CN117844793A - Application of oxidation squalene cyclization gene NiOSC2 in biosynthesis - Google Patents

Application of oxidation squalene cyclization gene NiOSC2 in biosynthesis Download PDF

Info

Publication number
CN117844793A
CN117844793A CN202410031805.6A CN202410031805A CN117844793A CN 117844793 A CN117844793 A CN 117844793A CN 202410031805 A CN202410031805 A CN 202410031805A CN 117844793 A CN117844793 A CN 117844793A
Authority
CN
China
Prior art keywords
amyrin
lupeol
gene
niosc2
resinol
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202410031805.6A
Other languages
Chinese (zh)
Inventor
李晓波
杨生超
张迎
郝冰
张广辉
卢迎春
和四梅
刘冠泽
丁靖洋
王雪
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Yunnan Agricultural University
Original Assignee
Yunnan Agricultural University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Yunnan Agricultural University filed Critical Yunnan Agricultural University
Priority to CN202410031805.6A priority Critical patent/CN117844793A/en
Publication of CN117844793A publication Critical patent/CN117844793A/en
Pending legal-status Critical Current

Links

Landscapes

  • Enzymes And Modification Thereof (AREA)

Abstract

The invention discloses application of an oxidation squalene cyclization gene NiOSC2 in biosynthesis, and belongs to the technical fields of synthetic biology and natural medicines. The invention is prepared from cucurbitaceae plant cucurbita pepoNeoalsomitra integrifoliola) Starting from this, a synthetic lupeol was cloned and functionally identified,β-aromatic resinous alcoholαThe triterpene synthase NiOSC2 coding gene of the amyrin is shown as the sequence of Seq ID No.2, the gene is cloned and then connected with an expression vector pYES2 to construct a recombinant plasmid which can be expressed in escherichia coli, and then the recombinant plasmid is transformed into saccharomyces cerevisiae to construct engineering cells, thus realizing the heterologous efficient synthesis of the compound lupeol of the saccharomyces cerevisiae,β-aromatic resinous alcoholαThe gene engineering cell constructed by the invention is safe and stable, has short production period and shows great value in application and development. The invention providesNiOSC2The product can be used for preparing medicines for protecting cardiovascular and cerebrovascular, enhancing immunity, reducing blood sugar, relieving inflammation, resisting oxidation, relieving fatigue, resisting AIDS, and resisting cancer.

