MsCYP20-3B and application thereof

Technical Field

The invention relates to the fields of biotechnology and plant genetic breeding, in particular to an alfalfa gene MsCYP20-3B and application thereof.

Background

Alfalfa (Medicago sativa L.), leguminous, compared with other leguminous pastures, has the nutritional value of various pastures, high and stable yield, easy cultivation and good reputation of the king of pastures. Alfalfa precocity has important effects on seed production, pasture harvesting, nutritional quality, and the like. The flowering time has important influence on the maturity and yield of alfalfa, the early and late flowering can influence the planting adaptability of alfalfa, excellent germplasm resources with ideal flowering time are obtained, and the method is an important target for the work of breeders.

Cyclophilins (CYPs) belong to the family of immunophilins, and are present in all organisms and are widely distributed in various organelles and other locations outside the cell. Has the activity of peptidyl prolyl cis-trans isomerase (PPIase), catalyzes the Xaa-Pro cis-trans isomerization of proline N-terminal peptide bond, is the rate-limiting step of protein folding, and plays a key role in the aspects of cell growth, maturation, space-time expression of signal transduction genes, stress response of plants, flowering time of plants and the like.

At present, the role of cyclophilin CYP genes in regulating and controlling the flowering time of plants is researched in Arabidopsis, but the functions of genes related to the flowering time are less researched in alfalfa, particularly the regulation genes of the photoperiod and temperature ways, and the molecular mechanism of the flowering time is not clear.

Disclosure of Invention

The invention aims to provide an alfalfa gene MsCYP20-3B and application thereof.

In order to achieve the object of the present invention, in a first aspect, the present invention provides alfalfa gene MsCYP20-3B, which is a gene encoding the following protein (a) or (B):

(a) a protein consisting of an amino acid sequence shown as SEQ ID NO. 2;

(b) 2, protein which is derived from (a) and has the same function by substituting, deleting or adding one or more amino acids in the sequence shown in SEQ ID NO. 2.

Alternatively, the nucleotide sequence of the alfalfa gene MsCYP20-3B is shown in SEQ ID NO. 1. The mRNA sequence was 756 bases. MsCYP20-3B can encode a protein having 251 amino acids.

In a second aspect, the present invention provides a biomaterial containing the gene MsCYP20-3B, including but not limited to recombinant DNA, expression cassettes, transposons, plasmid vectors, phage vectors, viral vectors, engineered bacteria, or non-regenerable plant parts.

In a third aspect, the invention provides application of the gene MsCYP20-3B or a biological material containing the gene MsCYP20-3B in regulation and control of plant growth and development. The gene MsCYP20-3B is overexpressed in medicago truncatula, the number of lateral branches of a transgenic plant is increased, the contents of endogenous abscisic acid and jasmonic acid are increased, and the growth of the plant is promoted.

In a fourth aspect, the invention provides application of the gene MsCYP20-3B or a biological material containing the gene MsCYP20-3B in regulation of plant photoperiod and promotion of plant flowering.

Under the conditions of short sunshine and low temperature treatment, the MsCYP20-3B gene expression is reduced, the MsCYP20-3B gene expression level in part of low-autumn-sleep-level alfalfa is obviously increased, and the early-flowering phenotype of the alfalfa is promoted.

In a fifth aspect, the invention provides application of the gene MsCYP20-3B or biological material containing the gene MsCYP20-3B in preparation of transgenic plants.

In a sixth aspect, the invention provides an application of the gene MsCYP20-3B or a biological material containing the gene MsCYP20-3B in plant breeding.

In the present invention, the plant includes dicotyledonous plants and monocotyledonous plants, preferably alfalfa plants, more preferably alfalfa, medicago truncatula.

In a seventh aspect, the present invention provides a method of promoting flowering in a plant, the method comprising:

1) allowing the plant to comprise said gene MsCYP 20-3B; or

2) And (3) over-expressing the gene MsCYP20-3B in the plant.

Preferably, the plant is alfalfa, medicago truncatula.

Such methods include, but are not limited to, transgenics, crosses, backcrosses, selfs, or asexual propagation.

Further, the method for overexpressing the gene MsCYP20-3B is selected from the following 1) to 4), or an optional combination thereof:

1) introducing a plasmid having the gene MsCYP20-3B into a plant;

2) by increasing the copy number of the gene MsCYP20-3B on a plant chromosome;

3) by operably linking a strong promoter to the gene MsCYP 20-3B;

4) by introducing an enhancer.

By the technical scheme, the invention at least has the following advantages and beneficial effects:

the invention provides a gene MsCYP20-3B capable of effectively improving flowering time of alfalfa, which is applied to determine a molecular mechanism of the gene in regulating and controlling flowering time of alfalfa and has important guiding significance for cultivating early-maturing varieties of alfalfa.

