CN104357418A - Applications of glycosyltransferase and mutants thereof to synthesis of ginsenoside Rh2 - Google Patents
Applications of glycosyltransferase and mutants thereof to synthesis of ginsenoside Rh2 Download PDFInfo
- Publication number
- CN104357418A CN104357418A CN201410534597.8A CN201410534597A CN104357418A CN 104357418 A CN104357418 A CN 104357418A CN 201410534597 A CN201410534597 A CN 201410534597A CN 104357418 A CN104357418 A CN 104357418A
- Authority
- CN
- China
- Prior art keywords
- glycosyltransferase
- ugt51
- amino
- ginsenoside
- protopanoxadiol
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/1048—Glycosyltransferases (2.4)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P33/00—Preparation of steroids
- C12P33/02—Dehydrogenating; Dehydroxylating
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P33/00—Preparation of steroids
- C12P33/20—Preparation of steroids containing heterocyclic rings
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Medicinal Chemistry (AREA)
- Enzymes And Modification Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention discloses glycosyltransferase which can catalyze protopanaxdiol to be glycosylated to synthesize rare ginsenoside Rh2. Multiple mutants with optimized catalytic efficiency are obtained through transformation of the glycosyltransferase. The yield of the rare ginsenoside Rh2 synthesized by the mutants with an in-vitro enzyme method is obviously higher than that of wild type ginsenoside Rh2. The glycosyltransferase and the mutants thereof can be applied to total synthesis of the rare ginsenoside Rh2 in microorganism bodies.
Description
Technical field
The invention belongs to biological pharmacy technical field, relate to a kind of glycosyltransferase and mutant thereof, particularly relate to a kind of glycosyltransferase and mutant thereof and turning the application in glycosylation synthesis rare ginsenoside Rh2.
Background technology
Ginsenoside, as the main active medicinal matter of ginseng, is a kind of triterpenoid saponin, belongs to steroid compound.There is vasorelaxation, anti-oxidant, anti-inflammatory and the effect such as antitumor.The structure of ginsenoside is because of sugar side chains difference, and the character demonstrated and function also have larger difference.Wherein most study and relevant to apoptosis of tumor cells have Rh2 and Rg3, they have higher anti-tumor activity, and to not normal cells side effect, the related products of this compounds widely uses clinical.Therefore, the study hotspot that a large amount of, highly purified ginsenoside becomes modern pharmacy is obtained.
At present, ginsenoside mainly extracts from cultivated ginseng, domestic to extracting Radix Ginseng total saponins and monomer saponin has carried out large quantifier elimination from ginseng for medicinal use raw material, the extracting method of ginsenoside has: water extraction method, organic solvent extraction, distillation method, ultrasonic immersing method and supercritical CO
2extraction process etc.Because the Ginseng Growth cycle is long, and the technical process of extracting ginsenoside is complicated, and therefore production cost is higher.In addition ginsenoside Rh2 belongs to rare ginsenoside, content in ginseng is extremely low, extraction yield is limited, mainly by carrying out enzymatic conversion method to the total saponins extracted, improve the content of the wherein rare ginsenoside of high medical active, obtain Rh2 monomer saponin through a series of separation and purification process again, but be still limited to ginseng crude drug's carrier and saponin content wherein.Complex manufacturing, yields poorly, and cost is higher, is difficult to the requirement realizing scale operation rare ginsenoside.
In recent years, synthetic biology has penetrated in the links of natural product exploitation, especially for the manufacture of natural product opens a new effective way.Such as, Keasling laboratory utilizes yeast synthetic artemisinin precursor arteannuinic acid in vivo, and by constantly transforming pathways metabolism and optimizing the raising making the output of arteannuinic acid achieve some orders of magnitude, final arteannuinic acid reaches the output (Nature of 25g/L, 2006,440:940-943; Nature, 2013,496:528-532); Gregory study group utilizes intestinal bacteria to synthesize the precursor Japanese yew diene (Science, 2010,330:70-74) of taxol first.The biosynthetic pathway rebuilding Plant Drug Secondary Metabolites in microorganism is prepared high value added product and is demonstrated good application prospect.In addition, Zhang Xueli study group constructs the biosynthetic pathway of panoxadiol type saponin(e aglycon in yeast saccharomyces cerevisiae, by metabolic engineering and fermentation engineering optimization, the output of protopanoxadiol reaches more than 1g/L (Metabolic Engineering, 2013,20:146-156), this lays a good foundation for complete synthesis rare ginsenoside in external enzymatic clarification or microbe.But synthesize relevant glycosyltransferase gene to ginsenoside and report less, glycosyltransferase is the multigene family albumen that organic sphere extensively exists, only be cloned in minority plant, by enzyme activity method carry out identifying then less, the glycosyltransferase wherein participating in triterpenoid saponin is only studied in the plant such as M. truncatula, Semen Vaccariae.In the recent period, Zhou Zhihua seminar identifies the glycosyltransferase gene (Cell Research, 2014:1-4) of catalysis protopanoxadiol synthesis Ginsenoside compound K in ginseng.Still the report of relevant glycosyltransferase gene is not synthesized at present to rare ginsenoside Rh2.
The shortage of glycosyltransferase gene makes the synthesis of the allos of rare ginsenoside Rh2 be difficult to realize, and therefore the excavation of glycosyltransferase gene seems particularly important.Along with the continuous progress of sequencing technologies, gene data base resource constantly expands, and this is that the screening of functional enzyme gene is had laid a good foundation.
Therefore, screening potential from abundant gene pool can the functional gene of catalysis protopanoxadiol glycosylation synthesis rare ginsenoside Rh2 be one of effective way obtaining relevant glycosyltransferase gene.
By taking protopanoxadiol as substrate complete synthesis method in enzymatic conversion method synthesis or microbe in vitro, the output of ginsenoside Rh2 can be improved.But these two kinds of methods all need to obtain can the glycosyltransferase gene of catalysis protopanoxadiol synthesis rare ginsenoside Rh2, still there is no the report of this functional gene so far.
Summary of the invention
Because the above-mentioned defect of prior art, technical problem to be solved by this invention is a kind of effective glycosyltransferase of exploitation, for complete synthesizing process synthesis rare ginsenoside Rh2 in external enzymatic conversion method and microbe.
For achieving the above object, the invention provides a kind of glycosyltransferase and mutant thereof, and it is complete synthesis to utilize the glycosyltransferase of improvement to achieve in the external enzyme process of ginsenoside Rh2 and microbe.
The present inventor is by the gopher Rxnfinder based on compound, chemical reaction, in conjunction with database resources such as PIR, NCBI, based on principles such as substrate similarity and catalyzed reaction types, screen the glycosyltransferase gene of some possibility catalysis protopanoxadiols 3 hydroxyl glycosylations.The gene of screening is carried out functional expression in escherichia expression system, obtains the crude enzyme liquid of recombinant protein.The experiment proved that, the UGT51 glycosyltransferase wherein deriving from Saccharomyces Cerevisiae in S accharomyces cerevisiae S288c can the glycosylation of catalysis protopanoxadiol.The glycation product obtained is single, is 61% to the transformation efficiency of substrate protopanoxadiol after optimization.
