CN117866932A - Application of oxidation squalene cyclase NiOSC6 and encoding gene thereof in biosynthesis - Google Patents

Abstract

The invention discloses an oxidation squalene cyclase NiOSC6 and application of a coded product cucurbitadienol, belonging to the technical fields of synthetic biology and natural medicines. The invention is prepared from cucurbitaceae plant cucurbita pepoNeoalsomitra integrifoliola) The invention discloses a triterpene synthase NiOSC6 coding gene for synthesizing cucurbitadienol, which is cloned and functionally identified, wherein the nucleotide sequence is shown as Seq ID No.2, the gene is cloned and then connected with an expression vector pYES2 to construct a recombinant plasmid capable of being expressed in escherichia coli, and the recombinant plasmid is transformed into saccharomyces cerevisiae to construct engineering cells, so that the heterologous efficient synthesis of the compound cucurbitadienol by the saccharomyces cerevisiae is realized. The invention providesNiOSC6The application of cucurbitadienol in preparing antiallergic, moisturizing, skin cell growth promoting, melanocyte growth inhibiting and antitumor medicines is provided.

Description

Application of oxidation squalene cyclase NiOSC6 and encoding gene thereof in biosynthesis

Technical Field

The invention belongs to the technical fields of synthetic biology and natural medicines. In particular to an oxidation squalene cyclase NiOSC6 and a coding product cucurbitadienol thereof, and application of the product thereof in preparing medicaments for moisturizing, promoting skin cell growth, inhibiting melanin cell growth and resisting tumors.

Background

Cucurbitadienol (Cucurbitadienol) is a cucurbitane-type tetracyclic triterpene compound, and recent researches find that the cucurbitane-type tetracyclic triterpene compound has obvious anti-inflammatory and anti-tumor activities. Cucurbitadienol is also an important pharmaceutical intermediate and lead compound, is a key substrate for semi-chemical synthesis and biosynthesis of cucurbitane compounds, has been found to be about 300 cucurbitane triterpenoids, is mainly distributed in dozens of plants in cucurbitaceae, and many plants in cruciferae, lacquer tree and the like, is also called cucurbitacin compounds, and has various biological activities of resisting tumor, protecting liver, resisting inflammation, improving organism immunity, regulating gastrointestinal functions and the like.

In the cucurbitane compound biosynthesis pathway, cucurbitadienol synthase catalyzes the substrate 2, 3-oxidation squalene to synthesize cucurbitadienol, and cucurbitadienol forms momordicin and cucurbitacin through a series of protonation, cyclization, rearrangement and deprotonation.

The biosynthesis path of cucurbitadienol in plants is complex, the cucurbitadienol can be generated after more than ten steps of reaction, a large amount of isomers of the cucurbitadienol and derivatives thereof, such as cycloartenol, amynol, lupeol and other compounds exist in the plants, the separation is difficult, the content of the cucurbitadienol in the plants is very low, and the content of the cucurbitadienol extracted from the plants is about ten parts per million according to the prior research report. The existence of the above problems brings great difficulty to scientific research and production application. At present, a plurality of traditional Chinese medicine active ingredients (including alkaloids, flavonoids, terpenes and the like) have been researched by synthetic biology techniques, and some ingredients have been subjected to breakthrough progress and rapidly transferred into industrialized application research, so that the traditional Chinese medicine active ingredients become the latest front edge of biosynthesis of traditional Chinese medicine ingredients. Along with the discovery of cucurbitadienol synthase genes in different plants and the competitive development of functional research thereof, the key genes for catalyzing the synthesis of cucurbitadienol are discovered by analyzing the synthesis mechanism of cucurbitadienol, so that the problem of the synthesis of cucurbitadienol plants can be effectively solved, and a foundation is laid for the development and the utilization of cucurbitadienol and derivatives thereof.

Disclosure of Invention

Aiming at the defects existing in the prior art, the invention provides an oxidation squalene cyclase gene NiOSC6 and a coding product thereof, wherein the gene is a key enzyme gene participating in the synthesis of triterpenoid sapogenin of the cucurbitacin, and can be used as a biosynthesis regulatory gene of cucurbitadienol and applied to the preparation of the cucurbitadienol. Thus providing a novel method for biosynthesis of cucurbitadienol.

In order to achieve the above object of the present invention, the present invention adopts the following technical scheme:

an oxidosqualene cyclase nioc 6, which is:

(1) A protein comprising the amino acid sequence shown in Seq ID No. 1;

(2) The amino acid sequence shown in the Seq ID No.1 is a derivative protein with the same function by substituting and/or deleting and/or adding one or more amino acid residues.

The coding gene of the oxidation squalene cyclase NiOSC6 is as follows:

(a) A nucleotide sequence shown as Seq ID No.2;

(b) The nucleotide sequence shown in Seq ID No.2 is a nucleotide sequence which is substituted and/or deleted and/or added with one or several nucleotides and expresses the same functional protein.

A recombinant vector containing the gene encoding the oxidation squalene cyclase NiOSC 6.

Recombinant bacteria containing the gene encoding the oxidation squalene cyclase NiOSC 6.

The oxidation squalene cyclase NiOSC6 or the coding gene thereof is applied to the preparation of recombinant vectors, expression cassettes, transgenic cell lines and recombinant bacteria containing cucurbitadienol.

The application of the oxidation squalene cyclase NiOSC6 or the coding gene thereof in preparing fermentation liquor containing compound cucurbitadienol is characterized in that the application adopts: constructing an expression vector containing the coding gene, converting the recombinant vector into saccharomyces cerevisiae cells, and fermenting and culturing the obtained genetically engineered saccharomycetes to obtain fermentation liquor containing cucurbitadienol.

The application of the oxidation squalene cyclase NiOSC6 or the coding gene thereof in preparing antiallergic drugs.

The application of the oxidation squalene cyclase NiOSC6 or the coding gene thereof in preparing medicaments for moisturizing, promoting skin cell growth, inhibiting melanin cell growth and resisting tumors.

The application of the oxidation squalene cyclase NiOSC6 or the coding gene thereof in the synthesis or preparation of cucurbitadienol.

The preparation method of the compound cucurbitadienol comprises the following steps:

constructing an expression vector containing a coding gene for coding an oxidation squalene cyclase NiOSC6, converting the recombinant vector into saccharomyces cerevisiae, fermenting and culturing the obtained genetically engineered saccharomycetes to obtain a fermentation liquor containing cucurbitadienol, extracting the fermentation liquor with petroleum ether or ethyl acetate or dichloromethane or chloroform to obtain an extract containing the cucurbitadienol, separating and purifying the extract by a silica gel column chromatography method to finally obtain a compound cucurbitadienol shown in the following structural formula,

the application of cucurbitadienol in preparing antiallergic, moisturizing, skin cell growth promoting, melanocyte growth inhibiting and antitumor medicines is provided.

The Open Reading Frame (ORF) of the gene encoding the oxidation squalene cyclase gene NiOSC6 provided by the invention is 2277bp (Seq ID No. 2), and the gene encodes 758 amino acids (Seq ID No. 1). BLASTN analysis of this was aligned in NCBI and showed 85.5% homology to SgCBD of Momordica grosvenori (Siraitia grosvenorii) belonging to Cucurbitaceae.

The coding gene of the oxidation squalene cyclase NiOSC6 provided by the invention is a gene cloned from a cucurbitacin (Neoalsomitra integrifoliola), and can cyclize 2, 3-oxidation squalene to form a compound cucurbitadienol which is a key precursor substance of cucurbitacin compounds. The NiOSC6 is cloned from the plant for the first time, and the discovery of the oxidation squalene cyclase NiOSC6 and the coding gene thereof enriches the diversity of triterpene synthase.

The invention clones and functionally identifies the oxidation squalene cyclase NiOSC6 from cucurbitaceae plant mallow, and uses saccharomyces cerevisiae to generate cucurbitadienol.

The invention starts from cucurbitaceae plant cucurbit (Neoalsomitra integrifoliola), clones and functionally identifies a coding gene of an oxidation squalene cyclase NiOSC6 for synthesizing cucurbit dienol, the nucleotide sequence of the coding gene is shown as a Seq ID No.2, the coding gene is connected with an expression vector pYES2 after being subjected to gene cloning, the coding gene is constructed into a recombinant plasmid capable of being expressed in escherichia coli, and then the recombinant plasmid is transformed into saccharomyces cerevisiae to be constructed into engineering cells, so that the heterologous efficient synthesis of the compound cucurbit dienol by the saccharomyces cerevisiae is realized. The application of the cucurbitadienol serving as the NiOSC6 product in preparing the medicines for resisting allergy, preserving moisture, promoting the growth of skin cells, inhibiting the growth of melanocytes and resisting tumors is provided.

Drawings

FIG. 1 shows the analysis of the expression level of the oxidosqualene cyclase NiOSC6 in roots, stems, leaves and flowers in example 2.

FIG. 2 is a general rational diagram of GC-MS analysis of an engineered yeast extract expressing the oxidosqualene cyclase NiOSC6 in example 2.

FIG. 3 is a mass spectrum of the catalytic product cucurbituril of the oxidation squalene cyclase NiOSC6 of example 2.

FIG. 4 is a chromatogram of the cucurbitadienol standard of example 2.

FIG. 5 is a graph of the standard quality of cucurbitadienol in example 2.

FIG. 6 is a schematic diagram showing the construction of recombinant expression plasmid pYES2-NiOSC6 in example 2.

Detailed description of the preferred embodiments

The following description of the embodiments of the present invention will be made clearly and fully with reference to the accompanying drawings, in which it is evident that the embodiments described are only some, but not all embodiments of the invention. All other embodiments, which can be made by those skilled in the art based on the embodiments of the invention without making any inventive effort, are intended to be within the scope of the invention.

Unless otherwise indicated, the examples were conducted under conventional experimental conditions, such as the molecular cloning laboratory Manual of Sambrook et al (Sambrook J & Russell DW, molecular cloning: a laboratory manual, 2001), or under conditions recommended by the manufacturer's instructions.

Example 1

Cloning of the Oxidation squalene cyclase Gene NiOSC6 in Calophyllum Instrongylus.

1. According to the sequenced data of the gloriope clavatus transcriptome, the candidate oxidation squalene cyclase gene cDNA sequence in the gloriope clavatus saponin synthesis pathway is obtained through operations such as splicing, annotation, screening and the like.

2. Designing a primer of the candidate oxidation squalene cyclase gene, wherein the primer sequence is as follows:

forward primer (NiOSC 6-F): gggaatattaagcttggtaccATGTGGAAGTTAAAGATCGGAGCAG, ID NO.3;

reverse primer (NiOSC 6-R): ccctctagatgcatgctcgagTTATTCATTCAGAACCCGATGACAATATTCTC, ID NO.4;

primers were synthesized by Kunming division, inc. of Biotech, beijing.

3. Individual tissues (root, stem, leaf and flower) of the plant of the Hamamelis mollis were taken, total RNA was extracted using TRIzol kit (Invitrogen, carlsbad, calif., USA) using PrimeScript ^TM Reverse transcription is carried out by RT kit (Takara, china) to obtain cDNA, and the gene sequence of NiOSC6 is amplified by taking the cDNA as a template.

4. The amplified product agarose gel electrophoresis shows a specific band at about 2.3kb, the target band is subjected to gel cutting recovery, the gel recovery product is connected to a vector pYES2, and E.coli DH5 alpha is transformed, positive clones are selected for sequencing (Kunming division of Beijing qing biological science and technology Co., ltd.), and NiOSC6 gene clones with correct sequences are selected and saved for the construction of subsequent expression vectors.

Sequencing to obtain the triterpenoid saponin anabolic pathway oxidation squalene cyclase gene NiOSC6 with the length of 2277bp and nucleotide sequence as ID No.2; encodes 758 amino acids, and the amino acid sequence is shown as ID NO.1.

By multiple sequence alignment and phylogenetic tree analysis of NiOSC6 with the identified OSCs, it was shown that NiOSC6 has the highly conserved domains QW and DCTAE of the OSCs gene family.

Example 2

Eukaryotic expression and functional analysis of NiOSC6 gene.

NiOSC6 function preliminary analysis.

Extracting RNA of root, stem, leaf and flower of Coptis chinensis respectively, referring to PrimeScript ^TM RT kit (Takara, china) was reverse transcribed into cDNA using 2X ChamQ Universal SYBR qPCR Master Mix (Vazyme) at Applied Biosystems QuantStudio ^TM Real-time fluorescent quantitative PCR amplification was performed on platform 5 (Life Technologies).

Forward primer (NiOSC 6-qRT-F): CTTCACCTATGCTGGGTGGT, ID NO.5;

reverse primer (NiOSC 6-qRT-R): CTTCGATGAGGGCCATTAAA, ID NO.6.

From the results of the real-time fluorescent quantitative PCR analysis (fig. 1), it was assumed that the expression level of nioc 6 was highest in roots, and that nioc 6 might be involved in cucurbitacin biosynthesis in the roots of pachyrhizus.

2. Construction of a Yeast expression vector.

ERG 7-deficient Saccharomyces cerevisiae mutant GIL77 lacking lanosterol synthase gene can endogenously accumulate 2, 3-oxidized squalene, and 2, 3-oxidized squalene can be used as a substrate for functional verification of NiOSC 6.

By analyzing the coding sequence and the cleavage site of the gene NiOSC6, primers with KpnI and XhoI cleavage sites are designed as follows, and the full-length ORF of the NiOSC6 is amplified.

After sequencing and verifying the amplification product, connecting a target gene NiOSC6 to a yeast expression vector pYES2 by a homologous recombination method, screening a transformed colony by using an LB solid plate containing ampicillin (100 mu g/mL), selecting a monoclonal for verification, sequencing and verifying correctness to obtain a pYES2-NiOSC6 vector, inoculating the verified correct monoclonal into 5mL of LB liquid culture with the same resistance, fermenting and culturing, and extracting pYES2-NiOSC6 plasmid.

3. Yeast transformation.

The pYES2-NiOSC6 plasmid was transferred into Saccharomyces cerevisiae strain GIL77 by lithium acetate transformation, and an empty pYES2 transformation control group was set. Positive clones GIL77-pYES2-NiOSC6 and GIL77-pYES2 were selected by colony PCR.

4. Induction of expression and incubation.

Positive yeast monoclonal GIL77-pYES2-NiOSC6 and GIL77-pYES2 were picked separately and inoculated in 50ml of uracil-free synthetic complete medium [ SC-U; comprises ergosterol (20. Mu.g/ml), tween 80 (5 mg/ml) and hemin (13. Mu.g/ml), and is then cultured at 30℃for 2 days with shaking at 200 rpm.

Yeast cells were harvested, resuspended in 50mL of SC-U medium containing 2% galactose and induced by shaking at 200rpm for 2 days at 30 ℃.

After induction for 2 days, the cells were harvested and resuspended in the same volume of 0.1M potassium phosphate buffer (pH 7.0; 2% glucose and hemin (13. Mu.g/ml) were added and incubated at 30℃for 12 hours with shaking at 200 rpm.

5. And (5) extracting and identifying a catalytic product.

After 12 hours of incubation, the cells were refluxed with the same volume of saponification reagent (20% KOH/50% EtOH) for 10 minutes at 92℃and then extracted twice with the same volume of petroleum ether, the extracts were combined, concentrated to dryness under reduced pressure and the residue was derivatised with 200. Mu.l of cyano trimethylsilane at 65℃for 30 minutes.

And (3) carrying out GC-MS analysis on the derived product, wherein a catalytic group containing the NiOSC6 gene recombinant expression vector pYES2-NiOSC6 shows a specific peak compared with a control group containing no-load pYES2, namely new substances are generated, and the specific product is identified as cucurbitadienol.

The experiment proves that the NiOSC6 gene participates in the biosynthesis of triterpenoid saponins of the cucurbita pepo, and the NiOSC6 gene can be used for regulating the biosynthesis of cucurbitadienol in the cucurbita pepo, so that the heterologous synthesis of cucurbitadienol is realized.

Example 3

And (3) preparing the compound cucurbitadienol.

RNA of Hakka Swinhonis was extracted, and reference was made to PrimeScript ^TM RT kit (Takara, china) is reversely transcribed into cDNA, the cDNA is taken as a template to amplify the gene sequence of NiOSC6, and the amplified product has specificity on the order of 2.3kb through agarose gel electrophoresisAnd (3) carrying out gel cutting recovery on the target strip, connecting a gel recovery product to a vector pYES2, converting into escherichia coli DH5 alpha, picking up positive clones for sequencing (Kunming division of Beijing qing family biotechnology Co., ltd.), selecting a NiOSC6 gene with correct sequencing, connecting the target gene NiOSC6 to a yeast expression vector pYES2 by adopting a homologous recombination method, obtaining a pYES2-NiOSC6 vector, and sequencing to verify the correctness. Extracting pYES2-NiOSC6 plasmid, introducing the pYES2-NiOSC6 plasmid into Saccharomyces cerevisiae GIL77 strain by adopting a lithium acetate method, selecting positive clones GIL77-pYES2-NiOSC6 and GIL77-pYES2 by adopting a colony PCR method, and inoculating the positive yeast monoclonal GIL77-pYES2-NiOSC6 to 50ml of synthetic complete medium [ SC-U ] without uracil; comprises ergosterol (20 μg/ml), tween 80 (5 mg/ml) and hemin (13 μg/ml)]Then incubated at 30℃for 2 days. 50ml of the bacterial liquid is inoculated to 10L of synthetic complete medium [ SC-U ] without uracil; comprises ergosterol (20 μg/ml), tween 80 (5 mg/ml) and hemin (13 μg/ml)]In the following, yeast cells were harvested by shaking culture at 200rpm for 2 days at 30℃and resuspended in 10L of SC-U medium containing 2% galactose and protein expression was induced by shaking culture at 200rpm for 2 days at 30 ℃. After induction for 2 days, the yeast cells were harvested and resuspended in the same volume of 0.1M potassium phosphate buffer (pH 7.0; 2% glucose and hemin (13. Mu.g/ml) were added and incubated at 30℃for 12 hours with shaking at 200rpm, after 12 hours of incubation the cells were refluxed with the same volume of saponification reagent (20% KOH/50% EtOH) at 92℃for 10 minutes, then extracted 3 times with the same volume of petroleum ether, the extracts were combined, the extracts were concentrated to dryness under reduced pressure to give a cucurbitadienol-containing extract, weighed, column chromatographed with 1.5 times the amount of silica gel, eluting 3 column volumes with petroleum ether first, eluting with 6 times the column volume of petroleum ether ethyl acetate (15:1, v/v-8:1, v/v gradient), collecting fractions, detecting by thin layer chromatography, collecting fractions containing cucurbitadienol, concentrating to dryness under reduced pressure, HPLC detecting purity, and identifying the structure as a compound of cucurbitadienol.

Pharmaceutical formulation examples 1-8:

in the following preparation examples, conventional reagents are selected and preparation is performed according to the conventional method, and the application examples only show that the compound cucurbitadienol of the invention can be prepared into different preparations, and specific reagents and operations are not particularly limited:

1. dissolving cucurbitadienol with absolute ethanol, adding water for injection according to conventional method, fine filtering, packaging, and sterilizing to obtain injection with concentration of 0.5-5mg/mL.

2. Dissolving cucurbitadienol in dimethyl sulfoxide, dissolving in sterile injectable water, stirring to dissolve, filtering with sterile suction filter funnel, sterile fine filtering, packaging in ampoule, freeze drying at low temperature, and sealing under sterile condition to obtain powder for injection.

3. The compound cucurbitadienol is added with excipient according to the mass ratio of 9:1 to prepare powder.

4. Adding excipient into cucurbitadienol compound according to the mass ratio of the cucurbitadienol compound to the excipient of 5:1, granulating and tabletting.

5. The compound cucurbitadienol is prepared into oral liquid according to a conventional oral liquid preparation method.

6. Adding excipient into cucurbitadienol at a mass ratio of 5:1, and making into capsule.

7. Adding excipient into cucurbitadienol at a mass ratio of 5:1, and making into granule.

8. The capsule comprises the following components: 20mg of cucurbituril, 180mg of lactose and 5mg of magnesium stearate.

The preparation method comprises the following steps: the compound was mixed with a cosolvent uniformly, sieved, and the resulting mixture was filled into gelatin capsules each weighing 205mg and having an active ingredient content of 20mg.

The generic principles defined herein may be applied to other embodiments without departing from the spirit or scope of the invention. Thus, the present invention is not intended to be limited to the embodiments shown herein but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims (10)

1. An oxidation squalene cyclase nioc 6, characterized in that it is:

(1) A protein comprising the amino acid sequence shown in Seq ID No. 1;

(2) The amino acid sequence shown in the Seq ID No.1 is a derivative protein with the same function by substituting and/or deleting and/or adding one or more amino acid residues.

2. The gene encoding the oxidosqualene cyclase nioc 6 according to claim 1, characterized in that it is:

(a) A nucleotide sequence shown as Seq ID No.2;

(b) The nucleotide sequence shown in Seq ID No.2 is a nucleotide sequence which is substituted and/or deleted and/or added with one or several nucleotides and expresses the same functional protein.

3. A recombinant vector comprising a gene encoding the oxidosqualene cyclase nioc 6 according to claim 2.

4. A recombinant bacterium comprising a gene encoding the oxidosqualene cyclase nioc 6 according to claim 2.

5. Use of an oxidosqualene cyclase nioc 6 or a gene encoding it according to claim 1 or 2 for the preparation of recombinant vectors, expression cassettes, transgenic cell lines, recombinant bacteria containing cucurbitadienol.

6. Use of the oxidation squalene cyclase nioc 6 or a gene encoding it according to claim 1 or 2 for the preparation of a fermentation broth comprising the compound cucurbitadienol, characterized in that the use is made of: constructing an expression vector containing the coding gene, converting the recombinant vector into saccharomyces cerevisiae cells, and fermenting and culturing the obtained genetically engineered saccharomycetes to obtain fermentation liquor containing cucurbitadienol.

7. Use of an oxidosqualene cyclase nioc 6 according to claim 1 or 2 or a gene encoding it for the synthesis or preparation of cucurbitadienol.

8. Use of the oxidosqualene cyclase nioc 6 or its coding gene according to claim 1 or 2 for the preparation of an antiallergic, moisturizing, skin cell growth promoting, melanocyte growth inhibiting, antitumor drug.

9. The preparation method of the compound cucurbitadienol is characterized by comprising the following steps:

constructing an expression vector containing a coding gene for coding an oxidation squalene cyclase NiOSC6, converting the recombinant vector into saccharomyces cerevisiae, fermenting and culturing the obtained genetically engineered saccharomycetes to obtain a fermentation liquor containing cucurbitadienol, extracting the fermentation liquor with petroleum ether or ethyl acetate or dichloromethane or chloroform to obtain an extract containing the cucurbitadienol, separating and purifying the extract by a silica gel column chromatography method to finally obtain a compound cucurbitadienol shown in the following structural formula,

10. the application of cucurbitadienol compound obtained by the preparation method of claim 9 in preparing antiallergic, moisturizing, skin cell growth promoting, melanocyte growth inhibiting and antitumor drugs.