CN108690822B - Genetically engineered bacterium for producing protopanoxadiol and method thereof - Google Patents

Abstract

The invention discloses a genetically engineered bacterium for producing protopanoxadiol, which is an engineered bacterium for expressing a squalene synthase gene, a2, 3-oxidosqualene synthase gene, a dammarenediol synthase gene, a protopanaxadiol synthase gene and a nicotinamide adenine dinucleotide phosphate-cytochrome P450 reductase gene in Escherichia coli (Escherichia coli). The protopanaxadiol is biosynthesized by utilizing the genetic engineering bacteria, and the method has the advantages of short fermentation time, simple culture medium, capability of meeting the requirements of modern industry, contribution to popularization and application and the like.

Description

Genetically engineered bacterium for producing protopanoxadiol and method thereof

Technical Field

The invention belongs to the technical field of genetic engineering, and particularly relates to a biosynthesis method of protopanoxadiol and a production strain thereof.

Background

Protopanaxadiol (PPD) belongs to tetracyclic triterpenoid, is aglycone of panaxadiol type saponins Ra1, Ra2, Rb1, Rb2, Rc, Rd, Rg3, Rh2 and the like, and is mainly derived from Araliaceae plants such as ginseng, pseudo-ginseng, American ginseng and the like and Cucurbitaceae plants such as gynostemma pentaphylla and the like. Has antitumor, antidepressant, and immunity enhancing effects. At present, the extraction of ginseng plants is mainly caused, the cost is high, the efficiency is low, and the sources of the ginseng plants are limited by natural environments, such as the input amount of land, climate and the like.

Synthetic biology is an emerging engineering subject emerging at the beginning of the 21 st century, is a new research field which is developed rapidly based on engineering and biology and oriented to innovation, and is expected to solve the big problems of biochemical engineering, biological energy, biological materials, biological medicine fields, national civilian relations and the like. The emergence of synthetic biology establishes an effective way for the rapid production of natural plant drugs, is expected to become one of the most promising green and environment-friendly technologies for drug production in the future, and can effectively solve the resource problem possibly caused by the research and development of natural drugs from plants. Biosynthesis of natural plant drugs, such as alkadiene, artemisinin, carotene, etc., has achieved remarkable success. The research not only proves the feasibility of realizing the heterologous biosynthesis of rare plant secondary metabolites through the design of synthetic biology, but also shows the great advantages and application potential of the technology.

At present, the heterologous production of various plant living natural medicines is realized by utilizing the synthetic biology principle to design and transform microbial strains, and the most common microbial hosts are saccharomyces cerevisiae and escherichia coli.

Saccharomyces cerevisiae (Saccharomyces cerevisiae) is a eukaryote that is more suitable for expression of genes of plant secondary metabolites including genes such as P450 oxidase because it has an endomembrane system. At present, many natural plant drugs have been biosynthesized in saccharomyces cerevisiae. Bo-dong (Zhubo Dai) etc. by introducing dammarane synthase, protopanaxadiol synthase and NADPH cytochrome P450 enzyme in Saccharomyces cerevisiae, 0.05mg/g protopanaxadiol was produced; further by introducing truncated 3-hydroxy-3-methylglutaryl coenzyme A, squalene synthase, 2, 3-oxidosqualene synthase and codon optimization of protopanoxadiol synthase, a 262-fold increase in protopanaxadiol is caused; further fermenting for 96h by bidirectional extraction fermentation technology to obtain 8.40mg/g (1189mg/L) of protopanaxadiol and 10.94mg/g (1548mg/L) of dammarenediol. The main disadvantage of this process is the too long fermentation time (patent application CN 102925376A & Zhubo Dai Yiiliu Xiana Zhang et al. Metabolic Engineering of Saccharomyces cerevisiae for production of enzymes [ J ]. Metabolic Engineering,2013,20146-. However, when the saccharomyces cerevisiae is used as an eukaryote and used for biosynthesis of a target substance, the saccharomyces cerevisiae has the defects of long fermentation period, complex genetic operation, difficulty in high-density fermentation and the like, and the application of the saccharomyces cerevisiae in biosynthesis of a plant secondary metabolite is limited.

Coli is the earliest and most mature one of all engineering bacteria, and has the advantages of high growth speed, short fermentation time, simple culture medium and the like, so that escherichia coli has incomparable advantages of saccharomyces cerevisiae in industrial production, and is more energy-saving and more efficient; and the Escherichia coli genome is small, the genetic tools, the technology and related knowledge are very clear, the requirements of modern industry are met, and the advantages are incomparable with the Saccharomyces cerevisiae, so that the strain becomes the preferred host bacterium in the research of plant secondary metabolite synthesis biology. At present, almost all kinds of natural products, such as polyketides (such as erythromycin), nonribosomal peptides (such as epothilone), terpenoids (such as taxadiene), phenylpropanoids (such as resveratrol), alkaloids ((S) -reticuline), and other compounds, are successfully reported to be synthesized heterologously in escherichia coli. Since Escherichia coli does not contain related genes such as squalene synthase, 2, 3-oxidosqualene synthase, dammarendiol synthase, protopanaxadiol synthase, and nicotinamide adenine dinucleotide phosphate-cytochrome P450 reductase, which are required for protopanaxadiol biosynthesis, it is necessary to introduce related genes such as squalene synthase, 2, 3-oxidosqualene synthase, dammarendiol synthase, protopanaxadiol synthase, and nicotinamide adenine dinucleotide phosphate-cytochrome P450 reductase into Escherichia coli for biosynthesis of protopanaxadiol by Escherichia coli, and finally obtain protopanaxadiol-producing Escherichia coli by fermentation.

The protopanoxadiol is biosynthesized in escherichia coli, has great economic value and academic value, not only realizes green production for industrial production of PPD, but also provides ideas and methods for realizing green production of active ingredients of traditional Chinese medicines and natural medicines through the escherichia coli.

Disclosure of Invention

The invention aims to solve the technical problems of low yeast growth speed, long fermentation time, complex culture medium, inconvenience for industrial production and the like in the prior art for biosynthesis of protopanoxadiol by using yeast, and provides an escherichia coli engineering bacterium capable of producing protopanoxadiol, a corresponding enzyme gene, a recombinant vector and a method for preparing protopanoxadiol. The protopanaxadiol is biosynthesized by utilizing the genetic engineering bacteria, and the method has the advantages of short fermentation time, simple culture medium, capability of meeting the requirements of modern industry, contribution to popularization and application and the like.

Through a plurality of attempts and researches, the inventor screens exogenous squalene synthase and 2, 3-oxidosqualene synthase from a plurality of enzymes for synthesizing protopanoxadiol, clones the exogenous squalene synthase and the 2, 3-oxidosqualene synthase, and simultaneously transfers the cloned exogenous squalene synthase and the genes of dammaradiene synthase, protopanaxadiol synthase and NADPH cytochrome P450 enzyme into escherichia coli, and finally successfully expresses five heterologous genes in escherichia coli.

One of the technical solutions for solving the above technical problems of the present invention is: a genetically engineered bacterium for producing protopanoxadiol is an engineered bacterium for expressing a squalene synthase gene, a2, 3-oxidosqualene synthase gene, a dammarendiol synthase gene, a protopanaxadiol synthase gene and a nicotinamide adenine dinucleotide phosphate-cytochrome P450 reductase gene in Escherichia coli (Escherichia coli).

Wherein the squalene synthase gene, the 2, 3-oxidosqualene synthase gene, the dammarendiol synthase gene, the protopanoxadiol synthase gene and the nicotinamide adenine dinucleotide phosphate-cytochrome P450 reductase gene may be cloned on the same vector for expression, or may be cloned on more than one vector for expression.

In order to take account of cost, preparation efficiency, better function of each gene and expression quantity of final products, preferably, the squalene synthase gene and the 2, 3-oxidosqualene synthase gene are cloned into an expression vector 1, and the skeleton of the expression vector 1 is preferably a plasmid pCDFDuet-1; cloning the dammarenediol synthase gene, the protopanaxadiol synthase gene and the nicotinamide adenine dinucleotide phosphate-cytochrome P450 reductase gene into an expression vector 2, wherein the skeleton of the expression vector 2 is preferably a plasmid pACYCDuet-1; more preferably, said expression vector 2 contains two of said nicotinamide adenine dinucleotide phosphate-cytochrome P450 reductase genes for better supplying electrons to dammarenediol synthase and protopanaxadiol synthase.

In order to overcome the defect that Escherichia coli lacks endoplasmic reticulum omentum required by P450 enzyme gene localization, the invention takes dammaradiene synthase (DDS, accession number: AB265170), protopanaxadiol synthase (PPDS, accession number: JN604537) and NADPH cytochrome P450 enzyme (AtCPR1, accession number: X66016) as templates to respectively optimize Escherichia coli codons and modify gene sequences, so that 5 exogenous genes can be simultaneously expressed in Escherichia coli cells and have synergistic effect. Wherein the dammarenediol synthase gene can catalyze 2, 3-oxidosqualene to synthesize dammaradiene, and preferably, the nucleotide sequence is shown as SEQ ID NO. 3; the protopanaxadiol synthase gene can catalyze dammarane to synthesize protopanaxadiol, and preferably, the nucleotide sequence of the protopanaxadiol synthase gene is shown as SEQ ID No. 4; the nicotinamide adenine dinucleotide phosphate-cytochrome P450 reductase gene can provide electrons for dammarane synthase and protopanaxadiol synthase, and preferably, the nucleotide sequence of the nicotinamide adenine dinucleotide phosphate-cytochrome P450 reductase gene is shown as SEQ ID NO. 5.

More preferably still, said dammarenediol synthase gene and protopanaxadiol synthase gene are each adjacent to one of said nicotinamide adenine dinucleotide phosphate-cytochrome P450 reductase genes; the nicotinamide adenine dinucleotide phosphate-cytochrome P450 reductase genes are preferably both located downstream of the dammarenediol synthase gene or the protopanaxadiol synthase gene. Optimally, in order to overcome the problem that the cytochrome P450 enzyme gene and cytochrome P450 reductase gene derived from eukaryotic cells are difficult to express in Escherichia coli, the nicotinamide adenine dinucleotide phosphate-cytochrome P450 reductase gene and the dammarendiol synthase gene or the protopanaxadiol synthase gene respectively form fusion genes, and the nucleotide sequences thereof are preferably shown as SEQ ID No.6 or SEQ ID No.7 respectively.

The squalene synthase gene can catalyze farnesyl pyrophosphate (FPP) to synthesize a squalene compound; preferably, it is derived from Saccharomyces cerevisiae; more preferably, the nucleotide sequence is shown in SEQ ID NO. 1.

The 2, 3-oxidosqualene synthase gene can catalyze squalene to synthesize 2, 3-oxidosqualene; preferably, a2, 3-oxidosqualene synthase gene derived from Saccharomyces cerevisiae (Saccharomyces cerevisiae) is selected; more preferably, the nucleotide sequence is shown in SEQ ID NO. 2.

The second technical scheme for solving the technical problems is as follows: a gene, which is a dammarenediol synthase gene, and the nucleotide sequence of the gene is shown in SEQ ID NO. 3;

it is a protopanaxadiol synthase gene, and the nucleotide sequence of the protopanaxadiol synthase gene is shown in SEQ ID NO. 4;

it is a nicotinamide adenine dinucleotide phosphate-cytochrome P450 reductase gene, and the nucleotide sequence of the gene is shown as SEQ ID NO. 5;

it is a fusion gene 1 of dammarenediol synthase gene and nicotinamide adenine dinucleotide phosphate-cytochrome P450 reductase gene, and the nucleotide sequence is shown as SEQ ID NO. 6; alternatively, the first and second electrodes may be,

it is a fusion gene 2 of the protopanaxadiol synthase gene and a nicotinamide adenine dinucleotide phosphate-cytochrome P450 reductase gene, and the nucleotide sequence of the fusion gene is shown as SEQ ID NO. 7.