First aspect, the invention provides a kind of glycosyl that turns and synthesize the glycosyltransferase of rare ginsenoside Rh2 and the gene of coding thereof, this gene is the glycosyltransferase gene UGT51 deriving from Saccharomyces Cerevisiae in S accharomyces cerevisiae S288c, by this glycosyltransferase called after UGT51 albumen.The gene order of described albumen is SEQNO:1, and aminoacid sequence is SEQ NO:2; The gene order of the albumen that described albumen obtains after removing N-terminal film land is SEQ NO:3, and aminoacid sequence is SEQ NO:4.
Further, above-mentioned glycosyltransferase also can be through replacement, lacks or add one or more amino acid and have the derived protein of identical function with albumen shown in SEQ NO:2 or SEQ NO:4.
Second aspect, the invention provides the mutant of UGT51 glycosyltransferase, described mutant is the glycosyltransferase mutant obtained by replacing the amino-acid residue on one or more positions of wild-type UGT51 glycosyltransferase with another kind of amino-acid residue; Preferred the position of substitution is the 801st, 802,804,812,815,816,849,888,892 or their corresponding position of the UGT51 glycosyltransferase aminoacid sequence represented by SEQ NO:2, and the specific activity wild-type of mutant catalysis protopanoxadiol glycosylation synthesis ginsenoside Rh2 significantly improves.
Further, described glycosyltransferase mutant is the glycosyltransferase mutant obtained by showing the amino-acid residue on one or more positions of the glycosyltransferase of the aminoacid sequence of at least 90% homology with another kind of amino-acid residue replacement with wild-type UGT51 glycosyltransferase; Preferred the position of substitution is the 801st, 802,804,812,815,816,849,888,892 or their corresponding position of the UGT51 glycosyltransferase aminoacid sequence represented by SEQNO:2, and the specific activity wild-type of mutant catalysis protopanoxadiol glycosylation synthesis ginsenoside Rh2 significantly improves.
Further, the described another kind of amino-acid residue for replacing original amino-acid residue is preferably L-Ala (amino acid abbreviations name is called A) or α-amino-isovaleric acid (amino acid abbreviations name is called V).
At the nucleotide coding of coding corresponding to the catastrophe point of this glycosyltransferase, be interpreted as the nucleotide coding coded by " another kind of amino-acid residue " of the present invention.
Particularly, present invention also offers the gene of some preferred glycosyltransferase mutant and coding thereof, the gene order of their glycosyltransferase that sets out is the SEQ NO:1 in sequence table, and the aminoacid sequence that sets out is the SEQ NO:2 in sequence table.They are the 801st mutant that Serine is replaced by L-Ala respectively, 802nd mutant that leucine is replaced by L-Ala, 804th mutant that α-amino-isovaleric acid is replaced by L-Ala, 812nd mutant that Methionin is replaced by L-Ala, 815th mutant that arginine is replaced by L-Ala, 816th mutant that L-glutamic acid is replaced by L-Ala, 849th mutant that Serine is replaced by L-Ala, 849th mutant that Serine is replaced by α-amino-isovaleric acid, 888th mutant that Methionin is replaced by L-Ala, 892nd mutant that l-asparagine is replaced by L-Ala.The mutant that the correspondence position of the aminoacid sequence that the SEQ NO:4 in sequence table represents replaces is also included.
The third aspect, the present invention still further provides the recombinant vectors comprising the above-mentioned glycosyltransferase of coding or its mutant gene, and comprises the transformant (such as microorganism of the present invention) of described recombinant vectors.
Recombinant vectors of the present invention, is interpreted as the recombinant vectors of arbitrary gene in prior art, such as various plasmid, and the mutator gene by glycosyltransferase mutant imports the DNA vector plasmid that can make this glycosyltransferase mutant stably express.
And the transformant of described recombinant vectors, namely refer to the host cell of recombinant vectors, such as, the host cell of the microorganism E.coli BL21 described in the embodiment of the present invention 4; Certainly, the microorganism of the host cell that prior art is commonly used comprises gram positive bacterium as subtilis, and gram negative bacterium is as intestinal bacteria, actinomycetes are as streptomycete, yeast is as yeast saccharomyces cerevisiae, and fungi is as aspergillus tubigensis, and their cell is all host cells of conventional recombinant vectors.
Fourth aspect, the invention provides a kind of method using glycosyltransferase to turn the external synthesis ginsenoside Rh2 of glycosylation, the method with protopanoxadiol and glycosyl donor UDPG for raw material, under the katalysis of glycosyltransferase, 3 hydroxyl generation glycosylations of protopanoxadiol, generate rare ginsenoside Rh2.
Preferably, the glycosyltransferase that described glycosyltransferase is UGT51 glycosyltransferase or obtains after removing N-terminal film land, or the glycosyltransferase mutant that above-mentioned second aspect provides.Under the same conditions, the efficiency ratio wild-type of UGT51 glycosyltransferase mutant catalysis protopanoxadiol glycosylation synthesis ginsenoside Rh2 improves 35%-50%.
Preferably, the ratio of described glycosyl donor and protopanoxadiol is 1:1 ~ 10:1 (w/w).
Preferably, the concentration of described glycosyl donor is 0.5 ~ 10g/L, and the concentration of described protopanoxadiol is 0.01 ~ 1g/L.
As a further improvement on the present invention, described protopanoxadiol is dissolved in nonaqueous phase.
Preferably, described nonaqueous phase is hydrophilic organic solvent, described hydrophilic organic solvent be selected from methyl alcohol, dimethyl sulfoxide (DMSO) (DMSO), dimethyl formamide (DMF), glycol dimethyl ether (DME) any one.
Preferably, described protopanoxadiol is dissolved in after in described hydrophilic organic solvent, and the ultimate density adding the hydrophilic organic solvent in reaction system is 5% ~ 20% (v/v).
5th aspect, present invention also offers a kind of method that the UGT51 of application gene and mutator gene thereof synthesize ginsenoside Rh2 in microbe.The method, based on the engineering bacteria can producing protopanoxadiol, imports the expression cassette of glycosyltransferase encoding gene UGT51 or its mutator gene, obtains recombinant bacterium.Fermentation culture obtains target product ginsenoside Rh2.
The expression cassette of described glycosyltransferase encoding gene UGT51 specifically comprises promotor PGK1, glycosyltransferase encoding gene UGT51 and terminator ADH1 further.
The expression cassette of described glycosyltransferase encoding gene UGT51 mutator gene specifically comprises promotor PGK1, glycosyltransferase encoding gene UGT51 mutator gene and terminator ADH1 further.
Described microorganism, such as, the brewing yeast cell described in the embodiment of the present invention 5; Certainly, prior art is commonly used microorganisms producing bacterial strain and is comprised gram positive bacterium as subtilis, and gram negative bacterium is as intestinal bacteria, actinomycetes are as streptomycete, yeast is as yeast saccharomyces cerevisiae, and fungi is as aspergillus tubigensis, and their cell is all conventional production bacterial strains.
By the realization of above technical scheme, invention achieves following technique effect:
1, utilize glycosyltransferase proteins of the present invention enzymatic clarification ginsenoside Rh2 in vitro, can 61% be reached to the transformation efficiency of substrate protopanoxadiol; Under the same conditions, the efficiency ratio wild-type of catalysis protopanoxadiol glycosylation synthesis ginsenoside Rh2 improves 35%-50% to its mutant;
2, glycosyltransferase proteins of the present invention and mutant thereof is utilized successfully to achieve complete synthesis ginsenoside Rh2 in microbe.
3, the UGT51 glycosyltransferase that obtains of the present invention and mutant thereof may be used for complete synthesisly in external enzyme process Synthesis and microbe preparing rare ginsenoside Rh2, a kind of new production method being different from existing production technology, production process simplify, consume low, output is high.
Be described further below with reference to the technique effect of accompanying drawing to design of the present invention, embodiment and generation, to understand object of the present invention, characteristic sum effect fully.
Accompanying drawing explanation
Fig. 1 is the TLC figure of UGT51 glycosyltransferase catalysed in vitro protopanoxadiol Transglycosylation;
Fig. 2 is mass spectrum (MS) spectrogram of protopanoxadiol glycation product;
Fig. 3 is the nucleus magnetic resonance of protopanoxadiol glycation product
1h-NMR spectrogram;
Fig. 4 is the nucleus magnetic resonance of protopanoxadiol glycation product
13c-NMR spectrogram;
Fig. 5 is the HPLC spectrogram of protopanoxadiol;
Fig. 6 is the HPLC spectrogram of protopanoxadiol and glycation product thereof.
Embodiment
Below in conjunction with specific embodiment, and comparable data describes in further detail the present invention.Should be understood that these embodiments just in order to demonstrate the invention, but not limit scope of invention by any way.
The generality in the source of biomaterial of the present invention illustrates:
1, primer synthesis: the primer used in the present invention is by the synthesis preparation of Nanjing Jin Sirui company.
2, in experiment the Q5 High-Fidelity archaeal dna polymerase that uses and T4 DNA ligase etc. purchased from NewEngland Biolabs company; PrimeSTAR HS high-fidelity enzyme is purchased from TakaRa company; Restriction enzyme is all purchased from Fermentas company; The DNA glue used reclaims test kit and the little extraction reagent kit of plasmid all purchased from Axygen company.
The screening of the glycosyltransferase of embodiment 1 turn of glycosylation protopanoxadiol synthesis ginsenoside Rh2
By the gopher Rxnfinder based on compound, chemical reaction, in conjunction with database resources such as PIR, NCBI, based on principles such as substrate similarity and catalyzed reaction types, screen the glycosylated glycosyltransferase gene of some possibility catalysis protopanoxadiols, be the UGT51 deriving from yeast saccharomyces cerevisiae respectively, derive from the OleD of antibiosis streptomycete and derive from the SGT2 of potato.The UGT51 clone wherein deriving from yeast saccharomyces cerevisiae obtains, and the OleD deriving from antibiosis streptomycete and the SGT2 full genome synthesis deriving from potato obtain.OleD, SGT2 full-length gene consists is cloned into pET28a (+) plasmid with NdeI, XhoI restriction enzyme site.
Use fungal gene group to extract the genome of test kit extraction Saccharomyces Cerevisiae in S accharomyces cerevisiae S288c, use primer UGT51-F and UGT51-R to carry out pcr amplification.Amplification system is: Q5 Reaction Buffer (5 ×) 10 μ L, dNTP (2.5mM) 4 μ L, genomic templates 0.5 μ L, primer (10 μMs) each 2.5 μ L, Q5 High-FidelityDNA polysaccharase 0.5 μ L, supplementary distilled water to 50 μ L.Amplification condition is 98 DEG C of denaturations 30 seconds; 98 DEG C of sex change, 10 seconds, 55 DEG C annealing 10 seconds, 72 DEG C extend 2 minutes (30 circulations); 72 DEG C extend 2 minutes.
UGT51-F：ATGCCCATCACTCAAATCATAT
UGT51-R：TTAAATCATCGTCCACCCTTC
Pcr amplification product is cloned on pEASY-Blunt cloning vector (Beijing Quanshijin Biotechnology Co., Ltd).Clone body is: PCR primer 1 μ L, pEASY-Blunt carrier 1 μ L, room temperature reaction 10 minutes after mixing, heat-shock transformed bacillus coli DH 5 alpha competent cell, coats on the LB flat board containing penbritin, screening positive clone after incubated overnight, sequence verification.Sequencing result shows on pEASY-Blunt carrier, insert correct goal gene UGT51 (3597bp), and nucleotides sequence is classified as SEQ ID NO:1 in sequence table, and aminoacid sequence is SEQ ID NO:2 in sequence table.
Remove protein N terminal film land (1-721 amino acid) when primer is expressed in design, primer is as follows:
UGT51-F2:CAAG
cATATGtTAATGATTGATGAGAATCCGC (band NdeI restriction enzyme site)
UGT51-R2:CTAG
cTCGAGtTAAATCATCGTCCACCCTTCA (band XhoI restriction enzyme site)
Q5 High-Fidelity archaeal dna polymerase is used to carry out pcr amplification.Amplification system is: each 2.5 μ L, Q5High-Fidelity archaeal dna polymerase 0.5 μ L of Q5 ReactionBuffer (5 ×) 10 μ L, dNTP (2.5mM) 4 μ L, genomic templates 0.5 μ L, primer (10 μMs), supplementary distilled water to 50 μ L.Amplification condition is 98 DEG C of denaturations 30 seconds; 98 DEG C of sex change, 10 seconds, 55 DEG C annealing 10 seconds, 72 DEG C extend 1 minute (30 circulations); 72 DEG C extend 2 minutes.
After PCR primer and pET28a (+) plasmid carry out the reaction of restriction enzyme NdeI, XhoI double digestion respectively, reclaim test kit with DNA glue and reclaim digestion products, ligation is carried out under the effect of T4 DNA ligase, connect product heat-shock transformed to bacillus coli DH 5 alpha competent cell, be applied to LB agar plate (containing 50 μ g/mL kantlex), screening positive clone after incubated overnight, sequence verification.Sequencing result shows correctly to insert goal gene fragment on pET28a (+) carrier.Nucleotides sequence is classified as SEQ ID NO:3 in sequence table, and aminoacid sequence is SEQ ID NO:4 in sequence table.
The recombinant expression plasmid of screening-gene is heat-shock transformed to e. coli bl21 competent cell, carries out genetic expression.When cultivation recombinant bacterium is 0.6-0.8 to OD, add 0.4mM IPTG, at low temperature 16 DEG C of abduction delivering 16h.4 DEG C, 6000rpm centrifugal collecting cell, is resuspended in cell in disruption buffer, and disruption buffer forms: containing the Tris-HCl damping fluid (50mM, pH7.5) of 5mMDTT.The culturing cell of 1L is finally resuspended in the disruption buffer of 100mL.After ultrasonication, 4 DEG C, 14000rpm is centrifugal, collects supernatant and namely obtains crude enzyme liquid.
The recombinant protein crude enzyme liquid that abduction delivering obtains is directly used in external activity and detects, and prepare reaction soln as follows, cumulative volume is 100 μ L:2mM GDPGs (UDPG), 1mM protopanoxadiol, 10mM magnesium chloride (MgCl
2), 20mM Tris-HCl pH7.5, add 70% (v/v) crude enzyme liquid.30 DEG C, 180rpm reacts 12 hours.Add the propyl carbinol termination reaction of same volume, get upper organic phase and carry out TLC analysis.TLC developping agent is chloroform: methyl alcohol=85:15, and developer is: 2.5% (w/v) Ammonium Molybdate Tetrahydrate, 1% (w/v) ammonium cerous sulfate, 10% (v/v) sulphur aqueous acid.In 110 DEG C of heating colour developing in 5 minutes.The UGT51 albumen wherein only deriving from yeast saccharomyces cerevisiae can generate a new compound by catalysis protopanoxadiol substrate, and result as shown in Figure 1, does not add UDPG glycosyl donor in the reaction system of wherein blank.
Carry out LC-MS analysis to reaction system further, instrument is HPLC 1290-MS 6230 (Agilent).Use the C18 post (model: XDB-C18,4.6 × 150mm, 5 μm) of Agilent company, moving phase uses gradient elution: 0-20min, 45-100% acetonitrile; 20-25min, 100% acetonitrile; 25-28min, 45% acetonitrile.Column temperature 40 DEG C, flow velocity: 0.4 mL/min.Compound uses positive ion mode ionization, and Ionization mode is electron spray(ES) (ESI).As shown in Figure 2, judge according to molecular weight, this compound is the mono-glycosylated product of protopanoxadiol to the mass spectrum of product, product HR-MS:m/z 623.4517 [M+H]
+, elementary composition is C
36h
62o
8, M+H calculated value is 623.4517.
The separation and purification of embodiment 2 glycation product and Structural Identification
By the reaction solution of the proportions 100mL in embodiment 1.Under 30 DEG C of conditions, react 48 hours.Add same volume propyl carbinol termination reaction.Get upper organic phase rotary evaporation dry, with silica column purification, eluent is chloroform: methyl alcohol=85:15, every 5mL equal portions are collected, the sample collected carries out TLC analysis (condition is ditto described), obtains protopanoxadiol glycation product part, purity <90%.
Utilize Sep-Pak tC18 post (Waters) to divide above-mentioned collection unit further and carry out purifying, water (A) and acetonitrile (B) are as eluent, adopt gradient elution (20%B, 40%B, 50%B, 60%B, 65%B, 70%B, 75%B, 80%B, 85%B, 90%B, 100%B), when 70% and 75% acetonitrile, obtain protopanoxadiol glycation product part, purity reaches 98%.Obtain white powder in 40 DEG C of rotary evaporations or lyophilize, product carries out NMR (Nuclear Magnetic Resonance) spectrum structural analysis and checking.The result (Fig. 3, Fig. 4) that the H spectrum of product and C compose is consistent with the collection of illustrative plates of the ginsenoside Rh2 of bibliographical information, and confirmation reaction product is ginsenoside Rh2.
Embodiment 3 UGT glycosyltransferase wild-type external enzyme process Synthesis ginsenoside Rh2
Scheme one
UGT51 glycosyltransferase crude enzyme liquid is obtained according to embodiment 1.
With dimethyl sulfoxide (DMSO) (DMSO), protopanoxadiol, uridine diphosphoglucose (UDPG), Tris-HCl buffering preparation reaction soln, in reaction soln, the ratio of organic solvent DMSO is 10% (v/v), protopanoxadiol 0.5g/L, the volumetric molar concentration of Tris-HCl buffering is 50mmol/L, pH is 7.5, UDPG is 10:1 (w/w) with the ratio of protopanoxadiol.Add UGT51 glycosyltransferase crude enzyme liquid in reaction solution in 70% (v/v) ratio, 30 DEG C, 180rpm, reacts 48 hours.
Add same volume propyl carbinol termination reaction, dissolve with methanol is added after the organic phase vacuum-drying of extraction, carry out HPLC and detect analysis with quantitative, result as shown in Figure 5 and Figure 6, Fig. 5 is the HPLC spectrogram (not adding UDPG glycosyl donor in reaction system) of protopanoxadiol, and Fig. 6 is the analytical results of reaction system.Use the C18 post (model: XDB-C18,4.6 × 150mm, 5 μm) of Agilent company, moving phase uses gradient elution: 0-14min, 45-100% acetonitrile; 14-18min, 100% acetonitrile; 18-20min, 45% acetonitrile.Column temperature 40 DEG C, flow velocity: 1 mL/min, determined wavelength 203nm.
HPLC identifies knows that the transformation efficiency of protopanoxadiol glycosylation is 61%.
Scheme two
UGT51 glycosyltransferase crude enzyme liquid is obtained according to embodiment 1.
With dimethyl sulfoxide (DMSO) (DMSO), protopanoxadiol, uridine diphosphoglucose (UDPG), Tris-HCl buffering preparation reaction soln, in reaction soln, the ratio of organic solvent DMSO is 5% (v/v), protopanoxadiol 0.5g/L, the volumetric molar concentration of Tris-HCl buffering is 50mmol/L, pH is 7.5, UDPG is 5:1 (w/w) with the ratio of protopanoxadiol.Add UGT51 glycosyltransferase crude enzyme liquid in reaction solution in 70% (v/v) ratio, 30 DEG C, 180rpm, reacts 48 hours.
Add same volume propyl carbinol termination reaction, after the organic phase vacuum-drying of extraction, add dissolve with methanol, carry out HPLC and detect analysis with quantitative.Detection method is identified with scheme one, HPLC and is known that the transformation efficiency of protopanoxadiol glycosylation is 53%.
Scheme three
UGT51 glycosyltransferase crude enzyme liquid is obtained according to embodiment 1.
With dimethyl sulfoxide (DMSO) (DMSO), protopanoxadiol, uridine diphosphoglucose (UDPG), Tris-HCl buffering preparation reaction soln, in reaction soln, the ratio of organic solvent DMSO is 20% (v/v), protopanoxadiol 1g/L, the volumetric molar concentration of Tris-HCl buffering is 50mmol/L, pH is 7.5, UDPG is 1:1 (w/w) with the ratio of protopanoxadiol.Add UGT51 glycosyltransferase crude enzyme liquid in reaction solution in 70% (v/v) ratio, 30 DEG C, 180rpm, reacts 48 hours.
Add same volume propyl carbinol termination reaction, after the organic phase vacuum-drying of extraction, add dissolve with methanol, carry out HPLC and detect analysis with quantitative.Detection method is identified with scheme one, HPLC and is known that the transformation efficiency of protopanoxadiol glycosylation is 36%.
Scheme four
UGT51 glycosyltransferase crude enzyme liquid is obtained according to embodiment 1.
With dimethyl formamide (DMF), protopanoxadiol, uridine diphosphoglucose (UDPG), Tris-HCl buffering preparation reaction soln, in reaction soln, the ratio of organic solvent DMF is 5% (v/v), protopanoxadiol 0.5g/L, the volumetric molar concentration of Tris-HCl buffering is 50mmol/L, pH is 7.5, UDPG is 10:1 (w/w) with the ratio of protopanoxadiol.Add UGT51 glycosyltransferase crude enzyme liquid in reaction solution in 70% (v/v) ratio, 30 DEG C, 180rpm, reacts 48 hours.
Add same volume propyl carbinol termination reaction, after the organic phase vacuum-drying of extraction, add dissolve with methanol, carry out HPLC and detect analysis with quantitative.Detection method is identified with scheme one, HPLC and is known that the transformation efficiency of protopanoxadiol glycosylation is 32%.
Scheme five
UGT51 glycosyltransferase crude enzyme liquid is obtained according to embodiment 1.
With methyl alcohol, protopanoxadiol, uridine diphosphoglucose (UDPG), Tris-HCl buffering preparation reaction soln, in reaction soln, the ratio of organic solvent methyl alcohol is 5% (v/v), protopanoxadiol 0.5g/L, the volumetric molar concentration of Tris-HCl buffering is 50mmol/L, pH is 7.5, UDPG is 10:1 (w/w) with the ratio of protopanoxadiol.Add UGT51 glycosyltransferase crude enzyme liquid in reaction solution in 70% (v/v) ratio, 30 DEG C, 180rpm, reacts 48 hours.
Add same volume propyl carbinol termination reaction, after the organic phase vacuum-drying of extraction, add dissolve with methanol, carry out HPLC and detect analysis with quantitative.Detection method is identified with scheme one, HPLC and is known that the transformation efficiency of protopanoxadiol glycosylation is 45%.
Scheme six
UGT51 glycosyltransferase crude enzyme liquid is obtained according to embodiment 1.
With glycol dimethyl ether (DME), protopanoxadiol, uridine diphosphoglucose (UDPG), Tris-HCl buffering preparation reaction soln, in reaction soln, the ratio of organic solvent DME is 5% (v/v), protopanoxadiol 0.5g/L, the volumetric molar concentration of Tris-HCl buffering is 50mmol/L, pH is 7.5, UDPG is 10:1 (w/w) with the ratio of protopanoxadiol.Add UGT51 glycosyltransferase crude enzyme liquid in reaction solution in 70% (v/v) ratio, 30 DEG C, 180rpm, reacts 48 hours.
Add same volume propyl carbinol termination reaction, after the organic phase vacuum-drying of extraction, add dissolve with methanol, carry out HPLC and detect analysis with quantitative.Detection method is identified with scheme one, HPLC and is known that the transformation efficiency of protopanoxadiol glycosylation is 48%.
The structure of embodiment 4 UGT glycosyltransferase mutant and external enzymatic clarification rare ginsenoside Rh2 thereof
With recombinant plasmid pET28-UGT51 for template, with the oligonucleotide of a pair complementation with mutational site for primer, carry out full plasmid PCR amplification with PrimeSTAR HS high-fidelity enzyme (TakaRa company), obtain the recombinant plasmid with specific mutational site.Primer sequence is as follows:
Corresponding to the 801st mutant that Serine is replaced by L-Ala in SEQ NO:2:
S801A_F:CCAGTGGAGTTGATGGCGTTGATGGTGGAAAATG
S801A_R:CATTTTCCACCATCAACGCCATCAACTCCACTGG；
Corresponding to the 802nd mutant that leucine is replaced by L-Ala in SEQ NO:2:
L802A_F:GTGGAGTTGATGTCCGCGATGGTGGAAAATGAAT
L802A_R:ATTCATTTTCCACCATCGCGGACATCAACTCCAC；
Corresponding to the 804th mutant that α-amino-isovaleric acid is replaced by L-Ala in SEQ NO:2:
V804A_F:TTGATGTCCTTGATGGCGGAAAATGAATCAATGA
V804A_R:TCATTGATTCATTTTCCGCCATCAAGGACATCAA；
Corresponding to the 812nd mutant that Methionin is replaced by L-Ala in SEQ NO:2:
K812A_F:ATGAATCAATGAATGTTGCGATGCTGAGAGAAGCT
K812A_R:GCTTCTCTCAGCATCGCAACATTCATTGATTCATT；
Corresponding to the 815th mutant that arginine is replaced by L-Ala in SEQ NO:2:
R815A_F:GAATGTTAAAATGCTGGCGGAAGCTTCGAGCAAA
R815A_R:TTTGCTCGAAGCTTCCGCCAGCATTTTAACATTC；
Corresponding to the 816th mutant that L-glutamic acid is replaced by L-Ala in SEQ NO:2:
E816A_F:GTTAAAATGCTGAGAGCGGCTTCGAGCAAATTT
E816A_R:AAATTTGCTCGAAGCCGCTCTCAGCATTTTAAC；
Corresponding to the 849th mutant that Serine is replaced by L-Ala in SEQ NO:2:
S849A_F：CTGATTGAATCACCCGCGGCTATGGTTGGTATTC
S849A_R：AATACCAACCATAGCCGCGGGTGATTCAATCAGA
Corresponding to the 849th mutant that Serine is replaced by α-amino-isovaleric acid in SEQ NO:2:
S849V_F：CTGATTGAATCACCCGTTGCTATGGTTGGTATTC
S849V_R：AATACCAACCATAGCAACGGGTGATTCAATCAGA
Corresponding to the 888th mutant that Methionin is replaced by L-Ala in SEQ NO:2;
K888A_F:ATTGTACCAGATCAAGCGAGGGGCGGTAACTA
K888A_R:TAGTTACCGCCCCTCGCTTGATCTGGTACAAT
Corresponding to the 892nd mutant that l-asparagine is replaced by L-Ala in SEQ NO:2:
N892A_F:AAAAAAGGGGCGGTGCGTATAACTACCTGACA
N892A_R:TGTCAGGTAGTTATACGCACCGCCCCTTTTTT
Amplification system is: PrimeSTAR Buffer (5 ×) 10 μ L, dNTP (2.5mM) 4 μ L, recombinant plasmid template 20ng, primer (10 μMs) each 2 μ L, PrimeSTAR HS high-fidelity enzyme 0.5 μ L, supplementary distilled water to 50 μ L.Amplification condition is 98 DEG C of denaturations 1 minute; 98 DEG C of sex change, 10 seconds, 68 DEG C annealing and extension 7 minutes (30 circulations).Glue reclaims PCR primer, digests glue reclaim product 2h with DpnI enzyme (Fermentas company) under 37 DEG C of conditions, degraded original template.Digestion product is converted into E.coli BL21, is applied to containing on 50 μ g/mL kantlex LB agar plates, 37 DEG C of incubated overnight, screening positive clone, sequence verification.Obtain the recombinant bacterium of UGT glycosyltransferase mutant.
The crude enzyme liquid of UGT51 glycosyltransferase mutant is obtained according to the method for embodiment 1.
With dimethyl sulfoxide (DMSO) (DMSO), protopanoxadiol, uridine diphosphoglucose (UDPG), Tris-HCl buffering preparation reaction soln, in reaction soln, the ratio of organic solvent DMSO is 10% (v/v), protopanoxadiol 0.5g/L, the volumetric molar concentration of Tris-HCl buffering is 50mmol/L, pH is 7.5, UDPG is 10:1 (w/w) with the ratio of protopanoxadiol.Add UGT51 glycosyltransferase mutant crude enzyme liquid in reaction solution in 70% (v/v) ratio, 30 DEG C, 180rpm, reacts 48 hours.
Add same volume propyl carbinol termination reaction, after the organic phase vacuum-drying of extraction, add dissolve with methanol, carry out HPLC and detect analysis with quantitative.Detection method is with embodiment 3, HPLC qualification knows that the transformation efficiency of protopanoxadiol glycosylation is respectively S801A:86%, L802A:92%, V804A:88%, K812A:90%, R815A:88%, E816A:88%, S849A:83%, S849V:85%, K888A:86%, N892A:84%.
Recombinant protein carries 6-His label at N-terminal, the crude enzyme liquid nickel post single step purification that abduction delivering obtains, and use 200mM imidazole solution wash-out, dialyzed overnight removes imidazoles, namely obtains pure enzyme.With Tween80, protopanoxadiol, uridine diphosphoglucose (UDPG), Tris-HCl buffering preparation reaction soln, in reaction soln, the ratio of Tween80 is 1% (v/v), protopanoxadiol 0.5mM, the volumetric molar concentration of Tris-HCl buffering is 50mmol/L, pH is 7.5, UDPG 5mM.Be that 0.3mg/mL adds the pure enzyme of UGT51 glycosyltransferase and mutant thereof in reaction solution, 30 DEG C by final concentration, reaction 15min.Add same volume propyl carbinol termination reaction, add dissolve with methanol after the organic phase vacuum-drying of extraction, HPLC analyzes and quantitative assay enzyme activity.The enzyme activity of UGT51 glycosyltransferase and mutant thereof is as shown in table 1.
| Enzyme | Relative activity |
| Wild-type | 1 |
| S801A | 4.1 |
| L802A | 12.3 |
| V804A | 6.9 |
| K812A | 8.4 |
| R815A | 6.1 |
| E816A | 6.5 |
| S849A | 2.9 |
| S849V | 4.3 |
| K888A | 5.8 |
| N892A | 3.9 |
Embodiment 5 utilizes UGT51 gene or its mutator gene in microbe, synthesize rare ginsenoside Rh2
For publication (publication number: CN102925376A), obtain engineering bacteria ZD-PPD-010 with reference to patent.In YPD substratum, (substratum forms ZD-PPD-010 engineering bacteria: 1% (w/v) yeast extract paste, 2% (w/v) peptone, 2% (w/v) glucose) middle incubated overnight, OD is about 0.6-0.8, getting 1mL is sub-packed in 1.5mL centrifuge tube, 4 DEG C, centrifugal 1 minute of 8000g, abandon supernatant, cell sterilized water washs 1 time, add 1mL treatment solution (10mM LiAc, 10mM DTT, 0.6M sorbyl alcohol, 10mM Tris-HCl pH7.5) re-suspended cell, place 20 minutes for 25 DEG C, centrifugal collecting cell, add 1mL 1M sorbyl alcohol (aseptic) resuspended, centrifugal, abandon supernatant, add 80 μ L 1M sorbyl alcohol (aseptic) resuspended, obtain ZD-PPD-010 competent cell.
With genes of brewing yeast group DNA for template, with primer in table 1, amplification promotor PGK1 (753bp) and UGT51 total length ORF gene (3597bp).Amplification system is: Q5 Reaction Buffer (5 ×) 10 μ L, dNTP (2.5mM) 4 μ L, DNA profiling 20ng, primer (10 μMs) each 2.5 μ L, Q5 High-Fidelity archaeal dna polymerase 0.5 μ L, supplementary distilled water to 50 μ L.Amplification condition is 98 DEG C of denaturations 30 seconds; 98 DEG C of sex change, 10 seconds, 52 DEG C annealing 10 seconds, 72 DEG C extend 2 minutes (30 circulations); 72 DEG C extend 2 minutes.
Table 1 primer sequence
PmeI enzyme cuts PGK1 amplified production and UGT51 amplified production, cut glue and reclaim two object fragments, respectively get 50ng and add linked system: T4 Ligation Buffer (10 ×) 2 μ L, T4 DNA Ligase 1 μ L, supplementary distilled water to 20 μ L, 16 DEG C of reaction overnight obtain connecting product.Get 1 μ L connection product and add PCR reaction system as template: Q5 ReactionBuffer (5 ×) 10 μ L, dNTP (2.5mM) 4 μ L, connection product template 1 μ L, primer BamHI-PGK1-F and NotI-UGT51-R (10 μMs) each 2.5 μ L, Q5 High-Fidelity archaeal dna polymerase 0.5 μ L, supplementary distilled water to 50 μ L.Amplification condition is 98 DEG C of denaturations 30 seconds; 98 DEG C of sex change, 10 seconds, 52 DEG C annealing 10 seconds, 72 DEG C extend 2.5 minutes (30 circulations); 72 DEG C extend 2 minutes.Obtain object fragment P
pGK1-UGT51, wherein P
pGK1nucleotides sequence be classified as SEQ ID NO:5 in sequence table, the nucleotides sequence of UGT51 gene is classified as the SEQ IDNO:1 in sequence table.
BamHI, NotI enzyme cuts object fragment P
pGK1-UGT51 and pESC-HIS carrier (Invitrogen company).Cut glue and reclaim two fragments, get P
pGK1-UGT51 digestion products (200ng), pESC-HIS carrier digestion products (100ng) add linked system: T4 Ligation Buffer (10 ×) 2 μ L, T4 DNA Ligase 1 μ L, supplementary distilled water to 20 μ L, 16 DEG C of reaction overnight obtain connecting product.Connect product conversion ZD-PPD-010 competent cell, cultivate in screening culture medium, obtain transformant.Screening culture medium is: 0.8% yeast Selective agar medium SD-Leu-Ura-His, 2% glucose; The condition of screening and culturing is: 30 DEG C, cultivates 36 hours.Carry out PCR qualification with primer BamHI-PGK1-F (primer table 1), NotI-UGT51-R (primer table 1), obtain correct positive colony, called after recombinant bacterium 1.
With recombinant plasmid pESC-P
pGK1-UGT51 is template, with the oligonucleotide of a pair complementation with mutational site for primer (see embodiment 4), carry out full plasmid PCR amplification with PrimeSTAR HS high-fidelity enzyme (TakaRa company), obtain the recombinant plasmid with specific mutational site.
Amplification system is: PrimeSTAR Buffer (5 ×) 10 μ L, dNTP (2.5mM) 4 μ L, recombinant plasmid template 20ng, primer (10 μMs) each 2 μ L, PrimeSTAR HS high-fidelity enzyme 0.5 μ L, supplementary distilled water to 50 μ L.Amplification condition is 98 DEG C of denaturations 1 minute; 98 DEG C of sex change, 10 seconds, 68 DEG C annealing and extension 8 minutes (30 circulations).Glue reclaims PCR primer, digests glue reclaim product 2h with DpnI enzyme (Fermentas company) under 37 DEG C of conditions, degraded original template.Digestion product is converted into E.coli DH5 α, is applied to containing on 100 μ g/mL penbritin LB agar plates, 37 DEG C of incubated overnight, screening positive clone, sequence verification.Extract recombinant plasmid, transform ZD-PPD-010 competent cell, cultivate in screening culture medium, obtain transformant.Screening culture medium is: 0.8% yeast Selective agar medium SD-Leu-Ura-His, 2% glucose; The condition of screening and culturing is: 30 DEG C, cultivates 36 hours.Carry out PCR qualification with primer BamHI-PGK1-F (primer table 1), NotI-UGT51-R (primer table 1), obtain correct positive colony, respectively called after recombinant bacterium 2-11.
Recombinant bacterium 1-11 prepares fermentation seed liquid in YPD liquid nutrient medium.30 DEG C, cultivate 16 hours under 220rpm condition.Collected by centrifugation thalline, is transferred in the 500mL triangular flask containing 100mLYPD liquid nutrient medium, adjusts OD to 0.5,30 DEG C, shaking culture 6 days under 220rpm condition.
Fermented liquid 8000g collected by centrifugation thalline, ultrasonication, 10000g collected by centrifugation supernatant liquor, with n-butanol extraction, gets organic phase, and with dissolve with methanol after vacuum-drying, carry out LC-MS analysis, method is with embodiment 1.All containing target product ginsenoside Rh2 in result display recombinant bacterium 1-11 fermentation broth extract.
More than describe preferred embodiment of the present invention in detail.Should be appreciated that those of ordinary skill in the art just design according to the present invention can make many modifications and variations without the need to creative work.Therefore, all technician in the art, all should by the determined protection domain of claims under this invention's idea on the basis of existing technology by the available technical scheme of logical analysis, reasoning, or a limited experiment.
Claims (10)
1. the application of glycosyltransferase in synthesis ginsenoside Rh2, it is characterized in that, described glycosyltransferase is the glycosyltransferase of the UGT51 genes encoding deriving from yeast saccharomyces cerevisiae, called after UGT51 albumen, the nucleotides sequence of this albumen of encoding is classified as SEQ NO:1, aminoacid sequence is that SEQ NO:2 or nucleotides sequence are classified as SEQNO:3, and aminoacid sequence is SEQ NO:4.
2. the application of glycosyltransferase in synthesis ginsenoside Rh2, it is characterized in that, described glycosyltransferase is through replacement, lacks or adds one or more amino acid and has the derived protein of identical function with albumen shown in SEQ NO:2 or SEQ NO:4.
3. a glycosyltransferase, is characterized in that, it is the glycosyltransferase mutant obtained by replacing the amino-acid residue on one or more positions of wild-type UGT51 glycosyltransferase with another kind of amino-acid residue.
4. a glycosyltransferase, it is characterized in that, it is the glycosyltransferase mutant obtained by showing the amino-acid residue on one or more positions of the glycosyltransferase of the aminoacid sequence of at least 90% homology with another kind of amino-acid residue replacement with wild-type UGT51 glycosyltransferase.
5. the glycosyltransferase as described in claim 3 or 4, is characterized in that, is preferably L-Ala or α-amino-isovaleric acid for the described another kind of amino-acid residue replacing original amino-acid residue.
6. the gene of coding glycosyltransferase mutant as described in claim 3 or 4.
7. comprise the recombinant vectors of glycosyltransferase mutant gene as claimed in claim 6.
8. a glycosyltransferase turns the method for the external synthesis ginsenoside Rh2 of glycosylation, it is characterized in that, with protopanoxadiol and glycosyl donor UDPG for raw material, under the katalysis of glycosyltransferase, 3 hydroxyl generation glycosylations of protopanoxadiol, generate rare ginsenoside Rh2;
Described glycosyltransferase is UGT51 albumen, or the UGT51 albumen removed behind N-terminal film land, or the amino-acid residue replaced with another kind of amino-acid residue on one or more positions of wild-type UGT51 glycosyltransferase and the glycosyltransferase mutant that obtains, or replace with another kind of amino-acid residue and show the amino-acid residue on one or more positions of the glycosyltransferase of the aminoacid sequence of at least 90% homology with wild-type UGT51 glycosyltransferase and the glycosyltransferase mutant that obtains.
9. method as claimed in claim 8, it is characterized in that, the ratio of described glycosyl donor UDPG and protopanoxadiol is: 1:1 ~ 10:1 (w/w).
10. the method for complete synthesis ginsenoside Rh2 in a microbe, it is characterized in that, based on the engineering bacteria can producing protopanoxadiol, import the expression cassette of glycosyltransferase encoding gene UGT51 or its mutator gene, obtain recombinant bacterium, fermentation culture obtains target product ginsenoside Rh2;
The expression cassette of described glycosyltransferase encoding gene UGT51 specifically comprises promotor PGK1, glycosyltransferase encoding gene UGT51 and terminator ADH1;
The expression cassette of described glycosyltransferase encoding gene UGT51 mutator gene specifically comprises promotor PGK1, glycosyltransferase encoding gene UGT51 mutator gene and terminator ADH1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410534597.8A CN104357418B (en) | 2014-10-11 | 2014-10-11 | The application of a kind of glycosyl transferase and its mutant in ginseng saponin Rh 2 is synthesized |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410534597.8A CN104357418B (en) | 2014-10-11 | 2014-10-11 | The application of a kind of glycosyl transferase and its mutant in ginseng saponin Rh 2 is synthesized |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104357418A true CN104357418A (en) | 2015-02-18 |
| CN104357418B CN104357418B (en) | 2017-11-10 |
Family
ID=52524731
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410534597.8A Active CN104357418B (en) | 2014-10-11 | 2014-10-11 | The application of a kind of glycosyl transferase and its mutant in ginseng saponin Rh 2 is synthesized |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104357418B (en) |
Cited By (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106350565A (en) * | 2016-09-12 | 2017-01-25 | 中国科学院天津工业生物技术研究所 | Production method of rare ginsenoside Rh2 |
| CN106520645A (en) * | 2016-09-27 | 2017-03-22 | 南开大学 | Engineering bacterium of gynostemma pentaphyllum glycosyl transferase, and construction method and application thereof |
| CN108588058A (en) * | 2018-04-28 | 2018-09-28 | 南京工业大学 | β -fructofuranosidase mutant and application thereof |
| CN108690822A (en) * | 2017-04-12 | 2018-10-23 | 上海医药工业研究院 | A kind of genetic engineering bacterium and its method producing protopanoxadiol |
| CN109295027A (en) * | 2018-11-06 | 2019-02-01 | 浙江华睿生物技术有限公司 | A kind of glycosyl transferase mutant |
| CN109468287A (en) * | 2018-11-22 | 2019-03-15 | 浙江华睿生物技术有限公司 | A kind of hydroxylation enzyme mutant |
| CN110462033A (en) * | 2017-05-16 | 2019-11-15 | 中国科学院上海生命科学研究院 | Glycosyl transferase, mutant and its application |
| CN116218810A (en) * | 2023-03-25 | 2023-06-06 | 西北大学 | Glycosyltransferase BS-YjiC mutant and construction method and application thereof |
| CN116286894A (en) * | 2023-02-22 | 2023-06-23 | 首都医科大学 | Glycosyltransferase for catalyzing biosynthesis of rare ginsenoside, and encoding gene and application thereof |
| CN117683794A (en) * | 2024-02-04 | 2024-03-12 | 湖南工程学院 | PgCOMT2 gene for promoting synthesis of melatonin and ginsenoside in ginseng and application thereof |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6498239B1 (en) * | 1996-10-21 | 2002-12-24 | Gesellschaft fur Erwerb und Verwertung von Schutzrechten—GVS mbH | Sterol glycosyl transferases |
| WO2014051215A1 (en) * | 2012-09-27 | 2014-04-03 | Korea Advanced Institute Of Science And Technology | Novel udp-glycosyltransferase derived from ginseng and use thereof |
| WO2014051214A1 (en) * | 2012-09-27 | 2014-04-03 | Korea Advanced Institute Of Science And Technology | Novel udp-glycosyltransferase derived from ginseng and use thereof |
| CN103849672A (en) * | 2012-12-06 | 2014-06-11 | 中国科学院上海生命科学研究院 | Group of glycosyl transferase and application thereof |
-
2014
- 2014-10-11 CN CN201410534597.8A patent/CN104357418B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6498239B1 (en) * | 1996-10-21 | 2002-12-24 | Gesellschaft fur Erwerb und Verwertung von Schutzrechten—GVS mbH | Sterol glycosyl transferases |
| WO2014051215A1 (en) * | 2012-09-27 | 2014-04-03 | Korea Advanced Institute Of Science And Technology | Novel udp-glycosyltransferase derived from ginseng and use thereof |
| WO2014051214A1 (en) * | 2012-09-27 | 2014-04-03 | Korea Advanced Institute Of Science And Technology | Novel udp-glycosyltransferase derived from ginseng and use thereof |
| CN103849672A (en) * | 2012-12-06 | 2014-06-11 | 中国科学院上海生命科学研究院 | Group of glycosyl transferase and application thereof |
Non-Patent Citations (4)
| Title |
|---|
| JOHNSTON,M.等: "AAB67475.1", 《GENBANK》 * |
| PINGPING WANG等: "Production of bioactive ginsenosides Rh2 and Rg3 by metabolically engineered yeasts", 《METABOLIC ENGINEERING》 * |
| SUK-CHAE JUNG等: "Two Ginseng UDP-Glycosyltransferases Synthesize Ginsenoside Rg3 and Rd", 《PLANT CELL PHYSIOL》 * |
| 王菡 等: "人参皂苷生物合成的相关酶及其基因的研究进展", 《人参研究》 * |
Cited By (15)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106350565A (en) * | 2016-09-12 | 2017-01-25 | 中国科学院天津工业生物技术研究所 | Production method of rare ginsenoside Rh2 |
| CN106520645A (en) * | 2016-09-27 | 2017-03-22 | 南开大学 | Engineering bacterium of gynostemma pentaphyllum glycosyl transferase, and construction method and application thereof |
| CN106520645B (en) * | 2016-09-27 | 2019-07-16 | 南开大学 | The engineering bacteria and its construction method of gynostemma pentaphylla glycosyl transferase and application |
| CN108690822A (en) * | 2017-04-12 | 2018-10-23 | 上海医药工业研究院 | A kind of genetic engineering bacterium and its method producing protopanoxadiol |
| CN108690822B (en) * | 2017-04-12 | 2021-11-05 | 上海医药工业研究院 | Genetically engineered bacterium for producing protopanoxadiol and method thereof |
| CN110462033A (en) * | 2017-05-16 | 2019-11-15 | 中国科学院上海生命科学研究院 | Glycosyl transferase, mutant and its application |
| CN108588058A (en) * | 2018-04-28 | 2018-09-28 | 南京工业大学 | β -fructofuranosidase mutant and application thereof |
| CN109295027A (en) * | 2018-11-06 | 2019-02-01 | 浙江华睿生物技术有限公司 | A kind of glycosyl transferase mutant |
| CN109468287A (en) * | 2018-11-22 | 2019-03-15 | 浙江华睿生物技术有限公司 | A kind of hydroxylation enzyme mutant |
| CN109468287B (en) * | 2018-11-22 | 2020-10-16 | 浙江华睿生物技术有限公司 | Hydroxylase mutant |
| CN116286894A (en) * | 2023-02-22 | 2023-06-23 | 首都医科大学 | Glycosyltransferase for catalyzing biosynthesis of rare ginsenoside, and encoding gene and application thereof |
| CN116218810A (en) * | 2023-03-25 | 2023-06-06 | 西北大学 | Glycosyltransferase BS-YjiC mutant and construction method and application thereof |
| CN116218810B (en) * | 2023-03-25 | 2023-09-12 | 西北大学 | Glycosyltransferase BS-YjiC mutant and construction method and application thereof |
| CN117683794A (en) * | 2024-02-04 | 2024-03-12 | 湖南工程学院 | PgCOMT2 gene for promoting synthesis of melatonin and ginsenoside in ginseng and application thereof |
| CN117683794B (en) * | 2024-02-04 | 2024-04-26 | 湖南工程学院 | PgCOMT2 gene for promoting synthesis of melatonin and ginsenoside in ginseng and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104357418B (en) | 2017-11-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104357418A (en) | Applications of glycosyltransferase and mutants thereof to synthesis of ginsenoside Rh2 | |
| CN109988722B (en) | Recombinant saccharomyces cerevisiae strain, application thereof and method for producing tyrosol and/or salidroside | |
| CN107164253B (en) | Genetically engineered bacterium for catalyzing glucosidation of flavonoid compound and application thereof | |
| CN110343678B (en) | Panax japonicus glycosyltransferase UGTPjm1 gene and application thereof in preparation of ginsenoside Ro | |
| CN106497827A (en) | A kind of orientation production anti-tubercular and engineering strain and its application of active compound for anti tumor | |
| CN104404065A (en) | Mangosteen glycosyltransferase gene UGT74AC1 and application thereof | |
| CN104673855A (en) | Method for synthesizing 6-hexose phosphate by employing enzymic method | |
| CN111424020B (en) | Epimedium-derived galactosyltransferase and application thereof in preparation of hyperoside | |
| CN110117582B (en) | Fusion protein, encoding gene thereof and application thereof in biosynthesis | |
| Wu et al. | Rhamnosyltransferases involved in the biosynthesis of flavone rutinosides in Chrysanthemum species | |
| CN106434703A (en) | Cytochrome CYP450 gene CYP71D410 participating in biosynthesis of tanshinone compounds as well as encoded product and application of gene | |
| CN115109787B (en) | Glycosyltransferase gene and application thereof in preparation of pseudo-ginseng/ginsenoside | |
| CN104673814B (en) | A kind of L threonine aldolases for coming from enterobacter cloacae and its application | |
| CN107880134B (en) | Method for enzymatic synthesis of kaempferol | |
| CN110305855A (en) | Rhizoma Gastrodiae GeCPR gene and its application | |
| CN107460152A (en) | Produce recombinant bacterium, construction method and the purposes of rhodioside and the like | |
| CN116731886A (en) | Engineering bacterium for producing glycosylated astaxanthin as well as construction method and application thereof | |
| Zhang et al. | Comparative transcriptome analysis and identification of candidate genes involved in cucurbitacin IIa biosynthesis in Hemsleya macrosperma | |
| CN110004099A (en) | A kind of fermentation method for producing of rhodioside | |
| CN108060143A (en) | A kind of CYP76B74 albumen for participating in alkannin biosynthesis and its encoding gene and application | |
| CN114736918A (en) | Recombinant escherichia coli for producing salidroside through integrated expression and application thereof | |
| CN113817757A (en) | Recombinant yeast engineering strain for producing cherry glycoside and application | |
| CN112646834A (en) | Lupeol derivative and synthesis method and application thereof | |
| CN109593740A (en) | A kind of glycosyl transferase and its application | |
| CN106916835B (en) | Biosynthetic gene cluster of compounds and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |