CN104232723B

CN104232723B - Group of glycosyltransferases and application thereof

Info

Publication number: CN104232723B
Application number: CN201410254022.0A
Authority: CN
Inventors: 周志华; 严兴; 王平平; 魏勇军; 魏维; 范云
Original assignee: Center for Excellence in Molecular Plant Sciences of CAS
Current assignee: Shenghe Everything (Shanghai) Biotechnology Co.,Ltd.
Priority date: 2013-06-07
Filing date: 2014-06-09
Publication date: 2021-03-26
Anticipated expiration: 2034-06-09
Also published as: CN104232723A

Abstract

The invention relates to a group of glycosyltransferases and applications thereof. Specifically, the application of glycosyltransferases gGT25, gGT13, gGT30, gGT25-1, gGT25-3, gGT25-5, gGT29, gGT29-3, gGT29-4, gGT29-5, gGT29-6, gGT29-7, 3GT1, 3GT2, 3GT3, 3GT4 and derived polypeptides in terpenoid glycosylation catalysis and new saponin synthesis is provided, wherein the glycosyltransferases can specifically and efficiently catalyze the C-20 position and/or C-6 position and/or C-3 hydroxyl glycosylation of a tetracyclic triterpene compound substrate and/or transfer glycosyl from a glycosyl donor to the first glycosyl at the C-3 position and C-6 position of the tetracyclic triterpene compound so as to extend sugar chains. The glycosyltransferase can also be used for constructing artificially synthesized rare ginsenoside and a plurality of new ginsenoside and derivatives thereof.

Description

Group of glycosyltransferases and application thereof

Technical Field

The invention relates to the field of biotechnology and plant biology, in particular to glycosyltransferase and application thereof.

Background

Ginsenoside is a general term for saponins separated from ginseng and other congeneric plants (such as panax notoginseng, American ginseng, etc.), belongs to triterpenoid saponin, and is a main effective component in ginseng. At present, at least 60 saponins have been isolated from ginseng, some of which have been shown to have a wide range of physiological functions and medicinal value: including the functions of resisting tumor, regulating immunity, resisting fatigue, protecting heart, protecting liver, etc.

Structurally, ginsenosides are bioactive small molecules formed by glycosylation of sapogenins. The ginsenosides have limited number of sapogenins, mainly protopanaxadiol and protopanaxatriol of dammarane type, and oleanolic acid. In recent years, new sapogenins, 25-OH-PPD and 25-OCH, have been isolated from Panax notoginseng₃PPD, these novel sapogenins all have very good antitumor activity.

After the sapogenin is glycosylated, the water solubility can be improved, and different physiological activities can be generated. The sugar chain of protopanaxadiol-type saponins is typically bound to the hydroxyl group of C3 (and) or C20 of sapogenin. Compared with protopanaxatriol saponin, the protopanaxatriol saponin has one more hydroxyl at C6 position, so the protopanaxatriol saponins found at present are all glycosylated by combining the hydroxyl of C6 (and) or C20, and the protopanaxatriol saponin combined with glycosyl at C3 is not reported. The glycosyl can be glucose, rhamnose, xylose, and arabinose.

The different glycosyl binding sites, sugar chain compositions and lengths make the ginsenoside have great difference in physiological functions and medicinal values. For example, ginsenosides Rb1, Rd and Rc are saponins with protopanaxadiol as the sapogenin, and the difference between them is only the difference in modification of glycosyl, but there are many differences in physiological functions between them. Rb1 has the function of stabilizing the central nervous system, while Rc has the function of inhibiting the central nervous system, Rb1 has a wide range of physiological functions, and Rd has only a limited function.

The structural diversity between ginsenoside sapogenins and saponins is also reflected in the steric structure, and although many chiral carbon atoms exist on the skeleton of the tetracyclic triterpene, the steric structure can be generated mainly at the C20 position. Almost every ginsenoside and sapogenin exists as the epimer at position C20. In ginseng, the content of ginsenoside and sapogenin of S configuration at C20 is much higher than that of ginsenoside and sapogenin of R configuration at C20, so that the ginsenoside and sapogenin refer to ginsenoside and sapogenin of S configuration at C20 in general. However, the epimers of ginsenoside and sapogenin C20 have significantly different physiological activities. For example, S-configuration ginsenoside Rh2 (3-O-beta- (D-glucopyranosyl) -20(S) -protopanaxadiol) can obviously inhibit prostate cancer cells, but the inhibition effect of R-configuration ginsenoside Rh2 (3-O-beta- (D-glucopyranosyl) -20(R) -protopanaxadiol) is poor. The R-configuration ginsenoside Rh2 can selectively inhibit the generation of osteoclast without any cytotoxicity, but the S-configuration ginsenoside Rh2 has weak effect of inhibiting the generation of osteoclast but has strong cytotoxicity to osteoclast. And the regulation effects of S-configuration and R-configuration ginsenoside Rh2 on P-glycoprotein are also greatly different.

The function of glycosyltransferases is to transfer the glycosyl groups on a glycosyl donor (nucleoside diphosphate sugar, e.g., UDP-glucose) to a different glycosyl acceptor. There are currently 94 families of glycosyltransferases, depending on the amino acid sequence. In plant genomes that have been sequenced to date, over a hundred different glycosyltransferases have been found. Glycosyl acceptors for these glycosyltransferases include sugars, lipids, proteins, nucleic acids, antibiotics, and other small molecules. Glycosyltransferase participating in glycosylation of saponin in ginseng has the function of transferring glycosyl on glycosyl donor to hydroxyl of C-3, C-6 or C-20 of sapogenin or aglycone, thereby forming saponin with different medicinal values.

At present, researchers have found a large number of glycosyltransferase genes through transcriptome analysis of ginseng, American ginseng and pseudo-ginseng, but it is not clear which glycosyltransferases are involved in the synthesis of ginsenoside. Since ginseng contains a large amount of glycosyltransferase and its content is low, research on the isolation and purification of ginseng has been slow.

Rare ginsenoside refers to saponin with extremely low content in ginseng. Ginsenoside CK (20-O-beta- (D-glucopyranosyl) -20(S) -protopanaxadiol) belongs to protopanaxadiol saponins, and a glucosyl group is connected to a hydroxyl group at the C-20 position of sapogenin. Ginsenoside CK has very low content in Ginseng radix, and is the main metabolite of protopanaxadiol type saponin produced by microbial hydrolysis in human intestinal tract. Research shows that most protopanaxadiol type saponins can be absorbed by human body only after being metabolized into CK, so that the ginsenoside CK is a real entity directly absorbed and exerted in the body, and other saponins are only prodrugs. Ginsenoside CK has good antitumor activity, and can induce tumor cell apoptosis and inhibit tumor cell metastasis. It can be used in combination with radiotherapy and chemotherapy to enhance the effect of radiotherapy and chemotherapy. In addition, the ginsenoside CK has antiallergic activity and antiinflammatory activity, and can be used for protecting nerve, resisting diabetes and resisting skin aging. The pharmacological activity of the ginsenoside CK has the characteristics of multiple target points, high activity and low toxicity.

Ginsenoside F1 (20-O-beta-D-glucopyranosyl-20 (S) -protopanaxatriol) belongs to protopanaxatriol type saponin, and its content in Ginseng radix is also very low, and belongs to rare ginsenoside. The structure of ginsenoside F1 is very close to CK, and a glucosyl group is also connected to C-20 hydroxyl of sapogenin. Ginsenoside F1 also has unique medicinal value. It has antiaging and antioxidant effects.

Ginsenoside Rh1 (6-O-beta-D-glucopyranosyl-20 (S) -protopanaxatriol) belongs to protopanaxatriol type saponin, and the content of the protopanaxatriol type saponin in ginseng is very low, and the ginsenoside also belongs to rare ginsenoside. Ginsenoside Rh1 has a structure very close to that of F1, but its glycosylation site is the hydroxyl at C6. Ginsenoside Rh1 also has special physiological functions, and has antiallergic and antiinflammatory effects.

Ginsenoside Rh2 (3-O-beta- (D-glucopyranosyl) -20(S) -protopaxadiol) is contained in ginseng in an extremely low amount, and the content of the ginsenoside Rh2 is only about one ten-thousandth of the dry weight of the ginseng, and the ginsenoside Rh2 also belongs to rare ginsenoside. However, ginsenoside Rh2 has good antitumor activity, is one of the most main antitumor active ingredients in ginseng, and can inhibit tumor cell growth, induce tumor cell apoptosis and resist tumor metastasis. Studies have shown that ginsenoside Rh2 can inhibit the proliferation of lung cancer cells3LL (mic), Morris liver cancer cells (rats), B-16 melanomas cells (mic), and HeLa cells (human). In clinic, the ginsenoside Rh2 can be used in combination with radiotherapy or chemotherapy to enhance the effect of radiotherapy and chemotherapy. In addition, ginsenoside Rh2 also has antiallergic, immunity improving, and inflammation inhibiting effects caused by NO and PGE.

The ginsenoside Rg3 has low content in the ginseng, has obvious anti-tumor effect, has complementarity with the ginsenoside Rh2 in the aspect of anti-tumor function, and clinical application proves that the synergistic effect of the combination of Rg3 and Rh2 in treating tumors is further improved.

Because the content of the rare ginsenosides CK, F1, Rh1, Rh2 and Rg3 is very low, the current production method starts from a large amount of saponins in ginseng, and carries out extraction and purification after conversion by a method of selectively hydrolyzing glycosyl. The 20(S) -protopanaxasaponin-Rh 2 is obtained by converting, separating and extracting total saponins or protopanaxadiol saponins of Panax plants as raw materials. The preparation method has the advantages of utilizing a large amount of diol saponins, but needing reaction at high temperature and high pressure (Songchun et al.20 (S) -ginsenoside-Rh 2 preparation method and pharmaceutical composition and application thereof [ P ]. Chinese patent: 1225366, 1999). Korean Ginseng tobacco research institute discloses 2 methods for preparing 20(R & S) -ginsenoside-Rh 2 from ginseng components. The method is characterized in that a protopanaxadiol saponin component is obtained firstly, then 20(R & S) -ginsenoside-Rg 3 is obtained through acid hydrolysis treatment, and then the ginsenoside Rg3 is processed to obtain the ginsenoside Rh2. The above methods have major drawbacks in that the starting material of the product requires protopanaxadiol-series monomeric saponins, so that the reaction steps are complicated, the raw material loss is large, the operation is complicated, the cost is increased, and the yield is difficult to improve. Since the sugar group of CK and F1 at C-20 is easily destroyed during hydrolysis, the chemical method is not suitable for the production of CK and F1. The yield of Rh1 prepared by hydrolyzing saponin with acid method and alkaline method is low, and many byproducts exist.

The enzyme conversion method has the characteristics of mild conditions, strong specificity and easy separation and purification of products, and is the main method for producing CK, F1 and Rh1 at present. The enzymes used for preparing ginsenoside CK, F1, Rh1 and Rh2 mainly comprise naringinase, pectinase, cellulase, lactase and the like. Ginsenoside CK can also be obtained by microbial transformation, mainly using anaerobic bacteria derived from intestinal tract. Although great progress has been made in the biotransformation (enzymatic and microbiological) processes for the preparation of the rare ginsenosides CK, F1, Rh1 and Rh2, the cost of the preparation of CK, F1, Rh1 and Rh2 is still very high and the yields are also rather limited, since the starting material is ginsenoside (Chinese patent: CN 1105781C; King history, et al, proceedings of the university of light industry, Ministry of Japan, 2001).

Because of the important biological activity and great economic value of ginsenoside Rh2, attempts have been made for decades to produce this saponin by chemical synthesis, the basic idea being that it is made by condensation of protopanaxadiol and corresponding sugar, i.e., semi-synthesis (Japanese patent: Japanese Kokai Hei 8-208688,1996). The method uses protopanaxadiol as a raw material to semi-synthesize 20(S) -protopanaxasaponin-Rh 2, the synthesis steps are divided into six steps, equivalent silver carbonate is used as a catalyst in the glycosylation reaction, the price is high, the cost of the method is high, the stereoselectivity of the catalyst is not high, and the product yield is low. Another method comprises substituting C-12 hydroxyl of protopanaxadiol with aromatic acyl or alkyl, adding glucose-based donor with activated C-1 hydroxyl under the protection of organic solvent and inert gas, performing condensation reaction in the presence of molecular sieve and Lewis acid, purifying the product by column chromatography or recrystallization, and removing the protective group to obtain 20(S) -ginsenoside-Rh 2 (Yongzheng et al, 20(S) -ginsenoside-Rh 2, Chinese patent: CN1587273A, 2005)

At present, a method for effectively producing rare ginsenosides CK, F1, Rh1, Rh2 and Rg3 is lacked in the field, so that the development of a plurality of specific and efficient glycosyltransferases is urgently needed.

Disclosure of Invention

The invention aims to provide a group of glycosyltransferases and application thereof.

In a first aspect of the invention, there is provided an in vitro glycosylation method, comprising the steps of:

transferring the glycosyl group of the glycosyl donor to the following sites of the tetracyclic triterpenoid in the presence of a glycosyltransferase:

the C-20, C-6, C-3 or the first glycosyl at C-3, C-6;

thereby forming a glycosylated tetracyclic triterpene compound;

wherein said glycosyltransferase is selected from the group consisting of:

a glycosyltransferase as set forth in SEQ ID nos. 2, 16, 18, 20, 22, 24, 26, 28, 41, 43, 55, 57, 59, or 61.

In a second aspect of the invention, there is provided an isolated polypeptide selected from the group consisting of:

(a) a polypeptide having an amino acid sequence as set forth in any one of SEQ ID nos. 2, 16, 18, 20, 26, 28, 41, 43, 55, 57, 59, or 61;

(b) 2, 16, 18, 20, 26, 28, 41, 43, 55, 57, 59 or 61 by one or more amino acid residue substitution, deletion or addition, or a derivative polypeptide with glycosyltransferase activity formed after adding a signal peptide sequence;

(c) a derivative polypeptide having the sequence of the polypeptide of (a) or (b);

(d) the amino acid sequence is similar to that of SEQ ID NOs: 2. 16, 18, 20, 26, 28, 41, 43, 55, 57, 59 or 61, and having glycosyltransferase activity.

In another preferred embodiment, the sequence (c) is a fusion protein formed by adding a tag sequence, a signal sequence or a secretion signal sequence to (a) or (b).

In another preferred embodiment, the polypeptide is a polypeptide having an amino acid sequence as set forth in SEQ ID Nos. 2, 16, 18, 20, 26, 28, 41, 43, 55, 57, 59, or 61.

In a third aspect of the invention, there is provided an isolated polypeptide selected from the group consisting of:

(a1) a polypeptide having an amino acid sequence as set forth in any one of SEQ ID nos. 22, 24;

(b1) a polypeptide comprising the polypeptide sequence of (a1) in sequence; and/or

The polypeptide is selected from the group consisting of:

(a2) a polypeptide having an amino acid sequence as set forth in any one of SEQ ID nos. 4 or 6;

(b2) a derivative polypeptide which is formed by substituting, deleting or adding one or more amino acid residues of the polypeptide of the amino acid sequence shown in any one of

SEQ ID NOs

4 or 6 or is formed by adding a signal peptide sequence and has glycosyltransferase activity;

(c2) a derivative polypeptide comprising in sequence the polypeptide sequence set forth in (b 2);

(d2) a derivative polypeptide having an amino acid sequence homology of 85% or more (preferably 95% or more) to the amino acid sequence shown in any one of SEQ ID Nos. 4 or 6 and having glycosyltransferase activity.

In another preferred embodiment, the sequence (c2) is a fusion protein formed by adding a tag sequence, a signal sequence or a secretion signal sequence to (a2) or (b 2).

In a fourth aspect of the invention, there is provided an isolated polynucleotide, said polynucleotide being a sequence selected from the group consisting of:

(A) a nucleotide sequence encoding a polypeptide of the first or second aspect;

(B) a nucleotide sequence encoding a polypeptide as set forth in

SEQ ID NOs

2, 4, 6, 16, 18, 20, 22, 24, 26, 28, 41, 43, 55, 57, 59, or 61;

(C) 1, 3, 5, 15, 17, 19, 21, 23, 25, 27, 40, 42, 54, 56, 58, or 60;

(D) a nucleotide sequence having greater than or equal to 95% (preferably greater than or equal to 98%) homology to the sequence shown in SEQ ID Nos. 1, 3, 5, 15, 17, 19, 21, 27, 40, 42, 54, 56, 58 or 60;

(E) a nucleotide sequence formed by truncating or adding 1-60 (preferably 1-30, more preferably 1-10) nucleotides at the 5 'end and/or the 3' end of the nucleotide sequence shown in

SEQ ID NOs

1, 3, 5, 15, 17, 19, 21, 23, 25, 27, 40, 42, 54, 56, 58 or 60;

(F) a nucleotide sequence complementary (preferably completely complementary) to the nucleotide sequence of any one of (A) to (E).

In another preferred embodiment, the nucleotide sequence is as set forth in

SEQ ID NOs

1, 3, 5, 15, 17, 19, 21, 23, 25, 27, 40, 42, 54, 56, 58 or 60.

In another preferred embodiment, the polynucleotide having a sequence as set forth in

SEQ ID NOs

1, 3, 5, 15, 17, 19, 21, 23, 25, 27, 40, 42, 54, 56, 58 or 60 encodes a polypeptide having an amino acid sequence as set forth in

SEQ ID NOs

2, 4, 6, 16, 18, 20, 22, 24, 26, 28, 41, 43, 55, 57, 59 or 61, respectively.

In a fifth aspect of the invention, there is provided a vector comprising the polynucleotide of the third aspect. Preferably, the vector comprises an expression vector, a shuttle vector and an integration vector.

In a sixth aspect of the invention there is provided the use of an isolated polypeptide according to the first or second aspects of the invention for catalysing one or more of the following reactions, or for the preparation of a catalytic formulation for catalysing one or more of the following reactions: transferring a glycosyl group from a glycosyl donor to a hydroxyl at C-20 and/or C-6 and/or C-3 of the tetracyclic triterpenoid to replace the H of the hydroxyl, and transferring a glycosyl group from a glycosyl donor to the first glycosyl group at C-3 or C6 of the tetracyclic triterpenoid to extend a sugar chain.

In another preferred embodiment, the glycosyl donor comprises a nucleoside diphosphate sugar selected from the group consisting of: UDP-glucose, ADP-glucose, TDP-glucose, CDP-glucose, GDP-glucose, UDP-acetylglucose, ADP-acetylglucose, TDP-acetylglucose, CDP-acetylglucose, GDP-acetylglucose, UDP-xylose, ADP-xylose, TDP-xylose, CDP-xylose, GDP-xylose, UDP-galacturonic acid, ADP-galacturonic acid, TDP-galacturonic acid, CDP-galacturonic acid, GDP-galacturonic acid, UDP-galactose, ADP-galactose, TDP-galactose, CDP-galactose, GDP-galactose, UDP-arabinose, ADP-arabinose, TDP-arabinose, CDP-arabinose, GDP-arabinose, UDP-rhamnose, ADP-rhamnose, TDP-rhamnose, CDP-rhamnose, GDP-rhamnose, or other nucleoside hexose or pentose diphosphates, or a combination thereof.

In another preferred embodiment, said glycosyl donor comprises a Uridine Diphosphate (UDP) sugar selected from the group consisting of: UDP-glucose, UDP-galacturonic acid, UDP-galactose, UDP-arabinose, UDP-rhamnose, or other uridine diphosphogliose or uridine diphosphogliose, or a combination thereof.

In another preferred embodiment, the isolated polypeptide is used to catalyze one or more of the following reactions or is used to prepare a catalytic formulation that catalyzes one or more of the following reactions:

compounds of formula (I) Compounds of formula (II)

Wherein R1 is H, monosaccharide glycosyl or polysaccharide glycosyl; r2 and R3 are H or OH; r4 is a glycosyl group; the polypeptide is selected from SEQ ID NO: 2. 16 or 18 or a polypeptide derived therefrom.

In another preferred embodiment, the monosaccharide includes glucose (Glc), rhamnose (Rha), acetyl glucose (Glc (6) Ac), arabinofuranose (Araf), arabinopyranose (Arap), xylose (Xyl), and the like.

In another preferred embodiment, the polysaccharide includes 2-4 monosaccharides such as Glc (2-1) Glc, Glc (6) Ac, Glc (2-1) Rha, Glc (6-1) Arap, Glc (6-1) Xyl, Glc (6-1) Araf, Glc (3-1), Glc (2-1) Glu (6) Ac, Glc (6-1) Arap (4-1) Xyl, Glc (6-1) Arap (2-1) Xyl, or Glc (6-1) Arap (3-1) Xyl.

The compounds substituted with R1-R4 are shown in the following table:

substrate	R1	R2	R3	R4	Product of
						PPD	H	H	OH	Sugar radical	CK
Rh2
		1 sugar radical	H	OH	Sugar radical	F2
Rg3
		2 glycosyl groups	H	OH	Sugar radical	Rd
PPT							H	OH	OH	Sugar radical	F1
	DM	H	H	H	Sugar radical	20-G-DM

That is, when R1 and R2 are both H and R3 is OH, the compound of formula (I) is protopanaxadiol (PPD)

R1 is a glucosyl group, R2 is H, R3 is OH, the compound of formula (I) is ginsenoside RH2

R1 is two glucosyl groups, R2 is H, and R3 is OH, the compound of formula (I) is ginsenoside RG3

R1 is H, R2 is OH, R3 is OH, and the compound of formula (I) is protopanaxatriol (PPT)

R1 is H, R2 is H, R3 is H, the compound of formula (I) Dammarenediol (DM)

Compounds of formula (III) Compounds of formula (IV)

Wherein R1 is H or glycosyl, R2 glycosyl, R3 is glycosyl, the polypeptide is selected from

SEQ ID NOs

2, 16, 18 or 20 or derivative polypeptide thereof;

or, R1 is H or a glycosyl group; r2 is H; r3 is glycosyl, and the polypeptide is selected from SEQ ID NO. 20 or derived polypeptide thereof.

The compounds substituted with R1-R3 are shown in the following table:

substrate	R1	R2	R3	Product of
					F1	H	Sugar radical	Sugar radical	Rg1
PPT	H	H	Sugar radical	Rh1

Namely, when R1 and R2 are both H, the compound of formula (III) is protopanaxatriol (PPT).

When R1 is H and R2 is glucosyl, the compound of formula (III) is ginsenoside F1.

Compounds of formula (V) Compounds of formula (VI)

Wherein R1 is H or OH; r2 is H or OH; r3 is H or a glycosyl group; r4 is a glycosyl group, and the polypeptide is selected from SEQ ID NOs 22, 24, 41 or 43 or a derivative polypeptide thereof.

The compounds substituted with R1-R4 are shown in the following table:

substrate	R1	R2	R3	R4	Product of
						PPD	H	OH	H	Sugar radical	Rh2
CK	H	OH	Sugar radical	Sugar radical	F2
						PPT	OH	OH	H	Sugar radical	3-G-PPT
F1	OH	OH	Sugar radical	Sugar radical	3-G-F1
						DM	H	H	H	Sugar radical	3-G-DM

That is, when R1 and R3 are both H and R2 is OH, the compound of formula (V) is protopanaxadiol (PPD);

when R1 is H, R2 is OH, and R3 is glucosyl, the compound of formula (V) is ginsenoside CK;

when R1 is OH, R2 is OH, and R3 is H, the compound of formula (V) is protopanaxatriol (PPT);

when R1 is OH, R2 is OH, and R3 is glucosyl, the compound of formula (V) is ginsenoside F1;

when R1 is H, R2 is OH, and R3 is H, the compound of formula (V) is Dammarenediol (DM).

When the substrate is PPD, the polypeptide is selected from SEQ ID NOs 22, 24, 41 or 43 or a derivative polypeptide thereof; when the substrate is CK, the polypeptide is selected from SEQ ID NOs 22, 24 or 43 or derived polypeptides thereof; when the substrate is PPT, the polypeptide is selected from SEQ ID NOs 22, 24 or 41 or derived polypeptides thereof; when the substrates are F1 and DM, the polypeptide is selected from SEQ ID NOs 22 or 24 or a derivative polypeptide thereof.

Compounds of formula (VII) Compounds of formula (VIII)

Wherein R1 is OH or OCH₃(ii) a R2 is a glycosyl group, and the polypeptide is selected from SEQ ID NOs 22, 24, 41 or 43 or a derivative polypeptide thereof.

The compounds substituted with R1-R2 are shown in the following table:

substrate	R1	R2	Product of
				25-OH-PPD	OH	Sugar radical	3-G-25-OH-PPD
25-OCH₃-PPD	OCH₃	Sugar radical	3-G-25-OCH₃-PPD

That is, when R1 is OH, the compound of formula (VII) is 25-OH-PPD;

when R1 is OCH, the compound of the formula (VII) is 25-OCH₃-PPD。

Compounds of formula (IX) Compounds of formula (X)

Wherein R1 is a glycosyl group; r2 and R3 are OH or H; r4 is a glycosyl group or H; r5 is glycosyl, R5-R1-O is glycosyl derived from the first glycosyl of C3, and the polypeptide is selected from the group consisting of SEQ ID NOs 26, 28, 55, 57, 59 or 61 or derived polypeptides thereof.

The compounds substituted with R1-R4 are shown in the following table:

substrate	R1	R2	R3	R4	Product of
						Rh2	Sugar radical	H	OH	H	Rg3
F2	Sugar radical	H	OH	Sugar radical	Rd

That is, when R1 is glucosyl; r2 is H, R3 is OH, R4 is H, the compound of formula (IX) is Rh2.

R1 is glucosyl; r2 is H, R3 is OH, R4 is glucosyl, and the compound of formula (IX) is F2.

Compounds of formula (XI) Compounds of formula (XII)

The polypeptide is selected from SEQ ID NO. 22 or SEQ ID NO. 24 or derived polypeptides thereof. The compound of formula (XI) is lanosterol and the compound of formula (XII) is 3-O-beta- (D-glucopyranosyl) -lanosterol.

Compounds of formula (XIII) Compounds of formula (XIV)

Wherein R1 and R2 are H or a glycosyl, and R3 and R4 are glycosyl. R3-R4-O is a glycosyl derived from the first glycosyl of C6, and the polypeptide is selected from SEQ ID NOs.55, 57, 59 or 61 or a polypeptide derived from the polypeptide.

When R1 and R2 are H and R3 is glucosyl, the compound of formula (XIII) is Rh 1.

Compounds of formula (XV) Compounds of formula (XVI)

The polypeptide is selected from SEQ ID NOs 22 or 24 or derived polypeptides thereof. The compound of formula (XV) is Ganoderic acid C2(Ganoderic acid C2), and the compound of formula (XVI) is 3-O-beta- (D-glucopyranosyl) -Ganoderic acid C2.

Compounds of formula (XVII) Compounds of formula (XVIII)

The polypeptide is selected from SEQ ID NOs 22 or 24 or derived polypeptides thereof. The compound of formula (XVII) is Agladupol A (gated acid C2) and the compound of formula (XVIII) is 3-O-. beta. - (D-glucopyranosyl) -Agladupol A.

Compounds of formula (XIX) Compounds of formula (XX)

The polypeptide is selected from SEQ ID NOs 22 or 24 or 41 or 43 or derivative polypeptide thereof. The compound of formula (XVII) is Hispidol B and the compound of formula (XVIII) is 3-O-beta- (D-glucopyranosyl) -Hispidol B.

Compounds of formula (XXI) Compounds of formula (XXII)

The polypeptide is selected from SEQ ID NOs 22 or 24 or 41 or derived polypeptides thereof. The compound of formula (XXI) is 24(R) -Cycloartane-3beta,24,25-triol and the compound of formula (XXII) is 3-O-beta- (D-glucopyranosyl) -24(R) -Cycloartane-3beta,24, 25-triol.

In another preferred embodiment, said glycosyl is selected from the group consisting of: glucosyl, galacturonic acid, galactosyl, arabinosyl, rhamnosyl, and other hexose or pentose groups.

In another preferred embodiment, the compounds of formula (I), (III), (V), (VII), (IX), (XI), (XIII), (XV), (XVII), (XIX) or (XXI) of the reaction include, but are not limited to: an S-configuration or R-configuration dammarane-type tetracyclic triterpene compound, a lanoline-type tetracyclic triterpene compound, an apotorucane-type tetracyclic triterpene compound, a euphorbiane-type tetracyclic triterpene compound, a cycloartenane (cycloartane) -type tetracyclic triterpene compound, a cucurbitane tetracyclic triterpene compound, or a meliane-type tetracyclic triterpene compound.

In another preferred embodiment, the polypeptide is selected from the group consisting of:

(d) the amino acid sequence is similar to SEQ ID NO: 2. 16, 18, 20, 26, 28, 41, 43, 55, 57, 59 or 61, and having glycosyltransferase activity.

The polypeptide is selected from the group consisting of:

SEQ ID NOs

In another preferred embodiment, the polynucleotide encoding the nucleotide sequence of the polypeptide is a sequence selected from the group consisting of:

(A) a nucleotide sequence encoding a polypeptide according to the first or second aspect of the invention;

(B) a nucleotide sequence encoding a polypeptide as set forth in

SEQ ID NOs

2, 4, 6, 16, 18, 20, 22, 24, 26, 28, 41, 43, 55, 57, 59, or 61;

(C) 1, 3, 5, 15, 17, 19, 21, 23, 25, 27, 40, 42, 54, 56, 58, or 60;

(D) a nucleotide sequence having greater than or equal to 95% (preferably greater than or equal to 98%) homology to the sequence shown in SEQ ID Nos. 1, 3, 5, 15, 17, 19, 21, 23, 25, 27, 40, 42, 54, 56, 58 or 60;

SEQ ID NOs

1, 3, 5, 15, 17, 19, 21, 23, 25, 27, 40, 42, 54, 56, 58 or 60;

In another preferred embodiment, the nucleotide sequence is as set forth in

SEQ ID NOs

1, 3, 5, 15, 17, 19, 21, 23, 25, 27, 40, 42, 54, 56, 58 or 60.

SEQ ID NOs

2, 4, 6, 16, 18, 20, 22, 24, 26, 28, 41, 43, 55, 57, 59 or 61, respectively.

In a seventh aspect of the present invention, there is provided a method of performing a glycosyltransfer catalysis reaction, comprising the steps of: the glycosyltransfer catalytic reaction is carried out in the presence of a polypeptide according to the second or third aspect of the invention or a polypeptide derived therefrom.

In another preferred embodiment, the method further comprises the steps of:

converting said compound of formula (I) to said compound of formula (II), or formula (III) to said compound of formula (IV), or formula (V) to said compound of formula (VI), or formula (VII) to said compound of formula (VIII), or formula (ix) to said compound of formula (X), or formula (XI) to said compound of formula (XII), in the presence of a glycosyl donor and a polypeptide and polypeptide derivative thereof as described in the second or third aspects of the invention;

in another preferred embodiment, the method further comprises adding the polypeptide and its derivative polypeptide to a catalytic reaction respectively; and/or

The polypeptide and its derivative polypeptide are added into catalytic reaction at the same time.

In another preferred embodiment, the method further comprises converting the compound of formula (I) to a compound of formulae (IV), (VI), (VIII), (X) and (XIV), or converting the compound of formula (III) to a compound of formulae (II), (VI), (VIII), (X) and (XIV), in the presence of a glycosyl donor and two or more polypeptides selected from the polypeptides of the second and third aspects of the invention and polypeptides derived therefrom; or the compound of the formula (V) is converted into a compound of the formulae (II), (IV), (VIII), (X) and (XIV), or the compound of the formula (VII) is converted into a compound of the formulae (II), (IV), (VI), (X) and (XIV), or (IX) is converted into a compound of the formulae (II), (IV), (VI), (VIII) and (XIV), or (XIII) is converted into a compound of the formulae (II), (IV), (VI), (VIII), (X).

In another preferred embodiment, the method further comprises co-expressing a nucleotide sequence encoding a glycosyltransferase with a key gene in the anabolic pathway of dammarenediol and/or protopanaxadiol and/or protopanaxatriol in a host cell to obtain the compound of formula (II), (IV), (VI), (VIII), (X), (XII) or (XIV).

In another preferred embodiment, the host cell is yeast or E.coli.

In another preferred embodiment, the polypeptide is a polypeptide having an amino acid sequence as set forth in SEQ ID nos. 2, 4, 6, 16, 18, 20, 22, 24, 26, 28, 41, 43, 55, 57, 59, or 61 and derivatives thereof.

In another preferred embodiment, the nucleotide sequence encoding the polypeptide is as set forth in

SEQ ID NOs

1, 3, 5, 15, 17, 19, 21, 23, 25, 27, 40, 42, 54, 56, 58 or 60.

In another preferred example, the method further comprises: an additive for regulating the activity of the enzyme is provided to the reaction system.

In another preferred embodiment, the additive for regulating the enzyme activity is: additives for increasing or inhibiting the activity of an enzyme.

In another preferred embodiment, the additive for regulating the enzymatic activity is selected from the group consisting of: ca²⁺、Co²⁺、Mn²⁺、Ba²⁺、Al³⁺、Ni²⁺、Zn²⁺Or Fe²⁺。

In another preferred embodiment, the additive for regulating the enzyme activity is: can generate Ca²⁺、Co²⁺、Mn²⁺、Ba²⁺、Al³⁺、Ni²⁺、Zn²⁺Or Fe²⁺The substance of (1).

In another preferred embodiment, the glycosyl donor is a nucleoside diphosphate sugar selected from the group consisting of: UDP-glucose, ADP-glucose, TDP-glucose, CDP-glucose, GDP-glucose, UDP-acetylglucose, ADP-acetylglucose, TDP-acetylglucose, CDP-acetylglucose, GDP-acetylglucose, UDP-xylose, ADP-xylose, TDP-xylose, CDP-xylose, GDP-xylose, UDP-galacturonic acid, ADP-galacturonic acid, TDP-galacturonic acid, CDP-galacturonic acid, GDP-galacturonic acid, UDP-galactose, ADP-galactose, TDP-galactose, CDP-galactose, GDP-galactose, UDP-arabinose, ADP-arabinose, TDP-arabinose, CDP-arabinose, GDP-arabinose, UDP-rhamnose, ADP-rhamnose, TDP-rhamnose, CDP-rhamnose, GDP-rhamnose, or other nucleoside hexose or pentose diphosphates, or a combination thereof.

In another preferred embodiment, said glycosyl donor is a uridine diphosphate sugar selected from the group consisting of: UDP-glucose, UDP-galacturonic acid, UDP-galactose, UDP-arabinose, UDP-rhamnose, or other uridine diphosphogliose or uridine diphosphogliose, or a combination thereof.

In another preferred embodiment, the pH of the reaction system is: pH4.0-10.0, preferably pH 5.5-9.0.

In another preferred embodiment, the temperature of the reaction system is: 10 ℃ to 105 ℃, preferably 20 ℃ to 50 ℃.

In another preferred embodiment, the key genes in the dammarenediol anabolic pathway include (but are not limited to): dammarenediol synthetase gene.

In another preferred embodiment, the key genes in the anabolic pathway of protopanaxadiol include (but are not limited to): a dammarenediol synthase gene, a cytochrome P450CYP716a47 gene, and a reductase gene of P450CYP716a47, or a combination thereof.

In another preferred embodiment, the key genes in the anabolic pathway of protopanaxatriol include (but are not limited to): dammarenediol synthetase gene, cytochrome P450CYP716A47 gene, reductase gene of P450CYP716A47 gene, cytochrome P450CYP716A53V2 gene and reductase gene thereof, or combination thereof.

In another preferred embodiment, the substrate for the glycosyl-catalyzed reaction is a compound of formula (I), (III), (V), (VII), (IX), (XI), (XIII), (XV), (XVII), (XIX) or (XXI), and the substrate is a compound of formula (II), (IV), (VI), (VIII), (X), (XII), (XIV), (XVI), (XVIII), (XX) or (XXII);

in another preferred embodiment, the compound of formula (I) is protopanaxadiol ppd (protopanaxadiol), and the compound of formula (II) is ginsenoside CK (20-O- β - (D-glucopyranosyl) -protopanaxadiol));

or, the compound of formula (I) is ginsenoside Rh2(3-O- β - (D-glucopyranosyl) -protopanaxadiol)), and the compound of formula (II) is ginsenoside F2(3-O- β - (D-glucopyranosyl) -20-O- β - (D-glucopyranosyl) -protopanaxadiol));

or, the compound of formula (I) is ginsenoside Rg3, and the compound of formula (II) is ginsenoside Rd;

or, the compound of formula (I) is protopanaxatriol PPT (Protopanaxatriol), and the compound of formula (II) is ginsenoside F1 (20-O-beta- (D-glucopyranosyl) -protopanaxatriol));

or, the compound of formula (I) is Dammarenediol DM (Dammarenediol II), and the compound of formula (II) is ginsenoside 20-O-beta- (D-glucopyranosyl) -Dammarenediol (20-O-beta- (D-glucopyranosyl) -Dammarenediol II;

or, the compound of formula (III) is protopanaxatriol PPT, and the compound of formula (IV) is ginsenoside Rh1 (6-O-beta- (D-glucopyranosyl) -protopanaxatriol));

or, the compound of formula (III) is ginsenoside F1, and the compound of formula (IV) is ginsenoside Rg1 (6-O-beta- (D-glucopyranosyl) -20-O-beta- (D-glucopyranosyl) -protopanaxadiol));

or, the compound of formula (V) is protopanaxadiol, and the compound of formula (VI) is ginsenoside Rh2 (3-O-beta- (D-glucopyranosyl) -protopanaxadiol));

or, the compound of formula (V) is CK, and the compound of formula (VI) is ginsenoside F2(3-O- β - (D-glucopyranosyl) -20-O- β - (D-glucopyranosyl) -protopanaxadiol));

or, the compound of formula (V) is protopanaxatriol PPT, and the compound of formula (VI) is ginsenoside 3-O-beta- (D-glucopyranosyl) -protopanaxatriol (3-O-beta- (D-glucopyranosyl) -protopanaxatriol);

or, the compound of formula (V) is ginsenoside F1, and the compound of formula (VI) is ginsenoside 3-O-beta- (D-glucopyranosyl) -F1 (3-O-beta- (D-glucopyranosyl) -F1);

or, the compound of formula (V) is Dammarenediol DM, and the compound of formula (VI) is ginsenoside 3-O-beta- (D-glucopyranosyl) -Dammarenediol (3-O-beta- (D-glucopyranosyl) -Dammarenediol II);

or, the compound of formula (VII) is 25-OH-protopanaxadiol (25-OH-protopanaxadiol), and the compound of formula (VIII) is ginsenoside 3-O- β - (D-glucopyranosyl) -25-OH-protopanaxadiol (3-O- β - (D-glucopyranosyl) -25-OH-protopanaxadiol);

or, the compound of the formula (VII) is 25-OCH₃-protopanaxadiol (25-OCH)₃-protopanaxadiol), and the compound of formula (VIII) is ginsenoside 3-O- β - (D-glucopyranosyl) -25-OCH₃-protopanaxadiol (3-O-beta- (D-glucopyranosyl) -25-OCH₃-protopanaxadiol)；

Or, the compound of formula (IX) is ginsenoside Rh2, and the compound of formula (X) is ginsenoside Rg 3;

or, the compound of formula (IX) is ginsenoside F2 and the compound of formula (X) is ginsenoside Rd;

or, the compound of formula (XI) is lanosterol (lanosterol), and the compound of formula (XII) is 3-O- β - (D-glucopyranosyl) -lanosterol (3-O- β - (D-glucopyranosyl) -lanosterol;

or, the compound of formula (XIII) is ginsenoside Rh1 and the compound of formula (XIV) is ginsenoside Rf;

or, the compound of formula (XV) is Ganoderic acid C2(Ganoderic acid C2), and the compound of formula (XVI) is 3-O- β - (D-glucopyranosyl) -Ganoderic acid C2(3-O- β - (D-glucopyranosyl) -Ganoderic acid C2);

or, the compound of formula (XVII) is Agladupol A, and the compound of formula (XVIII) is 3-O-beta- (D-glucopyranosyl) -Agladupol A (3-O-beta- (D-glucopyranosyl) -Agladupol A);

or, the compound of formula (XIX) is Hispidol B, and the compound of formula (XX) is 3-O-beta- (D-glucopyranosyl) -Hispidol B (3-O-beta- (D-glucopyranosyl) -Hispidol B);

or, the compound of formula (XXI) is 24(R) -cyclobornane-3 beta,24,25-triol (24(R) -Cycloartane-3beta,24,25-triol), and the compound of formula (XXII) is 3-O-beta- (D-glucopyranosyl) -24(R) -cyclobornane-3 beta,24,25-triol (3-O-beta- (D-glucopyranosyl) -24(R) -Cycloartane-3beta,24, 25-triol).

In an eighth aspect of the invention there is provided a genetically engineered host cell comprising a vector according to the fifth aspect of the invention, or having integrated into its genome a polynucleotide according to the fourth aspect of the invention.

In another preferred embodiment, the glycosyltransferase is a polypeptide as described in the second or third aspect of the invention or a polypeptide derived therefrom.

In another preferred embodiment, the nucleotide sequence encoding said glycosyltransferase is according to the fourth aspect of the present invention.

In another preferred embodiment, the cell is a prokaryotic cell or a eukaryotic cell.

In another preferred embodiment, the host cell is a eukaryotic cell, such as a yeast cell or a plant cell.

In another preferred embodiment, the host cell is a Saccharomyces cerevisiae cell.

In another preferred embodiment, the host cell is a prokaryotic cell, such as E.coli.

In another preferred embodiment, the host cell is a ginseng cell.

In another preferred embodiment, the host cell is not a cell which naturally produces a compound of formula (II), (IV), (VI), (VIII), (X), (XII).

In another preferred embodiment, said host cell is not naturally occurring rare ginsenoside CK and/or rare ginsenoside F1 and/or rare ginsenoside Rh2 and/or Rg3 and/or Rh1, and/or novel ginsenosides 20-O-beta- (D-glucopyranosyl) -dammarendiolII, 3-O-beta- (D-glucopyranosyl) -PPT, 3-O-beta- (D-glucopyranosyl) -F1, 3-O-beta- (D-glucopyranosyl) -DM, 3-O-beta-D-glucopyranosyl) -25-OH-PPD, 3-O-beta- (D-glucopyranosyl) -25-OCH₃PPD, and/or Rh1, F2, Rd and Rg1 and the like.

In another preferred embodiment, the host cell contains key genes in the protopanaxadiol anabolic pathway including (but not limited to): a dammarenediol synthase gene, a cytochrome P450CYP716a47 gene, and a reductase gene of P450CYP716a47, or a combination thereof.

In another preferred embodiment, the host cell contains key genes in the protopanaxatriol anabolic pathway including (but not limited to): a dammarenediol synthase gene, a cytochrome P450CYP716a47 gene, a reductase gene of P450CYP716a47, and a cytochrome P450CYP716a53V2 gene, or a combination thereof.

In a ninth aspect the invention provides the use of a host cell as described in the eighth aspect for the preparation of an enzyme-catalysed reagent, or for the production of a glycosyltransferase, or as a catalytic cell, or for the production of a compound of formula (II), (IV), (VI), (VIII), (X), (XII), (XIV), (XVI), (XVIII), (XXII), (XX) or (XXII).

In another preferred embodiment, the host cell is used for producing the neosaponin 20-O-beta- (D-glucopyranosyl) -dammarandiol II and/or 3-O-beta- (D-glucopyranosyl) -dammarandiol II, 3-O-beta- (D-glucopyranosyl) -protopanaxatriol, 3-O-beta- (D-glucopyranosyl) -F1 and/or rare ginsenoside CK and/or rare ginsenoside F1 and/or rare ginsenoside Rh1 and/or ginsenoside Rh2 and/or rare ginsenoside Rg3 by glycosylation reaction of dammar-Diol (DM) and/or protopanaxadiol (PPD) and/or protopanaxatriol (PPT).

In a tenth aspect of the present invention, there is provided a method of producing a transgenic plant, comprising the steps of: regenerating the genetically engineered host cell of the eighth aspect into a plant, and the genetically engineered host cell is a plant cell.

In another preferred embodiment, the genetically engineered host cell is a ginseng cell.

It is to be understood that within the scope of the present invention, the above-described features of the present invention and those specifically described below (e.g., in the examples) may be combined with each other to form new or preferred embodiments. Not to be reiterated herein, but to the extent of space.

Drawings

The following drawings are included to illustrate specific embodiments of the invention and are not intended to limit the scope of the invention as defined by the claims.

FIG. 1 shows agarose gel electrophoresis patterns of PCR products of gGT25 gene, gGT25-1 gene, gGT25-3 gene and gGT25-5 gene.

FIG. 2 shows the expression of gGT25, gGT25-1, gGT25-3 and gGT25-5 in Saccharomyces cerevisiae, detected by SDS-PAGE; lane 1, electrophoresis results of the protein Marker (molecular weight of 200, 116, 97.2, 66.4, 44.3kDa from top to bottom); lane 2, supernatant of lysate of gt25-pYES2 yeast recombinant; lane 3, lysate supernatant of gt25-1-pYES2 yeast recombinant; lane 4, lysate supernatant of gt25-3-pYES2 yeast recombinant; lane 5, lysate supernatant of gt25-5-pYES2 yeast recombinant; lane 6, supernatant of lysates from empty vector recombinants of pYES 2.

FIG. 3 shows the expression of gGT25, gGT25-1, gGT25-3 and gGT25-5 genes in Saccharomyces cerevisiae detected by Western Blot; lane 1, supernatant of lysate of gt25-pYES2 yeast recombinant; lane 2, supernatant of lysate of gt25-1-pYES2 yeast recombinant; lane 4, lysate supernatant of gt25-3-pYES2 yeast recombinant; lane 5, lysate supernatant of gt25-5-pYES2 yeast recombinant; lane 3, supernatant of lysates from empty vector recombinants of pYES 2.

FIG. 4 shows the expression of gGT13 and gGT30 in Saccharomyces cerevisiae detected by SDS-PAGE; lane 1, supernatant of lysate of gt30-pYES2 yeast recombinant; lane 2, supernatant of lysate of gt13-pYES2 yeast recombinant; lane 3, supernatant of lysate of empty vector pYES2 recombinant.

FIG. 5 shows Western Blot to detect gGT13 and gGT30 expression in Saccharomyces cerevisiae; lane 1, supernatant of lysate of gt30-pYES2 yeast recombinant; lane 2, supernatant of lysate of gt13-pYES2 yeast recombinant; lane 3, supernatant of lysate of empty vector pYES2 recombinant.

FIG. 6 shows TLC detection patterns of products of protopanaxadiol and protopanaxadiol-type saponins catalyzed by glycosyltransferases gGT25, gGT25-1 and gGT 25-3. Lane 25, gGT25 crude enzyme (gt25-pYES2 yeast recombinant lysis supernatant); lane 25-1, gGT25-1 crude enzyme solution (gt25-1-pYES2 yeast recombinant lysis supernatant); lane 25-3, gGT25-3 crude enzyme solution (gt25-3-pYES2 yeast recombinant lysis supernatant); lane "-", negative control, lysate supernatant of empty vector yeast instead of enzyme solution; lane M, mixed standard of protopanaxadiol and protopanaxadiol-type saponins.

FIG. 7 shows TLC detection patterns of products of protopanaxatriol and protopanaxatriol-type saponin catalyzed by glycosyltransferases gGT25, gGT25-1, gGT25-3 and gGT 25-5; lane M, mixed standard sample of protopanaxatriol (PPT) and protopanaxatriol-type saponin; lane 25, gGT25 crude enzyme (gt25-pYES2 yeast recombinant lysis supernatant); lane 25-1, gGT25-1 crude enzyme solution (gt25-1-pYES2 yeast recombinant lysis supernatant); lane 25-3, gGT25-3 crude enzyme solution (gt25-3-pYES2 yeast recombinant lysis supernatant); lane 25-5, gGT25-5 crude enzyme (gt25-5-pYES2 yeast recombinant lysis supernatant); lane "-", negative control, empty vector recombinant yeast lysis instead of enzyme solution.

FIG. 8 shows TLC patterns of detection of products of dammarenediol catalyzed by glycosyltransferases gGT25, gGT25-1 and gGT 25-3. Lane 25, gGT25 crude enzyme (gt25-pYES2 yeast recombinant lysis supernatant); lane 25-1, gGT25-1 crude enzyme solution (gt25-1-pYES2 yeast recombinant lysis supernatant); lane 25-3, gGT25-3 crude enzyme solution (gt25-3-pYES2 yeast recombinant lysis supernatant); lane "-", negative control, empty vector yeast lysis instead of enzyme solution; lane M, standard sample Dammarenediol (DM).

FIG. 9 shows TLC patterns of detection of products of protopanaxadiol and triol catalyzed by glycosyltransferases gGT13 and gGT 30; lane M1, protopanaxadiol saponin pool standard; lane M2, protopanaxatriol saponin mix standard sample; lane 1, gGT13 crude enzyme solution catalyzes protopanaxadiol; lane 2, gGT30 crude enzyme catalyzes protopanaxadiol; lane 3, negative control, ddH2O instead of enzyme solution; lane 4, gGT13 crude enzyme catalysis protopanaxatriol; lane 5, gGT30 crude enzyme catalysis protopanaxatriol; lane 6, negative control, ddH2O instead of enzyme solution.

FIG. 10 shows that glycosyltransferase gGT25 catalyzes the product HPLC detection of protopanaxadiol, second row sample: mixed standard samples of protopanaxadiol (PPD) and various saponins (CK, Rh2, F2, Rg 3); sample in the first row: gGT25 PPD catalyzed by crude enzyme; third row sample: negative control 1, the empty vector recombinant yeast lysate catalyzes PPD; fourth row sample: negative control 2, dH 2O.

FIG. 11 shows that glycosyltransferase gGT25 catalyzes the product HPLC detection of protopanaxatriol, second row sample: mixed standard samples of protopanaxatriol (PPT) and various triol saponins (F1, Rh1, Rg 1); sample in the first row: gGT25 catalyzing PPT by crude enzyme liquid; third row sample: negative control 1, the empty vector recombinant yeast lysate catalyzes PPT;

FIG. 12 shows LC/MS detection of protopanaxadiol product catalyzed by glycosyltransferase gGT25, showing the mass spectrum of peak 2 (product peak) and standard CK sample in FIG. 10.

FIG. 13 shows LC/MS detection of protopanaxatriol product catalyzed by glycosyltransferase gGT25, showing the mass spectra of Peak 1 (product Peak) and Standard F1 samples in FIG. 11.

Fig. 14 shows expression of gGT25-pET28a in e.coli BL21 as detected by Western Blot; lanes 1-3 are total protein, supernatant and pellet after 50uM IPTG induction, respectively.

FIG. 15 shows the product TLC check pattern of gGT25-pET28a recombinant E.coli cell lysate in vitro catalyzed PPD; lane 1, standard sample mixture of PPD and CK; lane 2, gGT25-pET28a after induction of recombinant E.coli (50. mu.M IPTG) the supernatant of the cell lysate catalyzes PPD.

FIG. 16 shows HPLC detection of cell lysate extract of CK-producing engineered yeast A, first row of samples: a mixed standard sample of protopanaxadiol (PPD), dammarenediol, and CK; second row of samples: producing CK yeast engineering bacteria A cell lysate; third row sample: negative control 1, lysate of yeast starting strain.

FIG. 17 shows the HPLC detection of products of protopanaxatriol catalyzed by glycosyltransferase gGT25-5, sample in line one: mixed standard samples of protopanaxatriol (PPT) and various triol saponins (F1, Rh1, Rg1 and Re); second row of samples: gGT25-5 catalyzing the product after PPT by crude enzyme liquid.

FIG. 18 shows the product LC/MS detection of protopanaxatriol catalyzed by glycosyltransferase gGT25-5, showing the mass spectra of the P1 peak (product Rh1 peak) and Rh1 standard sample in FIG. 17.

FIG. 19 shows agarose gel electrophoresis detection profiles of PCR products of (a)3GT1 and 3GT2, (b)3GT3 and (c)3GT4 genes.

FIG. 20 shows SDS-PAGE detection of expression of (a)3GT1 and 3GT2, (b)3GT3 and (c)3GT4 genes in E.coli; (a) lane 1, total protein in lysate of pet28a empty vector e.coli recombinants; lane 2, lysate supernatant of the E.coli recombinant 3GT1-pet28 a; lane 3, lysate pellet of the 3GT1-pet28a E.coli recombinant; lane 4, total protein of the 3GT1-pet28a E.coli recombinants; (ii) a Lane 5, lysate supernatant of the E.coli recombinant 3GT2-pet28 a; lane 6, lysate pellet of the E.coli recombinant 3GT2-pet28 a; lane 7, total protein of the 3GT2-pet28a E.coli recombinants; lane 8, protein molecular weight Marker (b) lane 1, protein molecular weight Marker; lane 2, lysate supernatant of the E.coli recombinant 3GT3-pET28 a; lane 3, lysate pellet of the E.coli recombinant 3GT3-pET28 a; lane 4, total protein of lysate of 3GT3-pET28a E.coli recombinants; (c) lane 1, 3GT4-pET28a total protein of lysate of E.coli recombinants; lane 2, lysate pellet of the E.coli recombinant 3GT4-pET28 a; lane 3, lysate supernatant of the E.coli recombinant 3GT4-pET28 a; lane 4, lysate of pet28a empty vector e.coli recombinant; lane 5, protein molecular weight Marker. The arrow points to the location of the protein of interest.

FIG. 21 shows Western Blot assay for the expression of (a)3GT1 and 3GT2, (b)3GT3 and (c)3GT4 genes in E.coli; (a) lane 1, total protein in lysate of pet28a empty vector e.coli recombinants; lane 2, lysate supernatant of the E.coli recombinant 3GT1-pet28 a; lane 3, lysate pellet of the 3GT1-pet28a E.coli recombinant; lane 4, total protein of the 3GT1-pet28a E.coli recombinants; (ii) a Lane 5, lysate supernatant of the E.coli recombinant 3GT2-pet28 a; lane 6, lysate pellet of the E.coli recombinant 3GT2-pet28 a; lane 7, total protein of the 3GT2-pet28a E.coli recombinants; (b) lane 1, lysate supernatant of the E.coli recombinant 3GT3-pET28 a; lane 2, lysate pellet of the E.coli recombinant 3GT3-pET28 a; lane 3, total protein of lysate of 3GT3-pET28a E.coli recombinants; (c) lane 1, 3GT4-pET28a total protein of lysate of E.coli recombinants; lane 2, lysate pellet of the E.coli recombinant 3GT4-pET28 a; lane 3, lysate supernatant of the E.coli recombinant 3GT4-pET28 a; lane 4, lysate of empty vector E.coli recombinants at pet28 a.

FIG. 22 shows TLC detection patterns of products of protopanaxadiol and CK catalyzed by glycosyltransferases 3GT1 and 3GT 2. Lane 1, protopanaxadiol-type saponin standard, lane 2, glycosyltransferase 3GT1 catalyzes the production of Rh2 from protopanaxadiol; lane 3, glycosyltransferase 3GT1 catalyzed ginsenoside CK to F2; lane 4, glycosyltransferase 3GT2 catalyzes the production of Rh2 from protopanaxadiol; lane 5, glycosyltransferase 3GT2 catalyzes the production of F2 from ginsenoside CK.

FIG. 23 shows the product TLC detection patterns of glycosyltransferases 3GT1 and 3GT2 catalyzing Dammarenediol (DM) and 25-OH-PPD (A)3GT1 crude enzyme solution (3GT1-pet28a E.coli recombinant lysis supernatant) catalyzing Dammarenediol (DM) and 25-OH-PPD. Lane 1, 25-OH-PPD standard, lane 2, 3GT1 crude enzyme catalyzes the formation of 3-O- β - (D-glucopyranosyl) -25-OH-protopaxadiol from 25-OH-PPD; lane 3, dammarenediol standard; lane 4, 3GT1 crude enzyme catalyzes the production of 3-O- β - (D-glucopyranosyl) -dammarendiolII from dammarenediol; (B) crude enzyme solution of 3GT 2(3 GT2-pet28a Escherichia coli recombinant lysis supernatant) catalyzes Dammarenediol (DM) and 25-OH-PPD. Lane 1, 25-OH-PPD standard, lane 2, 3GT2 crude enzyme catalyzes the formation of 3-O- β - (D-glucopyranosyl) -25-OH-protopaxadiol from 25-OH-PPD; lane 3, dammarenediol standard; lane 4, 3GT2 shows crude enzyme catalyzing dammarenediol to generate 3-O-beta- (D-glucopyranosyl) -dammarendiolII.

FIG. 24 shows that glycosyltransferases 3GT1 and 3GT2 catalyze the TLC detection of products of PPT and F1, and crude enzyme solutions of lanes 1 and 3GT 1(3 GT1-pet28a E.coli recombinant lysis supernatant) catalyze the production of 3-O- β - (D-glucopyranosyl) -protopanaxatriol from PPT; lane 2, 3GT1 shows that crude enzyme catalyzes the generation of 3-O-beta- (D-glucopyranosyl) -F1 from F1; lane 3, 3GT2 crude enzyme (3GT2-pet28a E.coli recombinant lysate supernatant) catalyzes PPT to generate 3-O-beta- (D-glucopyranosyl) -protopanaxatriol; lane 4, 3GT2 shows that the crude enzyme catalyzes F1 to generate 3-O-beta- (D-glucopyranosyl) -F1.

FIG. 25 shows TLC detection of products from 20(R) -PPD catalyzed by glycosyltransferases 3GT1 and 3GT 2. Lane 1, 20(R) -PPD standard; lane 2, 3GT1 crude enzyme (3GT1-pet28a E.coli recombinant lysate supernatant) catalyzed the formation of 20(R) -Rh2 from 20(R) -PPD; lane 3, 3GT2 crude enzyme (3GT2-pet28a E.coli recombinant lysate supernatant) catalyzed the formation of 20(R) -Rh2 from 20(R) -PPD; lane 4, control, pet28a empty vector e.coli recombinant lysate supernatant replacement enzyme; lane 5, 20(R) -Rh2 standard.

FIG. 26 shows that glycosyltransferase 3GT1 catalyzes the TLC detection of the product of lanosterol (lanosterol). Lane 1, crude enzyme solution of 3GT 1(3 GT1-pet28a E.coli recombinant lysate supernatant) catalyzes lanosterol; lane 2, crude enzyme 3GT 2(3 GT2-pet28a E.coli recombinant lysate supernatant) catalyzes lanosterol; lane 3: in contrast, the supernatant was lysed with pet28a empty vector E.coli recombinants instead of enzyme solution.

FIG. 27 shows the TLC patterns of products of protopanaxadiol, protopanaxatriol and 25-OH-PPD catalyzed by glycosyltransferase 3GT 3. (a)3GT3 crude enzyme liquid (3GT3-pet28a colon bacillus recombinant lysis supernatant) catalyzes protopanaxadiol to generate Rh2, M is protopanaxadiol type saponin mixed standard sample, (b)3GT3 crude enzyme liquid catalyzes protopanaxadiol triol to generate 3-O-beta- (D-glucopyranosyl) -PPT (3-G-PPT); (c)3GT3 crude enzyme solution catalyzes 25-OH-PPD to generate 3-O-beta- (D-glucopyranosyl) -25-OH-PPD (3-G-25-OH-PPD).

FIG. 28 shows the TLC pattern of the products of the catalysis of protopanaxadiol, CK and 25-OH-PPD by glycosyltransferase 3GT 4. (a)3GT4 crude enzyme solution (3GT4-pet28a colon bacillus recombinant cracking supernatant) catalyzes protopanaxadiol to generate Rh2, M is protopanaxadiol saponin mixed standard sample, "+" represents a sample added with the 3GT4 crude enzyme solution, and "-" is a control, namely pet28a empty carrier colon bacillus recombinant cracking supernatant is used for replacing enzyme solution (b)3GT4 crude enzyme solution catalyzes CK to generate F2; "+" represents the sample with 3GT4 crude enzyme added, "-" is the control, i.e., the supernatant from the cleavage of the pet28a empty vector E.coli recombinant was used instead of the enzyme; (c) glycosyltransferase 3GT4 catalyzes 25-OH-PPD to generate 3-O-beta- (D-glucopyranosyl) -25-OH-PPD (3-G-25-OH-PPD), "+" represents a sample added with 3GT4 crude enzyme solution, and "-" is a control, namely, pet28a empty carrier Escherichia coli recombinant is used for cracking supernatant to replace enzyme solution.

Figure 29 shows HPLC assays of glycosyltransferases 3GT1, 3GT3 and 3GT4 catalyzing protopanaxadiol to Rh2, first row samples: mixed standard samples of ginsenosides CK, Rh2 and F2; second row of samples: products obtained after the glycosyltransferase 3GT1 crude enzyme solution (3GT1-pet28a escherichia coli recombinant lysis supernatant) catalyzes PPD; a third row; the product of PPD catalysis by 3GT3 crude enzyme liquid (3GT3-pet28a colibacillus recombinant lysis supernatant); fourth row: the product of PPD catalysis by 3GT4 crude enzyme liquid (3GT4-pet28a colibacillus recombinant lysis supernatant).

FIG. 30 shows that glycosyltransferases 3GT1, 3GT3, and 3GT4 catalyze LC/MS detection of protopanaxadiol products. The mass spectrum of the Rh2 standard sample and the mass spectra of the P1 peak (product peak of 3GT 1), the P2 peak (product peak of 3GT 2) and the P3 peak (product peak of 3GT 4) in fig. 29 are shown.

FIG. 31 shows agarose gel electrophoresis of PCR products of (a) gGT29/gGT29-3 gene and (b) gGT29-4/gGT29-5/gGT29-6 and gGT29-7 gene. (b) Lane 1, nucleic acid Marker; lane 2, gGT29/gGT29-3 gene PCR product; (b) lane 1, PCR product of gGT29-4/gGT29-5/gGT29-6 gene; lane 2, gGT29-7 gene PCR product; lane 3, nucleic acid Marker.

FIG. 32 shows SDS-PAGE detecting expression of gGT29 and gGT29-3 in Saccharomyces cerevisiae; lane 1, supernatant of lysate of empty vector pYES2 recombinant; lane 2, supernatant of lysate of gGT29-pYES2 yeast recombinant; lane 3, gGT29-3-pYES2 yeast recombinant supernatant.

FIG. 33 shows Western Blot to detect expression of gGT29 and gGT29-3 in Saccharomyces cerevisiae; lane 1, supernatant of lysate of empty vector pYES2 recombinant; lane 2, supernatant of lysate of gGT29-pYES2 yeast recombinant; lane 3, gGT29-3-pYES2 yeast recombinant supernatant.

FIG. 34 shows TLC detection patterns of products of glycosyltransferases gGT29 and gGT29-3 catalyzing ginsenosides Rh2 and F2; lane 1, mixed standard sample of PPD and PPD type saponins, Lane 2, gGT29 crude enzyme (supernatant of gGT29-pYES2 yeast recombinant lysate) catalyzes Rh2 to generate Rg3, Lane 3, gGT29 crude enzyme catalyzes Rh2 contrast, adds pYES2 empty plasmid yeast recombinant lysate to replace enzyme solution; lane 4, gGT29 catalyzed F2 to generate Rd, lane 5, gGT29 catalyzed F2 control, and pYES2 empty plasmid yeast recombinant lysate was added instead of enzyme solution; lane 6, gGT29-3 crude enzyme (supernatant of gGT29-3-pYES2 yeast recombinant) catalyzed Rh2 to produce Rg 3; lane 7, gGT29-3 crude enzyme catalyzed the formation of Rd from F2.

FIG. 35 shows TLC detection of a product of catalytic PPD in combination with glycosyltransferases gGT29 and 3GT1 or gGT29 and 3GT 4; (a) gGT29 and 3GT1 in combination catalyze PPD, lane 1, PPD and mixed standard of PPD-type saponins; lane 2, 3GT1 catalyzes the formation of Rh2 from PPD; lane 3, gGT29 catalyzes Rh2 to Rg 3; lanes 4, 3GT1 and gGT29 in combination catalyze the production of Rg3 from PPD; (b) gGT29 and 3GT4 in combination catalyze PPD, lane 1, PPD and mixed standard of PPD-type saponins; lane 2, 3GT4 catalyzes the formation of Rh2 from PPD; lane 3, PPD; lanes 4, 3GT4 and gGT29 in combination catalyze the production of Rg3 from PPD.

FIG. 36 shows TLC detection profiles of products catalyzed by glycosyltransferases 3GT1 and gGT29 for 20(R) -PPD and 20(R) -PPD, respectively, and in combination for 20(R) -PPD; lane 1, 3GT1 catalyzes the formation of 20(R) -Rh2 from 20(R) -PPD; lane 2, gGT29 catalyzes the production of 20(R) -Rg3 from 20(R) -Rh 2; lanes 3, 3GT1 and gGT29 in combination catalyzed the formation of 20(R) -Rg3 from 20(R) -PPD.

Figure 37 shows the results of HPLC detection of glycosyltransferases gGT29 and 3GT1 or gGT29 and 3GT4 in combination catalyzing PPD products. First row, Rg3, Rh2 and PPD mixed standard samples; the second row, gGT29 and 3GT1, co-catalyze PPD, and the third row, gGT29 and 3GT4, co-catalyze PPD.

FIG. 38 shows the product LC/MS detection of the combination of glycosyltransferases gGT29 and 3GT1 or gGT29 and 3GT4 catalyzing PPD. The mass spectrum of the standard sample Rg3 and the mass spectra of the P1 peak (product of gGT29 and 3GT1 in combination catalyzed PPD) and the P2 peak (product of gGT29 and 3GT4 in combination catalyzed PPD) in fig. 37 are shown.

FIG. 39 shows the HPLC detection results of cell lysate extract of Rh 2-producing engineered yeast A1, the first row of samples: mixed standard samples of protopanaxadiol (PPD), Dammarenediol (DM), ginsenosides Rh2 and Rg 3; second row of samples: cell lysate extract of Rh 2-producing engineering yeast A1.

Fig. 40 shows the HPLC detection results of the lysate extract of Rg 3-producing engineered yeast a2 cell, the first row of samples: mixed standard samples of protopanaxadiol (PPD), Dammarenediol (DM), ginsenosides Rh2 and Rg 3; second row of samples: producing Rg3 yeast engineering bacteria A2 cell lysate extract.

FIG. 41 shows the HPLC detection results of cell lysate extract of Rh 1-producing engineered yeast A3, the first row of samples: standard samples of protopanaxatriol (PPT) and ginsenoside Rh 1; second row of samples: producing cell lysate extract of Rh1 yeast engineering bacteria A3;

FIG. 42 shows the HPLC detection results of cell lysate extract of engineered yeast F1A 4, first row of samples: standard samples of protopanaxatriol (PPT) and ginsenoside F1; second row of samples: producing cell lysate extract of the F1 yeast engineering bacteria A4.

FIG. 43 shows the HPLC detection results of cell lysate extract of Rh 2-producing engineered yeast A5, first row of samples: standard samples of Dammarendiol (DM), protopanaxadiol (PPD), ginsenoside Rh2 and ginsenoside Rg 3; second row of samples: cell lysate extract of Rh 2-producing engineering yeast A5.

FIG. 44 shows that expression of gGT29-4, gGT29-5, gGT29-6, gGT29-7 was detected by SDS-PAGE in recombinant E.coli. Lane 1, gGT29-4-pET28a recombinant E.coli lysate total protein; lane 2, gGT29-4-pET28a recombinant E.coli lysate supernatant; lane 3, gGT29-5-pET28a recombinant E.coli lysate total protein; lane 4, gGT29-5-pET28a recombinant E.coli lysate supernatant; lane 5, gGT29-6-pET28a recombinant E.coli lysate total protein; lane 6, gGT29-6-pET28a recombinant E.coli lysate supernatant; lane 7, gGT29-7-pET28a recombinant E.coli lysate total protein; lane 8, gGT29-7-pET28a recombinant E.coli lysate supernatant; lane 9, protein molecular weight Marker.

FIG. 45 shows the expression of gGT29-4, gGT29-5, gGT29-6, gGT29-7 in recombinant E.coli by Western Blot assay. Lane 1, gGT29-4-pET28a recombinant E.coli lysate total protein; lane 2, gGT29-4-pET28a recombinant E.coli lysate supernatant; lane 3, gGT29-5-pET28a recombinant E.coli lysate total protein; lane 4, gGT29-5-pET28a recombinant E.coli lysate supernatant; lane 5, gGT29-6-pET28a recombinant E.coli lysate total protein; lane 6, gGT29-6-pET28a recombinant E.coli lysate supernatant; lane 7, gGT29-7-pET28a recombinant E.coli lysate total protein; lane 8, gGT29-7-pET28a recombinant E.coli lysate supernatant.

FIG. 46 shows TLC detection profiles of products of glycosyltransferases gGT29-4, gGT29-5, gGT29-6, gGT29-7 catalyzing Rh2 and F2, respectively. Lane Rh2 shows the use of saponin Rh2 as substrate; lane F2 shows the use of saponin F2 as substrate. gGT29-4, gGT29-5, gGT29-6 and gGT29-7 show that different enzyme solutions are used for catalytic reaction.

FIG. 47 shows the TLC detection patterns of products in which glycosyltransferases gGT29-4, gGT29-5, gGT29-6, gGT29-7 catalyze Rh1, respectively. (a)

Lanes

1, 2 and 3 represent the products of glycosyltransferases gGT29-4, gGT29-5 and gGT29-6, respectively, catalyzing Rh1, and lane 4 represents the protopanaxatriol-type saponin mixture standard; (b) lane 1 represents the product of catalysis of Rh1 by glycosyltransferase gGT29-7, and lane 2 represents the protopanaxatriol-type saponin cocktail standard;

FIG. 48 shows the TLC patterns of products from the different types of tetracyclic triterpene substrates catalyzed by glycosyltransferases 3GT1, 3GT3 and 3GT4, respectively. (a) Catalytic lanosterol-type tetracyclic triterpene Ganoderic acid C2(Ganoderic acid C2); (b) catalyzing the apotriucallane type tetracyclic triterpene Agladupol A; (c) catalytic euphkanane-type tetracyclic triterpene Hispidol B; (d) catalyzed cycloartenane tetracyclic triterpene 24(R) -Cycloartane-3beta,24, 25-triol. Lanes 3GT3, 3GT3 and 3GT4 represent catalysis with glycosyltransferases 3GT1, 3GT3 and 3GT4, and lane M represents the corresponding substrate standard. The arrow indicates the resulting product.

Detailed Description

The present inventors have conducted extensive and intensive studies and, for the first time, have provided glycosyltransferases gGT25(SEQ ID NO: 2), gGT25-1(SEQ ID NO: 16), gGT25-3(SEQ ID NO: 18), gGT25-5(SEQ ID NO: 20), gGT29(SEQ ID NO: 26), gGT29-3(SEQ ID NO: 28), gGT29-4(SEQ ID NO: 55), gGT29-5(SEQ ID NO: 57), gGT29-6(SEQ ID NO: 59), gGT29-7(SEQ ID NO. 61) and 3GT1(SEQ ID NO. 22), 3GT2(SEQ ID NO. 24), 3GT3(SEQ ID NO. 41), 3GT4(SEQ ID NO. 43), gGT13(SEQ ID NO. 4), gGT30(SEQ ID NO. 6) in the catalysis of terpenoid glycosylation and the synthesis of novel saponins. Specifically, the glycosyltransferase of the present invention is capable of specifically and efficiently catalyzing the glycosylation of C-20 and/or C-6 and/or C-3 hydroxyls of a substrate of a tetracyclic triterpene compound, and/or transferring a glycosyl group from a glycosyl donor to the first glycosyl group at C-3 of the tetracyclic triterpene compound to extend a sugar chain. In particular, protopanaxadiol can be converted into the rare ginsenosides CK and Rh2 with anticancer activity, protopanaxatriol can be converted into the rare ginsenosides F1 with anti-aging activity and the rare ginsenosides Rh1 with anti-allergic effect, and Rh2 can be converted into the rare ginsenosides Rg3 with excellent anticancer activity. The glycosyltransferase of the present invention can also convert dammarendiol, protopanaxatriol, F1, 25-OH-PPD, 25-OCH₃New saponins not reported before the synthesis of-PPD, lanosterol, Garoderic acid C2, Agladupol A, Hispidol B and 24(R) -Cycloartene-3 beta,24,25-triol 20-O-beta- (D-glucopyranosyl) -dammarandiol II, 3-O-beta- (D-glucopyranosyl) -PPT, 3-O-beta- (D-glucopyranoso-syl) -F1, 3-O-beta- (D-glucopyranosyl) -25-OH-PPD, 3-O-beta- (D-glucopyranoso-syl) -25-OCH₃PPD, 3-O-beta- (D-glucopyranosyl) -lanosterol, 3-O-beta- (D-glucopyranosyl) -Ganoderic acid C2, 3-O-beta- (D-glucopyranosyl) -Agadupol A, 3-O-beta- (D-glucopyranosyl) -Hispidol B and 3-O-beta- (D-glucopyranosyl) -lanosterolosyl)-24(R)-Cycloartane-3beta,24,25-triol。。

The glycosyltransferase can also convert Rh2, CK and Rg3 into ginsenoside F2, Rd, Rg1 and the like respectively. The invention also provides conversion and catalytic processes. The glycosyltransferases of the present invention may also be co-expressed in a host cell with a key enzyme in the dammarenediol and/or protopanaxadiol or protopanaxatriol anabolic pathway, or in the genetic engineering cells for preparing Dammarenediol (DM), protopanaxadiol (PPD) and protopanaxatriol (PPT), is applied to the construction of artificially synthesized rare ginsenoside CK, F1, Rh1, Rh2 and Rg3, and novel ginsenosides 20-O-beta- (D-glucopyranosyl) -dammarendiolII, 3-O-beta- (D-glucopyranosyl) -PPT, 3-O-beta- (D-glucopyranosyl) -F1, 3-O-beta- (D-glucopyranosyl) -dammarendiolII, 3-O-beta- (D-glucopyranosyl) -25-OH-PPD, 3-O-beta- (D-glucopyranosyl) -25-OCH.₃PPD and F2, Rd and Rg1, etc. The present invention has been completed based on this finding.

Definition of

As used herein, the terms "active polypeptide", "polypeptide of the invention and polypeptides derived therefrom", "enzyme of the invention", "glycosyltransferase", "gGT 25, gGT13, gGT30, gGT25-1, gGT25-3, gGT25-5, gGT29, gGT29-3, 3GT1, 3GT2, 3GT3, 3GT4 protein" or "glycosyltransferase of the invention", all refer to glycosyltransferases gGT25(SEQ ID NO: 2), gGT13(SEQ ID NO: 4), gGT30(SEQ ID NO: 6), gGT25-1(SEQ ID NO: 16), gGT25-3(SEQ ID NO: 18), gGT25-5(SEQ ID NO: 20), gGT29(SEQ ID NO: 26), gGT29-3(SEQ ID NO: 28), gGT29-4(SEQ ID NO: 55), gGT29-5(SEQ ID NO: 57), gGT29-6(SEQ ID NO: 59), gGT29-7(SEQ ID No.:61) and 3GT1(SEQ ID No.:22), 3GT2(SEQ ID No.:24), 3GT3(SEQ ID No.:41), 3GT4(SEQ ID No.:43) polypeptides and derivatives thereof.

Unless otherwise specified, ginsenosides and sapogenins referred to herein are ginsenosides and sapogenins having the S configuration at position C20.

As used herein, "isolated polypeptide" means that the polypeptide is substantially free of other proteins, lipids, carbohydrates or other materials with which it is naturally associated. One skilled in the art can purify the polypeptide using standard protein purification techniques. Substantially pure polypeptides are capable of producing a single major band on a non-reducing polyacrylamide gel. The purity of the polypeptide can be further analyzed by amino acid sequence.

The active polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide. The polypeptides of the invention may be naturally purified products, or chemically synthesized products, or produced from prokaryotic or eukaryotic hosts (e.g., bacteria, yeast, plants) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptides of the invention may be glycosylated or may be non-glycosylated. The polypeptides of the invention may or may not also include an initial methionine residue.

The invention also includes fragments, derivatives and analogues of the polypeptides. As used herein, the terms "fragment," "derivative," and "analog" refer to a polypeptide that retains substantially the same biological function or activity as the polypeptide.

A polypeptide fragment, derivative or analogue of the invention may be (i) a polypeptide in which one or more conserved or non-conserved amino acid residues, preferably conserved amino acid residues, are substituted, and such substituted amino acid residues may or may not be encoded by the genetic code, or (ii) a polypeptide having a substituent group in one or more amino acid residues, or (iii) a polypeptide in which the mature polypeptide is fused to another compound, such as a compound that increases the half-life of the polypeptide, e.g. polyethylene glycol, or (iv) a polypeptide in which an additional amino acid sequence is fused to the sequence of the polypeptide (e.g. a leader or secretory sequence or a sequence used to purify the polypeptide or a proprotein sequence, or a fusion protein with an antigenic IgG fragment). Such fragments, derivatives and analogs are within the purview of those skilled in the art in view of the teachings herein.

The active polypeptide of the invention has glycosyltransferase activity and is capable of catalyzing one or more of the following reactions:

compounds of formula (I) Compounds of formula (II)

In another preferred embodiment, the polysaccharide includes 2 to 4 polysaccharides such as Glc (2-1) Glc, Glc (6) Ac, Glc (2-1) Rha, Glc (6-1) Arap, Glc (6-1) Xyl, Glc (6-1) Araf, Glc (3-1) Glc (3-1), Glc (2-1) Glu (6) Ac, Glc (6-1) Arap (4-1) Xyl, Glc (6-1) Arap (2-1) Xyl, Glc (6-1) Arap (3-1) Xyl, and the like.

The compounds substituted with R1-R4 are shown in the following table:

substrate	R1	R2	R3	R4	Product of
						PPD	H	H	OH	Sugar radical	CK
Rh2
		1 sugar radical	H	OH	Sugar radical	F2
Rg3
		2 glycosyl groups	H	OH	Sugar radical	Rd

PPT	H	OH	OH	Sugar radical	F1
						DM	H	H	H	Sugar radical	20-G-DM

When R1 is glucosyl, R2 is H, and R3 is OH, the compound of formula (I) is ginsenoside RH2.

When R1 is two glucosyl groups, R2 is H, and R3 is OH, the compound of formula (I) is ginsenoside RG 3.

R1 is H, R2 is OH, R3 is OH, and the compound of the formula (I) is protopanaxatriol (PPT).

R1 is H, R2 is H, R3 is H, and the compound of formula (I) is Dammarenediol (DM).

Compounds of formula (III) Compounds of formula (IV)

SEQ ID NOs

2, 16, 18 or 20 or derivative polypeptide thereof;

or, R1 is H or a glycosyl group; r2 is H or a glycosyl group; r3 is glycosyl, and the polypeptide is selected from SEQ ID NO. 20 or derived polypeptide thereof.

The compounds substituted with R1-R3 are shown in the following table:

Compounds of formula (V) Compounds of formula (VI)

The compounds substituted with R1-R4 are shown in the following table:

substrate	R1	R2	R3	R4	Product of
						PPD	H	OH	H	Sugar radical	Rh2
CK	H	OH	Sugar radical	Sugar radical	F2
						PPT	OH	OH	H	Sugar radical	3-G-PPT
F1	OH	OH	Sugar radical	Sugar radical	3-G-F1

DM

H

Sugar radical

3-G-DM

When R1 and R3 are both H and R2 is OH, the compound of formula (V) is protopanaxadiol (PPD) and the polypeptide is selected from the group consisting of SEQ ID NOs 22, 24, 41 or 43 or a derivative polypeptide thereof.

When R1 is H, R2 is OH, and R3 is glucosyl, the compound of formula (V) is ginsenoside CK, and the polypeptide is selected from SEQ ID NOs: 22, 24 or 43 or derivative polypeptide thereof;

when R1 is OH, R2 is OH and R3 is H, the compound of formula (V) is protopanaxatriol (PPT), and the polypeptide is selected from SEQ ID NOs 22, 24 or 41 or derivative polypeptides thereof;

when R1 is OH, R2 is OH, and R3 is glucosyl, the compound of formula (V) is ginsenoside F1, and the polypeptide is selected from SEQ ID Nos. 22 or 24 or derivative polypeptide thereof;

when R1 is H, R2 is OH, and R3 is H, the compound of formula (V) is Dammarenediol (DM), and the polypeptide is selected from SEQ ID Nos. 22 or 24 or a derivative polypeptide thereof.

Compounds of formula (VII) Compounds of formula (VIII)

The compounds substituted with R1-R2 are shown in the following table:

That is, when R1 is OH, the compound of formula (VII) is 25-OH-PPD;

when R1 is OCH, the compound of the formula (VII) is 25-OCH₃-PPD。

Compounds of formula (IX) Compounds of formula (X)

Wherein R1 is a glycosyl group; r2 and R3 are OH or H; r4 is a glycosyl group or H; r5 is a glycosyl group, and the polypeptide is selected from SEQ ID NOs 26, 28, 55, 57, 59 or 61 or a derivative polypeptide thereof.

The compounds substituted with R1-R4 are shown in the following table:

Compounds of formula (XI) Compounds of formula (XII)

The polypeptide is selected from SEQ ID NOs 22 or 24 or derived polypeptides thereof.

Compounds of formula (XIII) Compounds of formula (XIV)

Compounds of formula (XV) Compounds of formula (XVI)

Compounds of formula (XVII) Compounds of formula (XVIII)

Compounds of formula (XIX) Compounds of formula (XX)

The polypeptide is selected from SEQ ID NOs 22 or 24 or 41 or 43 or derivative polypeptide thereof.

Compounds of formula (XXI) Compounds of formula (XXII)

The polypeptide is selected from SEQ ID NOs 22 or 24 or 41 or derived polypeptides thereof.

The preferred sequence of the polypeptide is that shown in SEQ ID NOs.2, 16, 18, 20, 22, 24, 41, 26, 28, 43, 55, 57, 59 or 61, and the term also includes variants and derivative polypeptides of SEQ ID NOs.2, 16, 18, 20, 22, 24, 41, 26, 28, 43, 55, 57, 59 or 61 having the same function as the polypeptide shown. These variants include (but are not limited to): deletion, insertion and/or substitution of one or more (usually 1 to 50, preferably 1 to 30, more preferably 1 to 20, most preferably 1 to 10) amino acids, and addition of one or several (usually up to 20, preferably up to 10, more preferably up to 5) amino acids at the C-terminus and/or N-terminus. For example, in the art, substitutions with amino acids of similar or similar properties will not generally alter the function of the protein. Also, for example, the addition of one or several amino acids at the C-terminus and/or N-terminus does not generally alter the function of the protein. The term also includes active fragments and active derivatives of the human EGFRvA protein. The invention also provides analogs of the polypeptides. These analogs may differ from the native human EGFRvA polypeptide by amino acid sequence differences, by modifications that do not affect the sequence, or by both. These polypeptides include natural or induced genetic variants. Induced variants can be obtained by various techniques, such as random mutagenesis by irradiation or exposure to mutagens, site-directed mutagenesis, or other known molecular biological techniques. Analogs also include analogs having residues other than the natural L-amino acids (e.g., D-amino acids), as well as analogs having non-naturally occurring or synthetic amino acids (e.g., beta, gamma-amino acids). It is to be understood that the polypeptides of the present invention are not limited to the representative polypeptides exemplified above.

Modified (generally without altering primary structure) forms include: chemically derivatized forms of the polypeptide, such as acetylation or carboxylation, in vivo or in vitro. Modifications also include glycosylation, such as those resulting from glycosylation modifications in the synthesis and processing of the polypeptide or in further processing steps. Such modification may be accomplished by exposing the polypeptide to an enzyme that performs glycosylation, such as a mammalian glycosylase or deglycosylase. Modified forms also include sequences having phosphorylated amino acid residues (e.g., phosphotyrosine, phosphoserine, phosphothreonine). Also included are polypeptides modified to increase their resistance to proteolysis or to optimize solubility.

The amino terminal or carboxyl terminal of gGT25, gGT13, gGT30, gGT25-1, gGT25-3, gGT25-5, gGT29, gGT29-3, gGT29-4, gGT29-5, gGT29-6, gGT29-7 and 3GT1, 3GT2, 3GT3 and 3GT4 proteins of the invention may also contain one or more polypeptide fragments as protein tags. Any suitable label may be used in the present invention. For example, the tag can be FLAG, HA1, c-Myc, Poly-His, Poly-Arg, Strep-TagII, AU1, EE, T7, 4A6, ε, B, gE, and Ty 1. These tags can be used to purify proteins. Some of these tags and their sequences are listed in table 1.

TABLE 1

In order to make the translated protein expressed secretly (e.g. secreted extracellularly), a signal peptide sequence such as pelB signal peptide may be added to the amino acid amino terminal of gGT25, gGT13, gGT30, gGT25-1, gGT25-3, gGT25-5, gGT29, gGT29-3, gGT29-4, gGT29-5, gGT29-6, gGT29-7 and 3GT1, 3GT2, 3GT3, 3GT 4. The signal peptide may be cleaved off during secretion of the polypeptide from the cell.

The polynucleotide of the present invention may be in the form of DNA or RNA. The form of DNA includes cDNA, genomic DNA or artificially synthesized DNA. The DNA may be single-stranded or double-stranded. The DNA may be the coding strand or the non-coding strand. The sequence of the coding region encoding the mature polypeptide may be identical to the sequence of the coding region as set forth in SEQ ID NOs.1 or may be a degenerate variant. As used herein, "degenerate variant" refers in the present invention to a nucleic acid sequence that encodes a protein having the sequence of SEQ ID nos. 2, 4, 6, 16, 18, 20, 22, 24, 26, 28, 41, 43, 55, 57, 59, or 61 but differs from the sequence of the coding region shown in SEQ ID nos. 1, 3, 5, 15, 17, 19, 21, 23, 25, 27, 40, 42, 54, 56, 58, or 60.

Polynucleotides encoding mature polypeptides of SEQ ID nos. 2, 4, 6, 16, 18, 20, 22, 24, 26, 28, 41, 43, 55, 57, 59, or 61 include: a coding sequence encoding only the mature polypeptide; the coding sequence for the mature polypeptide and various additional coding sequences; the coding sequence (and optionally additional coding sequences) as well as non-coding sequences for the mature polypeptide.

The term "polynucleotide encoding a polypeptide" may include a polynucleotide encoding the polypeptide, and may also include additional coding and/or non-coding sequences.

The present invention also relates to variants of the above polynucleotides which encode polypeptides having the same amino acid sequence as the present invention or fragments, analogs and derivatives of the polypeptides. The variant of the polynucleotide may be a naturally occurring allelic variant or a non-naturally occurring variant. These nucleotide variants include substitution variants, deletion variants and insertion variants. As is known in the art, an allelic variant is a substitution of a polynucleotide, which may be a substitution, deletion, or insertion of one or more nucleotides, without substantially altering the function of the polypeptide encoded thereby.

The present invention also relates to polynucleotides which hybridize to the sequences described above and which have at least 50%, preferably at least 70%, and more preferably at least 80% identity between the two sequences. The present invention particularly relates to polynucleotides hybridizable under stringent conditions (or stringent conditions) with the polynucleotides of the present invention. In the present invention, "stringent conditions" mean: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2 XSSC, 0.1% SDS, 60 ℃; or (2) adding denaturant during hybridization, such as 50% (v/v) formamide, 0.1% calf serum/0.1% Ficoll, 42 deg.C, etc.; or (3) hybridization occurs only when the identity between two sequences is at least 90% or more, preferably 95% or more. And, the hybridizable polynucleotide encodes a polypeptide having the same biological function and activity as the mature polypeptide of

SEQ ID NOs

2, 4, 6, 16, 18, 20, 22, 24, 26, 28, 41, 43, 55, 57, 59, or 61.

The invention also relates to nucleic acid fragments which hybridize to the sequences described above. As used herein, a "nucleic acid fragment" is at least 15 nucleotides, preferably at least 30 nucleotides, more preferably at least 50 nucleotides, and most preferably at least 100 nucleotides in length. The nucleic acid fragments may be used in amplification techniques of nucleic acids (e.g. PCR) to determine and/or isolate polynucleotides encoding gGT25, gGT13, gGT30, gGT25-1, gGT25-3, gGT25-5, gGT29, gGT29-3, gGT29-4, gGT29-5, gGT29-6, gGT29-7 and 3GT1, 3GT2, 3GT3, 3GT4 proteins.

The polypeptides and polynucleotides of the invention are preferably provided in isolated form, more preferably purified to homogeneity.

The full-length nucleotide sequences of gGT25, gGT13, gGT30, gGT25-1, gGT25-3, gGT25-5, gGT29, gGT29-3, gGT29-4, gGT29-5, gGT29-6, gGT29-7, 3GT1, 3GT2, 3GT3 and 3GT4 of the invention or fragments thereof can be obtained by PCR amplification, recombination or artificial synthesis. For PCR amplification, primers can be designed based on the nucleotide sequences disclosed herein, particularly open reading frame sequences, and the sequences can be amplified using commercially available cDNA libraries or cDNA libraries prepared by conventional methods known to those skilled in the art as templates. When the sequence is long, two or more PCR amplifications are often required, and then the amplified fragments are spliced together in the correct order.

Once the sequence of interest has been obtained, it can be obtained in large quantities by recombinant methods. This is usually done by cloning it into a vector, transferring it into a cell, and isolating the relevant sequence from the propagated host cell by conventional methods.

In addition, the sequence can be synthesized by artificial synthesis, especially when the fragment length is short. Generally, fragments with long sequences are obtained by first synthesizing a plurality of small fragments and then ligating them.

At present, DNA sequences encoding the proteins of the present invention (or fragments or derivatives thereof) have been obtained completely by chemical synthesis. The DNA sequence may then be introduced into various existing DNA molecules (or vectors, for example) and cells known in the art. Furthermore, mutations can also be introduced into the protein sequences of the invention by chemical synthesis.

A method of amplifying DNA/RNA using PCR technology is preferably used to obtain the gene of the present invention. Particularly, when it is difficult to obtain a full-length cDNA from a library, it is preferable to use the RACE method (RACE-cDNA terminal rapid amplification method), and primers used for PCR can be appropriately selected based on the sequence information of the present invention disclosed herein and synthesized by a conventional method. The amplified DNA/RNA fragments can be isolated and purified by conventional methods, such as by gel electrophoresis.

The invention also relates to vectors comprising a polynucleotide of the invention, as well as host cells genetically engineered with a vector of the invention or a coding sequence for the gGT25, gGT13, gGT30, gGT25-1, gGT25-3, gGT25-5, gGT29, gGT29-3, gGT29-4, gGT29-5, gGT29-6, gGT29-7 and 3GT1, 3GT2, 3GT3, 3GT4 proteins, and methods for producing a polypeptide of the invention by recombinant techniques.

The polynucleotide sequences of the present invention may be used to express or produce recombinant gGT25, gGT13, gGT30, gGT25-1, gGT25-3, gGT25-5, gGT29, gGT29-3, gGT29-4, gGT29-5, gGT29-6, gGT29-7 and 3GT1, 3GT2, 3GT3, 3GT4 polypeptides by conventional recombinant DNA techniques. Generally, the following steps are performed:

(1) transforming or transducing a suitable host cell with a polynucleotide (or variant) of the invention encoding gGT25, gGT13, gGT30, gGT25-1, gGT25-3, gGT25-5, gGT29, gGT29-3, gGT29-4, gGT29-5, gGT29-6, gGT29-7 and 3GT1, 3GT2, 3GT3, 3GT4 polypeptides, or with a recombinant expression vector containing the polynucleotide;

(2) a host cell cultured in a suitable medium;

(3) isolating and purifying the protein from the culture medium or the cells.

In the present invention, polynucleotide sequences of gGT25, gGT13, gGT30, gGT25-1, gGT25-3, gGT25-5, gGT29, gGT29-3, gGT29-4, gGT29-5, gGT29-6, gGT29-7 and 3GT1, 3GT2, 3GT3, 3GT4 may be inserted into the recombinant expression vector. The term "recombinant expression vector" refers to a bacterial plasmid, bacteriophage, yeast plasmid, plant cell virus, mammalian cell virus such as adenovirus, retrovirus, or other vectors well known in the art. Any plasmid or vector may be used as long as it can replicate and is stable in the host. An important feature of expression vectors is that they generally contain an origin of replication, a promoter, a marker gene and translation control elements.

Methods well known to those skilled in the art can be used to construct expression vectors containing gGT25, gGT13, gGT30, gGT25-1, gGT25-3, gGT25-5, gGT29, gGT29-3, gGT29-4, gGT29-5, gGT29-6, gGT29-7 and 3GT1, 3GT2, 3GT3, 3GT4 encoding DNA sequences and appropriate transcription/translation control signals. These methods include in vitro recombinant DNA techniques, DNA synthesis techniques, in vivo recombinant techniques, and the like. The DNA sequence may be operably linked to a suitable promoter in an expression vector to direct mRNA synthesis. Representative examples of such promoters are: lac or trp promoter of E.coli; a lambda phage PL promoter; eukaryotic promoters include CMV immediate early promoter, HSV thymidine kinase promoter, early and late SV40 promoter, LTRs of retrovirus, and other known promoters capable of controlling gene expression in prokaryotic or eukaryotic cells or viruses. The expression vector also includes a ribosome binding site for translation initiation and a transcription terminator.

Furthermore, the expression vector preferably comprises one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance and Green Fluorescent Protein (GFP) for eukaryotic cell culture, or tetracycline or ampicillin resistance for E.coli.

Vectors comprising the appropriate DNA sequences described above, together with appropriate promoter or control sequences, may be used to transform appropriate host cells to enable expression of the protein.

The host cell may be a prokaryotic cell, such as a bacterial cell; or lower eukaryotic cells, such as yeast cells; or higher eukaryotic cells, such as mammalian cells. Representative examples are: escherichia coli, streptomyces; bacterial cells of salmonella typhimurium; fungal cells such as yeast; a plant cell; insect cells of Drosophila S2 or Sf 9; CHO, COS, 293 cells, or Bowes melanoma cells.

When the polynucleotide of the present invention is expressed in higher eukaryotic cells, transcription will be enhanced if an enhancer sequence is inserted into the vector. Enhancers are cis-acting elements of DNA, usually about 10 to 300 base pairs, that act on a promoter to increase transcription of a gene. Examples include the SV40 enhancer at the late side of the replication origin at 100 to 270 bp, the polyoma enhancer at the late side of the replication origin, and adenovirus enhancers.

It will be clear to one of ordinary skill in the art how to select appropriate vectors, promoters, enhancers and host cells.

Transformation of a host cell with recombinant DNA can be carried out using conventional techniques well known to those skilled in the art. When the host is a prokaryote such as the large intestineWhen bacillus is used, competent cells capable of DNA uptake can be harvested after exponential growth phase using CaCl₂Methods, the steps used are well known in the art. Another method is to use MgCl₂. If desired, transformation can also be carried out by electroporation. When the host is a eukaryote, the following DNA transfection methods may be used: calcium phosphate coprecipitation, conventional mechanical methods such as microinjection, electroporation, liposome encapsulation, etc.

The obtained transformant can be cultured by a conventional method to express the polypeptide encoded by the gene of the present invention. The medium used in the culture may be selected from various conventional media depending on the host cell used. The culturing is performed under conditions suitable for growth of the host cell. After the host cells have been grown to an appropriate cell density, the selected promoter is induced by suitable means (e.g., temperature shift or chemical induction) and the cells are cultured for an additional period of time.

The recombinant polypeptide in the above method may be expressed intracellularly or on the cell membrane, or secreted extracellularly. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. Examples of such methods include, but are not limited to: conventional renaturation treatment, treatment with a protein precipitant (such as salt precipitation), centrifugation, cell lysis by osmosis, sonication, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, High Performance Liquid Chromatography (HPLC), and other various liquid chromatography techniques, and combinations thereof.

Applications of

The invention relates to the use of active polypeptides or peptidyl transferases gGT25, gGT13, gGT30, gGT25-1, gGT25-3, gGT25-5, gGT29, gGT29-3, gGT29-4, gGT29-5, gGT29-6, gGT29-7 and 3GT1, 3GT2, 3GT3, 3GT4 including (but not limited to): specifically and efficiently catalyze the glycosylation of C-20 and/or C-6 and/or C-3 hydroxyl of a substrate of the tetracyclic triterpene compound or transfer glycosyl from a glycosyl donor to the first glycosyl at C-3 and C-6 of the tetracyclic triterpene compound so as to extend a sugar chain. Especially, it can convert protopanoxadiol into anticancer diluted extractContains ginsenoside CK and Rh2, converts protopanaxatriol into rare ginsenoside F1 with antiaging activity and rare ginsenoside Rh1 with antiallergic effect, and converts Rh2 into rare ginsenoside Rg3 with better anticancer activity. The glycosyltransferase of the present invention can also convert dammarendiol, protopanaxatriol, F1, 25-OH-PPD, 25-OCH₃-20-O-beta- (D-glucopyranosyl) -dammarendiolII, 3-O-beta- (D-glucopyranosyl) -PPT, 3-O-beta- (D-glucopyranosyl) -F1, 3-O-beta- (D-glucopyranosyl) -25-OH-PPD, 3-O-beta- (D-glucopyranosyl) -25-OCH-PPD, which have not been reported before PPD synthesis₃PPD. The glycosyltransferase can also convert Rh2, CK and Rg3 into ginsenoside F2, Rd, Rg1 and the like.

The tetracyclic triterpene compounds comprise (but are not limited to): tetracyclic triterpenoids such as dammarane type, lanoline type, kansuine type, cycloartane (cycloartane) type, apotorucallane type, cucurbitane type, and meliane type in S-or R-configuration.

The invention provides an industrial catalysis method, which comprises the following steps: compounds of formula (II), (IV), (VI), (VIII), (X), (XII), (XIV), (XVI), (XVIII), (XX) or (XXII) are obtained with gGT25, gGT13, gGT30, gGT25-1, gGT25-3, gGT25-5, gGT29, gGT29-3, gGT29-4, gGT29-5, gGT29-6, gGT29-7, 3GT1, 3GT2, 3GT3 and/or 3GT4 active polypeptides or peptidyl transferases of the invention under conditions that provide a glycosyl donor. Specifically, the polypeptide used in the reaction (a) is selected from the group consisting of SEQ ID NOs 2, 16 or 18; the polypeptide used in the reaction of (b) is selected from the group consisting of

SEQ ID NOs

20, 2, 16 or 18; the polypeptides used in the reactions of (c) and (d) are selected from the group consisting of SEQ ID NOs 22, 24, 41 and 43; the polypeptide used in the reaction of (e) is an active polypeptide selected from the group consisting of amino acid sequences shown in SEQ ID NOs 26, 28, 55, 57, 59, or 61; the polypeptide used in the reaction of (F) is selected from active polypeptides having an amino acid sequence shown in SEQ ID NOs 22 or 24; .

The glycosyl donor is nucleoside diphosphate sugar, and is selected from the following group: UDP-glucose, ADP-glucose, TDP-glucose, CDP-glucose, GDP-glucose, UDP-acetylglucose, ADP-acetylglucose, TDP-acetylglucose, CDP-acetylglucose, GDP-acetylglucose, UDP-xylose, ADP-xylose, TDP-xylose, CDP-xylose, GDP-xylose, UDP-galacturonic acid, ADP-galacturonic acid, TDP-galacturonic acid, CDP-galacturonic acid, GDP-galacturonic acid, UDP-galactose, ADP-galactose, TDP-galactose, CDP-galactose, GDP-galactose, UDP-arabinose, ADP-arabinose, TDP-arabinose, CDP-arabinose, GDP-arabinose, UDP-rhamnose, ADP-rhamnose, TDP-rhamnose, CDP-rhamnose, GDP-rhamnose, or other nucleoside hexose or pentose diphosphates, or a combination thereof.

Said glycosyl donor is preferably a uridine diphosphate sugar selected from the group consisting of: UDP-glucose, UDP-galacturonic acid, UDP-galactose, UDP-arabinose, UDP-rhamnose, or other uridine diphosphogliose or uridine diphosphogliose, or a combination thereof.

In the method, an enzyme activity supplement (a supplement for increasing the enzyme activity or inhibiting the enzyme activity) may be added. The enzymatic activity additive may be selected from the group consisting of: ca²⁺、Co²⁺、Mn²⁺、Ba²⁺、Al³⁺、Ni²⁺、Zn²⁺Or Fe²⁺(ii) a Or can generate Ca²⁺、Co²⁺、Mn²⁺、Ba²⁺、Al³⁺、Ni²⁺、Zn²⁺Or Fe²⁺The substance of (1).

The pH conditions of the method are as follows: pH4.0-10.0, preferably pH6.0-pH8.5, more preferably 8.5.

The temperature conditions of the method are as follows: 10 ℃ to 105 ℃, preferably 25 ℃ to 35 ℃, more preferably 35 ℃.

The present invention also provides a composition comprising an effective amount of an active polypeptide or peptidyl transferase of the invention gGT25, gGT13, gGT30, gGT25-1, gGT25-3, gGT25-5, gGT29, gGT29-3, gGT29-4, gGT29-5, gGT29-6, gGT29-7, 3GT1, 3GT2, 3GT3 and 3GT4, and a dietetically or industrially acceptable carrier or excipient. Such vectors include (but are not limited to): water, buffer, glucose, water, glycerol, ethanol, and combinations thereof.

The composition may further comprise a substance for regulating the enzymatic activity of gGT25 of the present invention. Any substance having a function of enhancing the enzymatic activity is usable. Preferably, the substance that enhances the enzymatic activity of gGT25 of the present invention is selected from mercaptoethanol. In addition, a number of agents can reduce enzymatic activity, including but not limited to: ca²⁺、Co²⁺、Mn²⁺、Ba²⁺、Al³⁺、Ni²⁺、Zn²⁺And Fe²⁺(ii) a Or hydrolyzable upon addition to the substrate to form Ca²⁺、Co²⁺、Mn²⁺、Ba²⁺、Al³⁺、Ni²⁺、Zn²⁺And Fe²⁺The substance of (1).

After obtaining gGT25, gGT13, gGT30, gGT25-1, gGT25-3, gGT25-5, gGT29, gGT29-3, gGT29-4, gGT29-5, gGT29-6, gGT29-7 and 3GT1, 3GT2, 3GT3, 3GT4 of the present invention, one skilled in the art can conveniently use the enzyme to exert the transglycosylation effect, particularly on dammar-diol, protopanaxadiol and protopanaxatriol. As a preferred embodiment of the present invention, there are also provided two methods for forming rare ginsenosides, one of the methods comprising: the substrate to be transglycosylated is treated by gGT25, gGT13, gGT30, gGT25-1, gGT25-3, gGT25-5, gGT29, gGT29-3, gGT29-4, gGT29-5, gGT29-6, gGT29-7, 3GT1 and/or 3GT2 enzyme of the invention, wherein the substrate comprises tetracyclic triterpenoids such as dammarenediol, protopanaxadiol and protopanaxatriol and derivatives thereof. Preferably, the substrate to be transglycosylated is treated with said enzymes gGT25, gGT13, gGT30, gGT25-1, gGT25-3, gGT25-5, gGT29, gGT29-3, gGT29-4, gGT29-5, gGT29-6, gGT29-7 and 3GT1, 3GT2, 3GT3, 3GT4 at pH 3.5-10. Preferably, the substrate to be transglycosylated is enzymatically treated with said enzymes gGT25, gGT13, gGT30, gGT25-1, gGT25-3, gGT25-5, gGT29, gGT29-3, gGT29-4, gGT29-5, gGT29-6, gGT29-7 and 3GT1, 3GT2, 3GT3, 3GT4, gGT29-3, 3GT1 and/or 3GT2 at a temperature of 30-105 ℃.

The second method comprises: gGT25, gGT13, gGT30, gGT25-1, gGT25-3, gGT25-5, gGT29, gGT29-3, gGT29-4, gGT29-5, gGT29-6, gGT29-7 and 3GT1, 3GT2, 3GT3, 3GT4 genes described in the present invention are transferred into engineering bacteria (for example, yeast or Escherichia coli engineering bacteria) capable of synthesizing dammarenediol, protopanaxadiol or protopanaxatriol, or gGT25, gGT13, gGT30, gGT25-1, gGT25-3, gGT25-5, gGT29, gGT29-3, gGT29-4, gGT29-5, gGT29-6, gGT29-7 and GT1, 3GT2, 3GT3, 3GT4 genes are co-expressed with dammarenediol, protopanaxadiol and protopanaxatriol in host cells (for example, yeast cells or Escherichia coli) to obtain rare saponins by co-expression, rh2, Rg3, Rh1 or F1.

The key genes in the dammarenediol anabolic pathway include (but are not limited to): dammarenediol synthetase gene.

In another preferred embodiment, the key genes in the anabolic pathway of protopanaxadiol include (but are not limited to): a dammarenediol synthase gene, a cytochrome P450CYP716a47 gene, and a reductase gene of P450CYP716a47, or a combination thereof. Or isozymes of the above enzymes and combinations thereof. Wherein the dammarenediol synthetase converts oxidosqualene (synthesized by saccharomyces cerevisiae) into dammarenediol, and the cytochrome P450CYP716A47 and the reductase thereof convert the dammarenediol into protopanoxadiol. (Han et al plant & cell physiology, 2011, 52.2062-73)

In another preferred embodiment, the key genes in the anabolic pathway of protopanaxatriol include (but are not limited to): a dammarenediol synthase gene, a cytochrome P450CYP716a47 gene, a reductase gene of P450CYP716a47, and a cytochrome P450CYP716a53V2 gene, or a combination thereof. Or isozymes of the above enzymes and combinations thereof. Wherein the dammarenediol synthetase converts oxidosqualene (synthesized by saccharomyces cerevisiae) into dammarenediol, the cytochrome P450CYP716A47 and the reductase thereof convert the dammarenediol into protopanaxadiol, and the reductases of the cytochrome P450CYP716A53v2(JX036031) and P450CYP716A47 further convert the protopanaxadiol into protopanaxatriol. (Han et al plant & cell physiology, 2012, 53.1535-45)

The invention has the main advantages that:

(1) the glycosyltransferase can specifically and efficiently transfer C-20 site and/or C-6 site and/or C-3 site hydroxyl of a substrate of the tetracyclic triterpene compound into glucose;

(2) the glycosyltransferase of the present invention can specifically and efficiently transfer a glycosyl group from a glycosyl donor to the first glycosyl group at C-3 and C-6 of a tetracyclic triterpene compound to extend a sugar chain

(3) The glycosyltransferase can particularly respectively convert protopanaxadiol and protopanaxatriol into rare ginsenoside CK, Rh2 or Rg3 with anticancer activity, rare ginsenoside F1 with anti-aging activity and rare ginsenoside Rh1 with antiallergic effect;

(4) the glycosyltransferase of the present invention can also convert dammarendiol, protopanaxatriol, F1, 25-OH-PPD, 25-OCH₃New compounds 20-O-beta- (D-glucopyranosyl) -dammarendiolII, 3-O-beta- (D-glucopyranosyl) -PPT, 3-O-beta- (D-glucopyranosyl) -F1, 3-O-beta- (D-glucopyranosyl) -25-OH-PPD, 3-O-beta-D-glucopyranosyl) -25-OCH₃PPD, 3-O-beta- (D-glucopyranosyl) -lanosterol, 3-O-beta- (D-glucopyranosyl) -Ganoderic acid C2, 3-O-beta- (D-glucopyranosyl) -Agadupol A, 3-O-beta- (D-glucopyranosyl) -Hispidol B and 3-O-beta- (D-glucopyranosyl) -24(R) -Cycloartane-3beta,24, 25-triol.

(5) The catalytic activity of 3GT1, 3GT2, gGT29, gGT29-3 and gGT25-5 is not influenced by the space configuration of the hydroxyl group at the 20-position or glycosyl group on the tetracyclic triterpene compound, and can catalyze the ginsenoside (sapogenin) with 20(S) configuration and the ginsenoside (sapogenin) with 20(R) configuration.

(6) A synthetic pathway of the ginsengenin (dammarenediol, protopanaxadiol and protopanaxatriol) is constructed in yeast, so that the fermentation production of new compounds 20-O-beta- (D-glucopyranosyl) -dammarandiol II, 3-O-beta- (D-glucopyranosyl) -PPT, 3-O-beta- (D-glucopyranosyl) -F1, 3-O-beta- (D-glucopyranosyl) -lanosterol and the like and rare ginsenosides CK, F1, Rh1, Rh2 and Rg3 by using the monosaccharide such as glucose and the like as substrates is realized, and the production cost of the rare ginsenosides, F1, Rh1, Rh2 and Rg3 can be greatly reduced.

The invention will be further illustrated with reference to the following specific examples. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. Experimental procedures without specific conditions noted in the following examples, molecular cloning is generally performed according to conventional conditions such as Sambrook et al: the conditions described in the Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the manufacturer's recommendations.

Example 1

Glycosyltransferases and isolation of genes encoding them

100 cDNA sequences of predicted glycosyltransferase are extracted from published expression profile data of the panax plants, 60 cDNA full-length sequences are cloned from the cDNA sequences and are subjected to expression and transglycosylation reaction analysis, wherein 11 expression products have transglycosylation activity on ginsengenin and saponin.

Extracting RNA of ginseng and carrying out reverse transcription to obtain cDNA of ginseng. PCR amplification was performed using the cDNA as a template, using primer set 1(SEQ ID NOs.:7, 8); primer pair 2(SEQ ID nos.:9, 10); primer pair 3(SEQ ID nos.:11, 12); primer pair 5(SEQ ID nos.:34, 35); primer pair 7(SEQ ID nos.:46, 47); primer pair 8(SEQ ID nos.:62, 63); amplification products were obtained for all of the primer pairs 9(SEQ ID NOs.:64, 65). The DNA polymerase is KOD DNA polymerase with high fidelity from BAO bioengineering GmbH. The PCR products were detected by agarose gel electrophoresis (FIGS. 1,19(c) and 31). The target DNA band is cut off by irradiating under ultraviolet. Then, the amplified DNA fragment was recovered from the agarose Gel using the Axygen Gel Extraction Kit (AEYGEN). The DNA fragment was ligated to a commercially available cloning Vector pMD18-T Vector after adding A to the end of rTaq DNA polymerase from Takara Bio Inc., the ligation product was used to transform commercially available E.coli EPI300 competent cells, the transformed E.coli solution was spread on LB plates supplemented with ampicillin 50ug/mL, IPTG0.5mM, and X-Gal 25. mu.g/mL, and recombinant cloning was confirmed by PCR and digestion. One of the clones is selected to extract recombinant plasmids and then sequenced. Open Reading Frames (ORFs) were searched using the BESTORF software. By sequence alignment, ORF encodes the conserved domain of family 1 of glycosyltransferase, indicating that it is a glycosyltransferase gene.

The genes obtained with primer set 1(SEQ ID NOs.:7, 8) had the nucleotide sequences shown in SEQ ID NOs.:1, 15, 17 and 19, which were designated gGT25, gGT25-1, gGT25-3 and gGT25-5, respectively. The nucleotide numbers 1 to 1425 of the 5 'end of SEQ ID No. 1 in the sequence list are protein coding sequence (CDS) of gGT25, and the nucleotide numbers 1 to 3 of the 5' end of SEQ ID No. 1 in the sequence list are initiation codon ATG of gGT25 gene. The nucleotides 1 to 1428 of the 5 ' end of the SEQ ID NO. 15 in the sequence table are an Open Reading Frame (ORF) of gGT25-1, the nucleotides 1 to 3 from the 5 ' end of the SEQ ID NO. 15 are the initiation codon ATG of the gGT25-1 gene, and the nucleotides 1426 to 1428 from the 5 ' end of the SEQ ID NO. 15 are the termination codon TAA of the gGT25-1 gene. The nucleotides 1 to 1428 from the 5 ' end of SEQ ID No. 17 in the sequence list are the Open Reading Frame (ORF) of gGT25-3, the nucleotides 1 to 3 from the 5 ' end of SEQ ID No. 17 are the start codon ATG of gGT25-3 gene, and the nucleotides 1426 to 1428 from the 5 ' end of SEQ ID No. 17 are the stop codon TAA of gGT25-3 gene. The nucleotides 1 to 1419 from the 5 ' end of SEQ ID NO. 19 in the sequence list are an Open Reading Frame (ORF) of gGT25-5, the nucleotides 1 to 3 from the 5 ' end of SEQ ID NO. 19 are the start codon ATG of gGT25-5 gene, and the nucleotides 1426 to 1428 from the 5 ' end of SEQ ID NO. 19 are the stop codon TAA of gGT25-5 gene.

The gene obtained with primer pair 2(SEQ ID nos.:9, 10) had the nucleotide sequence shown in SEQ ID No.:3 and was named gGT 13. The nucleotides 1 to 1431 from the 5 ' end of SEQ ID No. 3 in the sequence list are the Open Reading Frame (ORF) of gGT13, the nucleotides 1 to 3 from the 5 ' end of SEQ ID No. 3 are the start codon ATG of the gGT13 gene, and the nucleotides 1429 to 1431 from the 5 ' end of SEQ ID No. 1 are the stop codon TAA of the gGT13 gene.

The gene obtained with primer pair 3(SEQ ID nos.:11, 12) had the nucleotide sequence shown in SEQ ID No.:5 and was named gGT 30. The nucleotides 1 to 1353 from the 5 ' end of SEQ ID No.5 in the sequence list are an Open Reading Frame (ORF) of gGT30, the nucleotides 1 to 3 from the 5 ' end of SEQ ID No.5 are the start codon ATG of the gGT30 gene, and the nucleotides 1351 to 1353 from the 5 ' end of SEQ ID No.5 are the stop codon TAA of the gG30 gene.

The gene obtained with primer pair 5(SEQ ID NOs.:34, 35) had the nucleotide sequence shown in SEQ ID NOs.:25, 27, and was designated gGT29 and gGT29-3, respectively. Nucleotide numbers 1 to 1329 of the 5 ' end of the SEQ ID No. 25 in the sequence list are Open Reading Frames (ORFs) of gGT29, nucleotide numbers 1-3 of the 5 ' end of the SEQ ID No. 25 are initiation codon ATG of gGT29 gene, and nucleotide numbers 1327 to 1329 of the 5 ' end of the SEQ ID No. 25 are stop codon TAG of gG29 gene. The nucleotides 1-3 from the 5 'end of the SEQ ID NO. 27 are the initiation codon ATG of the gGT29-3 gene, and the nucleotides 1327-1329 from the 5' end of the SEQ ID NO. 27 are the stop codon TAG of the gGT29-3 gene.

The gene obtained with primer pair 6(SEQ ID NOs.:46, 47) had the nucleotide sequence shown in SEQ ID No.:42 and was designated 3GT 4. The nucleotides 1 to 1374 from the 5 ' end of SEQ ID No. 42 in the sequencing list are the Open Reading Frame (ORF) of 3GT4, the nucleotides 1 to 3 from the 5 ' end of SEQ ID No. 42 are the initiation codon ATG of 3GT4 gene, and the nucleotides 1372 to 1374 from the 5 ' end of SEQ ID No. 42 are the termination codon TAG of 3GT4 gene.

The genes obtained with primer pair 7(SEQ ID NOs.:62, 63) had the nucleotide sequences shown in SEQ ID NO.54, 56, 58, and were designated gGT29-4, gGT29-5 and gGT 29-6. The nucleotides 1 to 1341 from the 5 ' end of the SEQ ID No.54 in the sequence list are the Open Reading Frame (ORF) of gGT29-4, the nucleotides 1 to 3 from the 5 ' end of the SEQ ID No.54 are the initiation codon ATG of the gGT29-4 gene, and the nucleotides 1339 to 1341 from the 5 ' end of the SEQ ID No.54 are the termination codon TAG of the gGT29-4 gene. The nucleotides 1 to 1341 from the 5 ' end of the SEQ ID NO. 56 in the sequence list are the Open Reading Frame (ORF) of gGT29-5, the nucleotides 1 to 3 from the 5 ' end of the SEQ ID NO. 56 are the initiation codon ATG of the gGT29-5 gene, and the nucleotides 1339 to 1341 from the 5 ' end of the SEQ ID NO. 56 are the termination codon TAG of the gGT29-5 gene. The nucleotides 1 to 1341 from the 5 ' end of SEQ ID No. 58 in the sequence list are the Open Reading Frame (ORF) of gGT29-6, the nucleotides 1 to 3 from the 5 ' end of SEQ ID No. 58 are the initiation codon ATG of the gGT29-6 gene, and the nucleotides 1339 to 1341 from the 5 ' end of SEQ ID No. 58 are the termination codon TAG of the gGT29-6 gene.

The gene obtained with primer pair 8(SEQ ID NOs.:64, 65) had the nucleotide sequence shown in SEQ ID No.60 and was named gGT 29-7. The nucleotides 1 to 1341 from the 5 ' end of SEQ ID No.60 in the sequence list are the Open Reading Frame (ORF) of gGT29-7, the nucleotides 1 to 3 from the 5 ' end of SEQ ID No.60 are the initiation codon ATG of the gGT29-7 gene, and the nucleotides 1339 to 1341 from the 5 ' end of SEQ ID No.60 are the termination codon TAG of the gGT29-7 gene. Artificially synthesized nucleotide sequences shown in SEQ ID NOs 21, 23 and 40 and named 3GT1, 3GT2 and 3GT3 respectively. In the sequence list, nucleotides 1 to 1488 of the 5 ' end of SEQ ID No. 21 are the Open Reading Frame (ORF) of 3GT1, nucleotides 1 to 3 of the 5 ' end of SEQ ID No. 21 are the initiation codon ATG of 3GT1 gene, and nucleotides 1486 to 1488 of the 5 ' end of SEQ ID No. 21 are the termination codon TAA of 3GT1 gene. The nucleotides 1 to 1488 of the 5 ' end of SEQ ID No. 23 in the sequencing list are the Open Reading Frame (ORF) of 3GT2, the nucleotides 1 to 3 of the 5 ' end of SEQ ID No. 23 are the initiation codon ATG of 3GT2 gene, and the nucleotides 1486 to 1488 of the 5 ' end of SEQ ID No. 23 are the stop codon TAA of 3GT2 gene. The nucleotides 1 to 1494 from the 5 ' end of SEQ ID No. 40 in the sequence listing are the Open Reading Frame (ORF) of 3GT3, the nucleotides 1 to 3 from the 5 ' end of SEQ ID No. 40 are the start codon ATG of 3GT3 gene, and the nucleotides 1492 to 1494 from the 5 ' end of SEQ ID No. 40 are the stop codon TAA of 3GT3 gene. Two of the artificially synthesized genes (SEQ ID NO: 21 and SEQ ID NO: 23) were PCR-amplified with a primer pair 4(SEQ ID NOs.:29, 30) to obtain a PCR product having the nucleotide sequences shown in SEQ ID NO: 21 and SEQ ID NO: 23 (FIG. 19 (a)); another artificially synthesized gene (SEQ ID No.:40) was PCR amplified with primer pair 6(SEQ ID nos.:44, 45) to obtain a PCR product having a nucleotide sequence shown in SEQ ID No.:40 (fig. 19 (b)).

The glycosyltransferase gene gGT25 encodes a protein gGT25 containing 475 amino acids, having the amino acid sequence shown in SEQ ID No. 2 of the sequence Listing. The theoretical molecular weight of the protein is predicted to be 53kDa by software, and the isoelectric point pI is 5.14. From the amino terminus of SEQ ID NO. 2, position 344-387 is a family 1 conserved domain of glycosyltransferase. The amino acid sequence of the glycosyltransferase is less than 52% identical to the amino acid sequence of a saponin glycosyltransferase gene predicted in a ginseng transcriptome.

The glycosyltransferase gene gGT25-1 encodes a protein gGT25-1 containing 475 amino acids, and has an amino acid sequence shown in SEQ ID No. 16 of the sequence list. The theoretical molecular weight of the protein is predicted to be 53kDa by software, and the isoelectric point pI is 4.91. Position 344 and 387 from the amino terminus of SEQ ID NO. 16 is a family 1 conserved domain of glycosyltransferase. The amino acid sequence of the glycosyltransferase is less than 52% identical to the amino acid sequence of a saponin glycosyltransferase gene predicted in a ginseng transcriptome.

The glycosyltransferase gene gGT25-3 encodes a protein gGT25-3 containing 475 amino acids, and has an amino acid sequence shown in SEQ ID No. 18 of the sequence list. The theoretical molecular weight of the protein is predicted to be 53kDa by software, and the isoelectric point pI is 5.05. 18 from the amino terminus of SEQ ID No. 18 is the glycosyltransferase family 1 conserved domain at position 344 and 387. The amino acid sequence of the glycosyltransferase is less than 52% identical to the amino acid sequence of a saponin glycosyltransferase gene predicted in a ginseng transcriptome.

The glycosyltransferase gene gGT25-5 encodes a protein gGT25-5 containing 472 amino acids, and has an amino acid sequence shown in SEQ ID No. 20 of the sequence list. The theoretical molecular weight of the protein is predicted to be 53kDa by software, and the isoelectric point pI is 4.98. The amino-terminal 343- & ltSUB & gt position 386 from SEQ ID NO. 20 is a family 1 conserved domain of glycosyltransferase. The amino acid sequence of the glycosyltransferase is less than 52% identical to the amino acid sequence of a saponin glycosyltransferase gene predicted in a ginseng transcriptome.

The glycosyltransferase gene gGT13 encodes a protein gGT13 containing 476 amino acids, and has an amino acid sequence shown as a sequence SEQ ID No. 4 in a sequence table. The theoretical molecular weight of the protein is predicted to be 53kDa by software, and the isoelectric point pI is 4.91. Amino-terminal position 343-386 from SEQ ID NO. 4 is a family 1 conserved domain of glycosyltransferase. The amino acid sequence of the glycosyltransferase is up to 99.5% identical with the predicted amino acid sequence of saponin glycosyltransferase gene in ginseng transcriptome.

The glycosyltransferase gene gGT30 encodes a protein gGT30 containing 451 amino acids, and has an amino acid sequence shown in SEQ ID No.6 of the sequence list. The theoretical molecular weight of the protein is predicted to be 51kDa by software, and the isoelectric point pI is 6.79. Amino-terminal position 318-361 of SEQ ID NO.6 is a family 1 conserved domain of glycosyltransferase. The glycosyltransferase has the highest similarity (53%) with the glycosyltransferase of grape of vinifera (Vitis vinifera) (XP-002271587), indicating that the glycosyltransferase is a novel enzyme.

The glycosyltransferase gene 3GT1 encodes a protein 3GT1 having 495 amino acids and having the amino acid sequence shown in SEQ ID No. 22 of the sequence list. The theoretical molecular weight of the protein is predicted to be 56kDa by software, and the isoelectric point pI is 5.52. The 355-398 th site from the amino-terminus of SEQ ID NO. 22 is a family 1 conserved domain of glycosyltransferase. The glycosyltransferase has > 99% homology with a glycosyltransferase UGT73C10 derived from Arabidopsis thaliana (Barbarea vulgaris)

The glycosyltransferase gene 3GT2 encodes a protein 3GT2 having 495 amino acids and having the amino acid sequence shown in SEQ ID No. 24 of the sequence listing. The theoretical molecular weight of the protein is predicted to be 56kDa by software, and the isoelectric point pI is 5.62. The 355-398 th site from the amino-terminus of SEQ ID NO. 24 is a family 1 conserved domain of glycosyltransferase. The glycosyltransferase has > 99% homology with a glycosyltransferase UGT73C12 derived from Arabidopsis thaliana (Barbarea vulgaris)

The glycosyltransferase gene gGT29 encodes a protein gGT29 containing 442 amino acids having the amino acid sequence shown in SEQ ID No. 26 of the sequence Listing. The theoretical molecular weight of the protein is predicted to be 49kDa by software, and the isoelectric point pI is 5.93. 26 is a glycosyltransferase family 1 conserved domain at position 317-360 from the amino terminus of SEQ ID NO. The glycosyltransferase has a sequence similarity of less than 56% to a glycosyltransferase derived from Vitis vinifera (Vitis vinifera).

The glycosyltransferase gene gGT29-3 encodes a protein gGT29-3 with 442 amino acids, and has the amino acid sequence shown in SEQ ID No. 28 of the sequence list. The theoretical molecular weight of the protein is predicted to be 49kDa by software, and the isoelectric point pI is 5.48. Position 317-360 from the amino terminus of SEQ ID NO. 28 is a family 1 conserved domain of glycosyltransferase. The glycosyltransferase has a sequence similarity of less than 56% to a glycosyltransferase derived from Vitis vinifera (Vitis vinifera).

The glycosyltransferase gene 3GT3 encodes a 497 amino acid-containing protein 3GT3 having the amino acid sequence shown in SEQ ID No. 41 of the sequence Listing. The theoretical molecular weight of the protein is predicted to be 55kDa by software, and the isoelectric point pI is 5.50. 41 is a glycosyltransferase family 1 conserved domain at position 350-393 from the amino terminus of SEQ ID no. The glycosyltransferase has a homology of > 99% with a glycosyltransferase derived from Medicago truncatula.

The glycosyltransferase gene 3GT4 encodes a protein 3GT4 having 458 amino acids and having the amino acid sequence shown in SEQ ID No. 43 of the sequence Listing. The theoretical molecular weight of the protein is predicted to be 51kDa by software, and the isoelectric point pI is 5.10. From the amino terminus of SEQ ID NO. 43, position 333-376 is the conserved domain of glycosyltransferase family 1. The glycosyltransferase has less than 50% sequence homology with a glycosyltransferase derived from Vitis vinifera (Vitis vinifera).

The glycosyltransferase gene gGT29-4 encodes a protein gGT29-4 containing 446 amino acids, and has an amino acid sequence shown in SEQ ID No. 55 in the sequence table. The theoretical molecular weight of the protein is predicted to be 50kDa by software, and the isoelectric point pI is 5.78. 55 is a family 1 conserved domain of glycosyltransferase at position 321-364. The glycosyltransferase has a sequence similarity of less than 57% to a glycosyltransferase derived from Bupleurum chinense (Bupleurum chinense).

The glycosyltransferase gene gGT29-5 encodes a protein gGT29-5 containing 446 amino acids, and has an amino acid sequence shown in SEQ ID No. 57 of the sequence list. The theoretical molecular weight of the protein is predicted to be 50kDa by software, and the isoelectric point pI is 5.93. Amino-terminal position 321-364 from SEQ ID NO. 57 is a family 1 conserved domain of glycosyltransferase. The glycosyltransferase has a sequence similarity of less than 58% to a glycosyltransferase derived from Bupleurum chinense (Bupleurum chinense).

The glycosyltransferase gene gGT29-6 encodes a protein gGT29-6 containing 446 amino acids, and has an amino acid sequence shown in SEQ ID No. 59 of the sequence list. The theoretical molecular weight of the protein is predicted to be 50kDa by software, and the isoelectric point pI is 6.03. Amino-terminal position 321-364 from SEQ ID NO. 59 is a family 1 conserved domain of glycosyltransferase. The glycosyltransferase has less than 59% sequence similarity with a glycosyltransferase derived from Bupleurum chinense (Bupleurum chinense).

The glycosyltransferase gene gGT29-7 encodes a protein gGT29-7 containing 446 amino acids, and has an amino acid sequence shown in SEQ ID No. 61 of the sequence list. The theoretical molecular weight of the protein is predicted to be 50kDa by software, and the isoelectric point pI is 5.80. Amino-terminal position 321-364 from SEQ ID No. 61 is a family 1 conserved domain of glycosyltransferase. The glycosyltransferase has a sequence similarity of less than 57% to a glycosyltransferase derived from Bupleurum chinense (Bupleurum chinense).

Table 2 shows a summary of the glycosyl catalytic effect of the glycosyltransferases of the invention on different positions of the substrate, with "+" indicating activity at that position.

TABLE 2

Note a: glycosylation at the C-6 position can only be performed if the C-20 has been glycosylated

Example 2

Construction of recombinant expression vectors for glycosyltransferase genes gGT25, gGT25-1, gGT25-3 and gGT25-5 in Yeast

The target gene was amplified using plasmids gGT25-pMD18T, gGT25-1-pMD18T, gGT25-3-pMD18T and gGT25-5-pMD18T containing gGT25, gGT25-1, gGT25-3 and gGT25-5 genes constructed in example 1 as templates.

The forward primers used were:

5'-GCCGGAGCTCATGAAGTCAGAATTGATATTC-3' (SEQ ID NO: 13), which has added to its 5 ' end a SacI recognition site: GAGCTC;

the reverse primers used were:

5'-GCCGCTCGAGTTAATGATGATGATGATGATGCATAATTTCCTCAAATAGCTTC-3' (SEQ ID NO: 14), which has added at its 5 ' end a XholI recognition site: CTCGAG, reverse primer was introduced into 6 × His Tag for expression and purification by Western Blot.

gGT25, gGT25-1, gGT25-3 and gGT25-5 genes were amplified by PCR using the above primers and template. The high-fidelity DNA polymerase kod from Toyobo company is selected as the DNA polymerase, and the PCR program is set by referring to the specification: 94 ℃ for 2 min; 15s at 94 ℃, 30s at 58 ℃ and 1.5min at 68 ℃ for 30 cycles; 10min at 68 ℃; keeping the temperature at 10 ℃. And detecting the PCR product through agarose gel electrophoresis, and cutting off a band with the size consistent with that of the target DNA under ultraviolet light. Then, the DNA fragment was recovered from the agarose Gel using AxyPrep DNA Gel Extraction Kit from AXYGEN. The recovered DNA fragment was digested with the Quickcut restriction enzymes Kpn I and Xba I from Takara for 30min, and the digested product was collected by cleaning with AxyPrep PCR clean Kit from AXYGEN. The cleavage products were ligated with the Saccharomyces cerevisiae expression plasmid pYES2 (likewise cleaved with Kpn I and Xba I and recovered by tapping) using T4DNA ligase from NEB for 2h at 25 ℃. Coli TOP10 competent cells were transformed and plated on LB plates supplemented with 100. mu.g/mL ampicillin. Positive transformants were verified by colony PCR and further verified by sequencing, which indicated successful construction of expression plasmids gt25-pYES2, gt25-1-pYES2, gt25-3-pYES2 and gt25-5-pYES 2.

Example 3

Expression of glycosyltransferase genes gGT25, gGT25-1, gGT25-3 and gGT25-5 in Saccharomyces cerevisiae

The constructed expression plasmid gt25-pYES2 was transformed into Saccharomyces cerevisiae (Saccharomyces cerevisiae) by an electrotransformation method, and spread on a screening plate SC-Ura (0.67% yeast without amino acid basic nitrogen source, 2% glucose). Yeast recombinants were verified by colony PCR. Selecting yeastThe colonies of the group were cultured in 10mL of SC-Ura (2% glucose) medium at 30 ℃ and 200rpm for 20 hours. Centrifuging at 4 deg.C to 3500g, collecting thallus, washing thallus twice with sterile deionized water, resuspending thallus with induction culture medium SC-Ura (2% galactose), and inoculating into 50mL induction culture medium to make OD₆₀₀The induction of expression started at around 0.4, 200rpm at 30 ℃. 3500g of thalli for induced expression for 12h is collected by centrifugation at 4 ℃, the thalli is washed twice by sterile deionized water and is suspended in yeast lysis buffer solution to ensure that OD is achieved₆₀₀Between 50 and 100. The yeast cells were disrupted by shaking with a Fastprep cell disrupter, centrifuged at 12000g at 4 ℃ for 10min to remove cell debris, and the supernatant of the cell lysate was collected. And (3) performing SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis) detection on a proper amount of lysate supernatant, wherein the gt25-pYES2, the gt25-1-pYES2, the gt25-3-pYES2 and the gt25-5-pYES2 recombinants have no obvious band characteristics compared with the recombinants of the empty vector of pYES2, as shown in figure 2. Expression was examined by anti-6 XHis Tag Western Blot and, as shown in FIG. 3, the Saccharomyces cerevisiae recombinants expressing gGT25, gGT25-1, gGT25-3 and gGT25-5 showed strong Western Blot signals, indicating that gGT25, gGT25-1, gGT25-3 and gGT25-5 were expressed in yeast in a soluble manner, whereas recombinants transfected with empty vector pYES2 did not have anti-6 XHis Tag Western Blot signals.

Example 4

Yeast expression products gGT25, gGT25-1, gGT25-3 and gGT25-5 transglycosylation reactions and product identification

Recombinant yeast lysis supernatants expressing gGT25, gGT25-1, gGT25-3 and gGT25-5 were used as enzyme solutions to catalyze transglycosylation reactions of protopanaxadiol (Protopaxadiol PPD), Protopanaxatriol (Protopanaxatriol PPT) and Dammarenediol (Dammarenediol II, DM) substrates, and recombinant yeast lysis supernatants expressing empty vectors were used as controls. The 100 μ L reaction is shown in table 3:

TABLE 3

9% Tween 20	11.1μL
		50mM UDP-glucose	10μL
1M Tris-HCl pH8.5	5μL
		100mM substrate (ethanol soluble)	0.5μL
Enzyme solution	73.4μL

The reaction was carried out at 35 ℃ for 12h, then 100. mu.L of butanol was added to terminate the reaction and the product was extracted. The product was dried under vacuum and dissolved in methanol.

Detecting the reaction product by Thin Layer Chromatography (TLC), and converting the supernatant enzyme solution of recombinant yeast lysis expressed in gGT25, gGT25-1 or gGT25-3 into rare ginsenosides CK and F1 (FIG. 6 and FIG. 7) respectively by glycosylation at 20-hydroxy of protopanaxadiol and protopanaxatriol; protopanaxadiol type saponins (Rh2 and Rg3) with glycosylated 3-hydroxy can be catalyzed by gGT25, gGT25-1 and gGT25-3 to continuously glycosylate 20-hydroxy to respectively generate F2 and Rd (figure 6); gGT25, gGT25-1 and gGT25-3 can not only glycosylate the hydroxyl at position 20 of PPT to generate F1, but also can further glycosylate the hydroxyl at position 6 to form Rg1 (FIG. 7); gGT25, gGT25-1 and gGT25-3 can also glycosylate the 20-hydroxyl of dammarenediol, the precursor of PPD, to obtain a non-reported saponin 20-O-beta- (D-glucopyranosyl) -dammarendiiolII (FIG. 8). However, protopanaxatriol-type saponins (Rh1, Rg2 and Rf), in which the hydroxyl group at the 6-position has been glycosylated, cannot glycosylate the hydroxyl group at the 20-position under the catalysis of gGT25, gGT25-1 and gGT 25-3. Meanwhile, gGT25, gGT25-1 and gGT25-3 also failed to catalyze the extension of sugar chains. gGT25-5 has a catalytic activity different from that of gGT25, gGT25-1 and gGT25-3, and it cannot be glycosylated at the 20-hydroxyl of PPD, PPT or dammarenediol, like gGT25, gGT25-1 and gGT25-3, and it can only glycosylate the 6-hydroxyl of PPT to convert it into rare ginsenoside Rh1 (FIG. 7).

The gGT25 conversion product was further characterized by HPLC (FIGS. 10 and 11). In fig. 10, three peaks appear, wherein peak 2 is consistent with the retention time of CK in the standard sample and peak 3 is consistent with the peak of protopanoxadiol. Peak 3 is already small, indicating that protopanoxadiol is essentially converted to CK. Peak 1, also present in the negative control pattern, should be independent of protopanoxadiol conversion. In fig. 11, three peaks also appear, peak 1 corresponding to the retention time of F1 in the standard sample, and peak 3 corresponding to the peak of protopanaxatriol. Peak 3 was already small, indicating that protopanaxatriol is essentially converted to F1. Peak 2, also present in the negative control pattern, should be independent of protopanaxatriol conversion.

Finally, the product was further characterized by LC/MS (FIGS. 12 and 13). FIG. 12 is a mass spectrum of CK peak (peak 2 in FIG. 10) in protopanaxadiol conversion product, which is completely consistent with that of the standard CK sample. FIG. 13 is a mass spectrum of the F1 peak (peak 1 in FIG. 11) in the protopanaxatriol conversion product, which is completely identical to that of the standard sample F1. These results further confirm the gGT25 conversion products of protopanaxadiol and triol as CK and F1, respectively.

Example 5

Cloning and expression of glycosyltransferase genes gGT13 and gGT30, and transglycosylation reaction of expression product thereof

In the same manner as in example 2, gGT13 and gGT30 clones were obtained, and their yeast recombinant expression vectors were constructed and transformed into s.cerevisiae. Expression of glycosyltransferase was induced according to the same procedure as in example 3, and although no band of the target protein was evident on SDS-PAGE gel (FIG. 4), Western Blot detected significant hybridization information, indicating that gGT13 and gGT30 were both expressed in yeast (FIG. 5).

Protopanaxadiol (PPD) and protopanaxatriol (PPT) were catalyzed by recombinant yeast cell lysates expressing gGT13 and gGT30, respectively, in the same manner as in example 4.

As a result, it was found that neither of the protein expression products of gGT13 and gGT30 converted PPD or PPT (fig. 9); neither gGT13 nor gGT30 converted protopanaxadiol type saponins Rh2, CK, F2 and Rg3 and protopanaxatriol type F1, Rh1 and Rg 1.

The above results indicate that, although gGT13 has a high (99.5%) identity to the predicted amino acid sequence of ginsenoside glycosyltransferase in ginseng transcriptome, neither gGT13 nor gGT30 has transglycosylation on the above substrate.

Example 6

Expression of glycosyltransferase gene gGT25 in Escherichia coli and transglycosylation reaction of its expression product

The target gene gGT25 was amplified using the gGT25 gene-containing plasmid gGT25-pMD18T constructed in example 1 as a template, and cloned into E.coli expression vector pet28a (purchased from Merck), and E.coli expression vector gt25-pet28a was constructed and transformed into E.coli BL 21. Inoculating a recombinant into LB medium, culturing at 30 deg.C and 200rpm to OD₆₀₀About 0.6-0.8, cooling the bacterial liquid to 4 ℃, adding IPTG with the final concentration of 50 mu M, and inducing expression for 15h at 18 ℃ and 200 rpm. Centrifuging at 4 deg.C to collect thallus, ultrasonically breaking cells, centrifuging at 4 deg.C to 12000g to collect cell lysate supernatant, and performing SDS-PAGE electrophoresis on the sample.

Western Blot (FIG. 14) showed that glycosyltransferase gGT25 was also expressed in E.coli under 50. mu.M IPTG induction conditions. The transglycosylation reaction was carried out using the supernatant of the cell lysate of the recombinant Escherichia coli as a crude enzyme solution under the same conditions as in example 4.

The reaction was carried out at 35 ℃ for 12h, then 100. mu.L of butanol was added to terminate the reaction and the product was extracted. The product was dried under vacuum and dissolved in methanol. The reaction product was first detected by Thin Layer Chromatography (TLC), and gGT25 crude enzyme solution was observed in FIG. 15 to convert PPD to CK.

Example 7

Construction of CK-producing yeast engineering bacteria and product identification

On pESC-HIS plasmid ((Stratagene, Agilent), Dammarenediol synthase (ACZ71036.1) (GAL1/GAL10GAL10 side promoter, ADH1 terminator), cytochrome P450CYP716A47(AEY75213.1) (FBA1 promoter, CYC1 terminator) and glycosyltransferase GT25(GAL1/GAL10GAL1 side promoter, TDH2 terminator) were simultaneously assembled to construct episomal plasmid, Saccharomyces cerevisiae BY4742 was transformed, and Arabidopsis derived cytochrome P450 reductase ATR2-1 (NP-849472.2) was integrated into Saccharomyces cerevisiae BY4742 chromosome at chromosomal trp1 gene site (GAL1 promoter, using original terminator of ATtrp 1), recombinant Saccharomyces cerevisiae BY was constructed in the same manner, with the difference that Arabidopsis derived yeast reductase 2-1 was constructed on plasmid containing both the promoters of Dammarenediol synthase (ACZ), ATR 47-TI synthase (ATR), ATR 25-TI 639 and TEI 639, the promoters and terminators of the other 3 genes are the same as the corresponding genes of the recombinant bacterium A.

Recombinant yeast C was constructed in the same manner as recombinant yeast B, but the promoters and terminators of the respective genes were reprogrammed, as shown in Table 4.

Table 4 major enzyme promoter and terminator make up:

major enzymes	Promoters	Terminator
			Dammarenediol synthetase	GAL1/GAL10GAL10 side	ADH1
CYP716A47	GAL1/GAL10GAL1 side	TDH2
			ATR2-1	TEF2	TPI1
GT25	FBA1	CYC1

Fermenting the recombinant yeast strains A, B and C in an SC-Ura (0.67% of yeast has no amino acid basic nitrogen source and 2% of galactose) culture medium, wherein amino acid or uracil which is additionally added to each recombinant bacterium is shown in Table 5, taking 50mL of fermentation liquor of the recombinant yeast, resuspending the centrifuged and precipitated thallus in 5mL of yeast lysis buffer (50mM Tris-HCl, 1mM EDTA, 1mM PMSF, 5% glycerol, pH7.5), shaking the lysed yeast by Fastprep, setting the power to be 6M/S, and shaking for 7-8 times to fully lyse the yeast. The lysate was transferred to 2mL EP tubes, each containing 1mL, extracted with an equal volume (1mL) of n-butanol for about 30min and then centrifuged at 12000g for 10 min. The supernatant was pipetted into a new EP tube. The n-butanol was evaporated to dryness at 45 ℃ and under vacuum. Dissolved in 100. mu.L of methanol and used for HPLC detection.

By HPLC analysis, the cell lysate of recombinant yeast A contains dammarenediol, protopanaxadiol (PPD) and ginsenoside active metabolite CK (figure 16), and the yield of CK synthesized by yeast A reaches 0.6 mg/L. HPLC analysis likewise found that cell lysates of recombinant yeasts B and C contained traces of CK.

TABLE 5 corresponding amino acids or uracils to be supplemented by recombinant yeasts

Recombinant yeast strains	With addition of amino acids or uracils
		A	0.01% tryptophan (tryptophan), leucine (leucine), lysine (lysine)
B	0.01% uracil (uracil), leucine (leucine), lysine (lysine)
		C	0.01% uracil (uracil), leucine (leucine), lysine (lysine)

Example 8

Construction of Rh 1-producing yeast engineering bacteria and product identification

On pESC-HIS plasmid ((Stratagene, Agilent), Dammarenediol synthase) (ACZ71036.1) (GAL1/GAL10GAL10 side promoter, ADH1 terminator), cytochrome P450CYP716A47(AEY75213.1) (FBA1 promoter, CYC1 terminator), cytochrome P450CYP716A53V2 gene (ENO2 promoter, CYC1 terminator) and glycosyltransferase gGT25-5(GAL1/GAL10GAL1 side promoter, TDH2 terminator) were simultaneously assembled to construct an episomal plasmid, Saccharomyces cerevisiae 4742 was transformed, and cytochrome P450 reductase from Arabidopsis thaliana, ATR2-1 (NP-849472.2) was integrated into the chromosomal trp1 gene site (GAL1 promoter, using BYp 1 original terminator) in Saccharomyces cerevisiae BY4742 to construct a recombinant uracil recombination gene required for yeast or yeast uracil recombination.

The recombinant yeast A3 lysate was transferred to 2mL EP tubes, each containing 1mL, extracted with an equal volume (1mL) of n-butanol for about 30min and centrifuged at 12000g for 10 min. The supernatant was pipetted into a new EP tube. The n-butanol was evaporated to dryness at 45 ℃ and under vacuum. Dissolved in 100. mu.L of methanol and used for HPLC detection.

By HPLC analysis, the cell lysate of recombinant yeast a3 contained protopanaxatriol (PPT) and ginsenoside active metabolite Rh1 (fig. 41).

Example 9

Construction of recombinant expression vectors for glycosyltransferase genes 3GT1, 3GT2, 3GT3 and 3GT4 in E.coli

The plasmids 3GT1-pMD18T, 3GT2-pMD18T containing the genes 3GT1 and 3GT2 constructed in example 1 were used as templates to amplify the target genes.

The forward primers used for 3GT1 and 3GT2 were both SEQ ID No. 31 with the 5' end added a BamH I recognition site: GGATCC; 3GT1 the reverse primer used was SEQ ID No. 32 with the addition of a Sal I recognition site at the 5' end: CTCGAG; the reverse primer used for 3GT2 is SEQ ID No. 33, which has added to its 5' end a Sal I recognition site: CTCGAG.

The 3GT1 and 3GT2 genes were amplified by PCR using the above primers and templates. The high-fidelity DNA polymerase KOD of Toyobo company is selected as the DNA polymerase, and the PCR program is set by referring to the specification: 94 ℃ for 2 min; 15s at 94 ℃, 30s at 58 ℃ and 1.5min at 68 ℃ for 35 cycles; 10min at 68 ℃; keeping the temperature at 10 ℃. And detecting the PCR product through agarose gel electrophoresis, and cutting off a band with the size consistent with that of the target DNA under ultraviolet light. Then, the DNA fragment was recovered from the agarose Gel using AxyPrep DNA Gel Extraction Kit from AXYGEN. The recovered DNA fragment was digested with the Quickcut restriction enzymes Kpn I and Xba I from Takara for 30min, and the digested product was collected by cleaning with AxyPrep PCR clean Kit from AXYGEN. The cleavage products were ligated with E.coli expression plasmid pET28a (likewise digested with BamH I and Sal I and recovered by tapping) using T4DNA ligase from NEB for 4h at 16 ℃. Coli EPI300 competent cells were transformed with the ligation product and plated on LB plates supplemented with 50. mu.g/mL kanamycin. Positive transformants were verified by colony PCR and sequencing further verified the successful construction of the expression plasmids 3GT1-pET28a and 3GT2-pET28 a.

The plasmids 3GT3-pMD18T, 3GT4-pMD18T containing the genes 3GT3 and 3GT4 constructed in example 1 were used as templates to amplify the target genes.

The forward primer used for 3GT3 is shown in SEQ ID NO. 48, and the 5' end of the forward primer is added with a sequence homologous to the vector pET28 a: ACTTTAAGAAGGAGATATACC, respectively; the reverse primer used in 3GT3 is shown in SEQ ID No. 49, and the 5' end of the reverse primer is added with a sequence homologous to the vector pET28 a: CTCGAGTGCGGCCGCAAGCTT are provided.

3GT4 used a forward primer of SEQ ID No. 50 to which was added at the 5' end a sequence homologous to vector pET28 a: ACTTTAAGAAGGAGATATACC, respectively; the reverse primer used for 3GT4 was SEQ ID No. 51, to the 5' end of which was added an 18 base fragment homologous to the vector pET28 a: CTCGAGTGCGGCCGCAAGCTT are provided.

The genes for 3GT3 and 3GT4 were amplified by PCR using the above primers. The Q5 high-fidelity DNA polymerase of NEB company is selected as the amplification gene, and the PCR program is set according to the specification: 30s at 98 ℃; 35 cycles of 98 ℃ for 15s, 58 ℃ for 30s and 72 ℃ for 1 min; 2min at 72 ℃; keeping the temperature at 10 ℃.

Meanwhile, the vector pET28a was amplified using SEQ ID NO. 52 and SEQ ID NO. 53 as forward and reverse primers, respectively, to obtain a linearized vector pET28 a. The linear vector for pET28a amplification was also obtained using Q5 high fidelity DNA polymerase from NEB, and the PCR program was set up with reference to the description: 30s at 98 ℃; 35 cycles of 98 ℃ for 15s, 58 ℃ for 30s and 72 ℃ for 3 min; 2min at 72 ℃; keeping the temperature at 10 ℃.

The PCR products of the 3GT3 and 3GT4 genes and the linearized vector pET28a were detected by agarose gel electrophoresis, and the bands with the same size as the target DNA were excised under ultraviolet light. Then, the DNA fragment was recovered from the agarose Gel using AxyPrep DNA Gel Extraction Kit from AXYGEN. The recovered linearized pET28a vector fragment, the recovered 3GT3 or 3GT4 gene fragment, and the BGclonart seamless cloning reaction solution of NocGregorian Biotech Co., Ltd were mixed in an appropriate ratio to give 20. mu.l in total, with reference to the BGclonart seamless cloning kit of NocGregorian Biotech Co., Ltd. After mixing, incubation was carried out at 50 ℃ for 30 minutes, and then the mixed reaction solution was transferred to ice. Coli EPI300 competent cells were transformed with 5. mu.l of the reaction solution and plated on LB plates supplemented with 50. mu.g/mL kanamycin. Positive transformants were verified by colony PCR and sequencing further verified the successful construction of the expression plasmids 3GT3-pET28a and 3GT4-pET28 a.

Example 10

Expression of glycosyltransferase genes 3GT1, 3GT2, 3GT3 and 3GT4 in E.coli

The E.coli expression vectors constructed in example 9 were 3GT1-pET28a, 3GT2-pET28a, 3GT3-pET28a and 3GT4-pET28a, into commercially available E.coli BL 21. Inoculating a recombinant into LB medium, culturing at 30 deg.C and 200rpm to OD₆₀₀About 0.6-0.8, cooling the bacterial liquid to 4 ℃, adding IPTG with the final concentration of 50 mu M, and inducing expression for 15h at 18 ℃ and 200 rpm. The cells were collected by centrifugation at 4 ℃ and disrupted by sonication, and the supernatant of cell lysate was collected by centrifugation at 12000g at 4 ℃ and subjected to SDS-PAGE on a sample (FIG. 20). Compared with the recombinants of the pet28a empty vector, the 3GT1-pet28a, 3GT2-pet28a, 3GT3-pet28a and 3GT4-pet28a recombinants have distinct bands (about 55KD) characterizing 3GT1, 3GT2, 3GT3 and 3GT 4. From the results of Western Blot (fig. 21), it was also confirmed that the target proteins 3GT1, 3GT2, 3GT3 and 3GT4 achieved soluble expression in the host.

Example 11

Coli expression products 3GT1, 3GT2, 3GT3 and 3GT4 transglycosylation reactions and product identification

Recombinant Escherichia coli cracking supernatants expressing 3GT1, 3GT2, 3GT3 and 3GT4 are used as crude enzyme liquid to catalyze the transglycosylation reaction of ginsenoside and sapogenin, and recombinant Escherichia coli cracking supernatants expressing empty vectors are used as controls. The reaction system of 100. mu.L is shown in Table 3. The reaction was carried out at 35 ℃ for 12h, then 100. mu.L of butanol was added to terminate the reaction and the product was extracted. The product was dried under vacuum and dissolved in methanol.

Detecting the reaction product by Thin Layer Chromatography (TLC) (FIGS. 22-28, 48), and glycosylating the C3 hydroxyl of protopanaxadiol (PPD) with crude enzyme solutions of 3GT1, 3GT2, 3GT3 and 3GT4 to obtain rare ginsenoside Rh2 (FIGS. 22, 27(a) and 28 (a)); protopanaxadiol-type saponin (CK) with glycosylated 20-position hydroxyl can be further glycosylated with 3-position hydroxyl under the catalysis of crude enzyme solutions of 3GT1, 3GT2 and 3GT4 to respectively generate F2 (FIGS. 22 and 28 (b)); glycosyltransferases 3GT1 and 3GT2 can also glycosylate the hydroxyl group at C3 of Dammarenediol DM to convert it into the new compound 3-O-beta- (D-glucopyranosyl) -dammarendienol II (FIG. 23); glycosyltransferases 3GT1, 3GT2, 3GT3 and 3GT4 can glycosylate the hydroxyl group at C3 of 25-OH-PPD to convert it into the novel compound 3-O-beta- (D-glucopyranosyl) -25-OH-PPD. (FIG. 23, FIG. 27(c) and FIG. 28 (c)); 3GT1, 3GT2 and 3GT3 can also glycosylate the hydroxyl group at position C3 of protopanaxatriol (PPT) to convert it to the previously unreported neosaponin 3-O-beta- (D-glucopyranosyl) -PPT (FIGS. 24 and 27 (b)); 3GT1 and 3GT2 also glycosylated the hydroxyl at C3 of F1 to convert to the novel saponin 3-O-beta- (D-glucopyranosyl) -F1 not previously reported (FIG. 24); 3GT1 and 3GT2 can also glycosylate the hydroxyl at position C3 of lanosterol, Garoderic acid C2, Agadupol A, Hispidol B and 24(R) -Cycloartene-3 beta,24,25-triol to convert the hydroxyl at position C3 to the new compounds 3-O-beta- (D-glucopyranosyl) -lanosterol, 3-O-beta- (D-glucopyranosyl) -Garoderic acid C2, 3-O-beta- (D-glucopyranosyl) -Agadupol A, 3-O-beta- (D-glucopyranosyl) -Hispidol B and 3-O-beta- (D-glucopyranosyl) -24(R) -Cycloartene-3 beta,24,25-triol (FIGS. 26 and 48). Meanwhile, the catalytic activity of 3GT1 and 3GT2 is not affected by the spatial configuration of the 20-hydroxy group or glycosyl group, and for example, the catalytic activity can catalyze 20(S) -PPD and 20(R) -PPD to generate rare ginsenoside 20(R) -ginsenoside Rh2 (fig. 25). Although the four glycosyltransferases 3GT1, 3GT2, 3GT3 and 3GT4 can all incorporate a sugar group at the 3-position of tetracyclic triterpene sapogenins, the substrate spectra that they can catalyze differ greatly. As shown in table 6, 3GT1 and 3GT2 catalyzed the most and 3GT3 the least substrates, but 3GT4 had the best specificity, catalyzing protopanaxadiol-type saponins (PPD, CK, 25-OH-PPD, etc.), and in addition it had only weak activity against Hispidol B (fig. 48(C), table 6).

The products of 3GT1, 3GT3 and 3GT4 catalyzed PPD were further tested by HPLC (fig. 29). In fig. 29, the glycosyltransferases 3GT1, 3GT3 and 3GT4 all exhibited peaks with the same retention time in the products that catalyze PPD (P1, P2 and P3), which are consistent with the retention time of ginsenoside Rh2 in the standard, indicating that glycosyltransferases 3GT1, 3GT3 and 3GT4 catalyze PPD to generate ginsenoside Rh2. Finally, the three sample peaks in fig. 29, P1, P2, and P3, were mass-identified by LC/MS (fig. 30), which is in full agreement with the mass spectrum of the standard sample ginsenoside Rh2, further indicating that the glycosyltransferases 3GT1, 3GT3, and 3GT4 catalyze PPD to produce Rh2.

Comparison of substrates catalysed by glycosyltransferases 3GT1, 3GT2, 3GT3 and 3GT4 is shown in table 6:

TABLE 6

Example 12

Construction of Rh 2-producing yeast engineering bacteria and product identification

12.1 on pESC-HIS plasmid ((Stratagene, Agilent), Dammarenediol synthase) (ACZ71036.1) (GAL1/GAL10GAL10 side promoter, ADH1 terminator), cytochrome P450CYP716A47(AEY75213.1) (FBA1 promoter, CYC1 terminator) and glycosyltransferase 3GT4(GAL1/GAL10GAL1 side promoter, TDH2 terminator) were assembled together to construct an episomal plasmid, Saccharomyces cerevisiae BY4742 was transformed, and cytochrome P450 ATR2-1 (NP. RTM. 849472.2) derived from Arabidopsis thaliana was integrated into the chromosomal trp1 gene site (GAL1 promoter, using trp1 terminator) in Saccharomyces cerevisiae BY4742, and recombinant A1. recombinant yeast was constructed, and the corresponding amino acids or uracil to be supplemented were shown in Table 5.

The recombinant yeast A1 lysate was transferred to 2mL EP tubes, each containing 1mL, extracted with an equal volume (1mL) of n-butanol for about 30min and centrifuged at 12000g for 10 min. The supernatant was pipetted into a new EP tube. The n-butanol was evaporated to dryness at 45 ℃ and under vacuum. Dissolved in 100. mu.L of methanol and used for HPLC detection.

By HPLC analysis (fig. 39), the cell lysate of recombinant yeast a1 contained dammarenediol, protopanaxadiol (PPD), and the ginsenoside active metabolite Rh2.

12.2 the method differs from 12.1 in that the glycosyltransferase 3GT1 is used instead of 3GT4 to obtain the recombinant yeast A5.

The results are shown in FIG. 43, and the cell lysate of recombinant yeast A5 contains dammarenediol, protopanaxadiol (PPD) and ginsenoside active metabolite Rh2 by HPLC analysis.

Example 13

Construction of recombinant expression vectors for glycosyltransferase genes gGT29 and gGT29-3 in Yeast

The target genes were amplified using plasmids gGT29-pMD18T and gGT29-3-pMD18T containing gGT29 and gGT29-3 genes constructed in example 1 as templates, respectively.

gGT29 the forward primers used were all (SEQ ID NO: 36) with a Kpn I recognition site added to the 5' end: GGATCC; the reverse primers used were all (SEQ ID No.:37) with an XhoI recognition site added to the 5' end: CTCGAG, reverse primer introduction of 6-His Tag for Western Blot detection of expression and purification.

gGT29-3 was used as a forward primer (SEQ ID NO: 38) with a Kpn I recognition site added to the 5' end: GGATCC; the reverse primers used were all (SEQ ID No.:39) with an XhoI recognition site added to the 5' end: CTCGAG, reverse primer introduction of 6-His Tag for Western Blot detection of expression and purification.

The genes of gGT29 and gGT29-3 were amplified by PCR using the above primers using plasmids gGT29-pMD18T and gGT29-3-pMD18T as templates. The high-fidelity DNA polymerase kod from Toyobo company is selected as the DNA polymerase, and the PCR program is set by referring to the specification: 94 ℃ for 2 min; 15s at 94 ℃, 30s at 58 ℃ and 1.5min at 68 ℃ for 30 cycles; 10min at 68 ℃; keeping the temperature at 10 ℃. And detecting the PCR product through agarose gel electrophoresis, and cutting off a band with the size consistent with that of the target DNA under ultraviolet light. Then, the DNA fragment was recovered from the agarose Gel using AxyPrep DNA Gel Extraction Kit from AXYGEN. The recovered DNA fragment was digested with the Quickcut restriction enzymes Kpn I and Xba I from Takara for 30min, and the digested product was collected by cleaning with AxyPrep PCR clean Kit from AXYGEN. The cleavage products were ligated with the Saccharomyces cerevisiae expression plasmid pYES2 (likewise cleaved with Kpn I and Xba I and recovered by tapping) using T4DNA ligase from NEB for 2h at 25 ℃. Coli TOP10 competent cells were transformed and plated on LB plates supplemented with 100. mu.g/mL ampicillin. Positive transformants were verified by colony PCR and sequencing further verified the successful construction of expression plasmids gGT29-pYES2 and gGT29-3-pYES 2.

Example 14

Expression of glycosyltransferase genes gGT29 and gGT29-3 in Saccharomyces cerevisiae

The constructed expression plasmids gGT29-pYES2 and gGT29-3-pYES2 were transformed into Saccharomyces cerevisiae (Saccharomyces cerevisiae) by electrotransformation method, and spread on screening plate SC-Ura (0.67% yeast without amino acid basic nitrogen source, 2%Glucose). Yeast recombinants were verified by colony PCR. Yeast recombinant colonies were picked and cultured in 10mL of SC-Ura (2% glucose) medium at 30 ℃ and 200rpm for 20 hours. Centrifuging at 4 deg.C to 3500g, collecting thallus, washing thallus twice with sterile deionized water, resuspending thallus with induction culture medium SC-Ura (2% galactose), and inoculating into 50mL induction culture medium to make OD₆₀₀The induction of expression started at around 0.4, 200rpm at 30 ℃. 3500g of thalli for induced expression for 12h is collected by centrifugation at 4 ℃, the thalli is washed twice by sterile deionized water and is suspended in yeast lysis buffer solution to ensure that OD is achieved₆₀₀Between 50 and 100. The yeast cells were disrupted by shaking with a Fastprep cell disrupter, centrifuged at 12000g at 4 ℃ for 10min to remove cell debris, and the supernatant of the cell lysate was collected. The appropriate amount of lysate supernatant was subjected to SDS-PAGE, and compared with the recombinants of pYES2 empty vector, the gGT29-pYES2 and gGT29-3-pYES2 recombinants had no obvious band representation (FIG. 32). When the expression condition is detected by anti-6-His Tag Western Blot, the Saccharomyces cerevisiae expressing gGT29 and gGT29-3 shows strong Western Blot signals, which indicate that gGT29 and gGT29-3 can be expressed in the yeast in a soluble way, while the recombinant transferred with pYES2 empty vector does not have the anti-6-His Tag Western Blot signal (FIG. 33).

Example 15

Yeast expression products gGT29 and gGT29-3 transglycosylation reactions and product identification

The recombinant yeast cracking supernatant for expressing gGT29 and gGT29-3 is used as enzyme liquid to catalyze the transglycosylation reaction of ginsenoside Rh2 and F2, and the recombinant yeast cracking supernatant for expressing an empty vector is used as a control. The reaction system of 100. mu.L is shown in Table 3. The reaction was carried out at 35 ℃ for 12h, then 100. mu.L of butanol was added to terminate the reaction and the product was extracted. The product was dried under vacuum and dissolved in methanol.

The reaction product was first detected by Thin Layer Chromatography (TLC), and the yeast host lysis supernatant enzyme solution expressing gGT29 and gGT29-3 was converted into ginsenosides Rg3 and Rd (FIG. 34) by further extending a glycosyl group at position 3 of ginsenosides Rh2 and F2. gGT29 and gGT29-3 are not affected by the configuration of 20-glycosyl or hydroxyl of ginsenoside, and can convert 20(R) -Rh2 into 20(R) -Rg3 (FIG. 36).

Example 16

Combined transglycosylation reactions and product identification of glycosyltransferases 3GT1/3GT4 and gGT29

Protopanaxadiol (PPD) is co-catalyzed by using an Escherichia coli host lysis supernatant expressing 3GT1 or 3GT4 and a yeast host lysis supernatant expressing gGT29 as enzyme solutions. The reaction system of 100. mu.L is shown in Table 3. mu.L of 3GT1 large intestine host lysis supernatant in 73.4. mu.L of enzyme solution, the remaining 33.4. mu.L of gGT29 yeast host lysis supernatant. The reaction was carried out at 35 ℃ for 12h, then 100. mu.L of butanol was added to terminate the reaction and the product was extracted. The product was dried under vacuum and dissolved in methanol. The reaction products were first detected by Thin Layer Chromatography (TLC) (FIG. 35), and it was seen that glycosyltransferases 3GT1 and gGT29 or 3GT4 and gGT29 in combination converted PPD to Rg 3.

The glycosyltransferases 3GT1 and gGT29 or 3GT2 and gGT29 in combination catalyze 20(R) -PPD to form 20(R) -Rg3 (FIG. 36).

Example 17

Construction and product identification of Rg 3-producing yeast engineering bacteria

17.1 on pESC-HIS plasmid ((Stratagene, Agilent), Dammarenediol synthase) (ACZ71036.1) (GAL1/GAL10GAL10 side promoter, ADH1 terminator), cytochrome P450CYP716A47(AEY75213.1) (FBA1 promoter, CYC1 terminator) and glycosyltransferases 3GT4 and gGT29(GAL1/GAL10GAL1 side promoter, TDH2 terminator) were assembled at the same time to construct episomal plasmid, Saccharomyces cerevisiae BY4742 was transformed, and cytochrome P450 Arabidopsis reductase 2-1 (NP-849472.2) derived from Arabidopsis was integrated into chromosomal trp1 gene site (GAL1 promoter, using trp 32 original terminator) in Saccharomyces cerevisiae BY4742 chromosome to construct recombinant 1. recombinant yeast A2. required for supplementing corresponding amino acids or uracil are shown in Table 5.

The recombinant yeast A2 lysate was transferred to 2mL EP tubes, each containing 1mL, extracted with an equal volume (1mL) of n-butanol for about 30min and centrifuged at 12000g for 10 min. The supernatant was pipetted into a new EP tube. The n-butanol was evaporated to dryness at 45 ℃ and under vacuum. Dissolved in 100. mu.L of methanol and used for HPLC detection.

By HPLC analysis, the cell lysate of recombinant yeast a2 contained dammarenediol, protopanaxadiol (PPD), and ginsenoside active metabolite Rg3 (fig. 40).

The method 17.2 is the same as 17.1 except that the glycosyltransferase 3GT1 is used in place of 3GT4 to obtain recombinant yeast A6. By HPLC analysis, the cell lysate of recombinant yeast A6 also contains dammarenediol, protopanaxadiol (PPD) and ginsenoside active metabolite Rg 3.

Example 18

Construction and product identification of F1-producing yeast engineering bacteria

On pESC-HIS plasmid ((Stratagene, Agilent), Dammarenediol synthase (ACZ71036.1) (GAL1/GAL10GAL10 side promoter, ADH1 terminator), glycosyltransferase gGT25(GAL1/GAL10GAL1 side promoter, TDH2 terminator), cytochrome P450CYP716A47(AEY75213.1) (FBA1 promoter, FBA1 terminator), cytochrome P450CYP716A53V2(ENO2 promoter, CYC1 terminator) were assembled at the same time, an episomal plasmid was constructed, Saccharomyces cerevisiae BY4742 was transformed, and cytochrome P450 reductase 2-1 (NP-849472.2) derived from Arabidopsis thaliana was integrated into chromosome of Saccharomyces cerevisiae BY4742 at the trp1 gene site (GAL1 promoter, using trp1 original terminator), and recombinant yeast uracil was constructed as shown in the Table 5.

The recombinant yeast A4 lysate was transferred to 2mL EP tubes, each containing 1mL, extracted with an equal volume (1mL) of n-butanol for about 30min and centrifuged at 12000g for 10 min. The supernatant was pipetted into a new EP tube. The n-butanol was evaporated to dryness at 45 ℃ and under vacuum. Dissolved in 100. mu.L of methanol and used for HPLC detection.

The cell lysate of recombinant yeast a4 contained protopanaxatriol (PPT) and the ginsenoside active metabolite F1 (fig. 42) as analyzed by HPLC.

Example 19

Construction of recombinant expression vectors for glycosyltransferase genes gGT29-4, gGT29-5, gGT29-6 and gGT29-7 in E.coli

The target gene was amplified using plasmids gGT29-4-pMD18T, gGT29-5-pMD18T, gGT29-6-pMD18T and gGT29-7-pMD18T containing gGT29-4, gGT29-5, gGT29-6 and gGT29-7 genes constructed in example 1 as templates.

gGT29-5 and gGT29-6 genes are shown in SEQ ID No. 66, and a sequence homologous to the vector pET28a is added to the 5' end of the forward primer: CTGGTGCCGCGCGGCAGC, respectively; the reverse primer is shown as SEQ ID NO. 68, and a sequence homologous to the vector pET28a is added at the 5' end: TGCGGCCGCAAGCTTGTC are provided.

gGT29-4 and gGT29-7 genes used forward primers of SEQ ID NO. 67 to which a sequence homologous to the vector pET28a was added at the 5' end: CTGGTGCCGCGCGGCAGC, respectively; the reverse primer used was SEQ ID No. 68, to the 5' end of which was added an 18 base fragment homologous to vector pET28 a: TGCGGCCGCAAGCTTGTC are provided.

gGT29-4, gGT29-5, gGT29-6 and gGT29-7 genes were amplified by PCR using the above primers. The Q5 high-fidelity DNA polymerase of NEB company is selected as the amplification gene, and the PCR program is set according to the specification: 30s at 98 ℃; 35 cycles of 98 ℃ for 15s, 58 ℃ for 30s and 72 ℃ for 1 min; 2min at 72 ℃; keeping the temperature at 10 ℃.

Meanwhile, the vector pET28a was amplified using SEQ ID NO. 69 and SEQ ID NO. 70 as forward and reverse primers, respectively, to obtain a linearized vector pET28 a. The linear vector for pET28a amplification was also obtained using Q5 high fidelity DNA polymerase from NEB, and the PCR program was set up with reference to the description: 30s at 98 ℃; 35 cycles of 98 ℃ for 15s, 58 ℃ for 30s and 72 ℃ for 3 min; 2min at 72 ℃; keeping the temperature at 10 ℃.

The PCR products of the gGT29-4, gGT29-5, gGT29-6 and gGT29-7 genes and the linearized vector pET28a are detected by agarose gel electrophoresis, and bands with the same size as the target DNA are cut under ultraviolet light. Then, the DNA fragment was recovered from the agarose Gel using AxyPrep DNA Gel Extraction Kit from AXYGEN. Referring to the BGclonart seamless cloning kit of NocGreenwich Biotech, 20. mu.l of the recovered linearized pET28a vector fragment, the recovered gGT29-4, gGT29-5, gGT29-6 and gGT29-74 gene fragments and the BGclonart seamless cloning reaction solution of NocGreenwich Biotech are mixed in a proper ratio. After mixing, incubation was carried out at 50 ℃ for 30 minutes, and then the mixed reaction solution was transferred to ice. Coli EPI300 competent cells were transformed with 5. mu.l of the reaction solution and plated on LB plates supplemented with 50. mu.g/mL kanamycin. Positive transformants were verified by colony PCR and sequencing further verified the success of the construction of expression plasmids gGT29-4-pET28a, gGT29-5-pET28a, gGT29-6-pET28a and gGT29-7-pET28 a.

Example 20

Expression of glycosyltransferase genes gGT29-4, gGT29-5, gGT29-6 and gGT29-7 in E.coli

Coli expression vectors gGT29-4-pET28a, gGT29-5-pET28a, gGT29-6-pET28a and gGT29-7-pET28a constructed in example 19 were transformed into E.coli BL21 available on the market. Inoculating a recombinant into LB medium, culturing at 30 deg.C and 200rpm to OD₆₀₀About 0.6-0.8, cooling the bacterial liquid to 4 ℃, adding IPTG with the final concentration of 50 mu M, and inducing expression for 15h at 18 ℃ and 200 rpm. The cells were collected by centrifugation at 4 ℃ and disrupted by sonication, and the supernatant of cell lysate was collected by centrifugation at 12000g at 4 ℃ and the sample was subjected to SDS-PAGE (FIG. 44). gGT29-4-pET28a, gGT29-5-pET28a, gGT29-6-pET28a and gGT29-7-pET28a recombinant lysates and total protein and supernatant all had significant bands of the protein of interest (approximately 50kD), characterizing glycosyltransferases gGT29-4, gGT29-5, gGT29-6 and gGT29-7, respectively. From the results of Western Blot (FIG. 45), it was also confirmed that the target proteins gGT29-4, gGT29-5, gGT29-6 and gGT29-7 were expressed in a soluble form in the host.

Example 21

Escherichia coli expression products gGT29-4, gGT29-5, gGT29-6 and gGT29-7 transglycosylation reaction and identification of products

Recombinant yeast cracking supernatants expressing gGT29-4, gGT29-5, gGT29-6 and gGT29-7 are used as enzyme liquid to catalyze the transglycosylation reaction of ginsenoside Rh2 and F2. The reaction system of 100. mu.L is shown in Table 3. The reaction was carried out at 35 ℃ for 12h, then 100. mu.L of butanol was added to terminate the reaction and the product was extracted. The product was dried under vacuum and dissolved in methanol.

Detecting the reaction product by Thin Layer Chromatography (TLC), wherein the crude enzyme solution of gGT29-6 can be obtained by extending a glycosyl on 3-position glycosyl of ginsenoside Rh2 and F2 to obtain ginsenoside Rg3 and Rd (FIG. 46); gGT29-4, gGT29-5 and gGT29-7 can extend a glycosyl group at position 3 of ginsenoside F2 to generate saponin Rd, but they can not catalyze saponin Rh2 (FIG. 46). gGT29-4, gGT29-5, gGT29-6 and gGT29-7 crude enzyme solutions can also be extended by a glycosyl group at C-6 position of protopanaxatriol type saponin Rh1 to form ginsenoside Rf (FIG. 47), wherein gGT29-4, gGT29-5 and gGT29-6 have weaker activity, and gGT29-7 has stronger activity (Table 7).

TABLE 7

All documents referred to herein are incorporated by reference into this application as if each were individually incorporated by reference. Furthermore, it should be understood that various changes and modifications of the present invention can be made by those skilled in the art after reading the above teachings of the present invention, and these equivalents also fall within the scope of the present invention as defined by the appended claims.

Claims

1. An in vitro glycosylation method, comprising the steps of:

at the C-3 position;

thereby forming a glycosylated tetracyclic triterpene compound;

wherein the content of the first and second substances,

said glycosyltransferase is selected from the group consisting of:

22 and 24, and

the tetracyclic triterpenoid is selected from the following groups:

protopanaxadiol, 20(R) -protopanaxadiol, ginsenoside CK, protopanaxatriol, ginsenoside F1, dammarenediol, 25-OH-protopanaxadiol, 25-OCH 3-protopanaxadiol, lanosterol, Ganoderic acid C2, Agadupol A, Hispidol B and 24(R) -Cycloartane-3beta,24, 25-triol; or

Said glycosyltransferase is selected from the group consisting of:

a glycosyltransferase as set forth in SEQ ID NOs.41, and

the tetracyclic triterpenoid is selected from the following groups:

protopanaxadiol (PPD), protopanaxatriol (PPT), 25-OH-protopanaxadiol, Hispidol B and 24(R) -Cycloartane-3beta,24, 25-triol; or

Said glycosyltransferase is selected from the group consisting of:

a glycosyltransferase as set forth in SEQ ID nos. 43, and

the tetracyclic triterpenoid is selected from the following groups:

protopanaxadiol (PPD), ginsenoside CK, 25-OH-protopanaxadiol and Hispidol B; or

the first glycosyl of C-3;

thereby forming a glycosylated tetracyclic triterpene compound;

wherein the content of the first and second substances,

said glycosyltransferase is selected from the group consisting of:

26, 28, 55, 57, 59 and 61, and the tetracyclic triterpenoid is ginsenoside F2; or

Said glycosyltransferase is selected from the group consisting of:

26, 28, and 59, and the tetracyclic triterpenoid is ginsenoside Rh 2;

and the glycosyl donor comprises UDP-glucose, UDP-acetyl glucose, UDP-xylose or UDP-rhamnose.

2. An isolated polypeptide capable of transferring a glycosyl donor glycosyl to the first glycosyl at C-3 in a tetracyclic triterpene compound, wherein the polypeptide is selected from the group consisting of:

(a) a polypeptide having an amino acid sequence as set forth in any one of SEQ ID nos. 26, 28, 55, 57, 59, or 61;

(b) a polypeptide having glycosyltransferase activity formed by adding a signal peptide sequence to SEQ ID NOs 26, 28, 55, 57, 59, or 61.

3. The isolated polypeptide of claim 2, wherein the polypeptide is a polypeptide having an amino acid sequence as set forth in SEQ ID nos. 26, 28, 55, 57, 59, or 61.

4. An isolated polynucleotide, wherein said polynucleotide is a sequence selected from the group consisting of:

(A) a nucleotide sequence encoding the polypeptide of claim 2;

(B) a nucleotide sequence encoding a polypeptide as set forth in any one of SEQ ID nos. 26, 28, 55, 57, 59, or 61;

(C) a nucleotide sequence set forth in any one of SEQ ID nos. 25, 27, 54, 56, 58, or 60;

(F) a nucleotide sequence complementary to the nucleotide sequence of any one of (A) to (C).

5. The isolated polynucleotide of claim 4, wherein the nucleotide sequence is set forth in SEQ ID No. 25, 27, 54, 56, 58, or 60.

6. The isolated polynucleotide of claim 4, wherein the polynucleotide encodes an amino acid sequence set forth in SEQ ID nos. 26, 28, 55, 57, 59, or 61, respectively, and the nucleotide sequence set forth in SEQ ID nos. 25, 27, 54, 56, 58, or 60, respectively.

7. A vector comprising the polynucleotide of claim 4.

8. Use of a polypeptide for catalyzing, or for preparing a catalytic formulation for catalyzing, one or more of the following reactions:

(iii) transferring a glycosyl group from a glycosyl donor to a hydroxyl group at the C-3 position of the tetracyclic triterpenoid;

(iv) transferring glycosyl from glycosyl donor to the first glycosyl at C-3 or C-6 position of tetracyclic triterpenoid, and extending sugar chain;

wherein the polypeptide is selected from the group consisting of:

(a) a polypeptide having an amino acid sequence as set forth in any one of SEQ ID nos. 43, 26, 28, 55, 57, 59, or 61;

(b) a polypeptide having glycosyltransferase activity formed by adding a signal peptide sequence to SEQ ID nos. 43, 26, 28, 55, 57, 59, or 61; and is

22 and 24 have an activity of transferring a glycosyl group of a glycosyl donor to the C-3 position of a tetracyclic triterpenoid selected from the group consisting of: protopanaxadiol, 20(R) -protopanaxadiol, ginsenoside CK, protopanaxatriol, ginsenoside F1, dammarenediol, 25-OH-protopanaxadiol, 25-OCH 3-protopanaxadiol, lanosterol, Ganoderic acid C2, Agadupol A, Hispidol B and 24(R) -Cycloartane-3beta,24, 25-triol; or

41 having an activity of transferring a glycosyl group of a glycosyl donor to the C-3 position of a tetracyclic triterpenoid selected from the group consisting of: protopanaxadiol, protopanaxatriol, 25-OH-protopanaxadiol, Hispidol B and 24(R) -Cycloartane-3beta,24, 25-triol; or

43 has an activity of transferring a glycosyl group of a glycosyl donor to the C-3 position of a tetracyclic triterpenoid selected from the group consisting of: protopanaxadiol, ginsenoside CK, 25-OH-protopanaxadiol and Hispidol B; or

26, 28, 55, 57, 59 and 61 has an activity of transferring a glycosyl group of a glycosyl donor to a first glycosyl group of C-3 of ginsenoside F2; or

26, 28 and 59 has an activity of transferring a glycosyl group of a glycosyl donor to a first glycosyl group of C-3 of ginsenoside Rh 2; or

55, 57, 59 and 61 has an activity of transferring a glycosyl group of a glycosyl donor to the first glycosyl group of C-6 of ginsenoside Rh 1;

and the glycosyl donor comprises UDP-glucose, UDP-acetyl glucose, UDP-xylose, or UDP-rhamnose.

9. The use according to claim 8, wherein the glycosyl donor is UDP-glucose.

10. The use of claim 8, wherein said glycosyl donor comprises a uridine diphosphate sugar selected from the group consisting of: UDP-glucose, UDP-rhamnose, or a combination thereof.

11. Use according to claim 8, wherein the polypeptide is used for catalyzing one or more of the following reactions or is used for preparing a catalytic preparation for catalyzing one or more of the following reactions:

(C)

wherein R1 is H; r2 is OH; r3 is H or a glycosyl group; r4 is a glycosyl group and the glycosyl donor comprises UDP-glucose, UDP-acetyl glucose, UDP-xylose, or UDP-rhamnose, and the polypeptide is selected from SEQ ID nos. 43;

(D)

wherein R1 is OH; r2 is glucosyl, the polypeptide is selected from SEQ ID NOs.43;

(E)

when R1 and R5 are glucosyl, R2 is H, R3 is hydroxyl, R4 is H, the compound of formula (IX) and the compound of formula (X) are ginsenoside Rh2 and Rg3 respectively, and the polypeptide is selected from SEQ ID Nos. 59;

when R1, R4 and R5 are glucosyl, R2 is H, R3 is hydroxy, the compound of formula (IX) and the compound of formula (X) are ginsenosides F2 and Rd, respectively, said polypeptide is selected from SEQ ID nos. 55, 57, 59 or 61;

(J)

the polypeptide is selected from SEQ ID NOs.43.

12. The use according to claim 11, wherein, in the reaction formula (C),

the compounds substituted with R1-R4 are shown in the following table:

substrate R1 R2 R3 R4 Product of PPD H OH H Sugar radical Rh2 CK H OH Sugar radical Sugar radical F2

And the glycosyl donor comprises UDP-glucose, UDP-acetyl glucose, UDP-xylose, or UDP-rhamnose;

that is, when R1 and R3 are both H and R2 is OH, the compound of formula (V) is protopanaxadiol PPD;

when R1 is H, R2 is OH, and R3 is glucosyl, the compound of formula (V) is ginsenoside CK.

13. The use of claim 12, wherein when the substrate is PPD, the polypeptide is selected from the group consisting of SEQ ID nos 43; when the substrate is CK, the polypeptide is selected from SEQ ID NOs.43.

14. The use according to claim 11, wherein, in the reaction formula (D),

the compounds substituted with R1-R2 are shown in the following table:

substrate R1 R2 Product of 25-OH-PPD OH Sugar radical 3-G-25-OH-PPD

Wherein R2 is glucosyl;

that is, when R1 is OH, the compound of formula (VII) is 25-OH-PPD.

15. The use according to claim 11, wherein, in the reaction formula (E),

the compounds substituted with R1-R4 are shown in the following table:

That is, when R1 is glucosyl; r2 is H, R3 is OH, R4 is H, the compound of formula (IX) is Rh 2;

16. The use of claim 8, further comprising: an additive for regulating the activity of the enzyme is provided to the reaction system.

17. The use according to claim 16, wherein the additive for modulating the enzymatic activity is: additives for increasing or inhibiting the activity of an enzyme.

18. The use according to claim 16, wherein the additive for modulating the enzymatic activity is selected from the group consisting of: ca²⁺、Co²⁺、Mn²⁺、Ba²⁺、Al³⁺、Ni²⁺、Zn²⁺Or Fe²⁺。

19. Use according to claim 11, wherein in reaction (J) the compound of formula (XIX) is Hispidol B and the compound of formula (XX) is 3-O- β - (D-glucopyranosyl) -Hispidol B.

20. The use according to claim 16, wherein the additive for modulating the enzymatic activity is: can be used forFormation of Ca²⁺、Co²⁺、Mn²⁺、Ba²⁺、Al³⁺、Ni²⁺、Zn²⁺Or Fe²⁺The substance of (1).

21. The use according to claim 8, wherein the glycosyl donor glycosyl is selected from the group consisting of: glucosyl, galacturonic acid, galactosyl, arabinosyl, and rhamnosyl.

22. A method of performing a glycosyl catalyzed reaction comprising the steps of: the glycosyl catalysis reaction of the tetracyclic triterpenoid is carried out in the presence of the following polypeptide:

(a1) a polypeptide having an amino acid sequence as set forth in any one of SEQ ID nos. 43, 22, 24 or 41;

(b1) a polypeptide having glycosyltransferase activity formed by adding a signal peptide sequence to SEQ ID NOs.43, 22, 24 or 41;

(c1) a fusion protein formed by adding a tag sequence, a signal sequence or a secretion signal sequence to (a1) or (b1),

the glycosylation catalysis reaction is to transfer the glycosyl of a glycosyl donor to the C-3 position of the tetracyclic triterpenoid in the presence of the polypeptide selected from (a1) - (C1); or

(a2) A polypeptide having an amino acid sequence as set forth in any one of SEQ ID nos. 26, 28, 55, 57, 59, or 61;

(b2) a polypeptide having glycosyltransferase activity formed by adding a signal peptide sequence to SEQ ID NOs 26, 28, 55, 57, 59, or 61;

(c2) a fusion protein formed by adding a tag sequence, a signal sequence or a secretion signal sequence to (a2) or (b2),

the glycosylation catalysis reaction is to transfer the glycosyl of a glycosyl donor to the first glycosyl of the tetracyclic triterpenoid C-3 in the presence of the polypeptide selected from (a2) - (C2); wherein

at the C-3 position;

thereby forming a glycosylated tetracyclic triterpene compound;

wherein the content of the first and second substances,

said glycosyltransferase is selected from the group consisting of:

22 and 24, and

the tetracyclic triterpenoid is selected from the following groups:

Said glycosyltransferase is selected from the group consisting of:

a glycosyltransferase as set forth in SEQ ID NOs.41, and

the tetracyclic triterpenoid is selected from the following groups:

protopanaxadiol, protopanaxatriol, 25-OH-protopanaxadiol, Hispidol B and 24(R) -Cycloartane-3beta,24, 25-triol; or

Said glycosyltransferase is selected from the group consisting of:

a glycosyltransferase as set forth in SEQ ID nos. 43, and

the tetracyclic triterpenoid is selected from the following groups:

protopanaxadiol, ginsenoside CK, 25-OH-protopanaxadiol and Hispidol B; or

the first glycosyl of C-3;

thereby forming a glycosylated tetracyclic triterpene compound;

wherein the content of the first and second substances,

said glycosyltransferase is selected from the group consisting of:

Said glycosyltransferase is selected from the group consisting of:

26, 28, and 59, and the tetracyclic triterpenoid is ginsenoside Rh 2;

23. The process of claim 22, wherein said glycosylation reaction comprises converting said compound of formula (V) to said compound of formula (VI), or said compound of formula (VII) to said compound of formula (VIII), or said compound of formula (IX) to said compound of formula (X), or said compound of formula (XI) to said compound of formula (XII), (C)

Wherein R1 is H; r2 is OH; r3 is H or a glycosyl group; r4 is a glycosyl, wherein the polypeptide is selected from SEQ ID NOs 22, 24, 41 or 43;

(D)

wherein R1 is OH; r2 is glucosyl, the polypeptide is selected from SEQ ID NOs 22, 24, 41 or 43;

(E)

wherein, when R1 and R5 are glucosyl, R2 is H, R3 is hydroxyl, R4 is H, the compound of formula (IX) and the compound of formula (X) are ginsenoside Rh2 and Rg3 respectively, and the polypeptide is selected from SEQ ID NOs. 26, 28 or 59;

when R1, R4 and R5 are glucosyl, R2 is H, R3 is hydroxyl, the compound of formula (IX) and the compound of formula (X) are ginsenoside F2 and Rd respectively, and the polypeptide is selected from SEQ ID NOs 26, 28, 55, 57, 59 or 61;

(F)

the polypeptide is selected from SEQ ID NOs 22 or 24;

(H)

the polypeptide is selected from SEQ ID NOs 22 or 24;

(I)

the polypeptide is selected from SEQ ID NOs 22 or 24;

(J)

the polypeptide is selected from SEQ ID NOs 22 or 24 or 41 or 43;

(K)

the polypeptide is selected from SEQ ID NOs 22 or 24 or 41;

wherein the glycosyl donor comprises UDP-glucose, UDP-acetyl glucose, UDP-xylose, or UDP-rhamnose.

24. The method of claim 22, further comprising separately adding said polypeptides to a catalytic reaction; and/or

The polypeptides are simultaneously added to the catalytic reaction.

25. The method of claim 23, further comprising converting the compound of formula (V) to the compound of formula (X) in the presence of a glycosyl donor and two or more polypeptides of claim 2, wherein the polypeptide further comprises a polypeptide having an amino acid sequence as set forth in any one of SEQ ID No. 22, 24, 41, or 43.

26. A method according to claim 23, further comprising co-expressing a nucleotide sequence encoding a glycosyltransferase with a dammarenediol and/or protopanaxadiol and/or a key gene in the protopanaxatriol anabolic pathway in a host cell to obtain the compound of formula (VI), (VIII), (X) or (XII), wherein the nucleotide sequence encoding the glycosyltransferase is as set forth in SEQ ID No. 21, 23, 25, 27, 40, 42, 54, 56, 58 or 60.

27. The method of claim 26, wherein the host cell is yeast or e.

28. The method of claim 26, wherein the method further comprises: an additive for regulating the activity of the enzyme is provided to the reaction system.

29. The method of claim 28, wherein the additive for modulating enzyme activity is selected from the group consisting of: ca²⁺、Co²⁺、Mn²⁺、Ba²⁺、Al³⁺、Ni²⁺、Zn²⁺Or Fe²⁺(ii) a And/or

The additive for regulating the enzyme activity is as follows: can generate Ca²⁺、Co²⁺、Mn²⁺、Ba²⁺、Al³⁺、Ni²⁺、Zn²⁺Or Fe²⁺The substance of (1).

30. The method of claim 22, wherein the pH of the reaction system is: pH4.0-10.0; and/or the temperature of the reaction system is: 10 ℃ to 105 ℃.

31. The method of claim 23, wherein the substrate of the glycosyl-catalyzed reaction is a compound of formula (V), (VII), (IX), (XI), (XV), (XVII), (XIX) or (XXI), and the product of the glycosyl-catalyzed reaction is a compound of formula (VI), (VIII), (X), (XII), (XVI), (XVIII), (XX) or (XXII).

32. The method of claim 31,

the compound of formula (V) is protopanaxadiol, and the compound of formula (VI) is ginsenoside Rh2 (3-O-beta- (D-glucopyranosyl) -protopanaxadiol));

or, the compound of formula (IX) is ginsenoside F2, and the compound of formula (X) is ginsenoside Rd.

33. A genetically engineered host cell comprising the vector of claim 7, or having the polynucleotide of claim 4 integrated into its genome.

34. Use of the host cell of claim 33 for the preparation of an enzyme-catalyzed reagent, or for the production of a glycosyltransferase, or as a catalytic cell, or for the production of a glycosylated tetracyclic triterpenoid;

wherein

at the C-3 position;

thereby forming a glycosylated tetracyclic triterpene compound;

wherein the content of the first and second substances,

said glycosyltransferase is selected from the group consisting of:

22 and 24, and

the tetracyclic triterpenoid is selected from the following groups:

Said glycosyltransferase is selected from the group consisting of:

a glycosyltransferase as set forth in SEQ ID NOs.41, and

the tetracyclic triterpenoid is selected from the following groups:

Said glycosyltransferase is selected from the group consisting of:

a glycosyltransferase as set forth in SEQ ID nos. 43, and

the tetracyclic triterpenoid is selected from the following groups:

protopanaxadiol, ginsenoside CK, 25-OH-protopanaxadiol and Hispidol B; or

the first glycosyl of C-3;

thereby forming a glycosylated tetracyclic triterpene compound;

wherein the content of the first and second substances,

said glycosyltransferase is selected from the group consisting of:

Said glycosyltransferase is selected from the group consisting of:

26, 28, and 59, and the tetracyclic triterpenoid is ginsenoside Rh 2;

35. The use of claim 34, wherein the host cell is a human ginseng cell.

36. The use of claim 34, wherein the host cell is not a cell that naturally produces a compound of formula (VI), (VIII), (X), (XII), wherein:

37. the use of claim 34, wherein the host cell is not naturally occurring rare ginsenoside CK and/or rare ginsenoside F1 and/or rare ginsenoside Rh2 and/or Rg3 and/or Rh1, and/or the novel ginsenoside 20-O-beta- (D-glucopyranosyl) -dammarendiolII, 3-O-beta- (D-glucopyranosyl) -PPT, 3-O-beta- (D-glucopyranosyl) -F1, 3-O-beta- (D-glucopyranosyl) -DM, 3-O-beta-D-glucopyranosyl) -25-OH-PPD, 3-O-beta- (D-glucopyranosyl) -25-OCH3-PPD, and/or Rh1, F2, Rd and Rg1 cells.

38. Use of a host cell according to claim 33 for the preparation of an enzyme-catalysed reagent, or for the production of a glycosyltransferase, or as a catalytic cell, or for the production of a compound of formula (VI), (VIII), (X), (XII), (XIV), (XVIII), (XX) or (XXII),

wherein the glycosyl donor in the compounds of the formulas VI, VIII and X is glucosyl.

39. The use according to claim 38, wherein the host cell is used for the production of neosaponin 3-O- β - (D-glucopyranosyl) -dammarendiol ii, 3-O- β - (D-glucopyranosyl) -protopanaxatriol, and/or rare ginsenoside Rh2 and/or rare ginsenoside Rg3 by glycosylation of dammarenediol DM and/or protopanaxadiol PPD and/or protopanaxatriol PPT.

40. A method of producing a transgenic plant comprising the steps of: regenerating the genetically engineered host cell of claim 33 into a plant, and said genetically engineered host cell is a plant cell.

41. The method of claim 22, wherein when the substrate is PPD, the polypeptide is selected from the group consisting of SEQ ID nos. 22, 24, 41, and 43; when the substrate is CK, the polypeptide is selected from SEQ ID NOs 22, 24 or 43; when the substrate is PPT, the polypeptide is selected from SEQ ID NOs 22, 24 or 41; or when the substrates are F1 and DM, the polypeptide is selected from SEQ ID NOs 22 or 24.