Description

Application of oxidation squalene cyclization gene NiOSC2 in biosynthesis
Technical Field
The invention belongs to the technical fields of synthetic biology and natural medicines. In particular to an application of oxidation squalene cyclase NiOSC2 and encoding products lupeol, beta-amyrin and alpha-amyrin thereof and products thereof in preparing medicaments for protecting cardiovascular and cerebrovascular, improving immunity, reducing blood sugar, resisting inflammation, oxidation, fatigue, AIDS and cancer.
Background
Pentacyclic triterpene is an important plant secondary metabolite, is formed by connecting 6 isoprene units, and is classified into various types according to aglycone differences. Pentacyclic triterpene not only participates in communication, defense and sensory regulation of plants, but also has wide pharmacological actions and important biological activities. Research shows that pentacyclic triterpene plays an important role in protecting cardiovascular and cerebrovascular, improving immunity, reducing blood sugar, resisting inflammation, resisting oxidation, resisting fatigue, resisting AIDS, resisting cancer, etc. However, pentacyclic triterpene compounds have the disadvantages of lack of natural resources, low content in plant bodies, long growth cycle, complex structure, difficulty in large-scale extraction from natural plant bodies and serious limitation of development and application of pentacyclic triterpene. Therefore, a new way for large-scale production of pentacyclic triterpene needs to be developed.
Disclosure of Invention
The invention provides an oxidation squalene cyclase gene NiOSC2 and a coding product thereof, wherein the gene is a key enzyme gene involved in the synthesis of triterpenoid sapogenin of the mallow fruits, can be used as a biosynthesis regulatory gene of lupeol, beta-amyrin and alpha-amyrin and applied to the preparation of lupeol, beta-amyrin and alpha-amyrin. Thus, a novel method for biosynthesis of lupeol, beta-resinol and alpha-resinol is provided.
In order to achieve the above object of the present invention, the present invention adopts the following technical scheme:
an oxidosqualene cyclase nioc 2, which is:
(1) A protein comprising the amino acid sequence shown in Seq ID No. 1;
(2) The amino acid sequence shown in the Seq ID No.1 is a derivative protein with the same function by substituting and/or deleting and/or adding one or more amino acid residues.
The coding gene of the oxidation squalene cyclase NiOSC2 is as follows:
(a) A nucleotide sequence shown as Seq ID No.2;
(b) The nucleotide sequence shown in Seq ID No.2 is a nucleotide sequence which is substituted and/or deleted and/or added with one or several nucleotides and expresses the same functional protein.
A recombinant vector containing the gene encoding the oxidation squalene cyclase NiOSC 2.
Recombinant bacteria containing the gene encoding the oxidation squalene cyclase NiOSC 2.
The oxidation squalene cyclase NiOSC2 or the coding gene thereof is applied to the preparation of recombinant vectors, expression cassettes, transgenic cell lines and recombinant bacteria containing lupeol, beta-amyrin and alpha-amyrin.
The application of the oxidation squalene cyclase NiOSC2 or the coding gene thereof in preparing fermentation liquor containing compounds lupeol, beta-amyrin and alpha-amyrin is characterized in that the application adopts: constructing an expression vector containing the coding gene, converting the recombinant vector into saccharomyces cerevisiae cells, and fermenting and culturing the obtained genetically engineered saccharomycetes to obtain fermentation liquor containing lupeol, beta-amyrin and alpha-amyrin.
The application of the oxidation squalene cyclase NiOSC2 or the coding gene thereof in preparing medicaments for protecting cardiovascular and cerebrovascular diseases, improving immunity, reducing blood sugar, resisting inflammation, resisting oxidization, resisting fatigue, resisting AIDS and resisting cancer.
The application of the oxidation squalene cyclase NiOSC2 or the coding gene thereof in synthesis or preparation of compounds lupeol, beta-amyrin and alpha-amyrin.
A process for the preparation of the compounds lupeol, beta-resinol and alpha-resinol, which process comprises the steps of:
constructing an expression vector containing a coding gene for coding an oxidation squalene cyclase NiOSC2, converting the recombinant vector into saccharomyces cerevisiae, fermenting and culturing the obtained genetically engineered saccharomycetes to obtain fermentation liquor containing lupeol, beta-amyrin and alpha-amyrin, extracting by petroleum ether, ethyl acetate, dichloromethane or trichloromethane to obtain extractum containing lupeol, beta-amyrin and alpha-amyrin, separating and purifying by combining a silica gel column chromatography method and a high performance liquid chromatography method to obtain compounds of the following structural formulas, namely the lupeol, the beta-amyrin and the alpha-amyrin,
