CN115109787B

CN115109787B - Glycosyltransferase gene and application thereof in preparation of pseudo-ginseng/ginsenoside

Info

Publication number: CN115109787B
Application number: CN202110285350.7A
Authority: CN
Inventors: 李检秀; 谢能中; 李燕婷
Original assignee: Guangxi Academy of Sciences
Current assignee: Guangxi Academy of Sciences
Priority date: 2021-03-17
Filing date: 2021-03-17
Publication date: 2023-07-14
Anticipated expiration: 2041-03-17
Also published as: CN115109787A

Abstract

The invention discloses a group of glycosyltransferase genes and application thereof in preparation of pseudo-ginseng/ginsenoside, wherein the genes are novel genes of 3 glycosyltransferases which are named as PnUGT 87, pnUGT 19 and PnUGT12 respectively and are obtained by digging in pseudo-ginseng genome for the first time, and have the nucleotide sequence shown in SEQ ID NOs: 1. 2 or 3; meanwhile, the amino acid sequences coded by the glycosyltransferase genes are respectively shown as SEQ ID NOs: 4. 5 or 6. The invention also discloses an expression vector containing the gene and a host cell transformed by the expression vector. The glycosyltransferase gene of the invention makes up for the small number of genes related to the biosynthesis of the existing ginseng/notoginsenoside, and most of ginseng/notoginsenoside molecular synthesis mechanisms are not clear, thus providing new genes for artificially synthesizing ginseng/notoginsenoside monomers.

Description

Glycosyltransferase gene and application thereof in preparation of pseudo-ginseng/ginsenoside

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a group of glycosyltransferase genes and application thereof in preparation of pseudo-ginseng/ginsenoside.

Background

Natural products are active substances selected and optimized for a long time in nature, and are the most important sources of drug discovery. The main medicinal components of the rare medicinal materials of pseudo-ginseng and ginseng are various saponins, more than 100 saponins are identified from pseudo-ginseng at present, and more than 150 saponins are identified from ginseng. However, the content of saponins in pseudo-ginseng and ginseng is low, the total saponins only account for 2% -9% of the dry weight of roots, the content of rare saponins with important drug effects is lower than one ten thousandth, and only few monomeric saponins with high content can be extracted and applied at present.

The synthesis of saponins and the increase of the content of saponins by biotechnology have become research hotspots, and the biosynthesis of saponins has been studied by tissue culture and bioconversion in recent years, providing a basic component for the production of saponins by synthetic biotechnology. Currently, glycosyltransferases from ginseng (UGTPg 1) acting on the C20-OH site of protopanaxadiol-type saponins, and gynostemma pentaphylla (GpUGT 23) acting on the C20-O-Glc site of protopanaxadiol-and protopanaxatriol-type saponins have been identified; in addition, glycosyltransferases PgUGT74AE2, UGTG45, pgUGT94Q2 and UGTPg29 respectively acting on the C3-OH site and the C3-O-Glc site of protopanaxadiol type saponin are also excavated and identified by Korean scientists and Chinese scientists. In the 2020 group Zhang Xueli, a candidate UGT gene element library derived from pseudo-ginseng is constructed, and five glycosyltransferase genes Pn1-3, pn3-29, pn3-31, pn3-32 and Pn3-32-i5 are successfully identified through a plug-and-play strategy, wherein glycosyltransferase Pn3-32-i5 can extend one molecule of xylosyl at the C6-O-Glc site of protopanaxatriol type saponin. However, the known functional genes involved in biosynthesis of ginseng/notoginsenoside have a small number, especially glycosyltransferase genes capable of catalyzing and extending sugar chains, and most of the molecular synthesis mechanisms of ginseng/notoginsenoside have not been completely resolved. In this case, the present invention has been conducted to identify glycosyltransferase genes in Panax notoginseng, and in particular, to clone and identify glycosyltransferases capable of extending one molecule of glucosyl or xylosyl at the C3-O-Glc and C20-O-Glc sites of protopanaxadiol-type saponins and glycosyltransferases capable of extending one molecule of xylosyl at the C6-O-Glc site of protopanaxatriol-type saponins.

Disclosure of Invention

Aiming at the defects that the number of genes related to biosynthesis of ginseng/notoginsenoside known in the prior art is small, the molecular synthesis mechanism of most of ginseng/notoginsenoside compounds is not clear, and the content of part of rare ginseng/notoginsenoside in plants is extremely low, the invention provides a group of glycosyltransferase genes for catalyzing and synthesizing various ginseng/notoginsenoside monomers and application of the glycosyltransferase genes in preparing glycosylated tetracyclic triterpene compounds.

The glycosyltransferase gene provided by the invention has the nucleotide sequence shown in SEQ ID NOs: 1. 2 or 3.

The invention establishes glycosyltransferase family gene libraries of species such as pseudo-ginseng, american ginseng, gynostemma pentaphylla and the like through integrating techniques and methods of functional genomics, transcriptomics, metabonomics and bioinformatics; through sequence comparison, conserved domain and evolutionary tree analysis, the gene functions of a glycosyltransferase gene resource library are predicted and identified, 3 glycosyltransferase new genes are obtained by digging in a pseudo-ginseng genome for the first time, and are named as PnUGT 87, pnUGT 19 and PnUGT 12 respectively, and the genes correspond to SEQ ID NO: 1. SEQ ID NO:2 and SEQ ID NO:3, and a nucleotide sequence shown in 3.

Meanwhile, the invention also provides glycosyltransferase coded by the glycosyltransferase gene, and the amino acid sequence of the glycosyltransferase is shown as SEQ ID NOs: 4. 5 or 6, wherein:

SEQ ID NO:4 consists of the amino acid sequence of SEQ ID NO:1, and the nucleotide sequence of the polypeptide is encoded by the nucleotide sequence of 1;

SEQ ID NO:5 consists of the amino acid sequence of SEQ ID NO:2, and the nucleotide sequence of the polypeptide is encoded by the nucleotide sequence of 2;

SEQ ID NO:6 consists of the amino acid sequence of SEQ ID NO:3, and the nucleotide sequence of the polypeptide is encoded.

Meanwhile, the invention also provides mutants of the glycosyltransferase, in particular mutants of PnUGT 87 glycosyltransferase and PnUGT 19 glycosyltransferase; the mutant is obtained by substituting amino acid residues at a plurality of positions of wild type glycosyltransferases PnUGT 87 and PnUGT 19.

Meanwhile, the invention also provides the amino acid sequences encoded by the PnUGT 87 glycosyltransferase mutant and the PnUGT 19 glycosyltransferase mutant, wherein:

the starting amino acid sequence of the PnUGT 87 glycosyltransferase mutant is SEQ ID NO in a sequence table: 4. these are PnUGT 87A43T/V112L/T389K/K423T, pnUGT G107E/T389K/K423T, pnUGT T389K, pnUGT 87D418E, respectively.

The starting amino acid sequence of the PnUGT 19 glycosyltransferase mutant is SEQ ID NO in a sequence table: 5. these are PnUGT 19P115L/T244I, pnUGT V89I/G355E/A361V/V423D, pnUGT V380A/G408D/P465S, respectively.

Meanwhile, the invention also provides an expression vector containing the glycosyltransferase gene.

Meanwhile, the invention also provides a host cell containing the expression vector.

Meanwhile, the invention also provides application of the glycosyltransferase, which is used as a catalytic preparation for glycosyl catalytic reaction to catalyze tetracyclic triterpene compounds to form glycosylated tetracyclic triterpene compounds.

Meanwhile, as a further application of the glycosyltransferase, the catalytic reaction for catalyzing the tetracyclic triterpene compound to form glycosylated tetracyclic triterpene compound is specifically one or more of the following reactions:

transferring a glycosyl group from a glycosyl donor to a C3-O-Glc site of a tetracyclic triterpene compound to extend a sugar chain;

(ii) transferring a glycosyl group from a glycosyl donor to a C20-O-Glc site of a tetracyclic triterpene compound to extend a sugar chain;

(III) transferring a glycosyl group from a glycosyl donor to a C6-OH site of a tetracyclic triterpene compound to add a glycosyl group;

(IV) transferring a glycosyl group from a glycosyl donor to a C6-O-Glc site of the tetracyclic triterpene compound to extend a sugar chain.

As a further improvement of the above catalytic reaction, the glycosyl donor is Uridine Diphosphate (UDP) sugar: UDP-glucose and/or UDP-xylose.

As a further application of the above glycosyltransferases, the present invention has clarified the functions of the above 3 glycosyltransferases by substrate specificity analysis and product identification; the 3 glycosyltransferases can realize in-vitro glycosylation reaction, catalyze tetracyclic triterpene compounds to generate various pseudo-ginseng/ginsenoside products, and are specific:

(A) The reaction formula of the catalytic reaction (I) is as follows:

and R1, R2, R3 and R4 are H, monosaccharide glycosyl or polysaccharide glycosyl.

The glycosyl donor is UDP-glucose and/or UDP-xylose.

The glycosyltransferase has the amino acid sequence shown in SEQ ID NO:4, and a polypeptide having the amino acid sequence shown in (a) and (b).

The substituted compounds of R1 and R2 are shown in table 1.

Table 1: glycosyltransferase PnUGT 87 catalyzes PPD type saponin

(B) The reaction formula of the catalytic reaction (II) is as follows:

wherein R1 is H, and R2 is monosaccharide glycosyl; r3 is H, and R4 is polysaccharide glycosyl.

The substituted compounds of R1 and R2 are shown in Table 2.

Table 2: glycosyltransferase PnUGT 87 catalyzes PPT type saponin

(C) The reaction formula of the catalytic reaction (III) is as follows:

wherein R1 is H, R2 is H, monosaccharide glycosyl or polysaccharide glycosyl, R3 is monosaccharide glycosyl, and R4 is H, monosaccharide glycosyl or polysaccharide glycosyl.

The glycosyl donor is UDP-glucose.

The glycosyltransferase has the amino acid sequence shown in SEQ ID NO: 5.

The substituted compounds of R1 and R2 are shown in Table 3.

Table 3: glycosyltransferase PnUGT 19 catalyzes PPT type saponin

(D) The reaction formula of the catalytic reaction (IV) is as follows:

wherein R1 is monosaccharide glycosyl, R2 is H or monosaccharide glycosyl, R3 is polysaccharide glycosyl, and R4 is H or monosaccharide glycosyl.

The glycosyl donor is UDP-xylose.

The glycosyltransferase has the amino acid sequence shown in SEQ ID NO:6, and a polypeptide having the amino acid sequence shown in FIG. 6.

The substituted compounds of R1 and R2 are shown in Table 4.

Table 4: glycosyltransferase PnUGT 12 catalyzes PPT type saponin

The substrates of the A, B, C, D four glycosyl catalytic reactions are compounds of formulas (I), (III), (V) and (VII); the product is a compound of formula (II), (IV), (VI), (VIII);

the compound of the formula (I) is saponin CK, and the compound of the formula (II) is gynostemma pentaphylla saponin LXXV;

or, the compound of the formula (I) is ginsenoside Rh2, and the compound of the formula (II) is ginsenoside Rg3;

or, the compound of the formula (I) is ginsenoside F2, and the compound of the formula (II) is ginsenoside Rd or ginsenoside Rb1 or gypenoside XVII or vietnam ginsenoside R16;

Alternatively, the compound of formula (I) is ginsenoside Rd, and the compound of formula (II) is ginsenoside Rb1 or ginsenoside Rb3;

alternatively, the compound of formula (I) is gypenoside XVII, and the compound of formula (II) is ginsenoside Rb1 or notoginsenoside L;

or, the compound of the formula (I) is notoginsenoside Fd, and the compound of the formula (II) is ginsenoside Rb3 or saponin Fd-Xyl;

or, the compound of the formula (I) is notoginsenoside Fe, and the compound of the formula (II) is ginsenoside Rc or saponin Fe-Xyl; or, the compound of formula (III) is ginsenoside F1, and the compound of formula (IV) is notoginsenoside U;

alternatively, the compound of formula (V) is protopanaxatriol (PPT), and the compound of formula (VI) is ginsenoside Rh1;

alternatively, the compound of formula (V) is ginsenoside F1 and the compound of formula (VI) is ginsenoside Rg1;

alternatively, the compound of formula (V) is ginsenoside F3 and the compound of formula (VI) is notoginsenoside FP1;

alternatively, the compound of formula (VII) is ginsenoside Rg1, and the compound of formula (VIII) is notoginsenoside R1;

alternatively, the compound of formula (VII) is ginsenoside Rh1 and the compound of formula (VIII) is notoginsenoside R2.

Meanwhile, the invention also provides application of the host cell, in particular to preparation of an enzyme catalysis reagent, or generation of glycosyltransferase, or generation of glycosylated tetracyclic triterpene compound (formula (II), (IV), (VI) or (VIII) as a catalysis cell.

Meanwhile, the invention also provides SEQ ID NO:1, and the glycosyltransferase PnUGT 87, the glycosyltransferase PnUGT 87 having the nucleotide sequence as set forth in SEQ ID NO:4, which is used as a catalytic agent for glycosyl catalytic reaction to catalyze ginsenoside F2 to form ginsenoside Rb1.

As a further improvement of the application of the glycosyltransferase PnUGT 87, the ginsenoside F2 is formed by catalyzing PPD by glycosyltransferase PnUGT 17 to generate ginsenoside Rh2 and then catalyzing ginsenoside Rh2 by glycosyltransferase PnUGT 35.

The invention develops a whole set of saccharomyces cerevisiae synthetic biology standard biological element library, a plurality of coenzyme regulation and control systems, microorganism directional transformation and a high-throughput screening platform by utilizing a synthetic biology technology. The function of the glycosyltransferase PnUGT 87 is determined through substrate specificity analysis and product identification, and the glycosyltransferase PnUGT 87 has the dual functions of specifically recognizing C3-O-Glc and C20-O-Glc sites and extending one molecule of glucosyl.

The invention also constructs a new path for artificially synthesizing ginsenoside Rb1, namely, 3 glycosyltransferase genes such as PnUGT 17, pnUGT 35, pnUGT 87 and the like are introduced into the PPD microorganism chassis cell, so as to realize the artificial synthesis of ginsenoside Rb1 monomers. Specifically: taking Saccharomyces cerevisiae BY4742 as an original strain, integrating 3-hydroxy-3-methylglutaryl coenzyme A reductase (tHMG 1), farnesyl pyrophosphoric acid synthase (ERG 20), squalene synthase (ERG 9), squalene epoxidase (ERG 1), damascene Diol Synthase (DS), protopanoxadiol synthase (CYP 716A 47) and coenzyme (ATR 1) providing reducing power NADPH into a BY4742 chromosome multicopy site region BY a homologous recombination mode, and constructing to obtain PPD chassis cells; then, three glycosyltransferase genes PnUGT 17, pnUGT 35 and PnUGT 87 are overexpressed in PPD chassis cells, so that the de novo synthesis of ginsenoside monomer Rb1 is realized.

The invention has the beneficial effects that:

1. the glycosyltransferase gene of the invention overcomes the defects that the number of genes related to biosynthesis of ginseng/notoginsenoside is small, most of the molecular synthesis mechanisms of ginseng/notoginsenoside compounds are not clear, and part of rare ginseng/notoginsenoside has extremely low content in plants in the prior art, and provides a new gene for saponin synthesis.

2. The glycosyltransferase produced by glycosyltransferase gene expression can realize in vitro glycosylation reaction, catalyze tetracyclic triterpene compounds to generate various pseudo-ginseng/ginsenoside, and improve the synthesis path and yield of pseudo-ginseng/ginsenoside.

3. The glycosyltransferase PnUGT 87 obtained by the identification has the function of specifically recognizing C3-O-Glc and C20-O-Glc sites, and ginsenoside F2 can be used as a precursor to obtain ginsenoside Rb1 through continuous two-step glycosylation and catalysis; in PPD chassis cells, only three glycosyltransferase genes PnUGT 17, pnUGT 35 and PnUGT 87 are cooperatively expressed, so that the de novo synthesis of ginsenoside monomer Rb1 can be realized, wherein glycosyltransferase PnUGT 17 can catalyze PPD to generate ginsenoside Rh2, pnUGT 35 can catalyze ginsenoside Rh2 to generate ginsenoside F2, and PnUGT 87 can catalyze ginsenoside F2 to generate ginsenoside Rb1 through two-step glycosylation reaction.

Drawings

FIG. 1 is an HPLC diagram of the production of gypenoside LXXV by using saponin CK as a glycosyl acceptor and UDP-glucose as a glycosyl donor and glycosyltransferase PnUGT 87 as a catalyst.

FIG. 2 is a LC-MS diagram of the production of gypenoside LXXV by the catalysis of glycosyltransferase PnUGT 87 with saponin CK as the glycosyl acceptor and UDP-glucose as the glycosyl donor.

FIG. 3 is an HPLC diagram of ginsenoside Rh2 as glycosyl acceptor, UDP-glucose as glycosyl donor, and glycosyltransferase PnUGT 87 for catalyzing the ginsenoside Rh2 to generate ginsenoside Rg 3.

FIG. 4 is a HPLC diagram of ginsenoside F2 as glycosyl acceptor, UDP-glucose as glycosyl donor, and glycosyltransferase PnUGT 87 for catalyzing the ginsenoside F2 to generate ginsenoside Rd and ginsenoside Rb 1.

FIG. 5 is a LC-MS diagram of ginsenoside F2 as glycosyl acceptor, UDP-glucose as glycosyl donor, and glycosyltransferase PnUGT 87 for catalyzing the ginsenoside F2 to generate ginsenoside Rd.

FIG. 6 is a LC-MS diagram of ginsenoside F2 as glycosyl acceptor, UDP-glucose as glycosyl donor, and glycosyltransferase PnUGT 87 for catalyzing the ginsenoside F2 to generate ginsenoside Rb 1.

FIG. 7 is a LC-MS diagram of the production of gypenoside XVII by the catalysis of glycosyltransferase PnUGT 87 using ginsenoside F2 as glycosyl acceptor and UDP-glucose as glycosyl donor.

FIG. 8 is an HPLC diagram of the production of Vietnam ginsenoside R16 catalyzed by glycosyltransferase PnUGT 87 using ginsenoside F2 as glycosyl acceptor and UDP-xylose as glycosyl donor.

FIG. 9 is a LC-MS diagram of the production of Vietnam ginsenoside R16 by using ginsenoside F2 as glycosyl acceptor, UDP-xylose as glycosyl donor and glycosyltransferase PnUGT 87 as catalyst.

FIG. 10 is a HPLC diagram of ginsenoside Rd as glycosyl acceptor, UDP-glucose as glycosyl donor, and glycosyltransferase PnUGT 87 for catalyzing the ginsenoside Rb 1.

FIG. 11 is a LC-MS diagram of ginsenoside Rd as a glycosyl acceptor and UDP-glucose as a glycosyl donor, and glycosyltransferase PnUGT 87 catalyzes the production of ginsenoside Rb 1.

FIG. 12 is a HPLC diagram of ginsenoside Rd as glycosyl acceptor, UDP-xylose as glycosyl donor, and glycosyltransferase PnUGT 87 for catalyzing the ginsenoside Rb 3.

FIG. 13 is a LC-MS diagram of ginsenoside Rd as glycosyl acceptor, UDP-xylose as glycosyl donor, and glycosyltransferase PnUGT 87 for catalyzing the acceptor to generate ginsenoside Rb 3.

FIG. 14 is an HPLC chart of the production of ginsenoside Rb1 catalyzed by glycosyltransferase PnUGT 87 using gypenoside XVII as the glycosyl acceptor and UDP-glucose as the glycosyl donor.

FIG. 15 is a LC-MS diagram of the production of ginsenoside Rb1 by the catalysis of glycosyltransferase PnUGT 87 using gypenoside XVII as the glycosyl acceptor and UDP-glucose as the glycosyl donor.

FIG. 16 is an HPLC diagram of the production of notoginsenoside L by using gypenoside XVII as a glycosyl acceptor and UDP-xylose as a glycosyl donor and glycosyltransferase PnUGT 87 as a catalyst.

FIG. 17 is a LC-MS diagram of the production of notoginsenoside L by using gypenoside XVII as the glycosyl acceptor and UDP-xylose as the glycosyl donor, and glycosyltransferase PnUGT 87 as the catalyst.

FIG. 18 is a HPLC diagram of ginsenoside Fd as a glycosyl acceptor, UDP-glucose as a glycosyl donor, and glycosyltransferase PnUGT 87 for catalyzing the production of ginsenoside Rb 3.

FIG. 19 is a LC-MS diagram of ginsenoside Fd as a glycosyl acceptor and UDP-glucose as a glycosyl donor, and the glycosyltransferase PnUGT 87 catalyzes the production of ginsenoside Rb 3.

FIG. 20 is a HPLC diagram of ginsenoside Fe as glycosyl acceptor, UDP-glucose as glycosyl donor, and glycosyltransferase PnUGT 87 for catalyzing the ginsenoside Fe to generate ginsenoside Rc.

FIG. 21 is a LC-MS diagram of ginsenoside Fe as glycosyl acceptor, UDP-glucose as glycosyl donor, and glycosyltransferase PnUGT 87 for catalyzing the ginsenoside Fe to generate ginsenoside Rc.

FIG. 22 is a HPLC chart of the production of notoginsenoside U by using ginsenoside F1 as a glycosyl acceptor, UDP-glucose as a glycosyl donor and glycosyltransferase PnUGT 87 as a catalyst.

FIG. 23 is a LC-MS diagram of ginsenoside F1 as a glycosyl acceptor, UDP-glucose as a glycosyl donor, and glycosyltransferase PnUGT 87 for catalyzing the ginsenoside F1 to generate notoginsenoside U.

FIG. 24 is an HPLC chart of the production of ginsenoside Rh1 catalyzed by glycosyltransferase PnUGT 19 using protopanaxatriol (PPT) as the glycosyl acceptor and UDP-glucose as the glycosyl donor.

FIG. 25 is a LC-MS diagram of the production of ginsenoside Rh1 catalyzed by glycosyltransferase PnUGT 19 using protopanaxatriol (PPT) as the glycosyl acceptor and UDP-glucose as the glycosyl donor.

FIG. 26 is an HPLC diagram of ginsenoside F1 as glycosyl acceptor, UDP-glucose as glycosyl donor, and glycosyltransferase PnUGT 19 for catalyzing the reaction to generate ginsenoside Rg 1.

FIG. 27 is a LC-MS diagram of ginsenoside F1 as glycosyl acceptor, UDP-glucose as glycosyl donor, and glycosyltransferase PnUGT 19 catalyzing the reaction to generate ginsenoside Rg 1.

FIG. 28 is an HPLC diagram of ginsenoside F3 as glycosyl acceptor, UDP-glucose as glycosyl donor, and glycosyltransferase PnUGT 19 for catalyzing the ginsenoside F3 to generate notoginsenoside FP 1.

FIG. 29 is a LC-MS diagram of the production of notoginsenoside FP1 by the catalysis of glycosyltransferase PnUGT 19 using ginsenoside F3 as the glycosyl acceptor and UDP-glucose as the glycosyl donor.

FIG. 30 is an HPLC diagram of ginsenoside Rg1 as a glycosyl acceptor, UDP-xylose as a glycosyl donor, and glycosyltransferase PnUGT 12 for catalyzing the ginsenoside R1.

FIG. 31 is a LC-MS diagram of the production of notoginsenoside R1 by the catalysis of glycosyltransferase PnUGT 12 using ginsenoside Rg1 as the glycosyl acceptor and UDP-xylose as the glycosyl donor.

FIG. 32 is an HPLC diagram of ginsenoside Rh1 as a glycosyl acceptor, UDP-xylose as a glycosyl donor, and glycosyltransferase PnUGT 12 for catalyzing the ginsenoside Rh1 to generate notoginsenoside R2.

FIG. 33 is a LC-MS diagram of ginsenoside Rh1 as a glycosyl acceptor, UDP-xylose as a glycosyl donor, and glycosyltransferase PnUGT 12 catalyzing the ginsenoside Rh1 to generate notoginsenoside R2.

FIG. 34 is a HPLC diagram of the production of Fd-Xyl catalyzed by glycosyltransferase PnUGT 87 using notoginsenoside Fd as substrate and UDP-xylose as glycosyl donor.

FIG. 35 is a LC-MC diagram of a glycosyltransferase PnUGT 87 catalyzed by a arasaponin Fd as a substrate and UDP-xylose as a glycosyl donor to produce Fd-Xyl.

FIG. 36 is a HPLC chart of the glycosyltransferase PnUGT 87 catalyzed production of Fe-Xyl with notoginsenoside Fe as substrate and UDP-xylose as glycosyl donor.

FIG. 37 is a LC-MC diagram of a glycosyltransferase PnUGT 87 catalyzed by a substrate of notoginsenoside Fe and a glycosyl donor of UDP-xylose to produce Fe-Xyl.

FIG. 38 is a HPLC identification chart of a catalytic product of glycosyltransferase PnUGT 87 with ginsenoside F2 as a precursor and UDP-glucose as a glycosyl donor.

FIG. 39 is a diagram showing LC-MS identification of a catalytic product of glycosyltransferase PnUGT 87 using ginsenoside F2 as a precursor and UDP-glucose as a glycosyl donor, wherein (A) is ginsenoside Rd and (B) is ginsenoside Rb1.

FIG. 40 is a HPLC identification chart of the engineering bacterium fermentation product of example 9.

FIG. 41 is a HPLC diagram of the production of notoginsenoside U by using ginsenoside F1 as a glycosyl acceptor, UDP-glucose as a glycosyl donor, and glycosyltransferase mutants PnUGT 87-1, pnUGT 87-2, pnUGT 87-3, and PnUGT 87-4.

FIG. 42 is an HPLC diagram of the glycosyltransferase mutants PnUGT 19-1, pnUGT 19-2, pnUGT 19-3 catalyzing the ginsenoside F1 as a glycosyl acceptor and UDP-glucose as a glycosyl donor to generate ginsenoside Rg 1.

Detailed Description

The invention is further described below with reference to the accompanying drawings.

1. Acquisition of glycosyltransferase genes PnUGT 87, pnUGT 19 and PnUGT 12

Example 1:

(1) Annotating the published whole genome data of pseudo-ginseng with HMMER3.1, annotating 34369 proteins in the published pseudo-ginseng genome to obtain 138 glycosyltransferases;

(2) Combining with genome data, performing transcriptome differential expression analysis, amino acid sequence comparison, conserved domain and evolutionary tree analysis on samples of rhizome, main root and fibrous root tissues of the three-year-old pseudo-ginseng, and performing functional prediction on the gene functions of the glycosyltransferase family gene library;

(3) Selecting glycosyltransferase with high transcription expression level and close homology (more than 90%) with the reported functional gene for functional verification;

finally, digging 3 new glycosyltransferase genes PnUGT 87, pnUGT 19 and PnUGT 12 in a pseudo-ginseng genome;

the nucleotide and amino acid sequences of the obtained glycosyltransferase PnUGT 87 are respectively shown in SEQ ID NO: 1. SEQ ID NO:4 is shown in the figure;

the nucleotide sequence and the amino acid sequence of the obtained glycosyltransferase PnUGT 19 are respectively shown as SEQ ID NO. 2 and SEQ ID NO:5 the number of the parts to be processed is shown in figure,

The nucleotide sequence and the amino acid sequence of the obtained glycosyltransferase PnUGT 12 are respectively shown in SEQ ID NO: 3. SEQ ID NO: shown at 6.

2. Construction of glycosyltransferase recombinant plasmids

Example 2:

extraction of pseudo-ginseng RNA

(1) Sterile ddH for radix Notoginseng ₂ After the O is washed clean, the water is sucked by sterile filter paper;

(2) Selecting fresh emerald root buds, quickly cutting into small blocks, transferring into a mortar which is cooled in advance for grinding, and continuously supplementing liquid nitrogen in the grinding process until the materials are crushed into white fine powder;

(3) Transferring the powder (about 100 mg) obtained by grinding into a 1.5mL centrifuge tube, adding 1mL of Trizol reagent, fully and uniformly mixing, and standing at room temperature for 10min to obtain a mixed solution a;

(4) Centrifuging the mixed solution a at 4 ℃ and 12000rpm for 10min, transferring the supernatant into a new 1.5mL centrifuge tube, adding 200 mu L of chloroform, 35 mu L of 3mol/L sodium acetate, 15 mu L of beta-mercaptoethanol and 10 mu L of 1% polyvinylpyrrolidone (PVP), fully mixing uniformly, and carrying out ice bath for 15min to obtain a mixed solution b;

(5) Centrifuging the mixed solution b at 4 ℃ and 12000rpm for 10min, transferring the supernatant into a new 1.5mL centrifuge tube, adding equal volume of isopropanol, 200 mu L of 3mol/L sodium acetate, and precipitating at-20 ℃ for 1h to obtain a mixed solution c;

(6) Centrifuging the mixed solution c at 4 ℃ and 12000rpm for 10min, discarding the supernatant, and adding 1mL of 75% ethanol to wash the precipitate to obtain a mixed solution d;

(7) Centrifuging the mixed solution d at 4deg.C and 12000rpm for 10min, discarding supernatant to minimize ethanol residue, vacuum drying for 2min, adding 30 μl RNase-free water, dissolving at room temperature for 5min, and preserving at-80deg.C;

(8) mu.L of the freshly extracted total RNA was taken for agarose gel electrophoresis analysis.

Construction of recombinant plasmid

(1) Performing reverse transcription by taking the extracted pseudo-ginseng RNA as a template to obtain a cDNA template;

(2) PCR amplification is carried out by using cDNA as a template and using primer pairs PnUGT 87-F1/R1 and PnUGT 19-F/R, pnUGT-F/R (see Table 8) to obtain an amplified product of 1.4-1.5 kb;

(3) Recovering PCR products by agarose gel to obtain glycosyltransferase gene PnUGT 87 and 4 mutants thereof (the amino acid sequence of PnUGT 87 is shown as SEQ ID NO:4, the substitution sites of the amino acid sequences of the 4 mutants are shown in the specification), pnUGT 19 and 3 mutants thereof (the amino acid sequence of PnUGT 19 is shown as SEQ ID NO:5, the substitution sites of the amino acid sequences of the 3 mutants are shown in the specification), pnUGT 12 (the amino acid sequence of PnUGT 12 is shown as SEQ ID NO: 6);

(4) Cloning the glycosyltransferase and the mutant thereof onto pYES3 plasmid to obtain pYES3-PnUGT87, pYES3-PnUGT19, pYES3-PnUGT12 recombinant plasmid and mutant gene recombinant plasmid.

3. Expression of glycosyltransferase genes PnUGT87, pnUGT19 and PnUGT12 in Saccharomyces cerevisiae

Example 3:

preparation of Saccharomyces cerevisiae W303-1B competent

(1) Selecting Saccharomyces cerevisiae W303-1B single colony into YPD culture medium, shaking overnight for 12 hr, and detecting OD of bacterial liquid with spectrophotometer ₆₀₀ Value, to its OD ₆₀₀ Centrifuging at 6000rpm for 5min at a value of 0.8-0.9, and collecting bacterial precipitate;

(2) Washing the thallus precipitate twice with sterile deionized water, re-suspending with 900 mu L of water, transferring the thallus to a sterile 1.5mL centrifuge tube, centrifuging for 30s with 13000g, and collecting thallus;

(3) Re-suspending the thalli with 900 mu L of water, and sub-packaging with 100 mu L of each tube; the supernatant was centrifuged to obtain competent Saccharomyces cerevisiae W303-1B for transformation.

Expression of (di) glycosyltransferases in Saccharomyces cerevisiae

(1) Converting pYES3-PnUGT87, pYES3-PnUGT19 and pYES3-PnUGT12 recombinant plasmids into competent Saccharomyces cerevisiae W303-1B by a lithium acetate conversion method, wherein an empty vector pYES3 is used as a negative control;

(2) Adding a transformation system, re-suspending thalli (which can vibrate), preserving heat for 20min in a 30 ℃ incubator, and slightly suspending after preserving heat;

(3) Heat shock is carried out on the suspension after heat preservation for 40min at 42 ℃, 180 mu L of CM-Trp coated flat plate is absorbed, the culture is carried out for 2d, and monoclonal sequencing verification is carried out;

(4) Inoculating the bacteria with correct sequence into 10mL CM-Trp (2% glucose) culture medium, and culturing at 30deg.C and 200rpm for 20 hr;

(5) Culturing the bacterial liquid at 4 DEG CCentrifuging at 6000rpm to collect thallus, washing thallus twice with sterile deionized water, re-suspending thallus with induction culture medium CM-Trp (2% galactose), and inoculating into 50mL induction culture medium to make OD ₆₀₀ About 0.4, and then induced to express at 30 ℃ and 200rpm for 12 hours;

(6) Centrifuging the expressed thallus at 4deg.C and 6000rpm to collect thallus, washing thallus twice with sterile deionized water, re-suspending thallus precipitate with yeast lysis buffer to obtain OD ₆₀₀ And (3) adding steel balls with the same volume as the thalli between 50 and 100, crushing cells for 2min by using a full-automatic grinding instrument, and finally centrifuging for 10min at the temperature of 4 ℃ and 12000g to collect cell lysis supernatant.

4. In vitro glycosylation reaction and product detection method

Example 4:

performing glycosylation reaction by taking cell lysates of the recombinant Saccharomyces cerevisiae W303-1B-pYES3-PnUGT 87, W303-1B-pYES3-PnUGT 19 and W303-1B-pYES3-PnUGT 12 obtained in the steps as crude enzyme solutions, and taking the cell lysates of the empty vector recombinant Saccharomyces cerevisiae W303-1B-pYES3 as negative control;

The glycosylation reaction system is as follows: 1% Tween-20, 5mM UDP-glucose or UDP-xylose, 50mM Tris-HCl (pH 8.5), 0.5mM saponin substrate, and appropriate amount of crude enzyme solution;

(1) After the reaction system is uniformly mixed, carrying out reaction for 12 hours in a water bath kettle at 30 ℃, adding 200 mu L of n-butanol to terminate the reaction;

(2) Evaporating n-butanol by a rotary evaporator, dissolving a sample by methanol, filtering by a 0.22 mu m filter, and detecting by HPLC;

HPLC detection conditions: the chromatographic column uses Agilent C18, the column temperature is 30 ℃, the detection wavelength is 203nm, and the mobile phase is water and acetonitrile. Elution conditions: 0min,22.5% acetonitrile; 0-55 min,62.5% acetonitrile; 55-60 min,62.5% acetonitrile; 60-65 min,22.5% acetonitrile; the flow rate was 1mL/min.

In the embodiment, the glycosylation reaction is carried out by taking the supernatant of the cell lysate of the recombinant saccharomyces cerevisiae W303-1B-pYES3-PnUGT 87 as a crude enzyme liquid, wherein the crude enzyme liquid has the amino acid sequence shown in SEQ ID NO:4, and the specific reaction is as follows:

(1) Taking saponin CK as a glycosyl acceptor and UDP-glucose as a glycosyl donor to catalyze the saponin CK to generate gynostemma pentaphylla saponin LXXV; HPLC and LC-MS detection are carried out, and an HPLC diagram of the gynosaponin LXXV is shown in figure 1; the LC-MS diagram of the gypenoside LXXV is shown in figure 2.

(2) Taking ginsenoside Rh2 as a glycosyl acceptor and UDP-glucose as a glycosyl donor to catalyze the acceptor to generate ginsenoside Rg3; HPLC detection is carried out, and the HPLC diagram of ginsenoside Rg3 is shown in FIG. 3.

(3) Taking ginsenoside F2 as a glycosyl acceptor and UDP-glucose as a glycosyl donor to catalyze the acceptor to generate ginsenoside Rd and ginsenoside Rb1; HPLC detection is carried out, and HPLC diagrams of ginsenoside Rd and ginsenoside Rb1 are shown in FIG. 4; LC-MS of ginsenoside Rd is shown in FIG. 5; an LC-MS diagram of ginsenoside Rb1 is shown in FIG. 6.

(4) Taking ginsenoside F2 as a glycosyl acceptor and UDP-glucose as a glycosyl donor to catalyze the acceptor to generate gypenoside XVII; LC-MS detection is carried out, and the LC-MS diagram of gypenoside XVII is shown in FIG. 7.

(5) Taking ginsenoside F2 as a glycosyl acceptor and UDP-xylose as a glycosyl donor to catalyze the acceptor to generate vietnamese ginsenoside R16; HPLC and LC-MS detection are carried out, and the HPLC diagram of the vietnamese ginsenoside R16 is shown in FIG. 8; the LC-MS diagram of Vietnam ginsenoside R16 is shown in FIG. 9.

(6) Taking ginsenoside Rd as a glycosyl acceptor and UDP-glucose as a glycosyl donor to catalyze the acceptor to generate ginsenoside Rb1; HPLC and LC-MS detection are carried out, and the HPLC diagram of ginsenoside Rb1 is shown in FIG. 10; an LC-MS diagram of ginsenoside Rb1 is shown in FIG. 11.

(7) Taking ginsenoside Rd as a glycosyl acceptor and UDP-xylose as a glycosyl donor to catalyze the acceptor to generate ginsenoside Rb3; HPLC and LC-MS detection are carried out, and the HPLC diagram of ginsenoside Rb3 is shown in FIG. 12; an LC-MS diagram of ginsenoside Rb3 is shown in FIG. 13.

(8) The gypenoside XVII is taken as a glycosyl acceptor, and UDP-glucose is taken as a glycosyl donor to catalyze the gypenoside XVII to generate ginsenoside Rb1; HPLC and LC-MS detection are carried out, and the HPLC diagram of ginsenoside Rb1 is shown in FIG. 14; the LC-MS diagram of ginsenoside Rb1 is shown in FIG. 15.

(9) Using gypenoside XVII as a glycosyl acceptor and UDP-xylose as a glycosyl donor to catalyze the gypenoside XVII to generate notoginsenoside L; HPLC and LC-MS detection were performed, the HPLC diagram of notoginsenoside L is shown in FIG. 16, and the LC-MS diagram of notoginsenoside L is shown in FIG. 17.

(10) Taking notoginsenoside Fd as a glycosyl acceptor and UDP-glucose as a glycosyl donor to catalyze the notoginsenoside Fd to generate ginsenoside Rb3; HPLC and LC-MS detection were performed, the HPLC diagram of ginsenoside Rb3 is shown in FIG. 18, and the LC-MS diagram of ginsenoside Rb3 is shown in FIG. 19.

(11) Taking notoginsenoside Fd as a glycosyl acceptor and UDP-xylose as a glycosyl donor to catalyze the notoginsenoside Fd to generate Fd-Xyl; HPLC and LC-MS detection were performed, and the HPLC chart of Fd-Xyl is shown in FIG. 34, and the LC-MS chart of Fd-Xyl is shown in FIG. 35.

(12) Taking notoginsenoside Fe as a glycosyl acceptor and UDP-glucose as a glycosyl donor to catalyze the notoginsenoside Fe to generate ginsenoside Rc; HPLC and LC-MS detection were performed, and the HPLC diagram of ginsenoside Rc is shown in FIG. 20, and the LC-MS diagram of ginsenoside Rc is shown in FIG. 21.

(13) Taking notoginsenoside Fe as a substrate, taking UDP-xylose as a glycosyl donor, and catalyzing the notoginsenoside Fe to generate Fe-Xyl; HPLC and LC-MS detection were performed, and the HPLC chart of Fe-Xyl is shown in FIG. 36, and the LC-MS chart of Fe-Xyl is shown in FIG. 37.

The compounds obtained by substituting R1 and R2 of the substrates in the reactions (1) to (13) are shown in Table 1.

Table 1: glycosyltransferase PnUGT 87 catalyzes PPD type saponin

The reaction formulae of reactions (1) to (13) are as follows:

The glycosyl donor is UDP-glucose and/or UDP-xylose.

Example 5:

(14) Taking ginsenoside F1 as a glycosyl acceptor and UDP-glucose as a glycosyl donor to catalyze the ginsenoside F1 to generate notoginsenoside U; HPLC and LC-MS detection are carried out, and the HPLC diagram of notoginsenoside U is shown in FIG. 22; the LC-MS diagram of notoginsenoside U is shown in FIG. 23.

The compounds obtained by substituting R1 and R2 of the substrate of the above reaction (14) are shown in Table 2.

Table 2: glycosyltransferase PnUGT 87 catalyzes PPT type saponin

The reaction formula of reaction (14) is as follows:

The glycosyl donor is UDP-glucose.

Example 6:

in the embodiment, the glycosylation reaction is carried out by taking the supernatant of the cell lysate of the recombinant saccharomyces cerevisiae W303-1B-pYES3-PnUGT 19 as a crude enzyme solution, wherein the crude enzyme solution has the amino acid sequence shown in SEQ ID NO:5, specifically the following reaction:

(15) In order to take protopanaxatriol (PPT) as a glycosyl acceptor and UDP-glucose as a glycosyl donor, catalyzing the protopanaxatriol to generate ginsenoside Rh1; HPLC graphs of ginsenoside Rh1 for HPL and LC-MSC detection are shown in FIG. 24; an LC-MS diagram of ginsenoside Rh1 is shown in FIG. 25.

(16) Taking ginsenoside F1 as a glycosyl acceptor and UDP-glucose as a glycosyl donor to catalyze the acceptor to generate ginsenoside Rg1; HPLC and LC-MS detection are carried out, and the HPLC diagram of ginsenoside Rg1 is shown in FIG. 26; an LC-MS diagram of ginsenoside Rg1 is shown in FIG. 27.

(17) Taking ginsenoside F3 as a glycosyl acceptor and UDP-glucose as a glycosyl donor to catalyze the ginsenoside F3 to generate notoginsenoside FP1; HPLC and LC-MS detection are carried out, and the HPLC diagram of notoginsenoside FP1 is shown in FIG. 28; FIG. 29 shows the LC-MS diagram of notoginsenoside FP 1.

The compounds obtained by substitution of R1 and R2 of the substrates obtained by the reactions (15) to (17) are shown in Table 3.

Table 3: glycosyltransferase PnUGT 19 catalyzes PPT type saponin

The reaction formulae of reactions (15) to (17) are as follows:

The glycosyl donor is UDP-glucose.

The glycosyltransferase has the amino acid sequence shown in SEQ ID NO: 5.

Example 7:

in the embodiment, the glycosylation reaction is carried out by taking the supernatant of the cell lysate of the recombinant saccharomyces cerevisiae W303-1B-pYES3-PnUGT 12 as a crude enzyme liquid, wherein the crude enzyme liquid has the amino acid sequence shown in SEQ ID NO:6, specifically the following reaction:

(18) Taking ginsenoside Rg1 as a glycosyl acceptor and UDP-xylose as a glycosyl donor to catalyze the ginsenoside Rg1 to generate notoginsenoside R1; HPLC and LC-MS detection are carried out, and the HPLC diagram of notoginsenoside R1 is shown in FIG. 30; the LC-MS diagram of notoginsenoside R1 is shown in FIG. 31.

(19) Ginsenoside Rh1 is used as a glycosyl acceptor, UDP-xylose is used as a glycosyl donor, and the ginsenoside Rh1 is catalyzed to generate notoginsenoside R2; HPLC and LC-MS detection are carried out, and the HPLC diagram of notoginsenoside R2 is shown in FIG. 32; the LC-MS diagram of notoginsenoside R2 is shown in FIG. 33.

The compounds obtained by substitution of R1 and R2 of the substrates obtained by the reactions (18) to (19) are shown in Table 4.

Table 4: glycosyltransferase PnUGT 12 catalyzes PPT type saponin

The reaction formulae of reactions (18) to (19) are as follows:

The glycosyl donor is UDP-xylose.

Example 8:

according to the procedure of example 3, 4 mutants of glycosyltransferase gene PnUGT 87 are subjected to heterologous expression, the supernatant of the expressed Saccharomyces cerevisiae cell lysate is used as crude enzyme solution for glycosylation reaction, and the cell lysate of the empty vector pYES3 recombinant Saccharomyces cerevisiae is used as a negative control; the specific procedure is the same as the fourth step "in vitro glycosylation reaction and product identification", and the specific reaction is as follows:

(20) In vitro catalytic reaction is carried out by using ginsenoside F1 as a substrate and UDP-glucose as a glycosyl donor and utilizing PnUGT 87 mutant crude enzyme liquid, HPLC (see specific results in figure 41) detection shows that a new substance is detected by a reaction system of 4 PnUGT 87 mutant crude enzyme liquids, and the retention time of the substance and a product U of the PnUGT 87 and the ginsenoside F1 is consistent, which indicates that the ginsenoside F1 is converted into the notoginsenoside U under the catalysis of the PnUGT 87 mutant crude enzyme liquid.

The reaction formula of reaction (20) is as follows:

The substituted compounds of R1 and R2 are shown in Table 5.

The compounds obtained by substitution of R1 and R2 of the substrate of reaction (20) are shown in Table 5.

Table 5: glycosyltransferase PnUGT 87 mutant catalyzed PPT type saponin

5. Application of glycosyltransferase PnUGT 87

Example 9:

functional verification of the (one) glycosyltransferase PnUGT 87

The pYES3-PnUGT 87 recombinant plasmid was prepared by the method of example 2.

(1) Preparation of Saccharomyces cerevisiae W303-1B competent

Selecting Saccharomyces cerevisiae W303-1B single colony into YPD culture medium, shaking overnight for 12 hr, and detecting OD of bacterial liquid with spectrophotometer ₆₀₀ Value, to its OD ₆₀₀ Centrifuging at 6000rpm for 5min at a value of 0.8-0.9, and collecting bacterial precipitate; washing the bacterial precipitate twice with sterile deionized water, re-suspending with 900 mu L of water, transferring the bacterial precipitate into a sterile 1.5mL centrifuge tube, and centrifuging at 13000rpm for 30s to collect bacterial precipitate; re-suspending the thalli with 900 mu L of water, and sub-packaging with 100 mu L of each tube; the supernatant was centrifuged and the cells were used for transformation.

(3) Expression of glycosyltransferase PnUGT 87 in Saccharomyces cerevisiae

Converting the pYES3-PnUGT 87 recombinant plasmid into Saccharomyces cerevisiae W303-1B by a lithium acetate conversion method, wherein an empty vector pYES3 is used as a negative control; adding a transformation system to resuspend thalli, and vibrating; preserving heat in a 30 ℃ incubator for 20min (after preserving heat, lightly suspending), thermally exciting at 42 ℃ for 40min, absorbing 180 mu L of the mixture onto a CM-Trp plate, culturing for 2d, and picking up monoclonal sequencing for verification.

Inoculating the bacteria with correct sequencing into 10mL CM-Trp (2% glucose) culture medium, and culturing for 20h at 30 ℃ and 200 rpm; then centrifugally collecting thalli at 4 ℃ and 6000rpm, and washing thalli twice by using sterile deionized water; then the cells were resuspended in CM-Trp (2% galactose) as an induction medium and inoculated into 50mL of the induction medium to adjust the OD ₆₀₀ Inducing and expressing for 12h at about 0.4, 30 ℃ and 200 rpm; then centrifugally collecting thalli at 4 ℃ and 6000rpm, and washing thalli twice by using sterile deionized water;

the bacterial pellet was resuspended in yeast lysis buffer to OD ₆₀₀ And (3) adding steel balls with the same volume as the thalli between 50 and 100, crushing yeast cells by using a full-automatic sample rapid grinding instrument, centrifuging at the temperature of 4 ℃ and at the speed of 12000rpm for 10min, and collecting cell lysate supernatant.

(4) In vitro transglycosylation activity and product identification

Performing transglycosylation reaction by taking the supernatant of the cell lysate of the recombinant saccharomyces cerevisiae W303-1B-pYES3-PnUGT 87 in the step (3) as a crude enzyme solution, taking the cell lysate of the recombinant saccharomyces cerevisiae of the empty vector pYES3 as a negative control, and identifying a reaction product by HPLC, wherein the reaction time is 12 h.

The ginsenoside F2 is taken as a glycosyl acceptor, UDP-Glucose is taken as a glycosyl donor, glycosyltransferase PnUGT 87 catalyzes the glycosyl donor to generate ginsenoside Rb1 and ginsenoside Rd, and an HPLC identification chart of the product is shown in figure 38; the LC-MS identification of the products is shown in FIG. 39.

Wherein glycosyltransferase PnUGT 17 can catalyze PPD to generate ginsenoside Rh2, pnUGT 35 can catalyze ginsenoside Rh2 to generate ginsenoside F2, glycosyltransferase PnUGT 87 reacts with F2 for 12h, and ginsenoside monomer Rb1 is generated. The reaction time is shortened to 30min, and the intermediate ginsenoside Rd is detected. Indicating that glycosyltransferase PnUGT 87 is capable of catalyzing F2 to produce Rb1 by two successive steps of glycosylation.

(II) construction of PDD Chassis cells

The yeast genome DNA is used as a template, and primers are designed to amplify genes tHMG1, ERG20, ERG9 and ERG1 respectively.

The following genes DS (GeneBank: KJ 804174.1), CYP716A47 (GeneBank: JN 604536), 46ATR1 (GeneBank: CAA 0396366.1) were synthesized according to Saccharomyces cerevisiae codon bias commission of Suzhou Jinwei Biotechnology Co., ltd, and related intermediate plasmids were constructed after the synthesis (see Table 6 for primer information).

(1) Construction of T1-ERG20-ERG9 plasmid

Designing a primer, and amplifying a T1 framework by taking a T1 plasmid as a template; amplifying the EGR20 and EGR9 gene fragments by taking yeast genome DNA as a template; the T1 skeleton, the EGR20 and the EGR9 gene fragments are connected through a homologous recombination technology, escherichia coli (Escherichia coli) is transformed, and the transformant is verified by sequencing.

(2) Construction of T2-ERG1-DS plasmid

Designing a primer, and amplifying a T2 framework by taking a T2 plasmid as a template; amplifying the EGR1 and DS gene fragments by taking yeast genome DNA as a template; the T2 skeleton, the EGR1 and the DS gene fragments are connected through a homologous recombination technology, escherichia coli (Escherichia coli) is transformed, and the transformant is verified by sequencing.

(3) Construction of T3-CYP716A47-46ATR1-tHMG1 plasmid

Designing a primer, and amplifying a T3 framework by taking a T3 plasmid as a template; amplifying CYP716A47, 46ATR1 and tHMG1 gene segments by taking plasmids constructed by Jin Weizhi biotechnology limited company as templates; the T3 skeleton, CYP716A47, 46ATR1 and tHMG1 gene segments are connected by homologous recombination technology, escherichia coli (Escherichia coli) is transformed, and the transformant is verified by sequencing.

(4) Construction of T4-CYP716A47-46ATR1 plasmid

Designing a primer, and amplifying a T4 framework by taking a T4 plasmid as a template; amplifying CYP716A47, 46ATR1 gene segment by taking a plasmid constructed by Jin Weizhi biotechnology limited company as a template; the T4 skeleton and YP716A47, 46ATR1 gene fragments are connected by homologous recombination technology, and Escherichia coli (Escherichia coli) is transformed, and the transformant is verified by sequencing.

(5) Amplifying the functional fragment

The transformants sequenced correctly as described above were used as templates, primers were designed, and functional expression fragments were amplified (specifically, as shown in Table 7): L1-ADH1-ERG20-tPI1-2HXT7-ERG9-PGI7-L2, L2-PGI-ERG1-ADH1-RPL8A-DS-CYC1-L3, L3-ADH1-CYP716A47-46ATR1-tFBA1-ADH3-tHMG1-tPDC1-L4, L4-pGK1-CYP716A47-46ATR1-tTDH1-L5.

The four transformants of T1, T2, T3 and T4 provide the gene with a promoter, a terminator and a homologous arm joint; the four functional fragments were recovered by gel (note: the following fragments are written with omission of promoter and terminator).

(6) Gene functional fragment cotransformation Saccharomyces cerevisiae BY4742

Selecting Saccharomyces cerevisiae BY4742 single colony, shaking overnight in YPD culture medium for 12 hr, and measuring OD of the culture bacterial liquid BY spectrophotometry ₆₀₀ To the OD thereof ₆₀₀ Centrifuging at 6000rpm for 5min with the value of 0.8-0.9, collecting thalli, washing twice with sterile deionized water, and re-suspending with 900 mu L of water;

transferring the cells into a sterile 1.5mL centrifuge tube, centrifuging at 13000rpm for 30s to collect the cells, re-suspending the cells with 900 μl of water, packaging, and adding 240 μl of PEG3350 (50%), 36 μl of 1.0M LiAc, 10 μl of salmon sperm DNA (10 mg/mL), L1-ERG20-ERG9-L2, L2-ERG1-DS-L3, L3-CY P716A47-46ATR1-tHMG1-L4, L4-CYP716A47-46ATR1-L5 200ng, ddH respectively per 100 μl, centrifuging, discarding supernatant ₂ O is filled up to 360 mu L;

resuspension of the bacterial cells in the mixed transformation system, heat shock for 40min at 42 ℃ in a 30 ℃ incubator, CM-His plate coating, 2d culture, and monoclonal sequencing verification.

Table 6:

/>

table 7:

primer name	Primer sequence (5 '. Fwdarw.3')
		L1-TPI1-F	CGTCTCCCCCGGTCCGTTTG
L2-PGIt-R	TAGTCCGCGAGTTGGATAGCC
		L2-ADH1-F	GACAAAGCGCCAAGGAACTGTAATA
L3-CYC1-R	GCGGACTTAGTCCGTTTCT
		L3-tFBA1-F	AACGACGGTAGACGCCAA
L4-tPDC1-R	AGGTTCCAACTGCTCTTACTGT
		L4-PGK1-F	CCAGACGATACAGAGGCTAAGA
L5-tTDH1-R	CGACGAACGAGATACGATAGAAC

Construction of ginsenoside Rb1 engineering bacteria

(1) Construction of glycosyltransferase recombinant plasmids

Amplifying PnUGT 17, pnUGT 35 and PnUGT 87 glycosyltransferase genes from root RNA of pseudo-ginseng through RT-PCR, respectively expressing the genes under the conditions of promoters TDH3, TEF1, ENO2 and terminators TPI1, CYC1 and PDC1, respectively constructing recombinant plasmids G4-P _TDH3 -PnUGT 17-T _TPI1 、G4-P _TEF1 -PnUGT 35-T _CYC1 And G4-P _ENO2 -PnUGT 87-T _PDC1 (see Table 8 for primer information).

(2) Amplifying the functional fragment

The plasmid with correct sequence is used as a template, primers are designed, functional expression fragments of genes are amplified, tag fragments are screened, homologous arms of integration sites are screened (primer information is shown in table 9), and the 5 functional fragments are recovered by glue.

The positive transformants of step (six) of example 9 were picked, cultured and made competent, and 240. Mu.L of PEG3350 (50%), 36. Mu.L of 1.0M LiAc, 10. Mu.L of salmon sperm DNA (10 mg/mL), gene functional fragments up-URA3, P were added _TDH3 -PnUGT 17-T _TPI1 、P _TEF1 -PnUGT 35-T _CYC1 、P _ENO2 -PnUGT 87-T _PDC1 200ng each of Down of URA3, ddH ₂ O is filled up to 360 mu L; resuspension of the bacterial cells in the mixed transformation system, heat shock for 40min at 42 ℃ in a 30 ℃ incubator, coating CM-URA3 flat plate, culturing for 2d, and picking up monoclonal sequencing for verification.

(3) Culture of Rb1 engineering bacteria and extraction of products

Selecting the positive transformant obtained in the step (2), inoculating the positive transformant into a straight bottle of a CM-URA liquid culture medium, culturing for 2d at 30 ℃ and 200rpm, inoculating 1% of the first seed liquid into 50mL of YPD culture medium as first seed liquid, and culturing for 3d at 30 ℃ and 200rpm to obtain fermentation liquor.

Taking 5mL of fermentation liquor, centrifuging at 6000rpm for 5min, collecting thalli, and using ddH for the thalli ₂ O was washed once, cells were resuspended in 0.5mL of lysate (methanol: acetone=1:1), the steel beads of the isophytes were added, the cells were milled with a high throughput mill for 3min, centrifuged at 13000rpm for 5min, the supernatant was filtered with a 0.22 μm filter, and Rb1 and intermediate yields were detected by HPLC.

The HPLC detection conditions were:

the chromatographic column uses Agilent C18; the column temperature is 30 ℃; the ultraviolet wavelength is 203nm; the mobile phase is water and acetonitrile; the flow rate is 1mL/min;

the elution condition is gradient elution, 0min:22.5% acetonitrile, 0-15 min:22.5 to 62.5 percent acetonitrile, 15 to 20 minutes: 62.5% acetonitrile, 20-21 min:62.5 to 90 percent of acetonitrile, 21 to 25 minutes: 90% acetonitrile, 25-26 min:90% -22.5% acetonitrile, 26-28 min:22.5% acetonitrile.

The detection result is shown in figure 40, and the recombinant yeast lysate contains ginsenoside Rb1 monomer and intermediates Rh2, F2, rd and XVII, which shows that 3 glycosyltransferase genes PnUGT 87 and PnUGT 17 and PnUGT 35 are cooperatively expressed, so that the de novo synthesis of ginsenoside Rb1 can be realized.

Table 8:

/>

table 9:

primer name	Primer sequence (5 '. Fwdarw.3')
		Z-up-F	CTAGGGAAGACAAGCAACGA
Z-URA3-R	CTTCTTGTTGTTGACGCTAACATTCAACGCTAGTATGGGTAATAACTGATATAATTAAA
		Z-TDH3-F	AATTAGAGCTTCAATTTAATTATATCAGTTATTACCCATACTAGCGTTGAATGTTAGCG
Z-TPI1-R	TGAGAAGGTTTTGGGACGCTCGAAGGCTTTAATTTGCCTATATAACAGTTGAAATTTGG
		Z-CYC1-F	GAGAAGATGTTCTTATCCAAATTTCAACTGTTATATAGGCAAATTAAAGCCTTCGAGCG
Z-TEF1-R	CTATAGAGTAAAGAACCCTTTCTATACCCGCAGCGTCGAAGTGATCCCCCACACACCAT
		Z-ENO2-F	AGAAACATTTTGAAGCTATGGTGTGTGGGGGATCACTTCGACGCTGCGGGTATAGAAAG
Z-PDC1-R	ATTTTTTTTTTTTCGTCATTATAGAAATCATTACGACCTGTTCCTTAATCAAGGATACC
		Z-down-F	CAAGGAAAAAAAAAGAGGTATCCTTGATTAAGGAACAGGTCGTAATGATTTCTATAATG
Z-down-R	GTCCCAAGGCAGCGTTTTG

Example 10:

according to the procedure of example 3, 3 mutants of glycosyltransferase gene PnUGT 19 are subjected to heterologous expression, the supernatant of the expressed Saccharomyces cerevisiae cell lysate is used as crude enzyme solution for glycosylation reaction, and the cell lysate of the empty vector pYES3 recombinant Saccharomyces cerevisiae is used as a negative control; the specific procedure is the same as the fourth step "in vitro glycosylation reaction and product identification", and the specific reaction is as follows:

(21) In vitro catalytic reaction is carried out by using ginsenoside F1 as a substrate and UDP-glucose as a glycosyl donor and utilizing PnUGT 19 mutant crude enzyme liquid, HPLC (specific results are shown in figure 42) detection shows that the PnUGT 19 mutant crude enzyme liquid detects a new substance, and the retention time of the substance is consistent with that of ginsenoside Rg1, which indicates that the ginsenoside F1 is converted into the ginsenoside Rg1 under the catalysis of the PnUGT 19 mutant crude enzyme liquid.

The reaction formula of reaction (21) is as follows:

The glycosyl donor is UDP-glucose.

The glycosyltransferase has the amino acid sequence shown in SEQ ID NO: 5.

The compounds obtained by substituting R1 and R2 of the substrate of the reaction (21) are shown in Table 10.

Table 10: glycosyltransferase PnUGT 19 mutant catalyzed PPT type saponin

The above embodiments are only exemplary embodiments of the present invention and are not intended to limit the present invention, the scope of which is defined by the claims. Various modifications and equivalent arrangements of parts may be made to the present invention within the spirit and scope of the invention, and such modifications and equivalents should be considered to fall within the scope of the invention.

Sequence listing

<110> academy of sciences in Guangxi province

<120> a group of glycosyltransferase genes and application thereof in preparation of pseudo-ginseng/ginsenoside

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1341

<212> DNA

<213> PnUGT 87

<400> 1

atggatatcg aaaaaggtag aatcagtata gttatgctgc catttttagc ccatggtcac 60

atatctccat tctttgagct agccaagcat ctctcaaaaa gaaattgcaa tatattcctc 120

tgttctaccc caatcaatct tagctccatc aagaacagag tatctgataa ggattcctct 180

gcttctataa aactagtaga gcttcatctt ccatcttccc ctgatcttcc tcctcagtac 240

cacaccacaa atggcctccc ttcccatctc atggtcccac tcaaaaacgc ctttgaaaca 300

gtaggcccca ccttctctga aatccttaaa accttagacc ctgatttgct tatttatgat 360

ttcaatccct catgggcacc ggagatcgct ttgtctcaca atattccggc agtttatttc 420

ctaacctcgg cagcagccac ctcttccgtg gccctacgtg ctttgaaaaa cccaggtgaa 480

aaatacccat ttccagattt ttatgataac agtaatatta cccctgaacc accttctgca 540

gataaaatga agctatttca tgattttgtt gcttgtttca aacgatcttg cgacattatt 600

ttgattaaga gttttagaga actagaaggg aaatatattg atttgctttc cactttatct 660

aagaaaactt tggttcctgt tggtccactc gttcaagatc ctttgggaca tgatgaagat 720

ccaaaaacag ggcatcttat aaactggctt gacaaaaggg ctgaatctac agtggtgttt 780

gtctgctttg gaagtgagta ttttccctcc aatgaggaat tggaagaagt agcaattggg 840

ctagagatta gcatggttaa tttcatattg gctgtgagat ttcttgaagg agagaaaaaa 900

ggggttttac cagaggggtt tgttcaaagg gtaggagaca gaggattggt tgtggagggg 960

tgggctccac aggcaagaat tttaggacat tcaagcaccg gtgggtttgt gagccattgt 1020

gggtggagtt ctattatgga gagtgtgaag tttggggttc cagtaattgc catggccagg 1080

catcttgatc agcctttgaa tgctaagctg gcggcggagg tcggtgtggg catggaggtt 1140

gtgagagatg aaaatgggaa gtataagaga gaagcgattg cagaggtaat aagaaaagtc 1200

gtgatggaga aaaatgggga ggttatcagg aggaaagcaa gggaattgag tgagaaaatg 1260

aaagagacag gagagcaaga gattggtagg gcagtggagg agctagtaca aatttgtaag 1320

atgaagaaag acgcacaata t 1341

<210> 2

<211> 1422

<212> DNA

<213> PnUGT 19

<400> 2

atgaagtcag aattgatatt cgtgcccgtc ccggccatcg gacacctcgt ggggatgatg 60

gagatggcta aacttttcat cagtcgacac gaaaacctct cggtcaccgt cctcatctcg 120

aaattcttca ttgatacggg tatagacaac tacaataaat cactctttgc gaaacctacc 180

ccgcgtctca caattataaa tctcccggaa atcgatcccc aaaaatattt gctcaaacca 240

cgttgcgcca tctttccttc cttcatcgag aatcagaaga cacacgtgcg agacgtaatt 300

tcccgcatga ctcagtccga gtcgactcgg gtcgttggtt tgctggcaga cattttgttc 360

gtcgacatct tcgacattgc cgatgagttc aatgttccaa cttatgtata ctcccctgcc 420

ggagccggtt ttcttggcct cgcgttccac ctccagacac tcaacgacga caaaatgcaa 480

gatgtgaccg agttcaggaa ctcggacact gagttattgg taccgagttt tgcaaacccg 540

gtccccgccg aggtcttgcc gtcgatattt ttggataaag aaggtaggca tgatgttttg 600

ttatcattgt accggaggtg cagggagaca aagggaatta ttgttaacac gtttgaggag 660

ctggaaccct atgcgatcaa ttccctccgg ctggatagta tgatccctcc gatatacccg 720

gtgggaccca tactaaatct caacggtgag ggccaaaact ccgatgaggc tgctgtgatc 780

cttggttggt tagatgatca accaccttca tctgtggtgt ttttgtgctt tggcagcttt 840

ggaagctttc cagaaaacca ggtgaaagag attgcaatgg gtctagagcg cagtgggcat 900

cgcttcttgt ggtccttgcg tccgtatatc tctgaaggtg agacaaagct tcaacttaaa 960

tactcaaatt tggaaacaaa tctcccagcc gacttcttgg ataggacatc atgtctcgga 1020

aaagtgattg gatgggcccc acaaatgtcc gtgctagcac acgaggcagt cggagggttc 1080

gtgtctcatt gtggttggaa ttcggcacta gagagtgtgt ggtatggcat gcctgtcgca 1140

acatggccaa tgtacggtga gcaacaactc aacgcttttg agatagttaa ggagttgggt 1200

cttgcggtgg aaattgaggt ggactatagg aatgaatata acaagactga ttttattgtt 1260

aaggctgacg aaattgagac gaaaataaag aagttgatga tggatggaaa gaatagtgaa 1320

ataaggaaga aggtaaagga aatgaaagaa aagagtaggg ctgccgtgtc agagaatgga 1380

tcatcttata cttctttggc gaaactattt gaggaaatta tg 1422

<210> 3

<211> 1338

<212> DNA

<213> PnUGT 12

<400> 3

atggataacc aagaggctag aatctctatc gtcatgcttc cattcttggc ccacggacac 60

atcagtcctt tcttcgaact tgccaagcat ttgtctaaaa gaaactgcaa tatttttttg 120

tgttctactc caatcaactt gtcttctatt aaaaatagag tttctgataa agactcttct 180

gcttctatca agttggtcga acttcacttg ccatctagtc cagacttgcc tcctcactac 240

cacactacca acggtttgcc aagtcacttg atggtccctt tgaggaacgc ctttgaaacc 300

gccggtccta ccttcagtga aatccttaaa actttgaatc cagatttgct tatctacgac 360

ttcaacccat cttgggcccc agagatcgcc tcttctcaca acatcccagc cgtctgcttc 420

atcattggtg gtgccgcctc tagtagtatg tctttgcatt cttttaagaa tcccggtgaa 480

aaatatcctt tcttggattt cgatgaaaac tctaacatca ccccagagcc tccaagtgcc 540

gataacatga aattgttcct tgacttcatg acttgtttcg agaggagttg tgacatcatc 600

cttatcaagt ctttcagaga attggaagga aaatactttg attttttcag taccctttct 660

gacaagactg tcgtcccagt tggtccattg gttcaagacc caatgggaca caacgaggac 720

ccaaagaccg agcagttcat caactggctt gataagaggg ccgagtctac cgtcgttttt 780

gtctgcttcg gttctgaata tttcttgtct aacgaagaat tggaggaggt cgccatcggt 840

ttggagatta gtatggttaa cttcatctgg gccgttagat ttttggaggg tgagaagaaa 900

ggtgtcttgc cagagggttt cgttcagaga gtcggtgata gaggtcttgt tgtcgaaggt 960

tgggctccac aagctaggat cttgggacac tcttctaccg gaggttttgt cagtcactgt 1020

ggttggtcta gtatcaccga gtctatgaag ttcggtgtcc cagttatcgc catggccaga 1080

cacttcgatc agcctcttaa cggtaaattg gccgctgagg ttggtgtcgg aatggaagtc 1140

gttagagacg agaacggaaa gtacaagagg gaagatatcg ctggtgttat caggaaagtc 1200

gtcgtcgaga agtctggtga ggttattaga aggaaggcca gagaattgag tgagaaaatg 1260

aaggaaaagg gtgaacaaga aatcgatagg gtcgttgagg aacttgtcca gatctgcaag 1320

aaaaaaaaag acgagcaa 1338

<210> 4

<211> 447

<212> PRT

<213> PnUGT 87

<400> 4

Met Ala Ile Gly Leu Gly Ala Ile Ser Ile Val Met Leu Pro Pro Leu

1 5 10 15

Ala His Gly His Ile Ser Pro Pro Pro Gly Leu Ala Leu His Leu Ser

20 25 30

Leu Ala Ala Cys Ala Ile Pro Leu Cys Ser Thr Pro Ile Ala Leu Ser

35 40 45

Ser Ile Leu Ala Ala Val Ser Ala Leu Ala Ser Ser Ala Ser Ile Leu

50 55 60

Leu Val Gly Leu His Leu Pro Ser Ser Pro Ala Leu Pro Pro Gly Thr

65 70 75 80

His Thr Thr Ala Gly Leu Pro Ser His Leu Met Val Pro Leu Leu Ala

85 90 95

Ala Pro Gly Thr Val Gly Pro Thr Pro Ser Gly Ile Leu Leu Thr Leu

100 105 110

Ala Pro Ala Leu Leu Ile Thr Ala Pro Ala Pro Ser Thr Ala Pro Gly

115 120 125

Ile Ala Leu Ser His Ala Ile Pro Ala Val Thr Pro Leu Thr Ser Ala

130 135 140

Ala Ala Thr Ser Ser Val Ala Leu Ala Ala Leu Leu Ala Pro Gly Gly

145 150 155 160

Leu Thr Pro Pro Pro Ala Pro Thr Ala Ala Ser Ala Ile Thr Pro Gly

165 170 175

Pro Pro Ser Ala Ala Leu Met Leu Leu Pro His Ala Pro Val Ala Cys

180 185 190

Pro Leu Ala Ser Cys Ala Ile Ile Leu Ile Leu Ser Pro Ala Gly Leu

195 200 205

Gly Gly Leu Thr Ile Ala Leu Leu Ser Thr Leu Ser Leu Leu Thr Leu

210 215 220

Val Pro Val Gly Pro Leu Val Gly Ala Pro Leu Gly His Ala Gly Ala

225 230 235 240

Pro Leu Thr Gly His Leu Ile Ala Thr Leu Ala Leu Ala Ala Gly Ser

245 250 255

Thr Val Val Pro Val Cys Pro Gly Ser Gly Thr Pro Pro Ser Ala Gly

260 265 270

Gly Leu Gly Gly Val Ala Ile Gly Leu Gly Ile Ser Met Val Ala Pro

275 280 285

Ile Leu Ala Val Ala Pro Leu Gly Gly Gly Leu Leu Gly Val Leu Pro

290 295 300

Gly Gly Pro Val Gly Ala Val Gly Ala Ala Gly Leu Val Val Gly Gly

305 310 315 320

Thr Ala Pro Gly Ala Ala Ile Leu Gly His Ser Ser Thr Gly Gly Pro

325 330 335

Val Ser His Cys Gly Thr Ser Ser Ile Met Gly Ser Val Leu Pro Gly

340 345 350

Val Pro Val Ile Ala Met Ala Ala His Leu Ala Gly Pro Leu Ala Ala

355 360 365

Leu Leu Ala Ala Gly Val Gly Val Gly Met Gly Val Val Ala Ala Gly

370 375 380

Ala Gly Leu Thr Leu Ala Gly Ala Ile Ala Gly Val Ile Ala Leu Val

385 390 395 400

Val Met Gly Leu Ala Gly Gly Val Ile Ala Ala Leu Ala Ala Gly Leu

405 410 415

Ser Gly Leu Met Leu Gly Thr Gly Gly Gly Gly Ile Gly Ala Ala Val

420 425 430

Gly Gly Leu Val Gly Ile Cys Leu Met Leu Leu Ala Ala Gly Thr

435 440 445

<210> 5

<211> 474

<212> PRT

<213> PnUGT 19

<400> 5

Met Leu Ser Gly Leu Ile Pro Val Pro Val Pro Ala Ile Gly His Leu

1 5 10 15

Val Gly Met Met Gly Met Ala Leu Leu Pro Ile Ser Ala His Gly Ala

20 25 30

Leu Ser Val Thr Val Leu Ile Ser Leu Pro Pro Ile Ala Thr Gly Ile

35 40 45

Ala Ala Thr Ala Leu Ser Leu Pro Ala Leu Pro Thr Pro Ala Leu Thr

50 55 60

Ile Ile Ala Leu Pro Gly Ile Ala Pro Gly Leu Thr Leu Leu Leu Pro

65 70 75 80

Ala Cys Ala Ile Pro Pro Ser Pro Ile Gly Ala Gly Leu Thr His Val

85 90 95

Ala Ala Val Ile Ser Ala Met Thr Gly Ser Gly Ser Thr Ala Val Val

100 105 110

Gly Leu Leu Ala Ala Ile Leu Pro Val Ala Ile Pro Ala Ile Ala Ala

115 120 125

Gly Pro Ala Val Pro Thr Thr Val Thr Ser Pro Ala Gly Ala Gly Pro

130 135 140

Leu Gly Leu Ala Pro His Leu Gly Thr Leu Ala Ala Ala Leu Met Gly

145 150 155 160

Ala Val Thr Gly Pro Ala Ala Ser Ala Thr Gly Leu Leu Val Pro Ser

165 170 175

Pro Ala Ala Pro Val Pro Ala Gly Val Leu Pro Ser Ile Pro Leu Ala

180 185 190

Leu Gly Gly Ala His Ala Val Leu Leu Ser Leu Thr Ala Ala Cys Ala

195 200 205

Gly Thr Leu Gly Ile Ile Val Ala Thr Pro Gly Gly Leu Gly Pro Thr

210 215 220

Ala Ile Ala Ser Leu Ala Leu Ala Ser Met Ile Pro Pro Ile Thr Pro

225 230 235 240

Val Gly Pro Ile Leu Ala Leu Ala Gly Gly Gly Gly Ala Ser Ala Gly

245 250 255

Ala Ala Val Ile Leu Gly Thr Leu Ala Ala Gly Pro Pro Ser Ser Val

260 265 270

Val Pro Leu Cys Pro Gly Ser Pro Gly Ser Pro Pro Gly Ala Gly Val

275 280 285

Leu Gly Ile Ala Met Gly Leu Gly Ala Ser Gly His Ala Pro Leu Thr

290 295 300

Ser Leu Ala Pro Thr Ile Ser Gly Gly Gly Thr Leu Leu Gly Leu Leu

305 310 315 320

Thr Ser Ala Leu Gly Thr Ala Leu Pro Ala Ala Pro Leu Ala Ala Thr

325 330 335

Ser Cys Leu Gly Leu Val Ile Gly Thr Ala Pro Gly Met Ser Val Leu

340 345 350

Ala His Gly Ala Val Gly Gly Pro Val Ser His Cys Gly Thr Ala Ser

355 360 365

Ala Leu Gly Ser Val Thr Thr Gly Met Pro Val Ala Thr Thr Pro Met

370 375 380

Thr Gly Gly Gly Gly Leu Ala Ala Pro Gly Ile Val Leu Gly Leu Gly

385 390 395 400

Leu Ala Val Gly Ile Gly Val Ala Thr Ala Ala Gly Thr Ala Leu Thr

405 410 415

Ala Pro Ile Val Leu Ala Ala Gly Ile Gly Thr Leu Ile Leu Leu Leu

420 425 430

Met Met Ala Gly Leu Ala Ser Gly Ile Ala Leu Leu Val Leu Gly Met

435 440 445

Leu Gly Leu Ser Ala Ala Ala Val Ser Gly Ala Gly Ser Ser Thr Thr

450 455 460

Ser Leu Ala Leu Leu Pro Gly Gly Ile Met

465 470

<210> 6

<211> 446

<212> PRT

<213> PnUGT 12

<400> 6

Met Ala Ala Gly Gly Ala Ala Ile Ser Ile Val Met Leu Pro Pro Leu

1 5 10 15

Ala His Gly His Ile Ser Pro Pro Pro Gly Leu Ala Leu His Leu Ser

20 25 30

Leu Ala Ala Cys Ala Ile Pro Leu Cys Ser Thr Pro Ile Ala Leu Ser

35 40 45

Ser Ile Leu Ala Ala Val Ser Ala Leu Ala Ser Ser Ala Ser Ile Leu

50 55 60

Leu Val Gly Leu His Leu Pro Ser Ser Pro Ala Leu Pro Pro His Thr

65 70 75 80

His Thr Thr Ala Gly Leu Pro Ser His Leu Met Val Pro Leu Ala Ala

85 90 95

Ala Pro Gly Thr Ala Gly Pro Thr Pro Ser Gly Ile Leu Leu Thr Leu

100 105 110

Ala Pro Ala Leu Leu Ile Thr Ala Pro Ala Pro Ser Thr Ala Pro Gly

115 120 125

Ile Ala Ser Ser His Ala Ile Pro Ala Val Cys Pro Ile Ile Gly Gly

130 135 140

Ala Ala Ser Ser Ser Met Ser Leu His Ser Pro Leu Ala Pro Gly Gly

145 150 155 160

Leu Thr Pro Pro Leu Ala Pro Ala Gly Ala Ser Ala Ile Thr Pro Gly

165 170 175

Pro Pro Ser Ala Ala Ala Met Leu Leu Pro Leu Ala Pro Met Thr Cys

180 185 190

Pro Gly Ala Ser Cys Ala Ile Ile Leu Ile Leu Ser Pro Ala Gly Leu

195 200 205

Gly Gly Leu Thr Pro Ala Pro Pro Ser Thr Leu Ser Ala Leu Thr Val

210 215 220

Val Pro Val Gly Pro Leu Val Gly Ala Pro Met Gly His Ala Gly Ala

225 230 235 240

Pro Leu Thr Gly Gly Pro Ile Ala Thr Leu Ala Leu Ala Ala Gly Ser

245 250 255

Thr Val Val Pro Val Cys Pro Gly Ser Gly Thr Pro Leu Ser Ala Gly

260 265 270

Gly Leu Gly Gly Val Ala Ile Gly Leu Gly Ile Ser Met Val Ala Pro

275 280 285

Ile Thr Ala Val Ala Pro Leu Gly Gly Gly Leu Leu Gly Val Leu Pro

290 295 300

Gly Gly Pro Val Gly Ala Val Gly Ala Ala Gly Leu Val Val Gly Gly

305 310 315 320

Thr Ala Pro Gly Ala Ala Ile Leu Gly His Ser Ser Thr Gly Gly Pro

325 330 335

Val Ser His Cys Gly Thr Ser Ser Ile Thr Gly Ser Met Leu Pro Gly

340 345 350

Val Pro Val Ile Ala Met Ala Ala His Pro Ala Gly Pro Leu Ala Gly

355 360 365

Leu Leu Ala Ala Gly Val Gly Val Gly Met Gly Val Val Ala Ala Gly

370 375 380

Ala Gly Leu Thr Leu Ala Gly Ala Ile Ala Gly Val Ile Ala Leu Val

385 390 395 400

Val Val Gly Leu Ser Gly Gly Val Ile Ala Ala Leu Ala Ala Gly Leu

405 410 415

Ser Gly Leu Met Leu Gly Leu Gly Gly Gly Gly Ile Ala Ala Val Val

420 425 430

Gly Gly Leu Val Gly Ile Cys Leu Leu Leu Leu Ala Gly Gly

435 440 445

Claims

1. A glycosyltransferase gene, characterized in that: the nucleotide sequence of the glycosyltransferase gene is shown as SEQ ID NOs: 1. 2 or 3.

2. A glycosyltransferase encoded by a glycosyltransferase gene according to claim 1, wherein: the amino acid sequence of the glycosyltransferase is shown as SEQ ID NOs: 4. 5 or 6.

3. A glycosyltransferase mutant characterized by: the sequence represented by SEQ ID NO:4, or a substitution site G107E/T389K/K423T, or a substitution site T389K, or a substitution site D418E, from the amino acid sequence of the gene 4;

Or with SEQ ID NO:5, or substitution site V89I/G355E/A361V/V423D, or substitution site V380A/G408D/P465S.

4. An expression vector, characterized in that: the vector comprising the glycosyltransferase gene of claim 1.

5. A host cell, characterized in that: the host cell contains the vector of claim 4.

6. Use of a glycosyltransferase according to claim 2, wherein: the preparation is used as a catalytic preparation for glycosyl catalytic reaction and is used for catalyzing the tetracyclic triterpene compound to form glycosylated tetracyclic triterpene compound; the catalytic reaction for catalyzing the tetracyclic triterpene compound to form glycosylated tetracyclic triterpene compound is one or more of the following reactions:

(I) Transferring a glycosyl group from a glycosyl donor to a C3-O-Glc site of a tetracyclic triterpene compound to extend a sugar chain;

7. The use of a glycosyltransferase according to claim 6, wherein:

the reaction formula of the catalytic reaction (I) is as follows:

wherein R1, R2, R3 and R4 are H, monosaccharide glycosyl or polysaccharide glycosyl; the glycosyltransferase has the amino acid sequence shown in SEQ ID NO:4, and a polypeptide sequence shown in the figure;

the reaction formula of the catalytic reaction (II) is as follows:

wherein R1 is H, and R2 is monosaccharide glycosyl; r3 is H, R4 is polysaccharide glycosyl; the glycosyltransferase has the amino acid sequence shown in SEQ ID NO:4, and a polypeptide sequence shown in the figure;

the reaction formula of the catalytic reaction (III) is as follows:

wherein R1 is H, R2 is H, monosaccharide glycosyl or polysaccharide glycosyl, R3 is monosaccharide glycosyl, and R4 is H, monosaccharide glycosyl or polysaccharide glycosyl; the glycosyltransferase has the amino acid sequence shown in SEQ ID NO:5, and a polypeptide sequence shown in the figure;

the reaction formula of the catalytic reaction (IV) is as follows:

wherein R1 is monosaccharide glycosyl, R2 is H or monosaccharide glycosyl, R3 is polysaccharide glycosyl, and R4 is H or monosaccharide glycosyl;

8. The use of a glycosyltransferase according to claim 7, wherein: the compound of the formula (I) is saponin CK, and the compound of the formula (II) is gynostemma pentaphylla saponin LXXV;

or, the compound of the formula (I) is notoginsenoside Fe, and the compound of the formula (II) is ginsenoside Rc or saponin Fe-Xyl;

or, the compound of formula (III) is ginsenoside F1, and the compound of formula (IV) is notoginsenoside U;

alternatively, the compound of formula (VII) is ginsenoside Rh1, and the compound of formula (VIII) is notoginsenoside R2;

the glycosyl donor is Uridine Diphosphate (UDP) sugar: UDP-glucose and/or UDP-xylose.

9. Use of the host cell of claim 5, wherein the host cell comprises: an enzyme catalytic reagent for preparing a glycosyl catalyzed reaction, or producing glycosyltransferase, or producing glycosylated tetracyclic triterpene compound.

10. The sequence of SEQ ID NO:1, characterized in that: the glycosyltransferase has the amino acid sequence shown in SEQ ID NO:4, which is used as a catalytic agent for glycosyl catalytic reaction to catalyze ginsenoside F2 to form ginsenoside Rb1.