The third technical scheme for solving the technical problems is as follows: an expression vector (expression vector 1) comprising the squalene synthase gene and a2, 3-oxidosqualene synthase gene. Preferably, the backbone of the expression vector is plasmid pCDFDuet-1.

The fourth technical scheme for solving the technical problems is as follows: an expression vector (expression vector 2) comprising the dammarenediol synthase gene, the protopanaxadiol synthase gene and the nicotinamide adenine dinucleotide phosphate-cytochrome P450 reductase gene; preferably, the expression vector comprises the fusion gene 1 and the fusion gene 2. More preferably, the backbone of the expression vector is preferably plasmid pACYCDuet-1.

The fifth technical scheme for solving the technical problems is as follows: a method for preparing protopanaxadiol comprises fermenting the above genetically engineered bacteria, and obtaining protopanaxadiol from the fermentation broth.

The sixth technical scheme for solving the technical problems of the invention is as follows: a preparation method of the genetic engineering bacteria comprises the following steps:

1) constructing an expression vector 1 containing a squalene synthase gene and a2, 3-oxidosqualene synthase gene, and an expression vector 2 containing a dammarendiol synthase gene, a protopanaxadiol synthase gene and two nicotinamide adenine dinucleotide phosphate-cytochrome P450 reductase genes;

2) escherichia coli (Escherichia coli) is used as a host strain, and the expression vector 1 and the expression vector 2 obtained in the step 1) are simultaneously transformed to obtain the Escherichia coli genetic engineering bacteria for recombinant expression of protopanoxadiol. The Escherichia coli is conventional in the art.

Preferably, the Escherichia coli strain of the present invention is preferably BL21(DE3) strain.

It is to be understood that "1" and "2" in "expression vector 1" and "expression vector 2" and "fusion gene 1" and "fusion gene 2" of the present invention have no practical meaning, but are merely intended to distinguish the same terms.

On the basis of the common knowledge in the field, the above preferred conditions can be combined randomly to obtain the preferred embodiments of the invention.

The reagents and starting materials used in the present invention are commercially available.

The positive progress effects of the invention are as follows:

the genetic engineering bacteria of the invention are utilized to biologically synthesize protopanaxadiol, the fermentation time is short, the culture medium is simple, the genome of escherichia coli is small, the genetic tools, the technology and the related knowledge are very clear, the requirements of modern industry are met, and the popularization and the application are facilitated; and the protopanoxadiol is biosynthesized in escherichia coli, has great economic value and academic value, not only realizes 'green' for industrial production of PPD, but also provides thinking and a method for realizing 'green' production of active ingredients of traditional Chinese medicines and natural medicines through escherichia coli.

Drawings

FIG. 1 is a schematic diagram of plasmid pCDFDuet-1SSSE construction.

FIG. 2 is a schematic diagram of the construction of plasmid pACYCDuet-1D612C46P72C 46.

FIG. 3 is a schematic diagram of the construction of plasmid pACYCDuet-1D612C46P1C 46.

FIG. 4 is an electrophoretogram of the Saccharomyces cerevisiae genome.

FIG. 5 is an electrophoretogram of SS gene and SE gene from Saccharomyces cerevisiae.

FIG. 6 shows the electrophoresis chart of pCDFDuet-1 and SS gene double-enzyme gel-cutting recovery.

FIG. 7 shows PCR verification of pCDFDuet-1SS plasmid.

FIG. 8 shows the electrophoresis of pCDFDuet-1SS and SE gene double-enzyme gel-cutting recovery.

FIG. 9 shows PCR verification of pCDFDuet-1SSSE plasmid.

FIG. 10 shows electrophoretograms of the D612, C46 and D612C46 genes.

FIG. 11 shows the electrophoretograms of the P72, C46 and P72C46 genes.

FIG. 12 shows the electrophoresis of P1, C46 and P1C46 genes.

FIG. 13 is the electrophoresis chart of the double-enzyme gel-cutting recovery of pACYDuet-1 and D612C46 genes.

FIG. 14 shows PCR verification of pACYDuet-1D612C46 plasmid liquid.

FIG. 15 is the electrophoresis diagram of the recovery of the double-enzyme gel of pACYDuet-1D612C46 and P72C46 genes.

FIG. 16 shows PCR verification of pACYDuet-1D612C46P72C46 plasmid.

FIG. 17 is the electrophoresis diagram of the recovery of the pACYDuet-1D612C46 and P1C46 gene double-enzyme gel.

FIG. 18 shows PCR verification of pACYDuet-1D612C46P1C46 plasmid.

FIGS. 19A-19E liquid chromatogram and product fragment ion diagram of protopanaxadiol and sample.

Detailed Description

The invention is further illustrated by the following examples, which are not intended to limit the scope of the invention. The experimental methods without specifying specific conditions in the following examples were selected according to the conventional methods and conditions, or according to the commercial instructions.

2 × Taq Master Mix (Dye Plus) was purchased from Novowed Biotechnology Inc.;

coli BL21(DE3) and DH 5. alpha. competent cells were purchased from Shanghai Diego Biotech Ltd

The enzymes used: nde I, Kpn I, BamH I, Hind III, Bgl II, T4 ligase and

max DNA polymerases are available from Dalibao Bio Inc. (TaKaRa, Dalian, China);

streptomycin and chloramphenicol were purchased from Shanghai Biotechnology, Inc.;

the DNA recovery kit is purchased from Shanghai Czeri bioengineering, Inc.;

sequencing company is Shanghai Ruidi Biotech, Inc.

EXAMPLE 1 plasmid pCDFDuet-1SSSE construction

(1) Saccharomyces cerevisiae Squalene Synthase (SS) gene cloning

Extracting Saccharomyces cerevisiae ATCC 204508 (purchased from ATCC) genome by fungal genome DNA extraction kit (Beijing Soilebao technologies, Ltd.), as electrophoretogram 4; the extracted Saccharomyces cerevisiae genome DNA is used as a template, and primers on SS and under SS are used for amplifying SS genes (GenBank accession number: EU675328), and the sequence is shown as SEQ ID NO. 1.

Amplification primer sequences:

on SS: CGGGATCCGATGGGAAAGCTATTACAATTG (see SEQ ID NO.11 for details);

under SS: CCAAGCTTTCACGCTCTGTGTAAAGTGTATATATAATAAAAC (see SEQ ID NO.12 for details).

Amplification system:

Max DNA polymerase：25μL；

primer (10 μ M): 2 μ L each;

S288C genomic DNA (template): 2 mu L of the solution;

distilled water was added to 50. mu.L.

Amplification conditions:

1) pre-denaturation at 98 ℃ for 10 s; 2) denaturation at 98 ℃ for 10 s; 3) annealing at 62 ℃ for 10 s; 4) extension at 72 ℃ for 10 s; 2) -4)35 cycles; 5) extension at 72 ℃ for 10 min.

And recovering the target gene fragment by using the thin agarose gel DNA recovery kit gel, such as an electrophoresis chart 5.

(2) Saccharomyces cerevisiae 2, 3-oxidosqualene Synthase (SE) Gene cloning

The extracted Saccharomyces cerevisiae genome DNA is used as a template, and primers of 'SE upper' and 'SE lower' are used for amplifying a SE gene (GenBank accession number: NC 001139), and the sequence is shown as SEQ ID NO. 2.

Amplification primer sequences:

on SE: GAAGATCTCATGTCTGCTGTTAACGTTGCAC (see SEQ ID NO.13 for details);

at SE: GGGGTACCTTAACCAATCAACTCACCAAAC (see SEQ ID NO.14 for details).

Amplification system:

Max DNA polymerase：25μL；

primer (10 μ M): 2 μ L each;

S288C genomic DNA (template): 2 mu L of the solution;

distilled water was added to 50. mu.L.

Amplification conditions:

1) pre-denaturation at 98 ℃ for 10 s; 2) denaturation at 98 ℃ for 10 s; 3) annealing at 62 ℃ for 10 s; 4) extension at 72 ℃ for 10 s; 2) -4)35 cycles; 5) extension at 72 ℃ for 10 min.

Then, the thin agarose gel DNA recovery kit gel is used for recovering the target gene fragment, as shown in the electrophoresis chart 5.

(3) Expression vector construction

pCDFDuet-1SS vector construction

The recovered SS gene and the vector pCDFDuet-1(Novagen) were subjected to double digestion with BamH I and Hind III, respectively, as shown in FIG. 6, the vector pCDFDuet-1 and the SS fragment were ligated with T4 ligase at 16 ℃ overnight at a molar ratio of 1:5, the ligation product was transformed into E.coli DH 5. alpha. and then spread on LB (peptone 10%, yeast extract 5%, NaCl 10%, agarose 12%) solid plates containing 100. mu.g/mL streptomycin, transformants were picked up and cultured overnight, and the bacterial solution was screened for positive clones by PCR with 2 XTAQ Master Mix (Dye Plus) as shown in FIG. 7, and the sequencing was verified to match the expected base sequence.

pCDFDuet-1SSSE vector construction

The recovered SE gene and the vector pCDFDuet-1SS were subjected to double digestion with Bgl II and Kpn I, respectively, as shown in FIG. 8, the vector pCDFDuet-1SS and the exogenous fragment SE were ligated with T4 ligase at 16 ℃ overnight in a molar ratio of 1:5, the ligation product was transformed into E.coli DH 5. alpha. and then spread on LB (peptone 10%, yeast extract 5%, NaCl 10%, agarose 12%) solid plate containing 100. mu.g/mL streptomycin, transformants were picked up, cultured overnight, and the bacterial solution was screened for positive clones by PCR with 2 XTAQ Master Mix (Dye Plus) as shown in FIG. 9, and the sequencing results were completely matched with the expected base sequences. The map of the resulting plasmid pCDFDuet-1SSSE is shown in FIG. 1.

EXAMPLE 2 construction of plasmid pACYCDuet-1D612C46P72C46

(1) Cloning of the D612C46 Gene

A. Using a dammarane synthase gene (DDS, accession number: AB265170) as a template, carrying out codon optimization by escherichia coli, chemically synthesizing a D gene (the sequence is shown as SEQ ID NO. 8), using the D gene as the template, carrying out hydrophobicity analysis, removing an amino acid sequence after the 612 th amino acid sequence, and amplifying the D612 gene by using 'upper D' and 'lower D' as primers, wherein the sequence of the D612 gene is shown as SEQ ID NO. 3.

Amplification primer sequences:

d, the last step: CGCGGATCCGATGTGGAAGCAGAAGGGCGCACAG (see SEQ ID NO.15 for details);

d, the following steps: GTGGTCTTCTTCCATGTCGACCCAGAGCCATCCGGCATCTGGTTGC (see SEQ ID NO.16 for details).

Amplification system:

Max DNA polymerase：25μL；

primer (10 μ M): 2 μ L each;

d gene (template): 2 mu L of the solution;

distilled water was added to 50. mu.L.

Amplification conditions:

1) pre-denaturation at 98 ℃ for 10 s; 2) denaturation at 98 ℃ for 10 s; 3) annealing at 62 ℃ for 10 s; 4) extension at 72 ℃ for 20 s; 2) -4)35 cycles; 5) extension at 72 ℃ for 10 min.

The target gene fragment was recovered using a thin agarose gel DNA recovery kit gel, as shown in FIG. 10.

B. Nicotinamide adenine dinucleotide phosphate-cytochrome P450 reductase gene (AtCPR1, accession number: X66016) is used as a template, a C gene (the sequence is shown as SEQ ID NO. 10) is chemically synthesized through codon optimization of escherichia coli, the C gene is used as the template, the front 46 amino acid sequence is removed through hydrophobicity analysis, the C46 gene is amplified by using primers on DC and under DC, and the sequence of the C46 gene is shown as SEQ ID NO. 5.

Amplification primer sequences:

on DC:

GCCGGATGGCTCTGGGTCGACATGGAAGAAGACCACCGCGGACC

(see SEQ ID NO.17 for details);

under DC: CCCAAGCTTTTACCACACATCACGCAGGTAGC (see SEQ ID NO.18 for details).

Amplification system:

max DNA polymerase: mu.L of 25. mu.L of each primer (10. mu.M) and 2. mu.L of C gene as a template, and distilled water was added to 50. mu.L.

Amplification conditions:

1) pre-denaturation at 98 ℃ for 10 s; 2) denaturation at 98 ℃ for 10 s; 3) annealing at 62 ℃ for 10 s; 4) extension at 72 ℃ for 20 s; 2) -4)35 cycles; 5) extension at 72 ℃ for 10 min.

The target gene fragment was recovered using a thin agarose gel DNA recovery kit gel, as shown in FIG. 10.

C. The D612C46 fusion gene is amplified by taking the D612 gene and the C46 gene as templates and taking the 'upper D' and 'lower DC' as primers, and the nucleotide sequence of the fusion gene is shown as SEQ ID NO. 6.

Amplification primer sequences:

d, the last step: CGCGGATCCGATGTGGAAGCAGAAGGGCGCACAG, respectively;

under DC: CCCAAGCTTTTACCACACATCACGCAGGTAGC are provided.

Amplification system:

Max DNA polymerase：25μL；

primer (10 μ M): 2 μ L each;

d612 gene, C46 gene (template): 2 μ L each;

distilled water was added to 50. mu.L.

Amplification conditions:

1) pre-denaturation at 98 ℃ for 10 s; 2) denaturation at 98 ℃ for 10 s; 3) annealing at 62 ℃ for 10 s; 4) extension at 72 ℃ for 40 s; 2) -4)35 cycles; 5) extension at 72 ℃ for 10 min.

The target gene fragment was recovered using a thin agarose gel DNA recovery kit gel, as shown in FIG. 10.

(2) Cloning of the P72C46 Gene

A. The method comprises the steps of using a protopanaxadiol synthase gene (PPDS, accession number: JN604537) as a template, carrying out codon optimization through escherichia coli, chemically synthesizing a P gene (the sequence is shown as SEQ ID NO. 9), removing the front 72 amino acid sequence through hydrophobicity analysis, amplifying the P72 gene by using 'P upper' and 'P lower' as primers, and using the sequence of a P72 gene as SEQ ID NO. 4.

Amplification primer sequences:

p, on: GGAATTCCATATGATGAAACGTATCCCGCAGAAGG (see SEQ ID NO.19 for details);

p is as follows: GGTCTTCTTCCATGTCGACCCGTTGTGCGGGTGCAGGTGAATC (see SEQ ID NO.20 for details).

Secondly, the amplification system is:

Max DNA polymerase：25μL；

primer (10 μ M): 2 mu L of the solution;

p gene (template): 2 mu L of the solution;

distilled water was added to 50. mu.L.

Amplification conditions:

1) pre-denaturation at 98 ℃ for 10 s; 2) denaturation at 98 ℃ for 10 s; 3) annealing at 62 ℃ for 10 s; 4) extension at 72 ℃ for 20 s; 2) -4)35 cycles; 5) extension at 72 ℃ for 10 min.

The target gene fragment was recovered using a thin agarose gel DNA recovery kit gel, as shown in FIG. 11.

B. The C gene optimized and chemically synthesized by the escherichia coli codon is used as a template, and the front 46 amino acid sequence is removed through hydrophobicity analysis, and PCR amplification is carried out to obtain the C46 gene.

The sequence of the amplification primer is as follows:

on PC: GCACCCGCACAACGGGTCGACATGGAAGAAGACCACCGCGGACCG (see SEQ ID NO.21 for details);

under PC: GGGGTACCTTACCACACATCACGCAGGTAGC (see SEQ ID NO.22 for details).

Amplification system:

Max DNA polymerase：25μL；

primer (10 μ M): 2 μ L each;

p gene (template): 2 mu L of the solution;

distilled water was added to 50. mu.L.

Amplification conditions:

1) pre-denaturation at 98 ℃ for 10 s; 2) denaturation at 98 ℃ for 10 s; 3) annealing at 62 ℃ for 10 s; 4) extension at 72 ℃ for 20 s; 2) -4)35 cycles; 5) extension at 72 ℃ for 10 min.

The target gene fragment was recovered using a thin agarose gel DNA recovery kit gel, as shown in FIG. 11.

C. The P72 gene and the C46 gene are used as templates to carry out overlapping PCR amplification to obtain the P72C46 fusion gene, and the nucleotide sequence of the fusion gene is shown as SEQ ID NO. 7.

Amplification primer sequences:

p, on: GGAATTCCATATGATGAAACGTATCCCGCAGAAGG, respectively;

under PC: GGGGTACCTTACCACACATCACGCAGGTAGC are provided.

Amplification system:

Max DNA polymerase：25μL；

primer (10 μ M): 2 μ L each;

p72 gene, C46 gene (template): 2 μ L each;

distilled water was added to 50. mu.L.

Amplification conditions:

1) pre-denaturation at 98 ℃ for 10 s; 2) denaturation at 98 ℃ for 10 s; 3) annealing at 62 ℃ for 10 s; 4) extension at 72 ℃ for 40 s; 2) -4)35 cycles; 5) extension at 72 ℃ for 10 min.

The thin agarose gel DNA recovery kit gel was used to recover the target gene fragment as shown in FIG. 11.

(3) pACYCDuet-1D612C46P72C46 vector construction

A. The recovered D612C46 gene and the pACYCDuet-1 vector (Novagen) were subjected to double digestion with BamHI and Hind III, respectively, as shown in FIG. 13. The vector pACYCDuet-1 and the exogenous fragment are connected by T4 ligase at 16 ℃ overnight according to the molar ratio of 1:5, the connection product is used for transforming Escherichia coli DH5 alpha, then LB (peptone 10%, yeast extract 5%, NaCl 10%, agarose 12%) solid plates containing 30 mu g/mL chloramphenicol are coated, transformants are picked up and cultured overnight, the bacterial liquid is used for screening positive clones by 2 xTaq Master Mix (Dye Plus) PCR, and the electrophoresis chart 14 is used for carrying out sequencing verification, and the sequencing result is completely matched with the expected base sequence.

B. The recovered P72C46 gene and the vector pACYDuet-1D612C46 were subjected to double digestion with Nde I and Kpn I, respectively, as shown in FIG. 15, the vector pACYDuet-1D612C46 and the exogenous fragment P72C46 were ligated with T4 ligase at 16 ℃ overnight in a molar ratio of 1:5, the ligation product was transformed into E.coli DH 5. alpha. which was then spread on LB (peptone 10%, yeast extract 5%, NaCl 10%, agarose 12%) solid plate containing 30. mu.g/mL chloramphenicol), transformants were picked and cultured overnight, and the bacterial solution was subjected to 2 XTAQQ Master Mix (Dye Plus) PCR to select positive clones, as shown in FIG. 16, and subjected to sequencing verification, with the sequencing result completely matching the expected base sequence. The map of the resulting plasmid pACYCDuet-1D612C46P72C46 is shown in FIG. 2.

Example 3 construction of recombinant Strain pCDFDuet-1SSSE pACYCDuet-1D612C46P72C46BL21(DE3)

Plasmid pCDFDuet-1SSSE was transformed into E.coli BL21(DE3) competent cells simultaneously with plasmid pACYDuet-1D612C46P72C46, plated on LB (peptone 10%, yeast extract 5%, NaCl 10%, agarose 12%) solid plates containing 100. mu.g/mL streptomycin and 30. mu.g/mL chloramphenicol, and positive clones were selected with 2 XTAQ Master Mix (Dye Plus), thereby obtaining recombinant strain SSSEDSDFDuet-1 SSSEPADYD 612C46P72C46BL21(DE 3).

EXAMPLE 4 fermentation of recombinant strains

The recombinant strain pCDFDuet-1SSSE pACYCDuet-1D612C46P72C46BL21(DE3) was inoculated in LB liquid medium (peptone 10g/L, yeast extract 5g/L, NaCl 10g/L) in an amount of 10. mu.L/2 mL, cultured at 37 ℃ and 220 rpm overnight, respectively. The next day TB liquid medium (1.2% (W/V) peptone, 2.4% (W/V) yeast extract, 17mM KH₂PO₄，72mM K₂HPO₄10g/L glucose), the inoculum size was 2mL/200mL, cultured at 30 ℃ for about 3h at 250 rpm, and when the OD600 became about 0.6 to 0.9, an inducer IPTG was added to the medium to a final concentration of 0.5mmol/L for induction. After 48 hours of incubation, the fermentation product was centrifuged at 8000 rpm for 5 minutes, the supernatant was removed,the precipitate was extracted with 10mL of acetone by sonication for 30min for 2 times, the acetone extracts were mixed and dried to obtain a crude fermented extract, which was dissolved in 200. mu.L of methanol, and then sampled for UPLC-MS/MS measurement (chemical reagents used were from national institute of medicine chemical Co.) (peptone, yeast extract and agarose were purchased from OXOID, UK).

Example 5UPLC-MS/MS assay

(1) Protopanaxadiol standard preparation

Accurately weighing 2.5mg of protopanaxadiol reference substance, placing in a 25mL volumetric flask, adding methanol to dissolve, fixing the volume to scale, and refrigerating for later use.

(2) Chromatographic conditions

Analyzing a chromatographic column: CORTECS^TM

Column (column) C18 (2.1X 100mm,1.6 μm), guard column: CORTECS^TMUPLC C18VanGuard Pre-column (column) (2.1X 5mm,1.6 μm); mobile phase: acetonitrile (a) with 0.1% formic acid (B), gradient elution: 0-3 min, 30-90% of A; 3-6 min, 90% A-90% A; 6-6.1 min, 90-30% A; 6.1-8 min, 30-30% A. Sample introduction amount: 2 mu L of the solution; flow rate: 0.

25 mL/min; column temperature: at 45 ℃.

(3) Conditions of Mass Spectrometry

ESI ionization source, using positive ion detection mode, mass spectrum parameters as follows: residence time(s): 0.003 s; capillary voltage: 3.5 kv; drying gas: n is a radical of₂(ii) a Collision gas: ar; source temperature: 150 ℃; extracting the voltage of the taper hole: 3.00V; desolventizing gas flow: 900 L.h^-1(ii) a Taper hole airflow: 50 L.h^-1(ii) a Desolventizing temperature: at 500 ℃.

As shown in FIG. 19, the retention times of the peaks of the liquid chromatogram target of the protopanaxadiol standard (FIG. 19A) and the sample (crude extract of example 4) (FIG. 19B) are consistent and both are 4.97 min; meanwhile, the fragment-ion graphs (m/z 407.69/425.09/443.43) of the products of the protopanaxadiol standard (FIG. 19D) and the sample (FIG. 19E) (the crude extract of example 4) are completely consistent, and the fact that the fermentation product of the sample contains the protopanaxadiol is proved, which indicates that the recombinant strain pCDFDuet-1 SSSEPCYDuet-1D 612C46P72C46(DE3) can produce the protopanaxadiol with the yield of 25 ng/L.

And (3) configuring a standard product: 1.26mg of protopanaxadiol standard (purchased from Shanghai Aladdin Biotechnology Co., Ltd.) was weighed into a 5mL volumetric flask, and methanol was added to the volume to a predetermined scale.

Construction of recombinant Strain pCDFDuet-1 SSSEPOCCUet-1D 612C46P1C46(DE3)

(1) Cloning of the D612C46 Gene

The same as in example 2.

(2) Cloning of the P1C46 Gene

A. The P1 gene was amplified using primers "above P1" and "below P" as templates from the codon-optimized and chemically synthesized P gene of example 2.

Amplification primer sequences:

on P1: GGAATTCCATATG ATGGTTCTGTTTTTCTCTCTG (SEQ ID NO. 23);

p is as follows: GGTCTTCTTCCATGTCGACCCGTTGTGCGGGTGCAGGTGAATC are provided.

Amplification system:

Max DNA polymerase：25μL；

primer (10 μ M): 2 μ L each;

p gene (template): 2 μ L each;

distilled water was added to 50. mu.L.

Amplification conditions:

1) pre-denaturation at 98 ℃ for 10 s; 2) denaturation at 98 ℃ for 10 s; 3) annealing at 62 ℃ for 10 s; 4) extension at 72 ℃ for 40 s; 2) -4)35 cycles; 5) extension at 72 ℃ for 10 min.

The target gene fragment was recovered using a thin agarose gel DNA recovery kit gel, as shown in FIG. 12.

B. The C gene (AtCPR1, accession number: X66016) is used as a template, the C gene is chemically synthesized through codon optimization of escherichia coli, the C gene is used as a template, the front 46 amino acid sequence is removed through hydrophobicity analysis, and the C46 gene is amplified through primers on and under PC.

Amplification primer sequences:

on PC: GCACCCGCACAACGGGTCGACATGGAAGAAGACCACCGCGGACCG, respectively;

under PC: GGGGTACCTTACCACACATCACGCAGGTAGC are provided.

Amplification system:

Max DNA polymerase：25μL；

primer (10 μ M): 2 μ L each;

c46 gene (template): 2 μ L each;

distilled water was added to 50. mu.L.

Amplification conditions:

1) pre-denaturation at 98 ℃ for 10 s; 2) denaturation at 98 ℃ for 10 s; 3) annealing at 62 ℃ for 10 s; 4) extension at 72 ℃ for 40 s; 2) -4)35 cycles; 5) extension at 72 ℃ for 10 min.

The target gene fragment was recovered using a thin agarose gel DNA recovery kit gel, as shown in FIG. 12.

C. The P1C46 fusion gene is amplified by primers on P1 and under PC, and the nucleotide sequence of the fusion gene is shown as SEQ ID NO.24 in the sequence table.

Amplification primer sequences:

on P1: GGAATTCCATATG ATGGTTCTGTTTTTCTCTCTG, respectively;

under PC: GGGGTACCTTACCACACATCACGCAGGTAGC are provided.

Amplification system:

Max DNA polymerase：25μL；

primer (10 μ M): 2 μ L each;

p1 gene and C46 gene (template): 2 μ L each;

distilled water was added to 50. mu.L.

Amplification conditions:

1) pre-denaturation at 98 ℃ for 10s 2; 2) denaturation at 98 ℃ for 10 s; 3) annealing at 62 ℃ for 10 s; 4) extension at 72 ℃ for 40 s; 2) -4)35 cycles; 5) extension at 72 ℃ for 10 min.

The target gene fragment was recovered using a thin agarose gel DNA recovery kit gel, as shown in FIG. 12.

(3) pACYDuet-1D612C46P1C46 vector construction

The recovered P1C46 gene and the vector pACYCDuet-1D612C46 were subjected to double digestion with Nde I and Kpn I, respectively, as shown in FIG. 17, the vector pACYCDuet-1D612C46 and the exogenous fragment P1C46 were ligated with T4 ligase at a molar ratio of 1:5 overnight at 16 ℃, the ligation product was transformed into E.coli DH 5. alpha. and then spread on LB (peptone 10%, yeast extract 5%, NaCl 10%, agarose 12%) solid plate containing 30. mu.g/mL chloramphenicol), transformants were picked up and cultured overnight, and the bacterial solution was subjected to 2 XTAQQ Master Mix (Dye Plus) PCR to select positive clones, FIG. 18, and sequencing was verified to obtain a complete match with the expected base sequence. A map of the resulting plasmid pACYCDuet-1D612C46P1C46 is shown in FIG. 3.

(4) Construction of recombinant Strain pCDFDuet-1 SSSEPOCCUet-1D 612C46P1C46(DE3)

Plasmid pCDFDuet-1SSSE was transformed into E.coli BL21(DE3) competent cells simultaneously with plasmid pACYDuet-1D612C46P1C46, plated on LB (peptone 10%, yeast extract 5%, NaCl 10%, agarose 12%) solid plates containing 100. mu.g/mL streptomycin and 30. mu.g/mL chloramphenicol, and positive clones were selected with 2 XTAQ Master Mix (Dye Plus), thereby obtaining recombinant strain SSSEDFDuet-1 SSSEPAGACYD-1D 612C46P1C46BL21(DE 3).

(5) Recombinant strain fermentation and UPLC-MS/MS assay

The same as in examples 4 and 5.

As shown in FIG. 19, no target peak consistent with the retention time of the liquid chromatogram of the protopanaxadiol standard (FIG. 19A) and the sample (FIG. 19C) was found by UPLC-MS/MS detection, which proves that the fermentation product of the sample does not contain protopanaxadiol, indicating that the recombinant strain pCDFDuet-1 SSSEPCYDuet-1D 612C46P1C46(DE3) can not produce protopanaxadiol.

<110> Shanghai institute for pharmaceutical industry, and institute for pharmaceutical industry of China

<120> a genetically engineered bacterium for producing protopanoxadiol and method thereof

<130> P1710076C

<160> 24

<170> PatentIn version 3.5

<210> 1

<211> 1335

<212> DNA

<213> Saccharomyces cerevisiae

<400> 1

atgggaaagc tattacaatt ggcattgcat ccggtcgaga tgaaggcagc tttgaagctg 60

aagttttgca gaacaccgct attctccatc tatgatcagt ccacgtctcc atatctcttg 120

cactgtttcg aactgttgaa cttgacctcc agatcgtttg ctgctgtgat cagagagctg 180

catccagaat tgagaaactg tgttactctc ttttatttga ttttaagggc tttggatacc 240

atcgaagacg atatgtccat cgaacacgat ttgaaaattg acttgttgcg tcacttccac 300

gagaaattgt tgttaactaa atggagtttc gacggaaatg cccccgatgt gaaggacaga 360

gccgttttga cagatttcga atcgattctt attgaattcc acaaattgaa accagaatat 420

caagaagtca tcaaggagat caccgagaaa atgggtaatg gtatggccga ctacatctta 480

gatgaaaatt acaacttgaa tgggttgcaa accgtccacg actacgacgt gtactgtcac 540

tacgtagctg gtttggtcgg tgatggtttg acccgtttga ttgtcattgc caagtttgcc 600

aacgaatctt tgtattctaa tgagcaattg tatgaaagca tgggtctttt cctacaaaaa 660

accaacatca tcagagatta caatgaagat ttggtcgatg gtagatcctt ctggcccaag 720

gaaatctggt cacaatacgc tcctcagttg aaggacttca tgaaacctga aaacgaacaa 780

ctggggttgg actgtataaa ccacctcgtc ttaaacgcat tgagtcatgt tatcgatgtg 840

ttgacttatt tggccggtat ccacgagcaa tccactttcc aattttgtgc cattccccaa 900

gttatggcca ttgcaacctt ggttttggta ttcaacaacc gtgaagtgct acatggcaat 960

gtaaagattc gtaagggtac tacctgctat ttaattttga aatcaaggac tttgcgtggc 1020

tgtgtcgaga tttttgacta ttacttacgt gatatcaaat ctaaattggc tgtgcaagat 1080

ccaaatttct taaaattgaa cattcaaatc tccaagatcg aacagtttat ggaagaaatg 1140

taccaggata aattacctcc taacgtgaag ccaaatgaaa ctccaatttt cttgaaagtt 1200

aaagaaagat ccagatacga tgatgaattg gttccaaccc aacaagaaga agagtacaag 1260

ttcaatatgg ttttatctat catcttgtcc gttcttcttg ggttttatta tatatacact 1320

ttacacagag cgtga 1335

<210> 2

<211> 1491

<212> DNA

<213> Saccharomyces cerevisiae

<400> 2

atgtctgctg ttaacgttgc acctgaattg attaatgccg acaacacaat tacctacgat 60

gcgattgtca tcggtgctgg tgttatcggt ccatgtgttg ctactggtct agcaagaaag 120

ggtaagaaag ttcttatcgt agaacgtgac tgggctatgc ctgatagaat tgttggtgaa 180

ttgatgcaac caggtggtgt tagagcattg agaagtctgg gtatgattca atctatcaac 240

aacatcgaag catatcctgt taccggttat accgtctttt tcaacggcga acaagttgat 300

attccatacc cttacaaggc cgatatccct aaagttgaaa aattgaagga cttggtcaaa 360

gatggtaatg acaaggtctt ggaagacagc actattcaca tcaaggatta cgaagatgat 420

gaaagagaaa ggggtgttgc ttttgttcat ggtagattct tgaacaactt gagaaacatt 480

actgctcaag agccaaatgt tactagagtg caaggtaact gtattgagat attgaaggat 540

gaaaagaatg aggttgttgg tgccaaggtt gacattgatg gccgtggcaa ggtggaattc 600

aaagcccact tgacatttat ctgtgacggt atcttttcac gtttcagaaa ggaattgcac 660

ccagaccatg ttccaactgt cggttcttcg tttgtcggta tgtctttgtt caatgctaag 720

aatcctgctc ctatgcacgg tcacgttatt cttggtagtg atcatatgcc aatcttggtt 780

taccaaatca gtccagaaga aacaagaatc ctttgtgctt acaactctcc aaaggtccca 840

gctgatatca agagttggat gattaaggat gtccaacctt tcattccaaa gagtctacgt 900

ccttcatttg atgaagccgt cagccaaggt aaatttagag ctatgccaaa ctcctacttg 960

ccagctagac aaaacgacgt cactggtatg tgtgttatcg gtgacgctct aaatatgaga 1020

catccattga ctggtggtgg tatgactgtc ggtttgcatg atgttgtctt gttgattaag 1080

aaaataggtg acctagactt cagcgaccgt gaaaaggttt tggatgaatt actagactac 1140

catttcgaaa gaaagagtta cgattccgtt attaacgttt tgtcagtggc tttgtattct 1200

ttgttcgctg ctgacagcga taacttgaag gcattacaaa aaggttgttt caaatatttc 1260

caaagaggtg gcgattgtgt caacaaaccc gttgaatttc tgtctggtgt cttgccaaag 1320

cctttgcaat tgaccagggt tttcttcgct gtcgcttttt acaccattta cttgaacatg 1380

gaagaacgtg gtttcttggg attaccaatg gctttattgg aaggtattat gattttgatc 1440

acagctatta gagtattcac cccatttttg tttggtgagt tgattggtta a 1491

<210> 3

<211> 1833

<212> DNA

<213> Artificial Sequence

<220>

<223> truncated E.coli codon-optimized dammarenediol synthase gene (D612)

<400> 3

atgtggaagc agaagggcgc acagggtaac gacccgtacc tgtactccac taacaacttc 60

gtgggtcgcc agtattggga gtttcagccg gacgctggca ccccggaaga gcgtgaagag 120

gttgaaaaag cgcgtaaaga ttatgtgaac aacaagaagc tgcatggtat tcatccgtgc 180

tctgacatgc tgatgcgccg tcagctgatt aaggagagcg gtattgacct gctgagcatt 240

ccgccgctgc gtctggatga aaacgagcag gttaactacg atgctgttac cactgctgtg 300

aaaaaagctc tgcgtctgaa ccgtgcgatt caggctcacg acggccactg gccggcagaa 360

aacgctggct ccctgctgta cactccgccg ctgatcatcg ctctgtatat ctccggcacc 420

attgacacca tcctgactaa gcagcacaaa aaggaactga tccgttttgt gtacaaccac 480

cagaacgaag atggcggttg gggttcttac attgaaggtc actctaccat gatcggttct 540

gttctgtctt acgtgatgct gcgcctgctg ggtgagggtc tggctgaatc tgatgatggt 600

aacggtgcgg tggagcgtgg ccgcaagtgg attctggacc acggtggtgc ggcaggtatt 660

ccgagctggg gtaagactta cctggcagtt ctgggtgttt atgaatggga gggctgtaac 720

ccgctgccgc cggagttttg gctgttcccg tctagctttc cgtttcaccc ggctaagatg 780

tggatctact gccgctgtac ttatatgccg atgtcttatc tgtatggtaa gcgctatcac 840

ggtccgatca ccgatctggt gctgtccctg cgtcaggaga tctataacat cccgtacgaa 900

cagattaaat ggaaccagca gcgtcacaac tgttgtaagg aagacctgta ttacccgcac 960

accctggttc aggacctggt ttgggatggc ctgcactatt ttagcgaacc gtttctgaag 1020

cgttggccgt tcaacaaact gcgtaaacgc ggcctgaaac gtgttgttga gctgatgcgt 1080

tatggcgcga ccgagacccg ttttatcact accggcaacg gcgagaaagc gctgcagatc 1140

atgagctggt gggcggagga cccgaacggt gacgagttca agcaccatct ggctcgcatc 1200

ccggattttc tgtggattgc ggaagacggt atgaccgttc agtctttcgg tagccagctg 1260

tgggattgta ttctggcaac tcaggcgatt attgcgacca acatggttga ggaatatggc 1320

gactccctga agaaagctca cttcttcatc aaggagtccc agatcaaaga gaacccgcgt 1380

ggtgacttcc tgaaaatgtg ccgccagttc actaaaggtg cgtggacctt ctctgaccag 1440

gaccacggct gcgttgtgag cgactgcacc gcagaagcac tgaagtgtct gctgctgctg 1500

tctcagatgc cgcaggatat cgttggcgaa aagccggaag ttgagcgcct gtacgaagca 1560

gttaacgttc tgctgtacct gcagtctcgt gttagcggtg gctttgcggt gtgggaaccg 1620

ccggttccga agccgtatct ggagatgctg aacccgtctg agattttcgc ggatattgtg 1680

gtggaacgtg aacacatcga atgtaccgcg tctgttatca aaggtctgat ggcgttcaaa 1740

tgtctgcatc cgggtcatcg tcagaaagaa atcgaagact ctgttgcgaa agcgatccgc 1800

tacctggaac gcaaccagat gccggatggc tct 1833

<210> 4

<211> 1380

<212> DNA

<213> Artificial Sequence

<220>

<223> truncated, E.coli codon-optimized protopanaxadiol synthase gene (P72)

<400> 4

atgaaacgta tcccgcagaa ggagaacgac tctaaagctc cgctgccgcc gggtcagacc 60

ggctggccgc tgatcggtga aaccctgaac tatctgtctt gcgttaaatc tggtgtttct 120

gagaacttcg ttaagtaccg taaagagaag tatagcccga aggtttttcg taccagcctg 180

ctgggcgaac cgatggcgat cctgtgtggc ccggaaggta acaaatttct gtactctacc 240

gaaaagaagc tggttcaggt ttggttcccg tcctctgtgg aaaaaatgtt cccgcgctct 300

cacggcgaat ctaacgctga taacttttct aaagttcgtg gtaagatgat gttcctgctg 360

aaagttgatg gtatgaaaaa gtatgttggc ctgatggacc gtgtgatgaa gcagtttctg 420

gagactgact ggaaccgcca gcagcagatt aacgtgcaca acactgttaa gaaatatact 480

gttaccatgt cttgtcgtgt tttcatgtct attgacgacg aggaacaggt tactcgtctg 540

ggtagctcta tccagaacat cgaagcgggt ctgctggcag ttccgatcaa cattccgggc 600

accgctatga accgtgctat caaaaccgtt aagctgctga ctcgcgaagt tgaagcggtt 660

atcaagcagc gtaaggttga cctgctggag aacaagcagg cgtctcagcc gcaggacctg 720

ctgtcccatc tgctgctgac cgcgaaccag gacggtcagt tcctgtctga atctgacatc 780

gcgagccacc tgattggtct gatgcagggc ggctacacta ctctgaacgg caccattact 840

tttgttctga actacctggc ggagttcccg gatgtttaca accaggtgct gaaggagcag 900

gttgaaatcg cgaactctaa gcatccgaaa gaactgctga actgggaaga tctgcgcaaa 960

atgaaatact cttggaacgt tgctcaggaa gtgctgcgca tcattccgcc gggtgttggt 1020

actttccgtg aggcgatcac cgacttcacc tacgctggct acctgatccc gaaaggttgg 1080

aaaatgcatc tgattccgca tgacacccac aaaaacccga cttacttccc gagcccggag 1140

aaattcgacc cgacccgttt cgaaggcaac ggtccggctc cgtatacctt tactccgttc 1200

ggcggtggtc cgcgtatgtg cccgggtatc gaatatgcgc gtctggttat tctgatcttc 1260

atgcataacg tggttactaa ctttcgttgg gaaaaactga ttccgaacga gaaaatcctg 1320

accgatccga tcccgcgttt cgcgcacggt ctgccgattc acctgcaccc gcacaactaa 1380

<210> 5

<211> 1941

<212> DNA

<213> Artificial Sequence

<220>

<223> truncated, E.coli codon-optimized nicotinamide adenine dinucleotide phosphate-cytochrome P450 reductase gene (C46)

<400> 5

tggaagaaga ccaccgcgga ccgctccggc gaactgaagc cgctgatgat tccgaagtct 60

ctgatggcta aagacgaaga tgatgatctg gacctgggca gcggcaaaac tcgtgtgtct 120

attttctttg gtactcagac tggtactgcg gagggttttg ctaaggcgct gtccgaggaa 180

atcaaagcgc gttatgaaaa ggcagctgtg aaagtgattg acctggatga ctatgcggca 240

gacgacgacc agtacgaaga aaaactgaaa aaagagaccc tggcgttctt ttgtgttgcg 300

acctacggcg atggcgagcc gaccgacaac gctgcacgct tttccaaatg gttcactgag 360

gagaacgaac gcgacattaa actgcagcag ctggcatacg gcgtgttcgc actgggcaac 420

cgtcagtatg aacactttaa caaaattggt atcgtgctgg acgaggaact gtgtaaaaaa 480

ggcgcaaaac gtctgattga agtgggtctg ggcgatgacg atcagtctat tgaggacgat 540

ttcaacgcgt ggaaggaatc cctgtggtcc gaactggata agctgctgaa ggatgaagac 600

gataagtctg tggctacccc gtataccgca gttatcccgg aataccgtgt tgtgactcat 660

gacccgcgct tcaccaccca gaagtctatg gagtctaacg ttgctaacgg taacaccacc 720

attgacatcc atcacccgtg ccgtgtggac gtggctgttc agaaggagct gcatacccac 780

gagagcgacc gttcttgcat ccacctggag ttcgacatct ctcgcaccgg catcacctat 840

gaaaccggtg accatgttgg cgtttatgct gagaaccacg ttgagatcgt tgaggaggca 900

ggcaaactgc tgggccactc cctggatctg gtgtttagca ttcacgcgga caaggaagat 960

ggcagcccgc tggaaagcgc agttccgccg ccgtttccgg gtccgtgtac cctgggcacc 1020

ggcctggctc gttatgcgga tctgctgaac ccgccgcgta aatctgcgct ggttgcactg 1080

gcggcgtatg cgactgaacc gagcgaggca gagaagctga aacatctgac ttctccggac 1140

ggtaaggacg aatactctca gtggatcgtg gcatcccagc gctccctgct ggaagttatg 1200

gctgcgttcc cgagcgctaa accgccgctg ggtgtgtttt ttgcagcgat tgctccgcgc 1260

ctgcagccgc gttactattc tatttcttct tgccaggact gggctccgtc ccgtgttcac 1320

gttacctctg ctctggttta cggtccgacc ccgaccggcc gtatccacaa gggcgtttgt 1380

tctacttgga tgaaaaacgc ggttccggcg gagaaatctc atgaatgcag cggtgcgccg 1440

atctttatcc gtgcgtccaa cttcaagctg ccgtctaacc cgtctactcc gattgttatg 1500

gttggtccgg gcaccggtct ggcaccgttc cgtggttttc tgcaggagcg tatggctctg 1560

aaagaggacg gtgaagaact gggttctagc ctgctgtttt tcggttgtcg taaccgccag 1620

atggatttta tctacgagga tgagctgaac aacttcgtgg accagggtgt tatcagcgag 1680

ctgattatgg cattttctcg cgaaggtgcg cagaaagagt atgtgcagca caaaatgatg 1740

gagaaagcgg cgcaggtgtg ggacctgatt aaagaagagg gttatctgta tgtttgcggc 1800

gacgcaaaag gtatggcacg tgacgtgcat cgcactctgc acaccatcgt tcaggaacag 1860

gaaggcgttt cttcctctga agcagaagcg attgttaaaa agctgcagac tgaaggtcgc 1920

tacctgcgtg atgtgtggta a 1941

<210> 6

<211> 3783

<212> DNA

<213> Artificial Sequence

<220>

<223> fusion gene D612C46

<400> 6

atgtggaagc agaagggcgc acagggtaac gacccgtacc tgtactccac taacaacttc 60

gtgggtcgcc agtattggga gtttcagccg gacgctggca ccccggaaga gcgtgaagag 120

gttgaaaaag cgcgtaaaga ttatgtgaac aacaagaagc tgcatggtat tcatccgtgc 180

tctgacatgc tgatgcgccg tcagctgatt aaggagagcg gtattgacct gctgagcatt 240

ccgccgctgc gtctggatga aaacgagcag gttaactacg atgctgttac cactgctgtg 300

aaaaaagctc tgcgtctgaa ccgtgcgatt caggctcacg acggccactg gccggcagaa 360

aacgctggct ccctgctgta cactccgccg ctgatcatcg ctctgtatat ctccggcacc 420

attgacacca tcctgactaa gcagcacaaa aaggaactga tccgttttgt gtacaaccac 480

cagaacgaag atggcggttg gggttcttac attgaaggtc actctaccat gatcggttct 540

gttctgtctt acgtgatgct gcgcctgctg ggtgagggtc tggctgaatc tgatgatggt 600

aacggtgcgg tggagcgtgg ccgcaagtgg attctggacc acggtggtgc ggcaggtatt 660

ccgagctggg gtaagactta cctggcagtt ctgggtgttt atgaatggga gggctgtaac 720

ccgctgccgc cggagttttg gctgttcccg tctagctttc cgtttcaccc ggctaagatg 780

tggatctact gccgctgtac ttatatgccg atgtcttatc tgtatggtaa gcgctatcac 840

ggtccgatca ccgatctggt gctgtccctg cgtcaggaga tctataacat cccgtacgaa 900

cagattaaat ggaaccagca gcgtcacaac tgttgtaagg aagacctgta ttacccgcac 960

accctggttc aggacctggt ttgggatggc ctgcactatt ttagcgaacc gtttctgaag 1020

cgttggccgt tcaacaaact gcgtaaacgc ggcctgaaac gtgttgttga gctgatgcgt 1080

tatggcgcga ccgagacccg ttttatcact accggcaacg gcgagaaagc gctgcagatc 1140

atgagctggt gggcggagga cccgaacggt gacgagttca agcaccatct ggctcgcatc 1200

ccggattttc tgtggattgc ggaagacggt atgaccgttc agtctttcgg tagccagctg 1260

tgggattgta ttctggcaac tcaggcgatt attgcgacca acatggttga ggaatatggc 1320

gactccctga agaaagctca cttcttcatc aaggagtccc agatcaaaga gaacccgcgt 1380

ggtgacttcc tgaaaatgtg ccgccagttc actaaaggtg cgtggacctt ctctgaccag 1440

gaccacggct gcgttgtgag cgactgcacc gcagaagcac tgaagtgtct gctgctgctg 1500

tctcagatgc cgcaggatat cgttggcgaa aagccggaag ttgagcgcct gtacgaagca 1560

gttaacgttc tgctgtacct gcagtctcgt gttagcggtg gctttgcggt gtgggaaccg 1620

ccggttccga agccgtatct ggagatgctg aacccgtctg agattttcgc ggatattgtg 1680

gtggaacgtg aacacatcga atgtaccgcg tctgttatca aaggtctgat ggcgttcaaa 1740

tgtctgcatc cgggtcatcg tcagaaagaa atcgaagact ctgttgcgaa agcgatccgc 1800

tacctggaac gcaaccagat gccggatggc tctgggtcga catggaagaa gaccaccgcg 1860

gaccgctccg gcgaactgaa gccgctgatg attccgaagt ctctgatggc taaagacgaa 1920

gatgatgatc tggacctggg cagcggcaaa actcgtgtgt ctattttctt tggtactcag 1980

actggtactg cggagggttt tgctaaggcg ctgtccgagg aaatcaaagc gcgttatgaa 2040

aaggcagctg tgaaagtgat tgacctggat gactatgcgg cagacgacga ccagtacgaa 2100

gaaaaactga aaaaagagac cctggcgttc ttttgtgttg cgacctacgg cgatggcgag 2160

ccgaccgaca acgctgcacg cttttccaaa tggttcactg aggagaacga acgcgacatt 2220

aaactgcagc agctggcata cggcgtgttc gcactgggca accgtcagta tgaacacttt 2280

aacaaaattg gtatcgtgct ggacgaggaa ctgtgtaaaa aaggcgcaaa acgtctgatt 2340

gaagtgggtc tgggcgatga cgatcagtct attgaggacg atttcaacgc gtggaaggaa 2400

tccctgtggt ccgaactgga taagctgctg aaggatgaag acgataagtc tgtggctacc 2460

ccgtataccg cagttatccc ggaataccgt gttgtgactc atgacccgcg cttcaccacc 2520

cagaagtcta tggagtctaa cgttgctaac ggtaacacca ccattgacat ccatcacccg 2580

tgccgtgtgg acgtggctgt tcagaaggag ctgcataccc acgagagcga ccgttcttgc 2640

atccacctgg agttcgacat ctctcgcacc ggcatcacct atgaaaccgg tgaccatgtt 2700

ggcgtttatg ctgagaacca cgttgagatc gttgaggagg caggcaaact gctgggccac 2760

tccctggatc tggtgtttag cattcacgcg gacaaggaag atggcagccc gctggaaagc 2820

gcagttccgc cgccgtttcc gggtccgtgt accctgggca ccggcctggc tcgttatgcg 2880

gatctgctga acccgccgcg taaatctgcg ctggttgcac tggcggcgta tgcgactgaa 2940

ccgagcgagg cagagaagct gaaacatctg acttctccgg acggtaagga cgaatactct 3000

cagtggatcg tggcatccca gcgctccctg ctggaagtta tggctgcgtt cccgagcgct 3060

aaaccgccgc tgggtgtgtt ttttgcagcg attgctccgc gcctgcagcc gcgttactat 3120

tctatttctt cttgccagga ctgggctccg tcccgtgttc acgttacctc tgctctggtt 3180

tacggtccga ccccgaccgg ccgtatccac aagggcgttt gttctacttg gatgaaaaac 3240

gcggttccgg cggagaaatc tcatgaatgc agcggtgcgc cgatctttat ccgtgcgtcc 3300

aacttcaagc tgccgtctaa cccgtctact ccgattgtta tggttggtcc gggcaccggt 3360

ctggcaccgt tccgtggttt tctgcaggag cgtatggctc tgaaagagga cggtgaagaa 3420

ctgggttcta gcctgctgtt tttcggttgt cgtaaccgcc agatggattt tatctacgag 3480

gatgagctga acaacttcgt ggaccagggt gttatcagcg agctgattat ggcattttct 3540

cgcgaaggtg cgcagaaaga gtatgtgcag cacaaaatga tggagaaagc ggcgcaggtg 3600

tgggacctga ttaaagaaga gggttatctg tatgtttgcg gcgacgcaaa aggtatggca 3660

cgtgacgtgc atcgcactct gcacaccatc gttcaggaac aggaaggcgt ttcttcctct 3720

gaagcagaag cgattgttaa aaagctgcag actgaaggtc gctacctgcg tgatgtgtgg 3780

taa 3783

<210> 7

<211> 3327

<212> DNA

<213> Artificial Sequence

<220>

<223> fusion gene P72C46

<400> 7

atgaaacgta tcccgcagaa ggagaacgac tctaaagctc cgctgccgcc gggtcagacc 60

ggctggccgc tgatcggtga aaccctgaac tatctgtctt gcgttaaatc tggtgtttct 120

gagaacttcg ttaagtaccg taaagagaag tatagcccga aggtttttcg taccagcctg 180

ctgggcgaac cgatggcgat cctgtgtggc ccggaaggta acaaatttct gtactctacc 240

gaaaagaagc tggttcaggt ttggttcccg tcctctgtgg aaaaaatgtt cccgcgctct 300

cacggcgaat ctaacgctga taacttttct aaagttcgtg gtaagatgat gttcctgctg 360

aaagttgatg gtatgaaaaa gtatgttggc ctgatggacc gtgtgatgaa gcagtttctg 420

gagactgact ggaaccgcca gcagcagatt aacgtgcaca acactgttaa gaaatatact 480

gttaccatgt cttgtcgtgt tttcatgtct attgacgacg aggaacaggt tactcgtctg 540

ggtagctcta tccagaacat cgaagcgggt ctgctggcag ttccgatcaa cattccgggc 600

accgctatga accgtgctat caaaaccgtt aagctgctga ctcgcgaagt tgaagcggtt 660

atcaagcagc gtaaggttga cctgctggag aacaagcagg cgtctcagcc gcaggacctg 720

ctgtcccatc tgctgctgac cgcgaaccag gacggtcagt tcctgtctga atctgacatc 780

gcgagccacc tgattggtct gatgcagggc ggctacacta ctctgaacgg caccattact 840

tttgttctga actacctggc ggagttcccg gatgtttaca accaggtgct gaaggagcag 900

gttgaaatcg cgaactctaa gcatccgaaa gaactgctga actgggaaga tctgcgcaaa 960

atgaaatact cttggaacgt tgctcaggaa gtgctgcgca tcattccgcc gggtgttggt 1020

actttccgtg aggcgatcac cgacttcacc tacgctggct acctgatccc gaaaggttgg 1080

aaaatgcatc tgattccgca tgacacccac aaaaacccga cttacttccc gagcccggag 1140

aaattcgacc cgacccgttt cgaaggcaac ggtccggctc cgtatacctt tactccgttc 1200

ggcggtggtc cgcgtatgtg cccgggtatc gaatatgcgc gtctggttat tctgatcttc 1260

atgcataacg tggttactaa ctttcgttgg gaaaaactga ttccgaacga gaaaatcctg 1320

accgatccga tcccgcgttt cgcgcacggt ctgccgattc acctgcaccc gcacaacggg 1380

tcgacatgga agaagaccac cgcggaccgc tccggcgaac tgaagccgct gatgattccg 1440

aagtctctga tggctaaaga cgaagatgat gatctggacc tgggcagcgg caaaactcgt 1500

gtgtctattt tctttggtac tcagactggt actgcggagg gttttgctaa ggcgctgtcc 1560

gaggaaatca aagcgcgtta tgaaaaggca gctgtgaaag tgattgacct ggatgactat 1620

gcggcagacg acgaccagta cgaagaaaaa ctgaaaaaag agaccctggc gttcttttgt 1680

gttgcgacct acggcgatgg cgagccgacc gacaacgctg cacgcttttc caaatggttc 1740

actgaggaga acgaacgcga cattaaactg cagcagctgg catacggcgt gttcgcactg 1800

ggcaaccgtc agtatgaaca ctttaacaaa attggtatcg tgctggacga ggaactgtgt 1860

aaaaaaggcg caaaacgtct gattgaagtg ggtctgggcg atgacgatca gtctattgag 1920

gacgatttca acgcgtggaa ggaatccctg tggtccgaac tggataagct gctgaaggat 1980

gaagacgata agtctgtggc taccccgtat accgcagtta tcccggaata ccgtgttgtg 2040

actcatgacc cgcgcttcac cacccagaag tctatggagt ctaacgttgc taacggtaac 2100

accaccattg acatccatca cccgtgccgt gtggacgtgg ctgttcagaa ggagctgcat 2160

acccacgaga gcgaccgttc ttgcatccac ctggagttcg acatctctcg caccggcatc 2220

acctatgaaa ccggtgacca tgttggcgtt tatgctgaga accacgttga gatcgttgag 2280

gaggcaggca aactgctggg ccactccctg gatctggtgt ttagcattca cgcggacaag 2340

gaagatggca gcccgctgga aagcgcagtt ccgccgccgt ttccgggtcc gtgtaccctg 2400

ggcaccggcc tggctcgtta tgcggatctg ctgaacccgc cgcgtaaatc tgcgctggtt 2460

gcactggcgg cgtatgcgac tgaaccgagc gaggcagaga agctgaaaca tctgacttct 2520

ccggacggta aggacgaata ctctcagtgg atcgtggcat cccagcgctc cctgctggaa 2580

gttatggctg cgttcccgag cgctaaaccg ccgctgggtg tgttttttgc agcgattgct 2640

ccgcgcctgc agccgcgtta ctattctatt tcttcttgcc aggactgggc tccgtcccgt 2700

gttcacgtta cctctgctct ggtttacggt ccgaccccga ccggccgtat ccacaagggc 2760

gtttgttcta cttggatgaa aaacgcggtt ccggcggaga aatctcatga atgcagcggt 2820

gcgccgatct ttatccgtgc gtccaacttc aagctgccgt ctaacccgtc tactccgatt 2880

gttatggttg gtccgggcac cggtctggca ccgttccgtg gttttctgca ggagcgtatg 2940

gctctgaaag aggacggtga agaactgggt tctagcctgc tgtttttcgg ttgtcgtaac 3000

cgccagatgg attttatcta cgaggatgag ctgaacaact tcgtggacca gggtgttatc 3060

agcgagctga ttatggcatt ttctcgcgaa ggtgcgcaga aagagtatgt gcagcacaaa 3120

atgatggaga aagcggcgca ggtgtgggac ctgattaaag aagagggtta tctgtatgtt 3180

tgcggcgacg caaaaggtat ggcacgtgac gtgcatcgca ctctgcacac catcgttcag 3240

gaacaggaag gcgtttcttc ctctgaagca gaagcgattg ttaaaaagct gcagactgaa 3300

ggtcgctacc tgcgtgatgt gtggtaa 3327

<210> 8

<211> 2310

<212> DNA

<213> Artificial Sequence

<220>

<223> E.coli codon-optimized dammaradiene synthase

<400> 8

atgtggaagc agaagggcgc acagggtaac gacccgtacc tgtactccac taacaacttc 60

gtgggtcgcc agtattggga gtttcagccg gacgctggca ccccggaaga gcgtgaagag 120

gttgaaaaag cgcgtaaaga ttatgtgaac aacaagaagc tgcatggtat tcatccgtgc 180

tctgacatgc tgatgcgccg tcagctgatt aaggagagcg gtattgacct gctgagcatt 240

ccgccgctgc gtctggatga aaacgagcag gttaactacg atgctgttac cactgctgtg 300

aaaaaagctc tgcgtctgaa ccgtgcgatt caggctcacg acggccactg gccggcagaa 360

aacgctggct ccctgctgta cactccgccg ctgatcatcg ctctgtatat ctccggcacc 420

attgacacca tcctgactaa gcagcacaaa aaggaactga tccgttttgt gtacaaccac 480

cagaacgaag atggcggttg gggttcttac attgaaggtc actctaccat gatcggttct 540

gttctgtctt acgtgatgct gcgcctgctg ggtgagggtc tggctgaatc tgatgatggt 600

aacggtgcgg tggagcgtgg ccgcaagtgg attctggacc acggtggtgc ggcaggtatt 660

ccgagctggg gtaagactta cctggcagtt ctgggtgttt atgaatggga gggctgtaac 720

ccgctgccgc cggagttttg gctgttcccg tctagctttc cgtttcaccc ggctaagatg 780

tggatctact gccgctgtac ttatatgccg atgtcttatc tgtatggtaa gcgctatcac 840

ggtccgatca ccgatctggt gctgtccctg cgtcaggaga tctataacat cccgtacgaa 900

cagattaaat ggaaccagca gcgtcacaac tgttgtaagg aagacctgta ttacccgcac 960

accctggttc aggacctggt ttgggatggc ctgcactatt ttagcgaacc gtttctgaag 1020

cgttggccgt tcaacaaact gcgtaaacgc ggcctgaaac gtgttgttga gctgatgcgt 1080

tatggcgcga ccgagacccg ttttatcact accggcaacg gcgagaaagc gctgcagatc 1140

atgagctggt gggcggagga cccgaacggt gacgagttca agcaccatct ggctcgcatc 1200

ccggattttc tgtggattgc ggaagacggt atgaccgttc agtctttcgg tagccagctg 1260

tgggattgta ttctggcaac tcaggcgatt attgcgacca acatggttga ggaatatggc 1320

gactccctga agaaagctca cttcttcatc aaggagtccc agatcaaaga gaacccgcgt 1380

ggtgacttcc tgaaaatgtg ccgccagttc actaaaggtg cgtggacctt ctctgaccag 1440

gaccacggct gcgttgtgag cgactgcacc gcagaagcac tgaagtgtct gctgctgctg 1500

tctcagatgc cgcaggatat cgttggcgaa aagccggaag ttgagcgcct gtacgaagca 1560

gttaacgttc tgctgtacct gcagtctcgt gttagcggtg gctttgcggt gtgggaaccg 1620

ccggttccga agccgtatct ggagatgctg aacccgtctg agattttcgc ggatattgtg 1680

gtggaacgtg aacacatcga atgtaccgcg tctgttatca aaggtctgat ggcgttcaaa 1740

tgtctgcatc cgggtcatcg tcagaaagaa atcgaagact ctgttgcgaa agcgatccgc 1800

tacctggaac gcaaccagat gccggatggc tcttggtacg gtttttgggg tatttgcttt 1860

ctgtacggca ccttctttac tctgagcggt ttcgcgtccg ctggccgtac ttacgacaac 1920

agcgaggcag tgcgcaaagg cgttaaattc ttcctgtcca ctcagaacga agaaggcggc 1980

tggggcgagt ctctggaatc ttgtccgagc gaaaaattca ccccgctgaa aggtaaccgc 2040

actaacctgg tgcagacctc ttgggcaatg ctgggcctga tgttcggtgg ccaggcggaa 2100

cgcgacccga ctccgctgca tcgcgctgcg aaactgctga tcaacgcgca gatggacaac 2160

ggcgactttc cgcagcagga aatcactggt gtgtattgca agaactccat gctgcattac 2220

gctgagtatc gtaacatctt cccgctgtgg gctctgggcg aataccgtaa gcgtgtgtgg 2280

ctgccgaaac accagcagct gaagatctaa 2310

<210> 9

<211> 1449

<212> DNA

<213> Artificial Sequence

<220>

<223> Escherichia coli codon-optimized protopanaxadiol synthase

<400> 9

atggttctgt ttttctctct gtccctgctg ctgctgccgc tgctgctgct gtttgcttat 60

ttctcttaca ccaaacgtat cccgcagaag gagaacgact ctaaagctcc gctgccgccg 120

ggtcagaccg gctggccgct gatcggtgaa accctgaact atctgtcttg cgttaaatct 180

ggtgtttctg agaacttcgt taagtaccgt aaagagaagt atagcccgaa ggtttttcgt 240

accagcctgc tgggcgaacc gatggcgatc ctgtgtggcc cggaaggtaa caaatttctg 300

tactctaccg aaaagaagct ggttcaggtt tggttcccgt cctctgtgga aaaaatgttc 360

ccgcgctctc acggcgaatc taacgctgat aacttttcta aagttcgtgg taagatgatg 420

ttcctgctga aagttgatgg tatgaaaaag tatgttggcc tgatggaccg tgtgatgaag 480

cagtttctgg agactgactg gaaccgccag cagcagatta acgtgcacaa cactgttaag 540

aaatatactg ttaccatgtc ttgtcgtgtt ttcatgtcta ttgacgacga ggaacaggtt 600

actcgtctgg gtagctctat ccagaacatc gaagcgggtc tgctggcagt tccgatcaac 660

attccgggca ccgctatgaa ccgtgctatc aaaaccgtta agctgctgac tcgcgaagtt 720

gaagcggtta tcaagcagcg taaggttgac ctgctggaga acaagcaggc gtctcagccg 780

caggacctgc tgtcccatct gctgctgacc gcgaaccagg acggtcagtt cctgtctgaa 840

tctgacatcg cgagccacct gattggtctg atgcagggcg gctacactac tctgaacggc 900

accattactt ttgttctgaa ctacctggcg gagttcccgg atgtttacaa ccaggtgctg 960

aaggagcagg ttgaaatcgc gaactctaag catccgaaag aactgctgaa ctgggaagat 1020

ctgcgcaaaa tgaaatactc ttggaacgtt gctcaggaag tgctgcgcat cattccgccg 1080

ggtgttggta ctttccgtga ggcgatcacc gacttcacct acgctggcta cctgatcccg 1140

aaaggttgga aaatgcatct gattccgcat gacacccaca aaaacccgac ttacttcccg 1200

agcccggaga aattcgaccc gacccgtttc gaaggcaacg gtccggctcc gtataccttt 1260

actccgttcg gcggtggtcc gcgtatgtgc ccgggtatcg aatatgcgcg tctggttatt 1320

ctgatcttca tgcataacgt ggttactaac tttcgttggg aaaaactgat tccgaacgag 1380

aaaatcctga ccgatccgat cccgcgtttc gcgcacggtc tgccgattca cctgcacccg 1440

cacaactaa 1449

<210> 10

<211> 2079

<212> DNA

<213> Artificial Sequence

<220>

<223> codon-optimized nicotinamide adenine dinucleotide phosphate-cytochrome P450 reductase gene of E.coli

<400> 10

atgactagcg cactgtacgc atccgatctg ttcaaacagc tgaagtccat tatgggtact 60

gattccctgt ctgacgatgt ggtgctggtg atcgcgacca ccagcctggc actggtggcg 120

ggcttcgttg ttctgctgtg gaagaagacc accgcggacc gctccggcga actgaagccg 180

ctgatgattc cgaagtctct gatggctaaa gacgaagatg atgatctgga cctgggcagc 240

ggcaaaactc gtgtgtctat tttctttggt actcagactg gtactgcgga gggttttgct 300

aaggcgctgt ccgaggaaat caaagcgcgt tatgaaaagg cagctgtgaa agtgattgac 360

ctggatgact atgcggcaga cgacgaccag tacgaagaaa aactgaaaaa agagaccctg 420

gcgttctttt gtgttgcgac ctacggcgat ggcgagccga ccgacaacgc tgcacgcttt 480

tccaaatggt tcactgagga gaacgaacgc gacattaaac tgcagcagct ggcatacggc 540

gtgttcgcac tgggcaaccg tcagtatgaa cactttaaca aaattggtat cgtgctggac 600

gaggaactgt gtaaaaaagg cgcaaaacgt ctgattgaag tgggtctggg cgatgacgat 660

cagtctattg aggacgattt caacgcgtgg aaggaatccc tgtggtccga actggataag 720

ctgctgaagg atgaagacga taagtctgtg gctaccccgt ataccgcagt tatcccggaa 780

taccgtgttg tgactcatga cccgcgcttc accacccaga agtctatgga gtctaacgtt 840

gctaacggta acaccaccat tgacatccat cacccgtgcc gtgtggacgt ggctgttcag 900

aaggagctgc atacccacga gagcgaccgt tcttgcatcc acctggagtt cgacatctct 960

cgcaccggca tcacctatga aaccggtgac catgttggcg tttatgctga gaaccacgtt 1020

gagatcgttg aggaggcagg caaactgctg ggccactccc tggatctggt gtttagcatt 1080

cacgcggaca aggaagatgg cagcccgctg gaaagcgcag ttccgccgcc gtttccgggt 1140

ccgtgtaccc tgggcaccgg cctggctcgt tatgcggatc tgctgaaccc gccgcgtaaa 1200

tctgcgctgg ttgcactggc ggcgtatgcg actgaaccga gcgaggcaga gaagctgaaa 1260

catctgactt ctccggacgg taaggacgaa tactctcagt ggatcgtggc atcccagcgc 1320

tccctgctgg aagttatggc tgcgttcccg agcgctaaac cgccgctggg tgtgtttttt 1380

gcagcgattg ctccgcgcct gcagccgcgt tactattcta tttcttcttg ccaggactgg 1440

gctccgtccc gtgttcacgt tacctctgct ctggtttacg gtccgacccc gaccggccgt 1500

atccacaagg gcgtttgttc tacttggatg aaaaacgcgg ttccggcgga gaaatctcat 1560

gaatgcagcg gtgcgccgat ctttatccgt gcgtccaact tcaagctgcc gtctaacccg 1620

tctactccga ttgttatggt tggtccgggc accggtctgg caccgttccg tggttttctg 1680

caggagcgta tggctctgaa agaggacggt gaagaactgg gttctagcct gctgtttttc 1740

ggttgtcgta accgccagat ggattttatc tacgaggatg agctgaacaa cttcgtggac 1800

cagggtgtta tcagcgagct gattatggca ttttctcgcg aaggtgcgca gaaagagtat 1860

gtgcagcaca aaatgatgga gaaagcggcg caggtgtggg acctgattaa agaagagggt 1920

tatctgtatg tttgcggcga cgcaaaaggt atggcacgtg acgtgcatcg cactctgcac 1980

accatcgttc aggaacagga aggcgtttct tcctctgaag cagaagcgat tgttaaaaag 2040

ctgcagactg aaggtcgcta cctgcgtgat gtgtggtaa 2079

<210> 11

<211> 30

<212> DNA

<213> Artificial Sequence

<220>

<223> on primer SS

<400> 11

cgggatccga tgggaaagct attacaattg 30

<210> 12

<211> 42

<212> DNA

<213> Artificial Sequence

<220>

<223> primer SS

<400> 12

ccaagctttc acgctctgtg taaagtgtat atataataaa ac 42

<210> 13

<211> 31

<212> DNA

<213> Artificial Sequence

<220>

<223> on primer SE

<400> 13

gaagatctca tgtctgctgt taacgttgca c 31

<210> 14

<211> 30

<212> DNA

<213> Artificial Sequence

<220>

<223> primer SE

<400> 14

ggggtacctt aaccaatcaa ctcaccaaac 30

<210> 15

<211> 34

<212> DNA

<213> Artificial Sequence

<220>

<223> primer D

<400> 15

cgcggatccg atgtggaagc agaagggcgc acag 34

<210> 16

<211> 46

<212> DNA

<213> Artificial Sequence

<220>

<223> primer D

<400> 16

gtggtcttct tccatgtcga cccagagcca tccggcatct ggttgc 46

<210> 17

<211> 44

<212> DNA

<213> Artificial Sequence

<220>

<223> primer on DC

<400> 17

gccggatggc tctgggtcga catggaagaa gaccaccgcg gacc 44

<210> 18

<211> 32

<212> DNA

<213> Artificial Sequence

<220>

<223> primer DC

<400> 18

cccaagcttt taccacacat cacgcaggta gc 32

<210> 19

<211> 35

<212> DNA

<213> Artificial Sequence

<220>

<223> on primer P

<400> 19

ggaattccat atgatgaaac gtatcccgca gaagg 35

<210> 20

<211> 43

<212> DNA

<213> Artificial Sequence

<220>

<223> primer P

<400> 20

ggtcttcttc catgtcgacc cgttgtgcgg gtgcaggtga atc 43

<210> 21

<211> 45

<212> DNA

<213> Artificial Sequence

<220>

<223> on primer PC

<400> 21

gcacccgcac aacgggtcga catggaagaa gaccaccgcg gaccg 45

<210> 22

<211> 31

<212> DNA

<213> Artificial Sequence

<220>

<223> primer PC

<400> 22

ggggtacctt accacacatc acgcaggtag c 31

<210> 23

<211> 34

<212> DNA

<213> Artificial Sequence

<220>

<223> primer P1

<400> 23

ggaattccat atgatggttc tgtttttctc tctg 34

<210> 24

<211> 3396

<212> DNA

<213> Artificial Sequence

<220>

<223> fusion gene P1C46

<400> 24

atggttctgt ttttctctct gtccctgctg ctgctgccgc tgctgctgct gtttgcttat 60

ttctcttaca ccaaacgtat cccgcagaag gagaacgact ctaaagctcc gctgccgccg 120

ggtcagaccg gctggccgct gatcggtgaa accctgaact atctgtcttg cgttaaatct 180

ggtgtttctg agaacttcgt taagtaccgt aaagagaagt atagcccgaa ggtttttcgt 240

accagcctgc tgggcgaacc gatggcgatc ctgtgtggcc cggaaggtaa caaatttctg 300

tactctaccg aaaagaagct ggttcaggtt tggttcccgt cctctgtgga aaaaatgttc 360

ccgcgctctc acggcgaatc taacgctgat aacttttcta aagttcgtgg taagatgatg 420

ttcctgctga aagttgatgg tatgaaaaag tatgttggcc tgatggaccg tgtgatgaag 480

cagtttctgg agactgactg gaaccgccag cagcagatta acgtgcacaa cactgttaag 540

aaatatactg ttaccatgtc ttgtcgtgtt ttcatgtcta ttgacgacga ggaacaggtt 600

actcgtctgg gtagctctat ccagaacatc gaagcgggtc tgctggcagt tccgatcaac 660

attccgggca ccgctatgaa ccgtgctatc aaaaccgtta agctgctgac tcgcgaagtt 720

gaagcggtta tcaagcagcg taaggttgac ctgctggaga acaagcaggc gtctcagccg 780

caggacctgc tgtcccatct gctgctgacc gcgaaccagg acggtcagtt cctgtctgaa 840

tctgacatcg cgagccacct gattggtctg atgcagggcg gctacactac tctgaacggc 900

accattactt ttgttctgaa ctacctggcg gagttcccgg atgtttacaa ccaggtgctg 960

aaggagcagg ttgaaatcgc gaactctaag catccgaaag aactgctgaa ctgggaagat 1020

ctgcgcaaaa tgaaatactc ttggaacgtt gctcaggaag tgctgcgcat cattccgccg 1080

ggtgttggta ctttccgtga ggcgatcacc gacttcacct acgctggcta cctgatcccg 1140

aaaggttgga aaatgcatct gattccgcat gacacccaca aaaacccgac ttacttcccg 1200

agcccggaga aattcgaccc gacccgtttc gaaggcaacg gtccggctcc gtataccttt 1260

actccgttcg gcggtggtcc gcgtatgtgc ccgggtatcg aatatgcgcg tctggttatt 1320

ctgatcttca tgcataacgt ggttactaac tttcgttggg aaaaactgat tccgaacgag 1380

aaaatcctga ccgatccgat cccgcgtttc gcgcacggtc tgccgattca cctgcacccg 1440

cacaacgggt cgacatggaa gaagaccacc gcggaccgct ccggcgaact gaagccgctg 1500

atgattccga agtctctgat ggctaaagac gaagatgatg atctggacct gggcagcggc 1560

aaaactcgtg tgtctatttt ctttggtact cagactggta ctgcggaggg ttttgctaag 1620

gcgctgtccg aggaaatcaa agcgcgttat gaaaaggcag ctgtgaaagt gattgacctg 1680

gatgactatg cggcagacga cgaccagtac gaagaaaaac tgaaaaaaga gaccctggcg 1740

ttcttttgtg ttgcgaccta cggcgatggc gagccgaccg acaacgctgc acgcttttcc 1800

aaatggttca ctgaggagaa cgaacgcgac attaaactgc agcagctggc atacggcgtg 1860

ttcgcactgg gcaaccgtca gtatgaacac tttaacaaaa ttggtatcgt gctggacgag 1920

gaactgtgta aaaaaggcgc aaaacgtctg attgaagtgg gtctgggcga tgacgatcag 1980

tctattgagg acgatttcaa cgcgtggaag gaatccctgt ggtccgaact ggataagctg 2040

ctgaaggatg aagacgataa gtctgtggct accccgtata ccgcagttat cccggaatac 2100

cgtgttgtga ctcatgaccc gcgcttcacc acccagaagt ctatggagtc taacgttgct 2160

aacggtaaca ccaccattga catccatcac ccgtgccgtg tggacgtggc tgttcagaag 2220

gagctgcata cccacgagag cgaccgttct tgcatccacc tggagttcga catctctcgc 2280

accggcatca cctatgaaac cggtgaccat gttggcgttt atgctgagaa ccacgttgag 2340

atcgttgagg aggcaggcaa actgctgggc cactccctgg atctggtgtt tagcattcac 2400

gcggacaagg aagatggcag cccgctggaa agcgcagttc cgccgccgtt tccgggtccg 2460

tgtaccctgg gcaccggcct ggctcgttat gcggatctgc tgaacccgcc gcgtaaatct 2520

gcgctggttg cactggcggc gtatgcgact gaaccgagcg aggcagagaa gctgaaacat 2580

ctgacttctc cggacggtaa ggacgaatac tctcagtgga tcgtggcatc ccagcgctcc 2640

ctgctggaag ttatggctgc gttcccgagc gctaaaccgc cgctgggtgt gttttttgca 2700

gcgattgctc cgcgcctgca gccgcgttac tattctattt cttcttgcca ggactgggct 2760

ccgtcccgtg ttcacgttac ctctgctctg gtttacggtc cgaccccgac cggccgtatc 2820

cacaagggcg tttgttctac ttggatgaaa aacgcggttc cggcggagaa atctcatgaa 2880

tgcagcggtg cgccgatctt tatccgtgcg tccaacttca agctgccgtc taacccgtct 2940

actccgattg ttatggttgg tccgggcacc ggtctggcac cgttccgtgg ttttctgcag 3000

gagcgtatgg ctctgaaaga ggacggtgaa gaactgggtt ctagcctgct gtttttcggt 3060

tgtcgtaacc gccagatgga ttttatctac gaggatgagc tgaacaactt cgtggaccag 3120

ggtgttatca gcgagctgat tatggcattt tctcgcgaag gtgcgcagaa agagtatgtg 3180

cagcacaaaa tgatggagaa agcggcgcag gtgtgggacc tgattaaaga agagggttat 3240

ctgtatgttt gcggcgacgc aaaaggtatg gcacgtgacg tgcatcgcac tctgcacacc 3300

atcgttcagg aacaggaagg cgtttcttcc tctgaagcag aagcgattgt taaaaagctg 3360

cagactgaag gtcgctacct gcgtgatgtg tggtaa 3396

Claims (14)

1. A genetically engineered bacterium for producing protopanoxadiol is characterized in that the genetically engineered bacterium is escherichia coli (E.coli) ((E.coli))Escherichia coli) Engineering bacteria expressing squalene synthase gene, 2, 3-oxidosqualene synthase gene, dammarendiol synthase gene, protopanoxadiol synthase gene and nicotinamide adenine dinucleotide phosphate-cytochrome P450 reductase gene; the nucleotide sequence of the dammarenediol synthase gene is shown as SEQ ID NO.3, the nucleotide sequence of the protopanaxadiol synthase gene is shown as SEQ ID NO.4, the nucleotide sequence of the nicotinamide adenine dinucleotide phosphate-cytochrome P450 reductase gene is shown as SEQ ID NO.5, the nucleotide sequence of the squalene synthase gene is shown as SEQ ID NO.1, and the nucleotide sequence of the 2, 3-oxidosqualene synthase gene is shown as SEQ ID NO. 2.

2. The genetically engineered bacterium of claim 1, carrying an expression vector 1 comprising said squalene synthase gene and said 2, 3-oxidosqualene synthase gene, and an expression vector 2 comprising said dammarendiol synthase gene, said protopanaxadiol synthase gene, and said nicotinamide adenine dinucleotide phosphate-cytochrome P450 reductase gene.

3. The genetically engineered bacterium of claim 2, wherein said expression vector 2 comprises two of said nicotinamide adenine dinucleotide phosphate-cytochrome P450 reductase genes.

4. The genetically engineered bacterium of claim 2, wherein said dammarenediol synthase gene and protopanaxadiol synthase gene are each adjacent to one of said nicotinamide adenine dinucleotide phosphate-cytochrome P450 reductase genes.

5. The genetically engineered bacterium of claim 4, wherein said nicotinamide adenine dinucleotide phosphate-cytochrome P450 reductase genes are both located downstream of said dammarenediol synthase gene or protopanaxadiol synthase gene.

6. The genetically engineered bacterium of claim 5, wherein the NADP-cytochrome P450 reductase gene and the dammarenediol synthase gene or the protopanaxadiol synthase gene form a fusion gene, respectively.

7. The genetically engineered bacterium of claim 6, wherein the nucleotide sequences of the fusion genes formed by the NADP-cytochrome P450 reductase gene and the dammarendiol synthase gene or the protopanaxadiol synthase gene are shown as SEQ ID NO.6 or SEQ ID NO.7, respectively.

8. The genetically engineered bacterium of claim 2, wherein the backbone of expression vector 1 is plasmid pCDFDuet-1; and/or, the skeleton of the expression vector 2 is plasmid pACYCDuet-1.

9. The genetically engineered bacterium of claim 8, wherein said Escherichia coli is Escherichia coli BL21(DE3) strain.

10. An expression vector 1 and an expression vector 2 are applied to the preparation of genetic engineering bacteria for producing protopanaxadiol, wherein the genetic engineering bacteria are escherichia coli, the expression vector 1 comprises a squalene synthase gene and a2, 3-oxidosqualene synthase gene, and the nucleotide sequences of the squalene synthase gene and the 2, 3-oxidosqualene synthase gene are respectively shown as SEQ ID NO.1 and SEQ ID NO. 2; the expression vector 2 comprises a fusion gene 1 and a fusion gene 2, wherein the nucleotide sequence of the fusion gene 1 is shown as SEQ ID NO.6, and the nucleotide sequence of the fusion gene 2 is shown as SEQ ID NO. 7.

11. Use according to claim 10, characterized in that the E.coli is the strain E.coli BL21(DE 3).

12. The use according to claim 11, wherein the backbone of expression vector 1 is plasmid pCDFDuet-1; the backbone of the expression vector 2 is plasmid pACYCDuet-1.

13. A method for producing protopanaxadiol, which comprises fermenting the genetically engineered bacterium according to any one of claims 1 to 9 to obtain protopanaxadiol from the fermentation broth.

14. A method for preparing the genetically engineered bacterium according to any one of claims 1 to 9, comprising the steps of:

1) constructing an expression vector 1 containing a squalene synthase gene and a2, 3-oxidosqualene synthase gene, and an expression vector 2 containing a dammarendiol synthase gene, a protopanaxadiol synthase gene and two nicotinamide adenine dinucleotide phosphate-cytochrome P450 reductase genes;

2) using Escherichia coli (Escherichia coli) The host strain is transformed by the expression vector 1 and the expression vector 2 obtained in the step 1) at the same time to obtain the escherichia coli genetic engineering bacteria for recombinant expression of protopanoxadiol.

Images