the compounds lupeol, beta-amyrin and alpha-amyrin are used in preparing medicine for protecting cardiac and cerebral vascular system, improving immunity, lowering blood sugar, resisting inflammation, resisting oxidation, resisting fatigue, resisting AIDS and resisting cancer.
The Open Reading Frame (ORF) of the gene encoding the oxidation squalene cyclase gene NiOSC2 provided by the invention is 2298bp (Seq ID No. 2), 765 amino acids (Seq ID No. 1) are encoded, and when the gene is placed in NCBI for BLASTN analysis and comparison, the result shows that the homology with SgBAS1 of Momordica grosvenori (Siraitia grosvenorii) of Cucurbitaceae is 76%.
The coding gene of the oxidation squalene cyclase NiOSC2 provided by the invention is a gene cloned from the cucumis metuliferus (Neoalsomitra integrifoliola), and can cyclize 2, 3-oxidation squalene to form compounds lupeol, beta-amyrin and alpha-amyrin. The NiOSC2 is cloned from the plant for the first time, and the discovery of the oxidation squalene cyclase NiOSC2 and the coding gene thereof enriches the diversity of triterpene synthase.
The invention clones and functionally identifies oxidation squalene cyclase NiOSC2 from cucurbitaceae plant mallow, and uses saccharomyces cerevisiae to generate lupeol, beta-amyrin and alpha-amyrin.
The invention starts from cucurbitaceae plant ulna (Neoalsomitra integrifoliola), clones and functionally identifies a coding gene of an oxidation squalene cyclase NiOSC2 of synthesized lupeol, beta-amyrin and alpha-amyrin, the nucleotide sequence is shown as Seq ID No.2, the coding gene is connected with an expression vector pYES2 after gene cloning, a recombinant plasmid capable of being expressed in escherichia coli is constructed, and then the recombinant plasmid is transformed into saccharomyces cerevisiae to construct engineering cells, thus realizing the heterologous efficient synthesis of compounds lupeol, beta-amyrin and alpha-amyrin by saccharomyces cerevisiae. The NiOSC2 product lupeol, beta-amyrin and alpha-amyrin provided by the invention are applied to the preparation of antiallergic, moisturizing, skin cell growth promoting, melanocyte growth inhibiting and antitumor drugs.
Drawings
FIG. 1 is a three-dimensional structure prediction diagram of the oxidosqualene cyclase NiOSC2 in example 1.
FIG. 2 shows the analysis of the expression level of the oxidosqualene cyclase NiOSC2 in roots, stems, leaves and flowers in example 2.
FIG. 3 is a total ion figure of GC-MS analysis of an engineered yeast extract expressing the oxidosqualene cyclase NiOSC2 in example 2.
FIG. 4 is a mass spectrum of the catalytic products lupeol, beta-resinol and alpha-resinol catalyzed by the oxidation squalene cyclase NiOSC2 of example 2.
FIG. 5 is a chromatogram of lupeol, beta-resinol and alpha-resinol standards in example 2.
FIG. 6 is a graph of standard quality of lupeol, beta-resinol and alpha-resinol from example 2.
FIG. 7 is a schematic diagram showing the construction of recombinant expression plasmid pYES2-NiOSC2 in example 2.
Detailed description of the preferred embodiments
The following description of the embodiments of the present invention will be made clearly and fully with reference to the accompanying drawings, in which it is evident that the embodiments described are only some, but not all embodiments of the invention. All other embodiments, which can be made by those skilled in the art based on the embodiments of the invention without making any inventive effort, are intended to be within the scope of the invention.
Unless otherwise indicated, the examples were conducted under conventional experimental conditions, such as the molecular cloning laboratory Manual of Sambrook et al (Sambrook J & Russell DW, molecular cloning: a laboratory manual, 2001), or under conditions recommended by the manufacturer's instructions.
Example 1
Cloning of the Oxidation squalene cyclase Gene NiOSC2 in Calophyllum Instrongylus.
1. According to the sequenced data of the gloriope clavatus transcriptome, the candidate oxidation squalene cyclase gene cDNA sequence in the gloriope clavatus saponin synthesis pathway is obtained through operations such as splicing, annotation, screening and the like.
2. Designing a primer of the candidate oxidation squalene cyclase gene, wherein the primer sequence is as follows:
forward primer (NiOSC 2-F):
gggaatattaagcttggtaccATGTGGAGACTAACAATGGGAGAGG，Seq ID NO.3；
reverse primer (NiOSC 2-R):
ccctctagatgcatgctcgagTTAACGAGGCATTGAAACCAAATTACGG，Seq ID NO.4；
primers were synthesized by Kunming division, inc. of Biotech, beijing.
3. Individual tissues (root, stem, leaf and flower) of the plant of the Hamamelis mollis were taken, total RNA was extracted using TRIzol kit (Invitrogen, carlsbad, calif., USA) using PrimeScript TM Reverse transcription is carried out by RT kit (Takara, china) to obtain cDNA, and the gene sequence of NiOSC2 is amplified by taking the cDNA as a template.
4. The amplified product agarose gel electrophoresis shows a specific band at about 2.3kb, the target band is subjected to gel cutting recovery, the gel recovery product is connected to a vector pYES2, and E.coli DH5 alpha is transformed, positive clones are selected for sequencing (Kunming division of Beijing qing biological science and technology Co., ltd.), and NiOSC2 gene clones with correct sequences are selected and saved for the construction of subsequent expression vectors.
Sequencing to obtain the triterpenoid saponin anabolic pathway oxidation squalene cyclase gene NiOSC2 with the length of 2298bp and nucleotide sequence of Seq ID No.2; codes for 765 amino acids, the amino acid sequence is as set forth in Seq ID No.1.
By multiple sequence alignment and phylogenetic tree analysis of NiOSC2 with the identified OSCs, it was shown that NiOSC2 has the highly conserved domains QW and DCTAE of the OSCs gene family.
Example 2
Eukaryotic expression and functional analysis of NiOSC2 gene.
NiOSC2 function preliminary analysis.
Extracting RNA of root, stem, leaf and flower of Coptis chinensis respectively, referring to PrimeScript TM RT kit (Takara, china) was reverse transcribed into cDNA using 2X ChamQ Universal SYBR qPCR Master Mix (Vazyme) at Applied Biosystems QuantStudio TM Real-time fluorescent quantitative PCR amplification was performed on platform 5 (Life Technologies).
Forward primer (NiOSC 2-qRT-F): TGTGGTAGAGCTCGCAAATG, seq ID No.5;
reverse primer (NiOSC 2-qRT-R): CAACCGACAGTAGCAAAGCA, seq ID No.6.
From the results of the real-time fluorescent quantitative PCR analysis, it was found that NiOSC2 was expressed in the leaves in the highest amount, and it was presumed that NiOSC2 was involved in the biosynthesis of triterpene compounds in the leaves of Hashimeji melon.
2. Construction of a Yeast expression vector.
ERG 7-deficient Saccharomyces cerevisiae mutant GIL77 lacking lanosterol synthase gene can endogenously accumulate 2, 3-oxidized squalene, and 2, 3-oxidized squalene can be used as a substrate for functional verification of NiOSC 2.
By analyzing the coding sequence and cleavage site of the gene NiOSC2, primers with Kpn I and XhoI cleavage sites are designed as follows, and full-length ORF amplification of NiOSC2 is performed.
After sequencing and verifying the amplification product, connecting a target gene NiOSC2 to a yeast expression vector pYES2 by a homologous recombination method, screening a transformed colony by using an LB solid plate containing ampicillin (100 mu g/mL), selecting a monoclonal for verification, sequencing and verifying correctness to obtain a pYES2-NiOSC2 vector, inoculating the verified correct monoclonal into 5mL of LB liquid culture with the same resistance, fermenting and culturing, and extracting a pYES2-NiOSC2 plasmid.
3. Yeast transformation.
The pYES2-NiOSC2 plasmid was transferred into Saccharomyces cerevisiae strain GIL77 by lithium acetate transformation, and an empty pYES2 transformation control group was set. Positive clones GIL77-pYES2-NiOSC2 and GIL77-pYES2 were selected by colony PCR.
4. Induction of expression and incubation.
Positive yeast monoclonal GIL77-pYES2-NiOSC2 and GIL77-pYES2 were picked separately and inoculated in 50ml of uracil-free synthetic complete medium [ SC-U; comprises ergosterol (20. Mu.g/ml), tween 80 (5 mg/ml) and hemin (13. Mu.g/ml), and is then cultured at 30℃for 2 days with shaking at 200 rpm.
Yeast cells were harvested, resuspended in 50mL of SC-U medium containing 2% galactose and induced by shaking at 200rpm for 2 days at 30 ℃.
After induction for 2 days, the cells were harvested and resuspended in the same volume of 0.1M potassium phosphate buffer (pH 7.0; 2% glucose and hemin (13. Mu.g/ml) were added and incubated at 30℃for 12 hours with shaking at 200 rpm.
5. And (5) extracting and identifying a catalytic product.
After 12 hours of incubation, the cells were refluxed with the same volume of saponification reagent (20% KOH/50% EtOH) for 10 minutes at 92℃and then extracted twice with the same volume of petroleum ether, the extracts were combined, concentrated to dryness under reduced pressure and the residue was derivatised with 200. Mu.l of cyano trimethylsilane at 65℃for 30 minutes.
And (3) carrying out GC-MS analysis on the derived product, wherein a catalytic group containing the NiOSC2 gene recombinant expression vector pYES2-NiOSC2 shows a specific peak compared with a control group containing no-load pYES2, namely new substances are generated, and the specific products are lupeol, beta-amyrin and alpha-amyrin through identification.
The experiment proves that the NiOSC2 gene participates in the biosynthesis of triterpenoid saponins of the pachyrhizus, and can be used for regulating the biosynthesis of lupeol, beta-amyrin and alpha-amyrin in the pachyrhizus, so that the heterologous synthesis of the lupeol, the beta-amyrin and the alpha-amyrin is realized.
Example 3
The compounds lupeol, beta-resinol and alpha-resinol are prepared.
RNA of Hakka Swinhonis was extracted, and reference was made to PrimeScript TM RT kit (Takara, china) is reverse transcribed into cDNA, the cDNA is taken as template to amplify the gene sequence of NiOSC2, agarose gel electrophoresis of amplified product shows specific band at about 2.3kb, the target band is cut and recovered, the recovered product is connected to vector pYES2, and E.coli DH5 alpha is transformed, positive clone is picked up and sequenced (Kunming division Co., ltd. Of Beijing family biotechnology Co., ltd.), the NiOSC2 gene with correct sequencing is selected, the target gene NiOSC2 is connected to yeast expression vector pYES2 by homologous recombination method to obtain pYES2-NiOSC2 vector, and sequencing verification is correct. Extracting pYES2-NiOSC2 plasmid, introducing the pYES2-NiOSC2 plasmid into Saccharomyces cerevisiae GIL77 strain by lithium acetate method, selecting positive clones GIL77-pYES2-NiOSC2 and GIL77-pYES2 by colony PCR method, inoculating positive yeast monoclonal GIL77-pYES2-NiOSC2 into 50ml synthetic complete culture medium [ SC-U ] without uracil; comprises ergosterol (20 μg/ml), tween 80 (5 mg/ml) and hemin (13 μg/ml)]Then incubated at 30℃for 2 days. 50ml of the bacterial liquid is inoculated to 10L of synthetic complete medium [ SC-U ] without uracil; comprises ergosterol (20 μg/ml), tween 80 (5 mg/ml) and hemin (13 μg/ml)]In the following, yeast cells were harvested by shaking culture at 200rpm for 2 days at 30℃and resuspended in 10L of SC-U medium containing 2% galactose and protein expression was induced by shaking culture at 200rpm for 2 days at 30 ℃. After induction for 2 days, the yeast cells were harvested and resuspended in the same volume of 0.1M potassium phosphate buffer (pH 7.0; 2% glucose and hemin (13. Mu.g/ml) were added and incubated at 30℃for 12 hours with shaking at 200rpm, after 12 hours of incubation, the cells were refluxed with the same volume of saponification reagent (20% KOH/50% EtOH) at 92℃for 10 minutes and then extracted 3 times with the same volume of petroleum ether, the extracts were combined and concentrated to dryness under reduced pressure to give lupeol, beta-oleoresinThe extractum of alcohol and alpha-amyrin alcohol is weighed, 1.5 times of silica gel is used for mixing, 15 times of silica gel is used for column chromatography, petroleum ether is used for: ethyl acetate (12:1, v/v-8:1, v/v), each gradient was eluted with an eluent of 6 column volumes, fractions were collected, examined by thin layer chromatography, fractions containing lupeol, beta-resinol and alpha-resinol were collected, concentrated to dryness under reduced pressure, then separated by preparative high performance liquid chromatography using acetonitrile (a) -water (B) as mobile phase, 0-15min,80% a-100% a,15-40min,100% a, flow rate 8ml/min, run for 45min, then run for 5min, detection wavelength 203nm, lupeol, beta-resinol and alpha-resinol were prepared by preparative liquid phase, and their structures were identified by nuclear magnetic resonance.
Pharmaceutical formulation examples 1-8:
in the following preparation examples, conventional reagents are selected and preparation is performed according to the conventional methods, and the application examples only show that the compounds lupeol, beta-amyrin and alpha-amyrin can be prepared into different preparations, and specific reagents and operations are not particularly limited:
1. dissolving one or a combination of lupeol, beta-resinol and alpha-resinol with absolute ethanol, adding water for injection according to a conventional method, fine filtering, packaging and sterilizing to obtain injection, wherein the concentration of the injection is 0.5-5mg/mL.
2. Dissolving lupeol, beta-resinol and alpha-resinol or their combination in dimethyl sulfoxide, dissolving in sterile water for injection, stirring to dissolve, filtering with sterile suction filter, sterile fine filtering, packaging in ampoule, freeze drying at low temperature, and sealing to obtain powder for injection.
3. Adding excipient into lupeol, beta-resinol and alpha-resinol or their combination at a ratio of 9:1, and making into powder.
4. The lupeol, beta-resinol and alpha-resinol are added into excipient according to the mass ratio of 5:1, and the mixture is granulated and tabletted.
5. The compound lupeol, beta-amyrin and alpha-amyrin or their combination are made into oral liquid according to conventional oral liquid preparation method.
6. Adding excipient into lupeol, beta-resinol and alpha-resinol or their combination at a ratio of 5:1, and making into capsule.
7. Adding excipient into lupeol, beta-resinol and alpha-resinol or their combination at a ratio of 5:1, and making into granule.
8. The capsule comprises the following components: 20mg of one or a combination of lupeol, beta-amyrin and alpha-amyrin, 180mg of lactose and 5mg of magnesium stearate.
The preparation method comprises the following steps: the compound was mixed with a cosolvent uniformly, sieved, and the resulting mixture was filled into gelatin capsules each weighing 205mg and having an active ingredient content of 20mg.
The generic principles defined herein may be applied to other embodiments without departing from the spirit or scope of the invention. Thus, the present invention is not intended to be limited to the embodiments shown herein but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims (10)

