CN115819531B - Application of overexpression of MtWUSCHEL gene in increasing leaf area and delaying flowering of leguminous forage - Google Patents

Abstract

The invention discloses an application of over-expression of a medicago sativa MtWUSCHEL gene in increasing the leaf area of leguminous forage and delaying flowering; wherein the nucleotide sequence of the alfalfa MtWUSCHEL gene is shown as SEQ ID No. 1. In the invention, a plant over-expression vector is constructed by utilizing a gene MtWUSCHEL under the background of alfalfa, and genetic transformation operation is carried out to obtain an over-expression transgenic plant. Analysis shows that the pasture quality of the over-expression plant is obviously improved, the flowering time of alfalfa is delayed by up to 20 days, and the leaf area can be improved by about 11%. The application of the invention is expected to play an important role in cultivating novel leguminous forage plant varieties, and has great significance in promoting the production of economic crops in the grass industry in China.

Description

Application of overexpression of MtWUSCHEL gene in increasing leaf area and delaying flowering of leguminous forage

Technical Field

The present invention relates to an application of a transcription factor WUSCHEL (WUS) gene related to stem cell determination in shoot apex, and in particular to an application of an overexpressed Medicago truncatula MtWUSCHEL (abbreviated as MtWUS) gene in increasing the leaf area of leguminous forage (such as alfalfa) and delaying flowering, belonging to the field of biological genetic engineering technology.

Background technique

Alfalfa is known as the "king of forage grass". It is the earliest and most widely cultivated excellent legume forage grass in the world. It is one of the important sources of protein feed in animal husbandry production. It has great production and utilization potential and research value because of its strong stress resistance, high yield and good palatability. However, my country's alfalfa has problems such as low yield and poor quality, which is far from meeting the various needs of animal husbandry and grass industry development. Therefore, it is urgent to improve the yield and quality of alfalfa to meet the needs of the market.

The protein of alfalfa is mainly found in the leaves, and the leaves can contribute up to 60% of the grass yield. Therefore, the leaves are not only an important indicator of alfalfa growth and development, yield composition and variety characteristics, but also one of the important indicators reflecting the nutritional value of alfalfa forage. Generally speaking, the larger the leaf area, the richer the protein content, the higher the nutritional value of alfalfa, and the higher the utilization value. Therefore, the selection and breeding of new alfalfa varieties with rich leaves, high protein content and high quality has always been the goal pursued by alfalfa breeders.

Flowering is the key to the transition of alfalfa from vegetative growth to reproductive growth. The decline in forage quality during the flowering period is a common problem for forage crops, which has a great impact on alfalfa forage yield. Trying to delay alfalfa flowering is expected to improve the following aspects: first, its vegetative growth stage is extended, biomass accumulation is increased, and the high quality of forage is maintained for a longer time; second, by delaying flowering, the plant can be protected from the effects of late winter and early spring frost; third, the harvest time of alfalfa can be extended to facilitate field management. However, the genetic and genomic basis of alfalfa flowering time and biomass regulation is still unclear, mainly due to the autologous polyploid characteristics of the species and the lack of sufficient genomic resources.

WUS is a member of the WOX (WUSCHEL-RELATED HOMEOBOX) gene family and plays an important regulatory role in key periods of plant development, including the maintenance of stem cell niches and the development of the stem apical meristem (SAM) (Clark, 2001; Fletcher, 2002; Kieffer et al., 2006; Laux et al., 1996). The functional loss of OsWUS in rice leads to a decrease in the number of tillers (Xia et al., Plant Journal, 2020, 104, 1635-1647). In maize, ZmWUS1 and ZmWUS2 are highly expressed in the axillary meristem (AM) and are involved in branching regulation (Nardmann and Werr, 2006). In Medicago truncatula, it has been reported that the homologous gene HDL (HEADLESS) of WUS functions as a transcriptional repressor. The loss-of-function mutants of HDL show blocked development of axillary meristems and loss of apical dominance, heart-shaped leaves, etc. (Ikeda et al., 2009; Meng et al., 2019). However, there are no reports on the application of overexpression of the MtWUSCHEL gene in increasing leaf area and delaying flowering in leguminous forages (such as alfalfa).

Summary of the invention

In view of the shortcomings of the prior art, the problem to be solved by the present invention is to provide an application of overexpressing Medicago truncatula MtWUSCHEL (MtWUS) gene in increasing the leaf area of leguminous forage and delaying flowering.

The invention discloses an application of the overexpressed Medicago truncatula MtWUSCHEL (MtWUS) gene in increasing the leaf area of leguminous forage and delaying flowering; wherein the nucleotide sequence of the Medicago truncatula MtWUSCHEL gene is shown in SEQ ID No.1, and the amino acid sequence encoded by the gene is shown in SEQ ID No.2; and the application is achieved by cloning the MtWUSCHEL gene coding sequence from Medicago truncatula by RT-PCR technology, constructing a plant overexpression vector, and carrying out plant transgenic operation to introduce the MtWUSCHEL gene into leguminous forage plant cells to obtain a leguminous forage transgenic strain overexpressing the MtWUSCHEL gene.

In the above application: the leguminous forage is preferably alfalfa or Medicago truncatula.

In the above application: the plant overexpression vector is preferably pEarleyGate103-MtWUS.

The invention discloses an application of the overexpressed Medicago truncatula MtWUSCHEL gene in improving the forage quality of alfalfa; wherein the nucleotide sequence of the Medicago truncatula MtWUSCHEL gene is shown in SEQ ID No.1.

The applicant cloned the MtWUS gene coding sequence from Medicago truncatula by RT-PCR using primers MtWUS-F (CACCATGGAACAGCCTCAACAACAACAAC) and MtWUS-R (TTAATTAGCATAATCTGGTGACCTACAGC), constructed a plant overexpression vector pEarleyGate103-MtWUS, and introduced the plant transgenic operation into alfalfa plant cells to obtain alfalfa transgenic strains overexpressing the MtWUS gene. Tests showed that the leaf area of the plants overexpressing MtWUS increased, the quality of forage was significantly improved, and the flowering time was significantly delayed (about 20 days), which is much higher than the current alfalfa varieties.

The beneficial effect of the present invention is that the overexpression of the MtWUSCHEL gene of Medicago truncatula in the compound-leaf species alfalfa for the first time significantly increases the leaf area of the transgenic plants and delays the flowering time (see Figures 1 and 2), and the results show that the flowering time of alfalfa can be delayed by up to 20 days, and the leaf area can be increased by about 11%. It is predicted that the application of the present invention is expected to play an important role in the cultivation of new leguminous forage plant varieties, which also provides a new theoretical basis and practical foundation for crop improvement, and is of great significance to promoting the production of cash crops in my country's grass industry.

BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1. Flowering time analysis of transgenic alfalfa lines overexpressing the MtWUS gene.

Among them, A is the whole plant phenotype of WT and MtWUS overexpressing plants, B is the top flowering phenotype of WT plants, C-E are the top non-flowering phenotypes of different strains of MtWUS overexpressing plants, F is the statistical number of internode positions where the first flower appears in WT and MtWUS overexpressing plants, and G is the statistical number of days for the first flower to appear in WT and MtWUS overexpressing plants; WT is the wild type, and OE-1, OE-3 and OE-5 are different strains of MtWUS overexpressing plants.

The results showed that wild-type alfalfa plants bloomed in about 40 days, while transgenic alfalfa plants overexpressing the MtWUS gene bloomed in about 60 days, indicating that overexpression of the MtWUS gene significantly delayed the flowering time of alfalfa.

Figure 2. Leaf phenotype and related index analysis of transgenic alfalfa lines overexpressing the MtWUS gene.

Among them, A is the leaf phenotype of WT and MtWUS overexpressing plants, B is the leaf area statistics of WT and MtWUS overexpressing plants, C is the length-width ratio statistics of leaves of WT and MtWUS overexpressing plants, D is the crude protein content determination of leaves of WT and MtWUS overexpressing plants, E is the fresh weight statistics of WT and MtWUS overexpressing plants, F is the total chlorophyll, chlorophyll a and chlorophyll b content statistics of leaves of WT and MtWUS overexpressing plants; WT is the wild type, OE-1, OE-3 and OE-5 are different strains of MtWUS overexpressing plants.

The results showed that compared with the wild type, the leaves of transgenic alfalfa plants overexpressing the MtWUS gene became larger and the leaves were greener. For this purpose, the wild type and MtWUS overexpressing plants with the same growth status were selected to calculate the leaf area, leaf width-to-length ratio, leaf crude protein content, fresh weight and chlorophyll content. The results showed that the leaf area, leaf width-to-length ratio, leaf crude protein content, fresh weight and chlorophyll content of the MtWUS overexpressing plants were significantly higher than those of the wild type, indicating that the MtWUS gene plays a significant role in improving legume forage.

Detailed ways

The present invention is described in detail below in conjunction with specific drawings and embodiments. The examples described below are only preferred embodiments of the present invention. It should be noted that the following description is only for the purpose of explaining the present invention and does not limit the present invention in any form. Any simple modification, equivalent changes and modifications made to the embodiments according to the technical essence of the present invention are within the scope of the technical solution of the present invention.

In the following examples, the experimental methods used, unless otherwise specified, are conventional methods, for example, reference may be made to Molecular Cloning Laboratory Manual (Sambrook and Russell, 2001).

In the following examples, the materials, reagents, strains, vectors, etc. used, unless otherwise specified, can be obtained from commercial sources.

The construction of the pEarleyGate103 overexpression vector described in this example is described in “Keith W Earley, Jeremy R Haag, Olga Pontes, Kristen Opper, Tom Juehne, Keming Song, Craig S Pikaard. 2006. Gateway-compatible vectors for plant functional genomics and proteomics. Plant J.”

10×N6 bulk salt mother solution (1 L): MgSO ₄ ·7H ₂ O 1.85 g, KNO ₃ 28.3 g, (NH 4 ) ₂ SO ₄ 4.63 g, CaCl ₂ ·2H ₂ O 1.66 g, KH ₂ PO ₄ 4 g.

1000×SH trace salt mother solution (100 mL): MnSO ₄ ·H ₂ O 1 g, H ₃ BO ₃ 500 mg, ZnSO ₄ ·7H ₂ O 100 mg, KI 100 mg, Na ₂ MoO ₄ ·2H ₂ O 10 mg, CuSO ₄ ·5H ₂ O 20 mg, CoCl ₂ ·6H ₂ O 10 mg.

1000×SH organic mother liquor (100 mL): nicotinic acid 500 mg, pyridoxine hydrochloride 500 mg, thiamine hydrochloride 500 mg.

50×EDFS iron salt mother solution (500 mL): NaFe·EDTA 3.487 g.

The formula of SH9 medium (1L) is: 100 mL of 10×N6 macro-salt stock solution, 1 mL of 1000×SH micro-salt stock solution, 1 mL of 1000×SH organic stock solution, 20 mL of 50×EDFS iron salt stock solution, 100 mg of inositol, 20 g of sucrose, and the pH is adjusted to 5.8. 7 g of agar is added to the solid medium.

The formula of SM4 medium (1L) is: 4.43 g of MURASHIGE & SKOOG (MS) BASAL MEDIUM (M519) (PhytoTechnology LaboratoriesTM), 0.4 mL of 2,4-D stock solution (10 mg/mL), 0.2 mL of 6-BAP stock solution (1 mg/mL), 30 g of sucrose, and the pH is adjusted to 5.8. 3 g of phytagel is added to the solid medium.

The formula of MSBK medium (1L) is: 4.43 g of MURASHIGE & SKOOG (MS) BASAL MEDIUM (M519) (PhytoTechnology LaboratoriesTM), 1 mL of kinetin (1 mg/mL), 0.5 mL of 6-BAP stock solution (1 mg/mL), 30 g of sucrose, and the pH is adjusted to 5.8. 3 g of phytagel is added to the solid medium.

The formula of 1/2MS medium (1L) is: 2.215 g of MURASHIGE & SKOOG (MS) BASAL MEDIUM (M519) (PhytoTechnology LaboratoriesTM), 12 g of sucrose, pH adjusted to 5.8. 7 g of agar is added to the solid medium.

Example 1 Obtaining transgenic alfalfa plants overexpressing the Medicago truncatula MtWUS gene

1. Construction of MtWUS overexpression vector

1.1 Obtain the coding sequence of the MtWUS gene as shown in SEQ ID No. 1 through the bioinformatics website NCBI. Design primers MtWUS-F (CACCATGGAACAGCCTCAACAACAACAAC) and MtWUS-R (TTAATTAGCATAATCTGGTGACCTACAGC) based on the coding sequence. Use the TRIzol kit to extract total RNA from Medicago truncatula and reverse transcribe it into cDNA. Using cDNA as a template, the full-length CDS sequence of the MtWUS gene was amplified by RT-PCR. Use Gateway technology to connect the MtWUS gene sequence into the pEarleyGate103 vector, transform Escherichia coli, identify positive clones, and sequence. Transform the obtained overexpression vector pEarleyGate103-MtWUS into Agrobacterium EHA105, identify positive clones, and store at -80°C for later use.

1.2 Agrobacterium-mediated genetic transformation of alfalfa leaf discs

The Agrobacterium obtained in step 1.1 and stored at -80℃ was streaked and inoculated into YEP solid medium (containing 100mg/L rifampicin and 50mg/L kanamycin), inverted and cultured at 28℃ for 2 days, and single clones were selected for colony PCR identification. Positive single colonies were selected and inoculated into YEP liquid medium supplemented with rifampicin and kanamycin for overnight culture until OD ₆₀₀ was 0.8, centrifuged at 28℃ 4000rpm for 15min, supernatant was discarded, and the bacteria were diluted to OD ₆₀₀ of 0.2 with transformation solution for later use.

1.3 Explant preparation

The 3rd to 5th fully expanded compound leaves of alfalfa from the terminal bud were taken as explants. After collection, they were disinfected in a clean bench with bleach containing 0.1% TritonX 100 and 30% sodium hypochlorite (the active ingredient is 0.5% sodium hypochlorite) for 15 minutes, and then washed with sterile water for 3 times before use.

1.4 Agrobacterium infection and co-cultivation

Place the explants obtained in step 1.3 into the infection solution prepared in step 1.2, evacuate to -0.09 MPa and maintain for 10 min, then slowly release the air and gently shake on a decolorizing shaker for 10 min. Place the explants on sterile filter paper, absorb the infection solution, place them on the co-culture medium, and culture them in the dark at 22°C for 3 days.

1.5 Callus induction and differentiation

The explants were transferred to SM4 solid medium containing antibiotic PPT (3 mg/L) and cephalosporin 500 mg/L to induce resistant callus, cultured at 22°C, 16 h light/8 h dark, subcultured every 2 weeks, for a total of 3 times; the callus was then transferred to MSBK solid medium containing screening antibiotic PPT (3 mg/L) and cephalosporin 500 mg/L to induce bud differentiation, cultured at 22°C, 16 h light/8 h dark, for 3 weeks; the embryonic callus was transferred to SH9 solid medium containing screening antibiotic PPT (3 mg/L) and cephalosporin 200 mg/L to continue inducing bud differentiation, cultured at 22°C, 16 h light/8 h dark, subcultured every 3 weeks, until regenerated seedlings were produced; the regenerated seedlings were transferred to 1/2MS solid medium for rooting, subcultured every 3-4 weeks, cultured at 22°C, 16 h light/8 h dark, and transplanted into soil after rooting.

1.5 Identification of alfalfa regeneration seedlings

A small leaf of the regenerated seedling was taken to extract genomic DNA, and then PCR was performed. The plasmid pEarleyGate103-MtWUS vector was used as a positive control, and the primers 35S-F (GCACAATCCCACTATCCTTC) and MtWUS-R (TTAATTAGCATAATCTGGTGACCTACAGC) were used for PCR amplification. The transgenic plants overexpressing the MtWUS gene of Medicago truncatula were determined.

The enzyme used in PCR was from Beijing Quanshijin Biotechnology Co., Ltd. DNA Polymerase (Catalog Number: AP111-01). For specific usage, see the instruction manual.

Example 2 Statistical analysis of flowering time of transgenic alfalfa plants overexpressing the Medicago truncatula MtWUS gene

By cloning the MtWUS gene from Medicago truncatula, transforming alfalfa using Agrobacterium EHA105, and finally screening to obtain a transgenic alfalfa strain that overexpresses the Medicago truncatula MtWUS gene in the alfalfa background, the phenotype of the transgenic plants was analyzed, and the results are shown in Figure 1.

The results showed that the overexpression plants could significantly delay the flowering time. The flowering time of the wild type was about 40 days, while the flowering time of the overexpression plants was about 60 days, which was delayed by nearly 20 days (Figure 1G). In addition, compared with the wild type, the number of internodes in the overexpression plants at the time of flowering was also significantly increased (Figure 1F).

Example 3 Plant type analysis of transgenic alfalfa plants overexpressing the Medicago truncatula MtWUS gene

By cloning the MtWUS gene from Medicago truncatula, transforming alfalfa using Agrobacterium EHA105, and finally screening out transgenic alfalfa lines overexpressing the MtWUS gene of Medicago truncatula in the alfalfa background, the phenotype of the transgenic plants overexpressing the MtWUS gene of Medicago truncatula was analyzed, and the results are shown in Figure 2.

The results showed that compared with the wild type, the leaves of the transgenic alfalfa plants overexpressing the MtWUS gene became larger and the leaves were greener, that is, the leaf area of the overexpressed plants increased significantly compared with the wild type, and the leaf area could be increased by about 11% (Figure 2A-B). For this purpose, the wild type and MtWUS overexpressed plants with the same growth status were selected, and the leaf area, leaf width-to-length ratio, leaf crude protein content, fresh weight and chlorophyll content were respectively counted. The results showed that the leaf area, leaf width-to-length ratio, leaf crude protein content, fresh weight and chlorophyll content of the MtWUS overexpressed plants were significantly higher than those of the wild type (Figure 2C-F), indicating that the MtWUS gene has a significant effect in improving legume forage.

Example 4 Analysis of forage quality of transgenic alfalfa plants overexpressing the Medicago truncatula MtWUS gene

By cloning the MtWUS gene from Medicago truncatula, transforming alfalfa using Agrobacterium EHA105, and finally screening out transgenic alfalfa lines overexpressing the MtWUS gene of Medicago truncatula in the alfalfa background, the forage quality of the transgenic plants overexpressing the MtWUS gene of Medicago truncatula was analyzed, and the results are shown in Table 1.

Wild-type and overexpression plants with the same growth status were selected, and various quality-related indicators in the wild-type and overexpression plants were measured by near-infrared mass spectrometry.

Table 1: Test results of quality related indicators

The results showed that the crude protein, crude fat, and water-soluble sugar contents of the overexpressed plants were significantly higher than those of the wild type, and the nitrogen, potassium, and plant carbon contents were also significantly higher than those of the wild type. This indicates that overexpression of the MtWUS gene significantly improves the forage quality of alfalfa.

Claims (2)

1. The application of over-expressed medicago sativa MtWUSCHEL gene in increasing the leaf area and delaying flowering of medicago sativa; wherein the nucleotide sequence of the alfalfa MtWUSCHEL gene is shown as SEQ ID No.1, and the amino acid sequence encoded by the gene is shown as SEQ ID No. 2; the application is realized by cloning MtWUSCHEL gene coding sequences from medicago tribulus through RT-PCR technology, constructing a plant over-expression vector pEarley gate103-MtWUS, performing plant transgenic operation, introducing into medicago sativa cells, and obtaining a medicago sativa transgenic strain of the over-expression MtWUSCHEL gene.

2. The application of over-expression of the alfalfa MtWUSCHEL gene in improving the forage quality of the alfalfa; wherein the nucleotide sequence of the alfalfa MtWUSCHEL gene is shown as SEQ ID No. 1.