Extracting total RNA of roots, stems, leaves, flower buds, flowers and fruit pods of different tissue parts of the alfalfa, carrying out reverse transcription to obtain cDNA, carrying out MsCYP gene family fluorescence quantitative PCR analysis, wherein the experimental result is shown in figure 1, the MsCYP20-3B gene has the highest expression quantity in 30 CYP gene families and mainly expresses in the stems, the leaves, the flower buds, the flowers and the fruit pods, and the MsCYP20-3B is used for regulating and controlling the flowering phenotype of the alfalfa.

The florigen gene FTa1(FLOWERING LOCUS T a1) (GenBank: XM _003624521.2) is a key regulating factor for regulating and controlling plant FLOWERING, and we further detect the expression of MtCYP20-3B gene in alfalfa FTa1 mutant. Experimental results show that the MtCYP20-3B gene expression is obviously down-regulated in alfalfa fta1 mutant, and the deletion of Fta1 gene influences the MtCYP20-3B gene expression (figure 2).

The expression conditions of the MsCYP20-3B gene under different photoperiods, temperatures and gibberellin treatment conditions are further analyzed by using a alfalfa Mediterranean No. 1 material (figure 3), and experimental results show that the short-day and low-temperature treatment obviously influences the MsCYP20-3B expression. The MsCYP20-3B expression is also regulated and controlled in alfalfa with different autumn sleeping grades, the expression level is obviously increased in part of alfalfa with low autumn sleeping grades (figure 4), and the experimental results show that the MsCYP20-3B participates in regulating the flowering time of the alfalfa.

The invention also carries out phenotype analysis on the alfalfa mtcyp20-3B mutant of the tribulus, and compared with a control, the mutant plant is short and has delayed flowering time (figure 5), thereby further explaining that the CYP20-3B gene regulates the flowering time of the alfalfa. Lays a foundation for further researching the function of MsCYP20-3B and obtaining the alfalfa material of the early blossoms.

The invention obtains an over-expression strain containing MsCYP20-3B gene in the medicago truncatula by a transgenic technology, and experimental results show that the number of lateral branches of transgenic materials is obviously increased, the contents of endogenous abscisic acid and jasmonic acid are also increased, and the early-flowering phenotype is shown (figure 6).

Drawings

FIG. 1 is the expression profile of the CYP gene family of alfalfa according to the present invention.

FIG. 2 shows the expression of MsCYP0-3B gene in fta1 mutant. Wherein, R108: medicago truncatula wild type as control; fta 1: florigen gene mutant. Indicates significant difference, P < 0.05.

FIG. 3 shows MsCYP20-3B gene expression under different treatment conditions according to the present invention. Wherein, the long-day means in the light incubator, 16h light/8 h dark is cultured, the short-day means in the light incubator, 8h light/16 h dark is cultured, the low temperature means in the light incubator, 16h light/8 h dark is cultured at 4 ℃ for 24h, the gibberellin means in the light incubator, 16h light/8 h dark is cultured, and seedlings growing to the 7 th day are sprayed with 100 mu M gibberellin.

FIG. 4 shows the expression of MsCYP20-3B gene in alfalfa of different fall-asleep grades according to the present invention. Indicates significant difference, P < 0.05.

FIG. 5 is a late floral phenotype of a mutant of mtcyp20-3b of the invention. R108: the wild type control, mtcyp20-3b, fta1 were mutants.

FIG. 6 is a diagram of the MsCYP0-3B transgenic Medicago truncatula phenotype of the present invention. Wherein, A: MsCYP0-3B transgenic Medicago truncatula; b: wild type strain (R108) collateral phenotype; c: transgenic line lateral shoot phenotype; d: analyzing the expression quantity of the MsCYP0-3B gene of the transgenic strain; e: and (4) measuring the content of endogenous hormones in the transgenic strains. OEMsCYP20-3B-1, OEMsCYP20-3B-2, OEMsCYP20-3B-4 denote MsCYP20-3B overexpression transgenic line numbers, respectively. Indicates significant difference, P < 0.05.

FIG. 7 is a diagram showing the structure of pCAMBIA1300 super-flag vector.

Detailed Description

The invention provides a method for cloning an alfalfa MsCYP20-3B gene and constructing an expression vector, wherein an MsCYP20-3B alfalfa early flowering transgenic strain is obtained through genetic transformation, and the function of the alfalfa MsCYP20-3B gene is further researched. By applying the gene, the quality of the alfalfa can be improved.

Extracting total RNA of alfalfa, and reverse transcribing into cDNA. Designing a specific primer, carrying out PCR amplification to obtain a gene with the total length of 756bp, carrying out gel cutting recovery on a PCR product, connecting the recovered product with a pEASy-Blunt Zero cloning vector, extracting a plasmid after the conversion, carrying out PCR and enzyme cutting verification on the extracted plasmid, carrying out PCR cutting verification to obtain a target band with about 756bp, sending the target band to a company for sequencing, carrying out double enzyme cutting on the plasmid by using restriction enzymes HindIII and SalI, carrying out enzyme cutting recovery and purification on the target gene and a pCAMBIA1300 super-flag vector (Beijing Huayuyan Biotech limited company, VECT0510 and figure 7) respectively, connecting a target gene to a plant expression vector, extracting plasmids after transformation, carrying out PCR and enzyme digestion verification on the extracted plasmids, obtaining DNA bands of about 756bp through plasmid verification, and obtaining a10 kb pCAMBIA1300 super-flag vector through enzyme digestion verification, thereby indicating that the vector construction is successful. The recombinant vector is used for dip-dyeing the leaves of the medicago truncatula, and a foundation is laid for transforming the medicago truncatula with a subsequent gene vector to obtain an early-maturing transgenic plant.

The specific scheme is as follows:

1. taking alfalfa leaves as a material, extracting total RNA, performing reverse transcription to obtain cDNA, designing a primer for PCR, wherein an upstream primer has a HindIII enzyme cutting site, and a downstream primer has a SalI enzyme cutting site:

an upstream primer: 5'-AAGCTTATGGCATCTTTGTTCTCAACACAG-3'

A downstream primer: 5'-GTCGACCACCATCTAGAGGAAGTTCTCCAG-3'

2. PCR amplification target fragments, PCR product gel cutting recovery, recovered product electrophoresis detection and pEASy-Blunt Zero cloning vector connection, then transformation of Escherichia coli, selection of single clone, bacteria shaking and plasmid extraction, PCR and enzyme digestion verification of the extracted plasmid, plasmid verification to obtain approximately 756bp DNA bands, enzyme digestion verification to obtain 3956bp and approximately 756bp target bands, and sent to the company for sequencing to prove that the sequence has no error and the enzyme digestion site is consistent with the design. Preliminary evidence has succeeded in cloning the alfalfa MsCYP20-3B gene.

3. The plasmid is cut by restriction enzymes HindIII and SalI, a target gene and a pCAMBIA1300 super-flag vector are respectively cut by enzyme for recovery and purification, then the target gene is connected to a plant expression vector, escherichia coli is transformed, monoclonal selection and shaking are carried out, the plasmid is extracted, PCR and enzyme digestion verification are carried out on the extracted plasmid, a DNA band of about 756bp is obtained through the plasmid verification, a pCAMBIA1300 super-flag vector of 10kb and a target band of about 756bp are respectively obtained through the enzyme digestion verification, and the obtained DNA band is sent to a company for sequencing to prove that the enzyme cutting site in the sequence is correct, which indicates that the vector construction is successful.

The Flag tag protein encodes a hydrophilic polypeptide of 8 amino acids. The Flag tag protein usually does not interact with the target protein, does not influence the function and the property of the target protein, and can be used for downstream research on the fusion protein. After fusion expression of the target protein, affinity chromatography can be directly carried out through a flag, the active fusion protein can be purified, and the purification efficiency is high. Can be identified by an anti-flag antibody, and is convenient to detect and identify by methods such as Western Blot and the like.

The following examples are intended to illustrate the invention but are not intended to limit the scope of the invention. Unless otherwise indicated, the examples follow conventional experimental conditions, such as the Molecular Cloning handbook, Sambrook et al (Sambrook J & Russell DW, Molecular Cloning: a Laboratory Manual, 2001), or the conditions as recommended by the manufacturer's instructions.

Example 1 cloning of alfalfa MsCYP20-3B Gene

1.1 experimental materials including alfalfa, Escherichia coli competent strain DH5 alpha; EHA105 agrobacterium strain; cloning vector pEASy-Blunt Zero and plant expression vector pCAMBIA1300 super-flag, plant total RNA extraction kit, reverse transcription kit, restriction enzyme HindIII enzyme, Sal I enzyme and T₄DNA ligase, a plasmid extraction kit, a gel recovery kit and the like.

1.2 Experimental methods:

1.2.1 alfalfa Total RNA extraction (RNAprep Pure plant Total RNA extraction kit, centrifugal column type) the operation steps are as follows:

(1)50-100mg of plant leaves are quickly ground into powder in liquid nitrogen, 450ul of RL (beta-mercaptoethanol is added before use) is added, and the mixture is vortexed and vigorously shaken and uniformly mixed.

(2) All solutions were transferred to the filtration column CS (the filtration column CS was placed in the collection tube), centrifuged at 12000rpm (about 13400 Xg) for 2-5min, and the supernatant from the collection tube was carefully pipetted into the RNase-Free centrifuge tube, with the tip being kept from touching the cell debris pellet in the collection tube as much as possible.

(3) 0.5 times the volume of the supernatant of absolute ethanol (usually 225ul) was slowly added, mixed (in this case, precipitation may occur), the resulting solution and the precipitate were transferred to adsorption column CR3, centrifuged at 12,000rpm (about 13400 Xg) for 30-60sec, the waste liquid in the collection tube was discarded, and adsorption column CR3 was returned to the collection tube.

(4) 350ul deproteinizing solution RW1, 12,000rpm (about 13400 Xg) was added to the adsorption column CR3, and centrifuged for 30-60sec, and waste liquid in the collection tube was discarded, and the adsorption column CR3 was returned to the collection tube.

(5) Preparing DNase I working solution: 10ul of DNase I stock solution was put into a new RNase-Free centrifuge tube, 70ul of RDD solution was added, and gently mixed.

(6) 80ul of DNase I working solution was added to the center of the adsorption column CR3 and left at room temperature for 15 min.

(7) 350ul of deproteinizing solution RW1 was added to the adsorption column CR3, centrifuged at 12000rpm (about 13400 Xg) for 30-60sec, the waste liquid in the collection tube was discarded, and the adsorption column CR3 was returned to the collection tube.

(8) 500ul of rinsing solution RW (ethanol was added before use) was added to the adsorption column CR3, and the mixture was allowed to stand at room temperature for 2min, centrifuged at 12000rpm (about 13400 Xg) for 30-60sec, the waste liquid in the collection tube was discarded, and the adsorption column CR3 was returned to the collection tube.

(9) And (5) repeating the step (8).

(10) Centrifuged at 12000rpm (about 13400 Xg) for 2min and the waste liquid was decanted. The adsorption column CR3 was left at room temperature for several minutes to thoroughly dry the residual rinse solution from the adsorption material.

(11) Placing the adsorption column CR3 into a new RNase-Free centrifuge tube, and dripping 30-100ul RNase-Free ddH into the middle part of the adsorption membrane₂O, left at room temperature for 2min, and centrifuged at 12000rpm (about 13400 Xg) for 2min to obtain an RNA solution.

RNA samples were stored at-80 ℃.

1.2.2 Synthesis of cDNA

Removal of genomic DNA:

adding 1ug of total RNA into 5 Xg DNA Eraser Buffer 2.0 μ l and gDNA Eraser 1.0 μ l, and adding RNase Free ddH₂O10. mu.l, incubated at 42 ℃ for 2min (or 5min at room temperature), and placed on ice.

Reverse transcription reaction:

the reaction solution was prepared on ice.

1ug of total RNA was added to 4.0ul of a reaction mixture of 5 XPrimeScript Buffer 2 (for Real Time PCR), 1.0 ul of PrimeScript RT Enzyme Mix I, 1.0 ul of RT Primer Mix, and 10.0 ul of (r), and RNase Free ddH was finally added₂O20. mu.l, incubated at 37 ℃ for 15min, at 85 ℃ for 5sec, gently mixed andthe reaction was stopped by brief centrifugation and placing the tube on ice and storing at-20 ℃.

1.2.3 cloning of MsCYP20-3B Gene

Designing a primer for PCR, wherein an upstream primer has a HindIII enzyme cutting site, and a downstream primer has a SalI enzyme cutting site:

an upstream primer: 5'-AAGCTTATGGCATCTTTGTTCTCAACACAG-3'

A downstream primer: 5'-GTCGAC CACCATCTAGAGGAAGTTCTCCAG-3'

Carrying out PCR amplification by taking cDNA synthesized by reverse transcription as a template, wherein a 50ul amplification system: 2 XFly Super Mix 25 ul; 1ul of each of the forward and reverse primers; 1ul of cDNA; ddH₂O21 ul. And (3) amplification procedure: after pre-denaturation at 94 ℃ for 3min, 35 cycles of amplification were carried out using reaction conditions of 94 ℃ for 20 sec, 55 ℃ for 20 sec, and 72 ℃ for 1min, and the extension was carried out at 72 ℃ for 10min and then placed in a refrigerator at 4 ℃ for further use. And recovering a PCR product for electrophoresis detection, connecting a pEASy-Blunt Zero vector, transforming Trans1-T1 escherichia coli, extracting a plasmid, and sending the plasmid to Beijing Tianyihui-Chiyowa Biotech limited company for sequencing after plasmid PCR and enzyme digestion verification.

The general agarose gel DNA recovery comprises the following operation steps:

1. column equilibration step: to the adsorption column CA2 (the adsorption column was put into the collection tube), 500. mu.l of the equilibrium solution BL was added, and the tube was centrifuged at 12,000rpm (about 13,400 Xg) for 1min to remove the waste liquid from the collection tube, and the adsorption column was returned to the collection tube.

2. A single band of the target DNA was cut out of the agarose gel (excess was removed as much as possible) and placed in a clean centrifuge tube and weighed.

3. To the gel block was added an equal volume of solution PN (100. mu.l of PN solution if the gel weighed 0.1g and the volume was considered to be 100. mu.l), and placed in a water bath at 50 ℃ with the centrifuge tube gently turned upside down to ensure that the gel block was fully dissolved. If the undissolved lumps of gum remain, the mixture can be kept standing for a few minutes or some sol solution can be added again until the lumps of gum are completely dissolved (if the volumes of the lumps of gum are too large, the lumps of gum can be cut into pieces in advance).

4. Adding the solution obtained in the previous step into an adsorption column CA2 (adsorption column is placed into a collection tube), standing at room temperature for 2min, centrifuging at 12,000rpm (about 13,400 Xg) for 30-60sec, discarding the waste liquid in the collection tube, and placing adsorption column CA2 into the collection tube.

5. To the adsorption column CA2, 600. mu.l of rinsing solution PW (previously used to check whether or not absolute ethanol has been added) was added, centrifuged at 12,000rpm (about 13,400 Xg) for 30-60sec, the waste liquid in the collection tube was discarded, and the adsorption column CA2 was placed in the collection tube.

6. Operation 5 is repeated.

7. The adsorption column CA2 was returned to the collection tube and centrifuged at 12,000rpm (about 13,400 Xg) for 2min to remove the rinse as much as possible. The adsorption column CA2 was left at room temperature for several minutes and thoroughly dried to prevent the residual rinse from affecting the next experiment.

8. Placing the adsorption column CA2 in a clean centrifuge tube, suspending and dropwise adding appropriate amount of elution buffer EB into the middle position of the adsorption membrane, and standing at room temperature for 2 min. The DNA solution was collected by centrifugation at 12,000rpm (about 13, 400 Xg) for 2 min.

Gene cloning operation:

cloning reaction system:

PCR amplification product 0.5-4ul

pEASy-Blunt Zero Cloning Vector 1ul

Mix gently and react for 5 minutes at room temperature (20 ℃ C. -37 ℃ C.). After the reaction was completed, the centrifuge tube was placed on ice.

E, transformation of escherichia coli:

(1) the ligation product was added to 50ul Trans1-TI competent cells (ligation product was added just after thawing of the competent cells), gently mixed and ice-cooled for 20-30 min.

(2) The water bath was heat-shocked at 42 ℃ for 30 seconds and immediately placed on ice for 2 minutes.

(3) 250ul of SOC or LB medium equilibrated to room temperature was added thereto, and the mixture was cultured at 37 ℃ and 200rpm for 1 hour.

(4) 200ul of the bacterial suspension was plated and cultured overnight (1, 500 Xg for l min to obtain more clones, part of the supernatant was discarded, I00-150ul was retained, the cells were suspended by flicking, all the bacterial suspension was plated and cultured overnight).

Plasmid extraction:

the operation steps are as follows:

1. column equilibration step: 500. mu.l of the equilibration solution BL was added to the adsorption column CP3 (the adsorption column was placed in the collection tube), and the tube was centrifuged at 12,000rpm (about 13,400 Xg) for 1min to remove the waste solution from the collection tube, and the adsorption column was replaced in the collection tube. (please use the column treated the same day)

2. 1-5ml of overnight-cultured bacterial liquid was taken, added to a centrifuge tube, centrifuged at 12,000rpm (about 13, 400 Xg) for 1min using a conventional tabletop centrifuge, and the supernatant was removed as much as possible (when the bacterial liquid was large, the bacterial pellet was collected in one centrifuge tube by centrifugation for several times).

3. Add 250. mu.l of solution P1 to the tube containing the pellet (please check if RNase A had been added first) and suspend the pellet thoroughly using a pipette or vortex shaker.

4. 250. mu.l of the solution P2 was added to the tube and gently turned upside down 6 to 8 times to lyse the cells sufficiently.

5. Add 350. mu.l of solution P3 to the tube, turn gently up and down 6-8 times immediately, mix well, at which time white flocculent precipitate will appear. Centrifuge at 12,000rpm (about 13, 400 Xg) for 10 min.

6. The supernatant collected in the previous step was pipetted into adsorption column CP3 (the adsorption column was put into the collection tube), taking care not to aspirate the pellet as much as possible. Centrifuge at 12,000rpm (about 13,400 Xg) for 30-60sec, remove waste liquid from the collection tube, and place adsorption column CP3 in the collection tube.

7. Optional steps are as follows: the adsorption column CP3 was added with 500. mu.l of deproteinized solution PD, centrifuged at 12,000rpm (about 13,400 Xg) for 30-60sec, the waste liquid in the collection tube was discarded, and the adsorption column CP3 was replaced in the collection tube.

8. 600 μ l of rinsing solution PW (please check whether absolute ethanol has been added or not) was added to the adsorption column CP3, centrifuged at 12,000rpm (about 13, 400 Xg) for 30-60sec, the waste liquid in the collection tube was discarded, and the adsorption column CP3 was placed in the collection tube.

9. Operation 8 is repeated.

10. The adsorption column CP3 was placed in a collection tube and centrifuged at 12,000rpm (about 13,400 Xg) for 2min in order to remove the residual rinse from the adsorption column.

11. The adsorption column CP3 was placed in a clean centrifuge tube, 50-100. mu.l of elution buffer EB was added dropwise to the middle of the adsorption membrane, and the solution was centrifuged at 12,000rpm (about 13, 400 Xg) for 2min at room temperature to collect the plasmid solution in the centrifuge tube.

The total length of the gene is 756bp, shown in SEQ ID NO. 1, and the amino acid sequence of the protein coded by the gene is shown in SEQ ID NO. 2. This gene was designated as MsCYP 20-3B.

EXAMPLE 2 construction of plant expression vectors

A specific product is amplified by using pEASy-MsCYP20-3B plasmid cloned on pEASy-Blunt Zero vector as a template by utilizing a forward primer and a reverse primer, wherein the designed primer (the forward primer: ACTGGCCGTCGTTTTAC; and the reverse primer: CAGGAAACAGCTATGAC) adopts high-fidelity enzyme amplification, the amplification reaction condition is that 35 cycles are carried out at 94 ℃ for 3min, (94 ℃ for 20s, 55 ℃ for 20s and 72 ℃ for 1min), and the amplification reaction is carried out at 72 ℃ for 10min and 4 ℃. The product was purified and recovered, and digested simultaneously with HindIII and SalI, and the digestion system contained 30ul of plasmid, 1ul each of HindIII and SalI, 10ul of CutSmart Buffer, and ddH, in 100ul of digestion system₂O58 ul, at 37 ℃ for 3h, electrophoretically recovering the target strip (Beijing Quanyujin Biotechnology Co., Ltd.,

zero Cloning Kit). The MsCYP20-3B gene of alfalfa is connected to a plant expression vector pCAMBIA1300 SUPER-flag by T4 DNA ligase, and is connected overnight at 16 ℃, an escherichia coli host is transformed into Trans1-T1, and a clone with positive transformation is selected by PCR identification, and is further identified by sequencing, wherein a sequencing primer adopts a vector self primer SUPER-flag F: ACACGCCAAGCCTCGCTAGT and SUPER-flag R: CATGCTTAACGTAATTCAACAG are provided. After the sequencing identification of the insert, agrobacterium EHA105 competent cells were transformed. Screening positive clones, and after the quality-improved grains are subjected to restriction enzyme digestion verification, proving that the transformation into agrobacterium is successful. The expression vector can be directly used for transforming plants such as medicago truncatula, medicago sativa, arabidopsis thaliana, tobacco and the like.

Agrobacterium EHA105 transformation:

the transformation method comprises the following steps:

1. competent cells of Agrobacterium were thawed in ice water at-80 ℃.

2. Under the aseptic condition, adding the plasmid to be transformed into the just thawed competent cell suspension, adding 1ug (the volume is not more than 10uL) of plasmid DNA into every 100uL of competent cells, and gently mixing. Standing in ice water bath for 5 min.

3. The tube was snap frozen in liquid nitrogen for 5 minutes.

4. The centrifuge tube was rapidly placed in a 37 ℃ water bath for 5 minutes without shaking the water surface. Then quickly transferred to an ice water bath and kept stand for 5 minutes.

5. Adding 800uL antibiotic-free 2 XYT or LB liquid medium, and shake-culturing at 28-30 deg.C for 2-3 hr. The cells were recovered and the resistance was expressed.

6. Centrifuging at 5000rpm for 1min to collect bacteria, reserving about 100uL of supernatant, lightly blowing and beating the resuspended bacteria, uniformly coating the bacteria on an LB solid culture medium flat plate containing corresponding antibiotics, after the liquid in the flat plate is completely absorbed, inverting the flat plate, and culturing at 28-30 ℃ for 48-72 h.

Example 3 genetic transformation of MsCYP20-3B Gene

1. Carrying out MsCYP20-3B gene genetic transformation on the medicago truncatula tissue culture seedlings by adopting an agrobacterium transformation method, and specifically comprising the following operation steps:

(1) seed disinfection

In an ultra-clean bench, shaking and rinsing with 75% alcohol for 60s, soaking with 50% concentrated sulfuric acid for 5-10 min, washing with sterile water for 3-5 times, shaking and sterilizing with 5% sodium hypochlorite for 40-50 min, and washing with sterile water for 3-5 times.

(2) Sterile seedling culture

And (3) inoculating the disinfected seeds on 1/2MS solid culture medium, wherein 20 seeds are placed in each dish in a dark place of a culture room for 1-2 days, and after the seeds germinate, the seeds are placed under light for culture.

(3) Preparation of bacterial liquid

Diluting 100ul Agrobacterium tumefaciens bacterial liquid to 20ml with YEP liquid culture medium containing rifampicin 25mg/L and kanamycin 100mg/L, shaking on shaking table at 28 deg.C and 220rpm, and waiting for OD of bacterial liquid₆₀₀Is up toTo 0.8-1.0. Centrifuging the bacteria liquid at 3000rpm for 10min, re-suspending the collected bacteria liquid, adding the re-suspended liquid into AS 150ul/L, OD₆₀₀The temperature reaches 0.5-0.6 ℃, the mixture is slowly shaken on a shaking table with 80rpm at 28 ℃ for 2 hours for standby.

(4) Preparation of explants: taking the complete and mature leaves of the aseptic seedlings cultured for 4-6 weeks by using aseptic scissors, and cutting the leaves into wounds by using a sterile scalpel.

(5) Infection and Co-cultivation

The explant leaves were cut into small pieces and placed in 50ml centrifuge tubes, to which approximately 10ml of ice-cold 3% sucrose solution (containing 300. mu.M Gln, 1. mu.M EGTA and 1mM CaCl) was added₂) The ice bath was carried out for 20min, and the sucrose solution was decanted off. About 20ml of a bacterial solution (containing 300. mu.M Gln, 1. mu.M EGTA, 1mM CaCl) was poured thereinto₂And 150 μ M AS), evacuating to 0.08MPa in a vacuum pump for about 10 min. Infection at 28 ℃ with 80rmp for 20 min. The inoculum was decanted and the infected explants transferred to sterile filter paper and slightly dried. And inoculating the infected explants on a co-culture medium, and performing dark culture for 2-3 days until bacterial plaques are found.

Wherein Gln, EGTA and AS are glutamine, ethylene glycol bis (2-aminoethyl ether) tetraacetic acid and acetosyringone respectively.

(6) Screening culture

The co-cultured explants were inoculated on selection medium (hygromycin 5mg/L) and cultured for two weeks. Hygromycin increased to 10mg/L and was cultured for two weeks. The callus was then placed in 16h light/8 h dark for 10 days. Successfully inducing the callus. The green, viscous callus was inoculated on differentiation medium and subcultured once every two weeks.

(7) Somatic embryo germination and rooting

Inoculating the embryoid to a rooting culture medium for rooting culture to obtain a transgenic plant.

(8) Media composition

YEP medium: 10g/L tryptone, 10g/L yeast extract, 5g/L sodium chloride, solid plus 15g/L agar (pH 7). When the bacteria were cultured, rifampicin 50mg/L and kanamycin 100mg/L were added.

② co-culture medium: modified N6 medium, 3.0 mg/L2, 4-D, 0.05mg/L KT, 0.6g/L MES, 150. mu.M AS (pH 5.4).

③ selecting a culture medium: modified N6 culture medium, 2.0 mg/L2, 4-D, 0.05mg/L KT, 0.6g/L

MES, 200mg/L timentin, 5mg/L or 10mg/L hygromycin (pH 5.8).

Fourthly, differentiation culture medium: modified N6 medium, 0.4mg/L KT, 0.6g/L MES, 200mg/L timentin, 5mg/L hygromycin (pH 5.8).

Fifthly, rooting culture medium: MS culture medium (15g/L sucrose), 100mg/L inositol, 100mg/L timentin, 1mg/L hygromycin (pH5.8).

Wherein the 2,4-D, KT and MES are respectively 2, 4-dichlorophenoxyacetic acid, kinetin and 2- (N-morpholine) ethanesulfonic acid.

The invention provides a cloning method and an expression vector of alfalfa genes, lays a foundation for transforming alfalfa tribulus to obtain transgenic plants through a subsequent MsCYP20-3B gene vector, and plays an important role in new species cultivation, production and popularization.

Example 4 overexpression of the MsCYP20-3B Gene in Medicago truncatula

According to example 3, 11 MsCYP20-3B gene overexpression materials were obtained in Medicago truncatula, wherein OEMsCYP20-3B-1, OEMsCYP20-3B-2, OEMsCYP20-3B-4 showed significantly higher branching numbers in the transgenic lines compared to the control R108 (12.33 lateral branches on average compared to the control) and flowering time was advanced by 5 days on average. Meanwhile, the content of endogenous hormones is measured to show that the contents of ABA and JA are respectively increased by 1.57 times and 2.23 times compared with the content of a control, and the increase of the lateral branches of the medicago truncatula is possibly promoted.

Although the invention has been described in detail hereinabove with respect to a general description and specific embodiments thereof, it will be apparent to those skilled in the art that modifications or improvements may be made thereto based on the invention. Accordingly, such modifications and improvements are intended to be within the scope of the invention as claimed.

Sequence listing

<110> university of agriculture in China

<120> alfalfa gene MsCYP20-3B and application

<130> KHP191115741.0

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 756

<212> DNA

<213> alfalfa (Medicago sativa L.)

<400> 1

atggcatctt tgttctcaac acagttggtg cagagtcaga accttctttc tggtttcaat 60

gctgtccagg ggaagtcaca tgcagtctgt agcagtacca gagcacacct tggatgcagt 120

aaattgtcat caggatatca ttacgcggct aggctttcgg tgtcacaaca atctaaagcg 180

aaatcaatca cttctcggag aataacatgt actagtagtg ctagtgctgc agatctgcaa 240

gccaaagtaa caagcaaggt tttctttgat gtagttattg gaggtgaatc tgctggaagg 300

attgttattg gcctatttgg agatgttgtt cccaaaacag ttgagaattt ccgagctttg 360

tgcacaggag agaaaggata tggttacaaa gattccacct tccatcgcat aatcaaagat 420

ttcatgattc agggagggga cttcacagaa ggaaatggaa ctggtggagt cagtatctat 480

ggtggtaaat ttgaagatga gaattttact ttgaagcatg ttggtcctgg agttttgagc 540

atggcaaatg ccggtcctaa tagtaacggc agtcaatttt ttatttgcac tgtaccgact 600

tcatggttgg acaatcgcca tgttgtattt ggacatgtca ttgatggaat ggatgttgtg 660

aggacacttg aatcacagga gacaagcagc tacaacaatg gtcccttgaa aacatgcaaa 720

attgttaact ctggagaact tcctctagat ggttga 756

<210> 2

<211> 251

<212> PRT

<213> alfalfa (Medicago sativa L.)

<400> 2

Met Ala Ser Leu Phe Ser Thr Gln Leu Val Gln Ser Gln Asn Leu Leu

1 5 10 15

Ser Gly Phe Asn Ala Val Gln Gly Lys Ser His Ala Val Cys Ser Ser

20 25 30

Thr Arg Ala His Leu Gly Cys Ser Lys Leu Ser Ser Gly Tyr His Tyr

35 40 45

Ala Ala Arg Leu Ser Val Ser Gln Gln Ser Lys Ala Lys Ser Ile Thr

50 55 60

Ser Arg Arg Ile Thr Cys Thr Ser Ser Ala Ser Ala Ala Asp Leu Gln

65 70 75 80

Ala Lys Val Thr Ser Lys Val Phe Phe Asp Val Val Ile Gly Gly Glu

85 90 95

Ser Ala Gly Arg Ile Val Ile Gly Leu Phe Gly Asp Val Val Pro Lys

100 105 110

Thr Val Glu Asn Phe Arg Ala Leu Cys Thr Gly Glu Lys Gly Tyr Gly

115 120 125

Tyr Lys Asp Ser Thr Phe His Arg Ile Ile Lys Asp Phe Met Ile Gln

130 135 140

Gly Gly Asp Phe Thr Glu Gly Asn Gly Thr Gly Gly Val Ser Ile Tyr

145 150 155 160

Gly Gly Lys Phe Glu Asp Glu Asn Phe Thr Leu Lys His Val Gly Pro

165 170 175

Gly Val Leu Ser Met Ala Asn Ala Gly Pro Asn Ser Asn Gly Ser Gln

180 185 190

Phe Phe Ile Cys Thr Val Pro Thr Ser Trp Leu Asp Asn Arg His Val

195 200 205

Val Phe Gly His Val Ile Asp Gly Met Asp Val Val Arg Thr Leu Glu

210 215 220

Ser Gln Glu Thr Ser Ser Tyr Asn Asn Gly Pro Leu Lys Thr Cys Lys

225 230 235 240

Ile Val Asn Ser Gly Glu Leu Pro Leu Asp Gly

245 250

Claims

1. The alfalfa gene MsCYP20-3B or the biological material containing the gene is applied to promoting the flowering of plants; the plant is a medicago plant;

the amino acid sequence of the protein coded by the alfalfa gene MsCYP20-3B is shown in SEQ ID NO. 2;

the biological material includes expression cassettes, transposons, plasmid vectors, viral vectors, engineered bacteria, or non-regenerable plant parts.

2. Use according to claim 1, wherein the plant is alfalfa or medicago truncatula.

3. A method of promoting flowering in a plant, said method comprising: allowing the plants to over-express alfalfa gene MsCYP 20-3B;

the plant is alfalfa or tribulus alfalfa;

the methods include transgenic, hybrid, backcross, selfing, or vegetative propagation.

4. The method according to claim 3, wherein the method for overexpressing the gene MsCYP20-3B is selected from the following 1) to 4), or an optional combination thereof:

1) introducing a plasmid having the gene MsCYP20-3B into a plant;

2) by increasing the copy number of the gene MsCYP20-3B on a plant chromosome;

3) by operably linking a strong promoter to the gene MsCYP 20-3B;

4) by introducing an enhancer.