1. An oxidation squalene cyclase nioc 2, characterized in that it is:
(1) A protein comprising the amino acid sequence shown in Seq ID No. 1;
(2) The amino acid sequence shown in the Seq ID No.1 is a derivative protein with the same function by substituting and/or deleting and/or adding one or more amino acid residues.
2. The gene encoding the oxidosqualene cyclase nioc 2 according to claim 1, characterized in that it is:
(a) A nucleotide sequence shown as Seq ID No.2;
(b) The nucleotide sequence shown in Seq ID No.2 is a nucleotide sequence which is substituted and/or deleted and/or added with one or several nucleotides and expresses the same functional protein.
3. A recombinant vector comprising a gene encoding the oxidosqualene cyclase nioc 2 according to claim 2.
4. A recombinant bacterium comprising a gene encoding the oxidosqualene cyclase nioc 2 according to claim 2.
5. Use of an oxidosqualene cyclase nioc 2 or a gene encoding it according to claim 1 or 2 for the preparation of recombinant vectors, expression cassettes, transgenic cell lines, recombinant bacteria comprising lupeol, β -resinol and α -resinol.
6. Use of the oxidation squalene cyclase nioc 2 or a gene encoding it for the preparation of a fermentation broth comprising the compounds lupeol, β -resinol and α -resinol according to claim 1 or 2, characterized in that the use is made of: constructing an expression vector containing the coding gene, converting the recombinant vector into saccharomyces cerevisiae cells, and fermenting and culturing the obtained genetically engineered saccharomycetes to obtain fermentation liquor containing lupeol, beta-amyrin and alpha-amyrin.
7. Use of the oxidation squalene cyclase nioc 2 or a gene encoding it according to claim 1 or 2 for the synthesis or preparation of the compounds lupeol, β -resinol and α -resinol.
8. Use of an oxidative squalene cyclase nioc 2 or a gene encoding it according to claim 1 or 2 for the preparation of a medicament for protecting cardiovascular and cerebrovascular vessels, improving immunocompetence, lowering blood sugar, anti-inflammatory, antioxidant, antifatigue, anti-aids, anticancer.
9. A process for the preparation of the compounds lupeol, β -resinol and α -resinol, characterized in that it comprises the steps of:
constructing an expression vector containing a coding gene for coding an oxidation squalene cyclase NiOSC2, converting the recombinant vector into saccharomyces cerevisiae, fermenting and culturing the obtained genetically engineered saccharomycetes to obtain fermentation liquor containing lupeol, beta-amyrin and alpha-amyrin, extracting by petroleum ether, ethyl acetate, dichloromethane or trichloromethane to obtain extractum containing lupeol, beta-amyrin and alpha-amyrin, separating and purifying by a silica gel column chromatography method to finally obtain compounds of the following structural formulas, namely lupeol, beta-amyrin and alpha-amyrin,
10. the use of lupeol, beta-amyrin and alpha-amyrin as compounds according to claim 9 for the preparation of medicaments for protecting cardiovascular and cerebrovascular vessels, improving immunocompetence, reducing blood glucose, anti-inflammatory, anti-oxidant, anti-fatigue, anti-AIDS and anti-cancer.
CN202410031805.6A 2024-01-09 2024-01-09 Application of oxidation squalene cyclization gene NiOSC2 in biosynthesis Pending CN117844793A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202410031805.6A CN117844793A (en) 2024-01-09 2024-01-09 Application of oxidation squalene cyclization gene NiOSC2 in biosynthesis

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202410031805.6A CN117844793A (en) 2024-01-09 2024-01-09 Application of oxidation squalene cyclization gene NiOSC2 in biosynthesis

Publications (1)

Publication Number Publication Date
CN117844793A true CN117844793A (en) 2024-04-09

Family

ID=90543336

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202410031805.6A Pending CN117844793A (en) 2024-01-09 2024-01-09 Application of oxidation squalene cyclization gene NiOSC2 in biosynthesis

Country Status (1)

Country Link
CN (1) CN117844793A (en)

Similar Documents

Publication Publication Date Title
CN106635853B (en) Recombinant saccharomyces cerevisiae for producing glycyrrhetinic acid, and construction method and application thereof
CN110438099A (en) The application of glycosyl transferase and its associated materials in the engineering bacteria that building produces ginsenoside Rb1 and Rg1
CN106318966B (en) A method of 3-O- glucosyl group oleanolic acid and cellobiose oleanolic acid are synthesized using saccharomyces cerevisiae
CN112813013B (en) Recombinant escherichia coli for producing hydroxytyrosol and application thereof
CN111154790B (en) Oxidosqualene cyclase gene GpOSC1 and encoding product and application thereof
CN106480004A (en) A kind of sesquiterpene synthase in Eupatorium adenophorum source, gene, carrier, engineering bacteria and its application
WO2023202122A1 (en) Curcuma wenyujin y. h. chen & c. ling-derived curcumin synthetase, gene, vector, engineered bacterium, and use thereof
CN110004099B (en) Fermentation production method of salidroside
CN109971651B (en) Tobacco endophytic fungus and application thereof in preparation of ergosterol 5,8 peroxide
CN113817757B (en) Recombinant yeast engineering strain for producing cherry glycoside and application thereof
CN117844793A (en) Application of oxidation squalene cyclization gene NiOSC2 in biosynthesis
CN113956990B (en) Recombinant saccharomyces cerevisiae for producing dihydronilotinib as well as preparation method and application thereof
CN117866934A (en) Application of oxidation squalene cyclization gene NiOSC3 in biosynthesis
CN117866933A (en) Oxidation squalene cyclase NiOSC5, encoding gene and application thereof
CN107903227B (en) Succinic anhydride compound, gene and protein related to succinic anhydride compound and preparation method of succinic anhydride compound
CN116004553A (en) Gene participating in gynostemma pentaphylla saponin synthesis and encoding product and application thereof
CN115109787B (en) Glycosyltransferase gene and application thereof in preparation of pseudo-ginseng/ginsenoside
CN117866932A (en) Application of oxidation squalene cyclase NiOSC6 and encoding gene thereof in biosynthesis
CN117904088A (en) Oxidation squalene cyclase gene NiOSC and encoding product thereof
CN117904089A (en) Oxidation squalene cyclase NiOSC1, coded product and application thereof
CN118165972A (en) Oxidation squalene cyclase NiOSC4, coded product and application thereof
CN117844792A (en) Oxidation squalene cyclase gene NiOSC3 and its coded product heterocycle triterpene
CN117844791A (en) Oxidation squalene cyclase gene NiOSC5 and its coded product heterocycle triterpene
CN118147122A (en) Application of oxidation squalene cyclase gene NiOSC4 in biosynthesis of heterocyclic triterpene
CN117925590A (en) Oxidation squalene cyclase gene NiOSC1 and its coded product heterocycle triterpene

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination